Skip to main content
PMC home page
Elsevier - PMC COVID-19 Collection logoLink to Elsevier - PMC COVID-19 Collection
. 2010 Feb 1;144(3):274–286. doi: 10.1016/j.vetmic.2010.01.019

Detection and genotyping of Korean porcine rotaviruses

Hyun-Jeong Kim a, Sang-Ik Park a, Thi Phuong Mai Ha a, Young-Ju Jeong a, Ha-Hyun Kim a, Hyoung-Jun Kwon a, Mun-Il Kang a, Kyoung-Oh Cho a,⁎, Su-Jin Park b,⁎⁎
PMCID: PMC7117351  PMID: 20359834

Abstract

Porcine group A rotavirus (GARV) is considered to be an important animal pathogen due to their economic impact in the swine industry and its potential to cause heterologous infections in humans. This study examined 475 fecal samples from 143 farms located in 6 provinces across South Korea. RT-PCR and nested PCR utilizing primer pairs specific for the GARV VP6 gene detected GARV-positive reactions in 182 (38.3%) diarrheic fecal samples. A total of 98 porcine GARV strains isolated from the GARV-positive feces were analyzed for G and P genotyping. Based on the sequence and phylogenetic analyses, the most predominant combination of G and P genotypes was G5P[7], found in 63 GARV strains (64.3%). The other combinations of G and P genotypes were G8P[7] (16 strains [16.3%]), G9P[7] (7 strains [7.1%]), G9P[23] (2 strains [2.0%]), and G8P[1] (1 strain [1.0%]). The counterparts of G or P genotypes were not determined in three G5, five P[7], and one P[1] strains. Interestingly, phylogenetic analysis indicated that all Korean G9 strains were more closely related to lineage VI porcine and human viruses than to other lineages (I–V) of GARVs and to Korean human G9 strains (lineage III). These results show that porcine GARV infections are common in diarrheic piglets in South Korea. The infecting strains are genetically diverse, and include homologous (G5P[7]), heterologous (G8P[1]), and reassortant (G8P[7]), as well as emerging G9 GARV strains.

Keywords: Rotavirus, Prevalence, Genetic diversity, Reassortant

1. Introduction

Group A rotavirus (GARV), a member of the Reoviridae family, is one of the major pathogens that cause severe, acute dehydrating diarrhea in young children and in a wide variety of domestic animals (Estes and Kapikian, 2007, Gentsch et al., 2005, Glass et al., 1997). The rotavirus genome consists of 11 segments of double-stranded (ds) RNA enclosed in a trilaminar capsid and encodes six structural (VP1–VP4, VP6, and VP7) and six nonstructural proteins (NSP1–NSP6) (Estes and Kapikian, 2007, Gentsch et al., 2005, Parashar et al., 2006). Due to the segmented nature of the genome, GARVs can undergo genetic reassortment if two different GARVs of the same group co-infect one cell (Estes and Kapikian, 2007, Gentsch et al., 2005, Parashar et al., 2006).

Recently, a new rotavirus classification system was proposed, in which nucleotide percentage identity cut-off values define different genotypes for all the 11 genomic RNA segments (Matthijnssens et al., 2008). The VP7 and VP4 outer capsid proteins independently elicit neutralizing antibody responses and are used to classify GARVs into G (for glycoprotein) and P (for protease-sensitive) types (Ciarlet and Estes, 2002, Estes and Kapikian, 2007, Glass et al., 1997). Currently, 23 G and 31 P genotypes have been described for GARVs of humans and animals (Abe et al., 2009, Ursu et al., 2009). As many more reassortant or new genotypes are predicted to appear, continuous monitoring of circulating rotaviruses is important for improving regional epidemiological information and updating the vaccine strains.

Porcine GARVs can cause enormous economic losses in the swine industry and are a potential source of heterologous GARV infections in humans (Jain et al., 2001, Leite et al., 1996, Martella et al., 2005, Timenetsky et al., 1994, Unicomb et al., 1999). Thus, molecular epidemiology on porcine GARVs in South Korea is needed to determine the prevalence, as well as the extent of diversity in the circulating strains to improve vaccination programs by updating the vaccine strains. This paper reports the prevalence of porcine GARVs in diarrheic piglets, along with the genetic diversity of the porcine GARVs based on the characterization of the G and P genotypes.

2. Materials and methods

2.1. Specimens

From 2006 to 2007, 475 fecal specimens from diarrheic pigs were obtained from 143 farms across 6 provinces in South Korea during the spring (215 samples/53 farms), summer (86 samples/17 farms), autumn (69 samples/20 farms), and winter (105 samples/53 farms). The ages of the pigs tested from these provinces ranged from 3 to 70 days old. The fecal samples were examined for common bacterial enteric pathogens including Escherichia coli (E. coli) and Salmonella spp. using specific agar media. Brachyspira hyodysenteriae was detected by PCR with the specific primers B.hyo nest3 (5′-CTGCTGCCTTCTTCATAAAT-3′) and B.hyo nest 5 (5′-AAGAATGGGTATTGTTGCTG-3′) (La et al., 2003). For the extraction of viral RNA, fecal suspensions of each sample were prepared immediately by diluting the feces 1:10 in 0.01 M phosphate-buffered saline (PBS), pH 7.2. The suspensions were then vortexed for 30 s, centrifuged (1200 ×  g for 20 min), and then the supernatants were collected and stored at −80 °C until needed.

2.2. RNA extraction

The RNA was extracted from a 200 μl starting volume of centrifuged 10% fecal suspensions and from the lysates of GARV-infected fetal rhesus monkey kidney (TF-104) cells using the SV Total RNA Isolation System reagent (Promega Corporation, Madison, WI) according to the manufacturer's instructions. The total RNA recovered was suspended in 50 μl of RNase free water and stored at −80 °C until used.

2.3. RT-PCR and nested PCR

RT-PCR assays with different primer sets (Table 1 ) for the detection of porcine groups A–C rotaviruses (GARVs-GCRVs), porcine sapovirus (PSaV), porcine norovirus (PNoV), porcine torovirus (PToV), transmissible gastroenteritis coronavirus (TGEV), and porcine epidemic diarrhea coronavirus (PEDV) were performed using a standard one-step RT-PCR as previously described (Jeong et al., 2007). In order to increase the sensitivity and specificity of RT-PCR, nested PCR assays with the primer pairs specific to porcine GARV, GCRV and PSaV (Table 1) were performed as previously described (Jeong et al., 2007). The amplification products were analyzed by 1.5 or 2% agarose gel electrophoresis and visualized by UV after ethidium bromide staining.

Table 1.

The list of the oligonucleotide primers designed for detecting and sequencing.

Target virusesa Target geneb Primer sequence, 5′ to 3′c Region (nt) Size (bp)
GARV VP6 F: AAA GAT GCT AGG GAC AAA ATT G 58–78 308
R: TTC AGA TTG TGG AGC TAT TCC A 344–365
nF: GAC AAA ATT GTC GAA GGC ACA TTA TA 69–94 121
nR: TCG GTA GAT TAC CAA TTC CTC CAG 166–189
VP4 F: GCT TCG CTC ATT TAT AGA CA 12–31 877
R: ATT TCG GAC CAT TTA TAA CC 868–887
VP7 F: GGC TTT AAA AGA GAG AAT TTC 1–21 1062
R: GGT CAC ATC ATA CAA TTC TAA 1042–1062



GBRV NSP2 F: CTA TTC AGT GTG TCG TGA GAG G 18–40 434
R: GCA GAC AAG CTA GCC CGC TTC G 429–451



GCRV VP6 F: CTC GAT GCT ACT ACA GAA TCA G 994–1018 366
R: AGC CAC ATA GTT CAC ATT TCA TCC 1339–1359
nF: CTC GAT GCT ACT ACA GAA TCA G 994–1018 328
nR: GGG ATC ATC CAC GTC ATG CGT 1300–1321



PSaV RdRp F: GTG CTC TAT TGC CTG GAC TA 4312–4331 572
R: TCT GTG GTG CGG TTA GCC TT 4864–4883
nF: GTG GTA TGC TGA GGA CAC AC 4392–4411 380
nR: GAG TGT CTG TTG GCT CAA TG 4752–4771



PSaV& RdRp F: GAT TAC TCC AAG TGG GAC TCC AC 4568–4590 319
PNoV R: TGACAA TGT AAT ATC ACC ATA 4865–4886



PToV N F: GTCAGAATAGATCACGCATT 170–189 185
R: CGCCAAACTCTGCAACTCAGGTGGA 330–354



TGEVd ORF1b F GGG TAA GTT GCT CAT TAG AAA TAA TGG 7968–7994 1006
Spike R: CTT CTT CAA AGC TAG GGA CTG 920–940



PEDV N F: AGG AAC GTG ACC TCA AAG ACA TCC C 812–836 540
R: CCA GGA TAA GCC GGT CTA ACA TTG 1328–1351
Open in a new tab
a

GARV: group A rotavirus; GBRV: group B rotavirus; GCRV: group C rotavirus; PSaV: porcine sapovirus; PNoV: porcine norovirus; PToV: porcine torovirus; TGE: transmissible gastroenteritis coronavirus; PED: porcine epidemic diarrhea coronavirus.

b

RdRp: RNA dependent RNA polymerase; ORF: open reading frame; N: nucleocapsid.

c

F: upstream primer for RT-PCR; R: downstream primer for RT-PCR; nF: upstream primer for nested PCR; nR: downstream primer for nested PCR.

d

TGEV: forward primer was designed from the portion of TGEV ORF1b; reverse primer was designed from the portion of TGEV spike gene.

2.4. Virus isolation

Monolayers of TF-104 cells (a cloned derivative of MA-104 monkey kidney cells) grown for 3 or 4 days in 6-well plates were used to isolate GARVs, as previously described (Bohl et al., 1984, Park et al., 2006). The isolated GARVs were confirmed by direct immunofluorescence (IF) tests and RT-PCR (Bohl et al., 1984, Park et al., 2006).

2.5. DNA sequencing

To obtain genomic data on the G and P genotypes of Korean porcine GARVs, porcine GARVs isolated from the diarrheic fecal samples were subjected to RT-PCR with primer pairs specific to each VP7 and VP4 gene of GARVs (Table 1). RT-PCR products amplified by each primer pair were selected based on the intensity of the bands shown by agarose gel electrophoresis and ethidium bromide visualization. Before sequencing, the RT-PCR products from each gene fragment were purified using a QIAEX II Gel Extraction kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions. DNA sequencing was carried out using an ABI system 3700 automated DNA sequencer (Applied Biosystems, Foster City, CA).

2.6. Molecular analysis

Using the DNA Basic module (DNAsis MAX, Alameda, CA), the nucleotide and deduced amino acid sequences of the partial VP4 gene (834 bp, devoid of primer pair sequences) and VP7 gene (1020 bp, devoid of primer pair sequences) were compared with those selected from other known GARVs (Table 2 ). Phylogenetic analysis based on the nucleotide alignments was constructed using the neighbor-joining method and the UPGMA method of Molecular Evolutionary Genetics analysis (MEGA version 4.0) with a pair-wise distance comparison (Tamura et al., 2007). A sequence similarity search was performed for the GARV VP4 and VP7 genes using the LALIGN Query program of the GENESTREAM network server at Institut de Génétique Humaine, Montpellier, France (http://www.eng.uiowa.edu/∼tscheetz/sequence-analysis/examples/LALIGN/lalign-guess.html).

Table 2.

Genbank accession numbers of Korea strains and the reference group A rotavirus strains used in phylogenetic analysis.

Genes Strains Type Species Accession number Genes Strains Type Species Accession number
VP4 BRV033 P[1] Bovine U62155 VP4 19 P[7] Porcine FJ870331
NCDV P[1] Bovine M63267 24 P[7] Porcine FJ870332
C486 P[1] Bovine Y00127 25-1 P[7] Porcine FJ870333
RF P[1] Bovine U65924 25-2 P[7] Porcine FJ870334
11-1 P[1] Porcine FJ807880 42-1 P[7] Porcine FJ870335
66-1 P[1] Porcine FJ870285 47-1 P[7] Porcine FJ870336
SA11 P[2] Simian M23188 47-2 P[7] Porcine FJ870337
RRV P[3] Simian M18736 49 P[7] Porcine FJ870338
RV5 P[4] Human M32559 52 P[7] Porcine FJ870339
CJN-M P[5] Bovine D16351 53 P[7] Porcine FJ870340
Gotffried P[6] Porcine M33516 57 P[7] Porcine FJ870341
OSU P[7] Porcine X13190 57-1 P[7] Porcine FJ870342
JL94 P[7] Porcine AY523636 61-1 P[7] Porcine FJ870343
SW20/21 P[7] Porcine AF427125 63-1 P[7] Porcine FJ870344
PP-1 P[7] Bovine AF427520 71 P[7] Porcine FJ870345
06-6-1 P[7] Porcine FJ870288 71-1 P[7] Porcine FJ870346
06-10-1 P[7] Porcine FJ870289 74-1 P[7] Porcine FJ870347
06-12-1 P[7] Porcine FJ870290 75-1 P[7] Porcine FJ870348
06-14-1 P[7] Porcine FJ870291 78-1 P[7] Porcine FJ870349
06-22-1 P[7] Porcine FJ870292 80-1 P[7] Porcine FJ870350
06-42-2 P[7] Porcine FJ870293 82-1 P[7] Porcine FJ870351
06-44-2 P[7] Porcine FJ870294 85 P[7] Porcine FJ870352
06-46-2 P[7] Porcine FJ870295 85-1 P[7] Porcine FJ870353
06-54-1 P[7] Porcine FJ870296 90-1 P[7] Porcine FJ870354
06-61-3 P[7] Porcine FJ870297 95-1 P[7] Porcine FJ870355
06-121 P[7] Porcine FJ870298 97-1 P[7] Porcine FJ870356
06-176-10 P[7] Porcine FJ870299 100-1 P[7] Porcine FJ870357
06-235 P[7] Porcine FJ870300 104-1 P[7] Porcine FJ870358
06-258-1 P[7] Porcine FJ870301 115-1 P[7] Porcine FJ870359
06-261-4 P[7] Porcine FJ870302 122-1 P[7] Porcine FJ870360
07-2 P[7] Porcine FJ870303 131 P[7] Porcine FJ870361
07-08-1 P[7] Porcine FJ870304 140-1 P[7] Porcine FJ870362
07-10-1 P[7] Porcine FJ870305 141-1 P[7] Porcine FJ870363
07-12-3 P[7] Porcine FJ870306 150-1 P[7] Porcine FJ870364
07-13-2 P[7] Porcine FJ870307 156-1 P[7] Porcine FJ870365
07-14-1 P[7] Porcine FJ870308 157-1 P[7] Porcine FJ870366
07-15-1 P[7] Porcine FJ870309 174-1 P[7] Porcine FJ870367
07-16-1 P[7] Porcine FJ870310 187-1 P[7] Porcine FJ870368
07-17-1 P[7] Porcine FJ870311 205-1 P[7] Porcine FJ870369
07-17-2 P[7] Porcine FJ870312 208-1 P[7] Porcine FJ870370
07-25 P[7] Porcine FJ870313 210-1 P[7] Porcine FJ870371
07-26-1 P[7] Porcine FJ870314 A-1 P[7] Porcine FJ870372
07-28-7 P[7] Porcine FJ870315 B-1 P[7] Porcine FJ870373
07-33-2 P[7] Porcine FJ870316 C-1 P[7] Porcine FJ870374
07-61-3 P[7] Porcine FJ870317 D-1 P[7] Porcine FJ870375
07-74-1 P[7] Porcine FJ870318 E-1 P[7] Porcine FJ870376
07-95-1 P[7] Porcine FJ870319 H-1 P[7] Porcine FJ870377
07-109-8 P[7] Porcine FJ870320 I-1 P[7] Porcine FJ870378
07-117-2 P[7] Porcine FJ870321 Wa P[8] Human L34161
07-134-7 P[7] Porcine FJ870322 K8 P[9] Human D90260
07-214-1 P[7] Porcine FJ870323 69M P10] Human M60600
1 P[7] Porcine FJ870324 KK3 P11] Bovine D13393
2 P[7] Porcine FJ870325 FI23 P[12] Equine D16342
3 P[7] Porcine FJ870326 MDR13 P[13] Porcine L07886
4 P[7] Porcine FJ870327 Sun9 P[14] Bovine AB158430
8-1 P[7] Porcine FJ870328 LP14 P[15] Ovine L11599
8-2 P[7] Porcine FJ870329 Eb P[16] Murine L18992
16 P[7] Porcine FJ870330 PO-13 P[17] Pigion AB009632
VP4 L338 P[18] Equine D13399 VP7 74-1 G[5] Porcine FJ807831
MC345 P[19] Human D38054 75-1 G[5] Porcine FJ807832
EHP P[20] Murine U08424 78-1 G[5] Porcine FJ807833
Hg18 P[21] Bovine AF237665 80-1 G[5] Porcine FJ807834
160/01 P[22] Lapine AF526374 82-1 G[5] Porcine FJ807835
A34 P[23] Porcine AY174094 85 G[5] Porcine FJ807836
JP32-4 P[23] Porcine AB176689 85-1 G[5] Porcine FJ807837
Hokkaido-14 P[23] Porcine AB176684 95-1 G[5] Porcine FJ807838
06-52-1 P[23] Porcine FJ870286 97-1 G[5] Porcine FJ807839
06-285 P[23] Porcine FJ870287 100-1 G[5] Porcine FJ807840
TUCH P[24] Simian AY596189 104-1 G[5] Porcine FJ807841
Dhaka6 P[25] Human AY773004 110-1 G[5] Porcine FJ807842
134/04-15 P[26] Porcine DQ061053 115-1 G[5] Porcine FJ807843
CMP034 P[27] Porcine DQ534016 122-1 G[5] Porcine FJ807844
ECU534 P[28] Bovine EU805773 131 G[5] Porcine FJ807845
Azuk-1 P[29] Bovine AB454420 140-1 G[5] Porcine FJ807846
Ch-02V0002G3 P[30] Chicken EU486965 150-1 G[5] Porcine FJ807847
Ch-06V0661 P[31] Chicken EU486962 187-1 G[5] Porcine FJ807848
VP7 Wa G[1] Human M21843 205-1 G[5] Porcine FJ807849
S2 G[2] Human M11164 210-1 G[5] Porcine FJ807850
RRV G[3] Simian Z32535 B-1 G[5] Porcine FJ807851
Gotffried G[4] Porcine X06386 E-1 G[5] Porcine FJ807852
OSU G[5] Porcine X04613 I-1 G[5] Porcine FJ807853
JL94 G[5] Porcine AY538665 NCDV G[6] Bovine M12394
KJ44 G[5] Bovine DQ494393 Erv99 G[6] Equine DQ981478
06-6-1 G[5] Porcine FJ807788 Ch2 G[7] Avian X56784
06-10-1 G[5] Porcine FJ807789 BRV16 G[8] Bovine AB077058
06-12-1 G[5] Porcine FJ807790 Sun9 G[8] Bovine AB158431
06-61-3 G[5] Porcine FJ807791 KAG80 G[8] Bovine AB077055
06-258-1 G[5] Porcine FJ807792 NGRBg8 G[8] Bovine AF361439
07-08-1 G[5] Porcine FJ807793 06-46-2 G[8] Porcine FJ807854
07-10-1 G[5] Porcine FJ807794 06-54-1 G[8] Porcine FJ807879
07-12-3 G[5] Porcine FJ807795 06-176-10 G[8] Porcine FJ807855
07-14-1 G[5] Porcine FJ807796 06-261-4 G[8] Porcine FJ807856
07-15-1 G[5] Porcine FJ807797 07-28-7 G[8] Porcine FJ807857
07-16-1 G[5] Porcine FJ807798 07-109-8 G[8] Porcine FJ807858
07-17-1 G[5] Porcine FJ807799 07-134-7 G[8] Porcine FJ807859
07-17-2 G[5] Porcine FJ807800 11-1 G[8] Porcine FJ807860
07-20-1 G[5] Porcine FJ807801 42-1 G[8] Porcine FJ807861
07-25 G[5] Porcine FJ807802 141-1 G[8] Porcine FJ807862
07-26-1 G[5] Porcine FJ807803 156-1 G[8] Porcine FJ807863
07-33-2 G[5] Porcine FJ807804 157-1 G[8] Porcine FJ807864
07-61-3 G[5] Porcine FJ807805 174-1 G[8] Porcine FJ807865
07-74-1 G[5] Porcine FJ807806 208-1 G[8] Porcine FJ807866
07-95-1 G[5] Porcine FJ807807 A-1 G[8] Porcine FJ807867
07-95-3 G[5] Porcine FJ807808 C-1 G[8] Porcine FJ807868
07-117-2 G[5] Porcine FJ807809 D-1 G[8] Porcine FJ807869
07-214-1 G[5] Porcine FJ807810 W161 G[9] Human EF672623
3 G[5] Porcine FJ807811 Au32 G[9] Human AB045372
4 G[5] Porcine FJ807812 F45 G[9] Human AB180970
8-1 G[5] Porcine FJ807813 116E G[9] Human L14072
8-2 G[5] Porcine FJ807814 95H115 G[9] Human AB045373
16 G[5] Porcine FJ807815 97CM108 G[9] Human AY866504
19 G[5] Porcine FJ807816 MW69 G[9] Human AJ250545
24 G[5] Porcine FJ807817 N23 G[9] Human AJ491177
25-1 G[5] Porcine FJ807818 3710CM G[9] Human AY816184
25-2 G[5] Porcine FJ807819 US1205 G[9] Human AF060487
47-1 G[5] Porcine FJ807820 US321 G[9] Human AJ250275
47-2 G[5] Porcine FJ807821 BS1414/02 G[9] Human DQ822599
49 G[5] Porcine FJ807822 6222LP G[9] Human AF529871
52 G[5] Porcine FJ807823 PH301 G[9] Human AJ491184
53 G[5] Porcine FJ807824 BD524 G[9] Human AJ250543
57 G[5] Porcine FJ807825 R136 G[9] Human AF438228
57-1 G[5] Porcine FJ807826 Bulumkutu G[9] Human AF359358
61-1 G[5] Porcine FJ807827 3298CM G[9] Human DQ647423
63-1 G[5] Porcine FJ807828 MD28 G[9] Human AB297791
71 G[5] Porcine FJ807829 CAU202 G[9] Human EF059922
71-1 G[5] Porcine FJ807830 KNIH-13 G[9] Human DQ990319
VP7 KUMS04-102 G[9] Human DQ056300 VP7 06-44-2 G[9] Porcine FJ807874
E192 G[9] Human EU708592 06-52-1 G[9] Porcine FJ807875
E205 G[9] Human EU708591 06-121 G[9] Porcine FJ807876
L865 G[9] Human EU708599 06-235 G[9] Porcine FJ807877
L880 G[9] Human EU708601 06-285 G[9] Porcine FJ807878
CMP003 G[9] Porcine AY707787 1 G[9] Porcine FJ807870
97'SZ G[9] Human EU486975 2 G[9] Porcine FJ807871
OM46 G[9] Human AJ491181 B223 G[10] Bovine X57852
OM67 G[9] Human AJ491179 YM G[11] Porcine M23194
Hokkaido-14 G[9] Porcine AB176677 L26 G[12] Human M58290
JP3-6 G[9] Porcine AB176678 L338 G[13] Equine D13549
JP13-3 G[9] Porcine AB176679 FI23 G[14] Equine M61876
JP16-3 G[9] Porcine AB176680 Hg18 G[15] Bovine AF237666
JP29-6 G[9] Porcine AB176681 EW G[16] Murine U08430
JP32-4 G[9] Porcine AB176682 Ty1 G[17] Turkey D82980
JP35-7 G[9] Porcine AB176683 PO-13 G[18] Pigion D82979
T203 G[9] Human AY003871 02V0002G3 G[19] Chicken FJ169859
K-1 G[9] Human AB045374 Ecu534 G[20] Bovine Ecu805775
99-Sp1904 G[9] Human AB091754 Azuk-1 G[21] Bovine AB454421
06-22-1 G[9] Porcine FJ807872 Tu-03V0002E10 G[22] Turkey EU486973
06-42-2 G[9] Porcine FJ807873 HUN G[23] Pheasant FN393056
Open in a new tab

3. Results

3.1. Prevalence of porcine GARVs in pigs with diarrhea in South Korea

In order to determine the prevalence of porcine GARVs in diarrheic Korean piglets, a total of 475 fecal samples from diarrheic pigs in 143 farms across South Korea were screened by RT-PCR and nested PCR using two sets of primer pairs (Table 1). By RT-PCR, 106 out of 475 diarrheic fecal samples tested positive for porcine GARVs. In nested PCR, an additional 76 samples were found to be positive for porcine GARVs. Overall, 182 (38.3%) out of 475 diarrheic fecal samples were positive for porcine GARVs (Table 3 ).

Table 3.

Summary of enteric pathogens present in the fecal samples obtained from pigs with diarrhea (2006–2007).

Enteric pathogens presenta No. of samples (%)b
GARV alone 58 (12.21)
GARV plus GBRV 5 (1.05)
GARV plus GCRV 49 (10.32)
GARV plus PSaV 2 (0.42)
GARV plus PToV 2 (0.42)
GARV plus E. coli 11 (2.32)
GARV plus Salmonella 7 (1.47)
GARV, GCRV plus PSaV 11 (2.32)
GARV, GCRV plus PToV 7 (1.47)
GARV, GBRV plus E. coli 1 (0.21)
GARV, GCRV plus E. coli 8 (1.68)
GARV, GCRV plus Salmonella 12 (2.53)
GARV, PSaV plus E. coli 1 (0.21)
GARV, GCRV plus Brachyspira hyodysenteriae 1 (0.21)
GARV, PSaV plus Brachyspira hyodysenteriae 1 (0.21)
GARV, GBRV, GCRV plus PSaV 1 (0.21)
GARV, GCRV, PSaV plus E. coli 1 (0.21)
GARV, GCRV, PSaV plus Salmonella 2 (0.42)
GARV, GCRV, PToV plus Salmonella 1 (0.21)
GARV, GBRV, GCRV, PToV plus PSaV 1 (0.21)
Other enteric pathogens detected 168 (35.37)
No enteric pathogens detected 125 (26.32)



Total 475 (100)
Open in a new tab
a

GARV: group A rotavirus; GBRV: group B rotavirus; GCRV: group C rotavirus; PSaV: porcine sapovirus; PToV: porcine torovirus.

b

Number of positive fecal samples.

3.2. Other enteric pathogens

Of the 182 porcine GARV-positive diarrheic fecal specimens, 58 fecal samples (12.2%) tested positive only for the porcine GARVs, while the other 124 fecal samples (26.1%) were also positive for other enteric pathogens, including GBRV, GCRV, PSaV, PToV, E. coli, Salmonella and B. hyodysenteriae (Table 3). In addition, 168 fecal specimens (35.4%) that tested negative for porcine GARVs were positive for other enteric pathogens (Table 3). No enteric pathogens were detected in the remaining 125 fecal samples (26.3%).

3.3. Seasonal distribution of porcine GARVs in diarrheic piglets in South Korea

Porcine GARV infections were more prevalent in fecal samples of pigs in summer than in the other seasons: 87 (40.5%) out of 215 fecal samples were positive in spring; 43 (50.0%) out of 86 fecal samples were positive in summer; 17 (24.6%) out of 69 fecal samples were positive in autumn; and 35 (33.3%) out of 105 fecal samples were positive in winter.

3.4. Virus isolation in TF-104 cells

Of the 182 porcine GARV-positive fecal samples by RT-PCR or nested PCR, porcine GARVs were isolated from 98 fecal samples. After the second or third passage, cytopathic effect (CPE), characterized by rounded and detached cells in clusters, was observed in the cultures inoculated with each fecal sample from diarrheic piglets at post inoculation days 1–2. No differences in CPEs were observed among the isolates. CPE was not observed in the mock-infected TF-104 cells. The direct IF test detected GARV-specific cytoplasmic fluorescence in the TF-104 cells inoculated with each of these samples at the second or third passage. A specific band was detected after amplification of all isolates using a RT-PCR assay targeting a 308 bp fragment of the VP6 gene of GARVs.

3.5. Sequence and phylogenetic analysis of VP7 gene

Using RT-PCR to amplify full length sequence (1062 nucleotides in length) of the VP7 gene, amplicons could be achieved for 92 out of 98 strains and could be sequenced. A comparison of the nucleotide and deduced amino acid sequences of the VP7 gene between all Korean porcine GARV strains and the GARV strains representing all 23 G genotypes was performed with a 1020 bp fragment (excluding the primer sequences) (Table 4, Table 5 ).

Table 4.

Nucleotide and deduced amino acid sequences comparison of the VP7 of 83 Korean porcine rotavirus strains with those of the G5 and G8 serotypes.

Strain G type Origin % identity with strains: 66 Korea strains
 % identity with strains: 17 Korea strains
nt aa nt aa
OSU G5 Porcine 98.2–99.8 95.4–99.9 75.4–77.7 78.5–82.4
JL94 G5 Porcine 98.5–99.7 96.6–100 75.5–77.8 78.8–82.7
KJ44 G5 Bovine 97.6–98.9 94.5–97.9 74.6–77.9 77.2–80.1
BRV16 G8 Bovine 75.8–76.9 77.7–80.8 87.7–97.8 90.9–98.2
Sun9 G8 Bovine 76.0–77.1 79.4–81.6 87.7–95.1 93.5–97.7
KAG80 G8 Bovine 74.80–75.9 77.9–80.1 87.2–96.1 91.7–96.6
NGRBg8 G8 Bovine 75.9–76.7 78.8–81.3 84.7–86.1 91.7–96.9
Open in a new tab

Table 5.

Nucleotide and deduced amino acid sequences comparison of the G9 of 9 Korean porcine rotavirus strains with those of the other lineages.

Strain Lineage Origin % identity with strains: 9 Korea strains
 Strain Lineage Origin % identity with strains: 9 Korea strains
nt aa nt aa
W161 L1 Human 87.0–89.7 89.9–96.0 KNIH-13 L3 Human 90.1–93.0 91.1–97.0
Au32 L1 Human 87.0–89.9 89.3–95.4 KUMS04-102 L3 Human 90.0–92.9 90.8–96.7
F45 L1 Human 87.3–90.1 89.9–95.7 E192 L3 Human 89.8–92.7 94.8–96.0
116E L2 Human 85.3–88.1 87.1–93.3 E205 L3 Human 89.8–92.7 90.8–95.4
95H115 L3 Human 90.1–92.9 91.4–97.2 L865 L3 Human 89.9–92.8 91.1–96.9
97CM108 L3 Human 89.3–92.1 90.8–96.6 L880 L3 Human 90.1–93.0 91.1–96.9
MW69 L3 Human 90.2–93.0 91.4–97.2 CMP003 L3 Porcine 89.1–91.8 90.2–95.7
N23 L3 Human 90.0–92.8 91.1–96.9 97'SZ L4 Human 87.7–89.9 90.5–96.1
3710CM L3 Human 90.0–92.8 91.1–96.9 OM46 L5 Human 86.5–89.1 90.5–96.3
US1205 L3 Human 89.9–92.8 91.4–97.2 OM67 L5 Human 86.7–89.7 90.5–96.3
US321 L3 Human 89.9–92.7 91.4–97.2 Hokkaido-14 L6 Porcine 90.4–93.1 91.7–97.5
BS1414/02 L3 Human 90.0–92.6 90.6–96.4 JP3-6 L6 Porcine 89.8–92.6 90.8–96.6
6222LP L3 Human 89.8–92.4 91.1–96.0 JP13-3 L6 Porcine 90.1–92.8 90.2–96.3
PH301 L3 Human 90.0–92.8 91.1–96.0 JP16-3 L6 Porcine 94.1–97.2 93.3–99.1
BD524 L3 Human 88.7–91.5 89.0–94.5 JP29-6 L6 Porcine 89.9–92.6 90.8–96.6
R136 L3 Human 90.3–93.2 91.4–97.2 JP32-4 L6 Porcine 89.3–92.1 90.5–96.0
Bulumkutu L3 Human 89.9–92.6 90.8–96.6 JP35-7 L6 Porcine 89.9–92.6 90.2–96.3
3298CM L3 Human 89.9–92.8 90.2–96.0 T203 L6 Human 91.7–94.6 90.5–96.7
MD28 L3 Human 89.7–92.7 89.9–95.7 K-1 L6 Human 91.1–94.1 90.8–96.7
CAU202 L3 Human 90.0–92.9 92.0–97.9 99-Sp1904 L6 Human 91.3–94.3 91.4–97.3
Open in a new tab

Sixty-six Korean strains showed high nucleotide (97.6–99.8%) and deduced amino acid (94.5–100%) identities with the G5 strains, which include the porcine OSU and JL94 strains, and the bovine KJ44 strains. On the other hand, these strains had comparatively lower nucleotide (63.4–83.2%) and deduced amino acid (54.2–89.8%) identities with the other G genotypes (data not shown). Phylogenetic analysis also confirmed that the VP7 gene of 66 Korean porcine GARV strains was closely related to the G5 strains and clustered with the porcine G5 strains (Fig. 1A). Seventeen of the 92 Korean porcine GARV strains had 84.7–97.8% nucleotide and 90.9–98.2% deduced amino acid identities to the G8 GARVs including the bovine BRV16, Sun9, KAG80, and NGRBg8 strains (Table 4), whereas they showed relatively lower nucleotide (61.8–78.7%) and deduced amino acid (54.4–84.7%) identities with other G genotypes (data not shown). Phylogenetically, these strains are grouped with G8 strains, including the bovine BRV16, Sun9, KAG80, and NGRBg8 strains. The remaining nine Korean porcine GARV strains showed high nucleotide (85.3–97.2%) and deduced amino acid (87.1–99.1%) identities with the G9 strains (Table 5). In contrast, these strains shared lower nucleotide (60.7–80.4%) and deduced amino acid (53.9–87.2%) identities with the other G genotypes (data not shown). Phylogenetic analysis showed that all G9 Korean porcine strains clustered with those of lineage VI. In addition, all Korean human G9 strains were found to be grouped with those of lineage III (Fig. 1B).

Fig. 1.

Fig. 1

Fig. 1

Open in a new tab

(A) Phylogenetic tree of the complete VP7 genes of the sixty-six G5, seventeen G8, and nine G9 strains of Korean porcine GARVs indicating their genetic relationships with other G genotypes. Black triangles contain rotavirus G5, G8, and G9 strains. (B) A detailed phylogenetic tree of the complete VP7 genes of the nine Korean porcine G9 strains with other known G9 strains indicating their genetic relationships with other known VI lineages of G9 genotype. Reference sequences used in the analysis (A and B) were obtained from the GenBank database (Table 2).

3.6. Sequence and phylogenetic analysis of VP4 gene

A part of the VP4 gene (874 nucleotides in length) was able to be amplified in 95 out of 98 isolated strains. The nucleotide and deduced amino acid sequences encoding 290 amino acids representing VP8* and the amino terminus of VP5* of the 95 strains were compared with GARV strains representing all the 31 P genotypes. Of the 95 Korean strains, 91 had high nucleotide (88.7–99.8%) and deduced amino acid (91.0–99.3%) identities with the P[7] GARVs including the porcine OSU, JL94, and SW20/21 strains, and the bovine PP-1 strain (Table 6 ), but less than 73.8% nucleotide and 79.4% deduced amino acid identities with the other P genotypes (data not shown). Phylogenetic analysis of the VP4 gene provided a molecular basis for their similarity to the P[7] genotype strains (Fig. 2 ). The sequences of the Korean strains, 11-1 and 66-1, were most closely related to the bovine BRV033, NCDV, C486, and RF strains, representing the P[1] genotype with 93.0–99.1% nucleotide and 94.5–99.3% deduced amino acid identities (Table 6). In contrast, these strains showed lower nucleotide (53.0–76.1%) and deduced amino acid (43.6–80.4%) identities to the representatives of other P genotypes (data not shown). Phylogenetically, these two strains clustered with those of the P[1] genotype (Fig. 2). The remaining two strains, 06-52-1 and 06-285, shared high nucleotide (84.5–89.7%) and deduced amino acid (94.1–95.1%) identities to the P[23] strains (A34, JP32-4, and Hokkaido-14 strains) (Table 6), but less than 73.9% nucleotide and 82.1% deduced amino acid identities compared to representatives of the other P genotypes (data not shown). Phylogenetic analysis of the VP4 gene showed that these strains were grouped with those of the P[23] genotype (Fig. 2).

Table 6.

Nucleotide and deduced amino acid sequences similarities of the VP4 of 95 Korean porcine rotavirus strains with those of the P[1], P[7] and P[23] genotypes.

Strain P type Origin % identity with strains: 91 Korea strains
 % identity with strains: 2 Korea strains
 % identity with strains: 2 Korea strains
nt aa nt aa nt aa
BRV033 P[1] Bovine 69.5–69.8 73.1–73.9 93.0–93.4 94.5–94.9 70.1 74.3
NCDV P[1] Bovine 71.2–73.1 73.9–79.0 98.1–99.1 96.2–99.3 72.3 79.7
C486 P[1] Bovine 72.2–73.0 75.9–78.7 97.4–98.2 95.2–97.9 71.9 79.0
RF P[1] Bovine 72.5–73.3 75.5–78.4 97.6–98.6 95.2–98.3 72.3 79.4
OSU P[7] Porcine 92.4–99.8 93.1–99.3 71.7–73.0 74.9–77.7 71.7–71.9 78.0
JL94 P[7] Porcine 92.4–99.7 92.8–99.3 72.1–73.3 75.6–78.4 71.7–71.9 78.0
SW20/21 P[7] Porcine 92.2–98.2 92.9–98.1 72.7–73.1 77.8 72.0–72.1 77.1
PP-1 P[7] Bovine 88.7–93.0 91.0–96.6 73.0–73.1 78.9–79.3 69.8–70.0 77.4
A34 P[23] Porcine 69.6–71.2 70.3–74.1 73.5–73.7 76.6–77.0 89.6–89.7 94.1
JP32-4 P[23] Porcine 70.8–71.5 72.2–75.6 72.5 78.2 89.5–89.6 95.1
Hokkaido-14 P[23] Porcine 70.1–71.3 72.6–75.9 71.9–72.1 77.4 84.5–84.6 94.7
Open in a new tab

Fig. 2.

Fig. 2

Open in a new tab

Phylogenetic tree of the VP4 gene of the ninety-five porcine rotavirus strains indicating their genetic relationships with other known P genotypes. Reference sequences used in the analysis were obtained from the GenBank database (Table 2).

3.7. Combinations of G and P genotypes

Based on the sequence and phylogenetic analyses of 98 Korean porcine GARVs, G and P genotype combinations were determined in the Korean porcine GARVs (Table 7 ). The most common combination of G and P genotypes was G5P[7], which was detected in 63 GARVs. Sixteen GARVs had the G8P[7] combination, while G9P[7] GARVs were detected in 7 strains. Two GARVs showed the G9P[23] combination, and one strain had the G8P[1] combination. In addition, the counterparts of G and P genotypes were not determined in three G5, five P[7], and one P[1] GARV strains (Table 7).

Table 7.

Combinations of G and P genotypes of 98 Korean porcine rotaviruses.

Genotypes G5 G8 G9 Unknown
P[1] 0 1 0 1
P[7] 63 16 7 5
P[23] 0 0 2 0
Unknown 3 0 0 0
Open in a new tab

4. Discussion

Epidemiological information related to the prevalence and genotype specificities of porcine GARVs are beneficial for the development of effective vaccines (Rosen et al., 1994). Therefore, we investigated the prevalence of porcine GARV infections as well as their genotype diversities in South Korea. The fecal prevalence of porcine GARV infections in diarrheic piglets has been reported to be 3.3% in Argentina (Parra et al., 2008), 4% in Southern Germany (Wieler et al., 2001), 9.2% in Canada (Morin et al., 1983), 22.3% in Thailand (Khamrin et al., 2007) and 35.3% in Brazil (Rácz et al., 2000). In this study, porcine GARV infections in South Korea were found widespread and highly prevalent at 38.3%, similar to Brazil at 35.3% (Rácz et al., 2000). This suggests that porcine GARV infections are epidemic in diarrheic piglets in South Korea. This is the first large-scale, epidemiological study on the prevalence of porcine GARV infections in diarrheic piglets in South Korea.

Epidemiological studies have demonstrated that five G genotypes (G3, G4, G5, G9, and G11) in combination with six dominant P genotypes (P[6], P[7], P[13], P[19], P[23], and P[26]) are the most frequent VP7 and VP4 types associated with porcine GARV infections (Kobayashi et al., 2007). In this study, two-thirds of the VP7 and VP4 genotypes were comprised of G5 and P[7] genotypes, respectively. The other G and P genotypes including G8, G9, P[1], and P[23] were a minority of the VP7 and VP4 genotypes. However, G3, G4, G11, P[6], P[13], P[19], and P[26] genotypes, which were known to be common, were not detected in this study. It is unclear whether the data in this study exactly reflected the true prevalence of G and P genotypes in the field farms due to the difficulty in cultivating some rotaviruses in cell culture (Zaberezhny et al., 1994). For example, P[6] porcine GARVs are quite common in nature, but are not usually cultivatable (Martella et al., 2006, Zaberezhny et al., 1994). Since we analyzed only cell culture cultivated porcine GARV strains, future studies should use the fecal samples for G and P genotyping of porcine GARVs to generate a more accurate picture of GARV genotypes in South Korea (Zaberezhny et al., 1994).

In this study, we isolated 17 G8 GARVs (17.3%) in combination with P[1] and P[7] across South Korea, which were ranked the second most frequently detected G and P types, indicating that these strains may be prevalent throughout South Korea. The discovery of these G8 GARVs is important to the swine industry, veterinary practitioners, and GARV vaccine producers in South Korea. It should be noted that the serotype G8 is one of the major bovine serotypes in combination with P[5] and P[1] genotypes (Alfieri et al., 2004, Chang et al., 1996, Fukai et al., 2004, Gentsch et al., 1992). In addition, G8 GAVR serotype has been detected in rare cases in humans (Adah et al., 2001, Cunliffe et al., 1999, Fischer et al., 2003, Matthijnssens et al., 2006, Palombo et al., 2000, Steele et al., 1999), and pigs (Gouvea et al., 1994). Among the G8 GARVs, one strain contained bovine-like P[1]-VP4 gene, indicating bovine-like G8P[1] strains can infect heterologous species in nature, such as pigs. The remaining 16 G8 strains contained the porcine-like P[7]-VP4 gene. This result implies that reassortant events between porcine and bovine GARVs occur in nature. In previous reports (Ha et al., 2009; Park et al., unpublished data), we demonstrated that reassortant GARVs between bovine and porcine, and heterologous GARVs whose 11 genome segments are of pig origin infect calves and induce diarrhea. Therefore, interspecies transmission of GARVs between bovine and porcine, either as whole virions or by gene segment reassortment, appear to occur in nature at a relatively high frequency in South Korea.

Since G9 GARV was first detected in a child with gastroenteritis in the United States in 1983 (Clark et al., 1987) and subsequently in other countries (Das et al., 1993, Nakagomi et al., 1990, Urasawa et al., 1992, Zizdić et al., 1992), G9 GARVs have not been reported in humans for a decade. From mid-1990s, G9 GARVs reemerged and efficiently spread throughout the world as the fifth globally important serotype (Ramachandran et al., 2000, Santos and Hoshino, 2005). Recently, G9 GARVs have been classified into I–VI lineages, with I–II consisting of strains isolated in the 1980s, and III–VI composing of strains isolated from the mid-1990s (Phan et al., 2007). Of these, lineages III and VI were found in both humans and pigs (Phan et al., 2007). In the present study, G9 GARVs were isolated and identified as the third most important genotype in the diarrheic pigs. All Korean strains were clustered in lineage VI of known porcine and human G9 GARVs. Thus, continuous genotypic characterization of the GARVs and cautions against the increase of the G9 is necessary in South Korea. Moreover, human G9 GARV infections belonging to lineage III have been emerging in South Korea since 2002 (Kang et al., 2005), meaning that Korean porcine G9 GARVs are different from Korean human G9 GARVs.

Human GARVs showed a striking seasonal pattern of infection in developed countries, with epidemic peaks occurring in the cooler months of each year (Estes and Kapikian, 2007). This may be related to the influence of low relative humidity as a factor facilitating the survival of GARVs on surfaces (Brandt et al., 1982). Studies describing the seasonal pattern of porcine GARVs in diarrheic piglets have rarely been published, and those published data varied widely (Will et al., 1994, Svensmark et al., 1989). In one of the few comparable studies, the seasonal curves of porcine GARV infections were highest in winter and the slightly higher in late summer and early autumn in Iowa, USA (Will et al., 1994). In contrast, Danish porcine GARV infections showed a slight increase during the autumn (Svensmark et al., 1989). In this study, however, porcine GARVs occurred throughout the year with the highest prevalence during the summer months. The reason for the seasonal pattern variations around the world is not yet known. Therefore, more intensified epidemiological studies throughout the world will be needed to fully understand the seasonal pattern of porcine GARV infections and to establish porcine GARV surveillance programs to prevent infections.

In summary, this study demonstrates that porcine GARV infections are epidemic and widespread in diarrheic piglets in South Korea. The infecting strains are genetically diverse, and include homologous (G5P[7]), heterologous (G8P[1]), and reassortant (G8P[7]), as well as emerging G9 GARV strains.

Acknowledgments

This study was supported by the National Veterinary Research and Quarantine Services (NVRQS), Ministry of Agriculture and Forestry, the Korea Science and Engineering Foundation (KOSEF) grant (2009-0081752), and the Regional Technology Innovation Program of the Ministry of Commerce, Industry and Energy (MOCIE), Republic of Korea. The authors would like to acknowledge a graduate fellowship from the Korean Ministry of Education and Human Resources Development through the Brain Korea 21 project.

Contributor Information

Kyoung-Oh Cho, Email: choko@chonnam.ac.kr.

Su-Jin Park, Email: sjpark@kribb.re.kr.

References

  1. Abe M., Ito N., Morikawa S., Takasu M., Murase T., Kawashima T., Kawai Y., Kohara J., Sugiyama M. Molecular epidemiology of rotaviruses among healthy calves in Japan: isolation of a novel rotavirus bearing new P and G genotypes. Virus Res. 2009;144:250–257. doi: 10.1016/j.virusres.2009.05.005. [DOI] [PubMed] [Google Scholar]
  2. Adah M.I., Wade A., Taniguchi K. Molecular epidemiology of rotaviruses in Nigeria: detection of unusual strains with G2P[6] and G8P[1] specificities. J. Clin. Microbiol. 2001;39:3969–3975. doi: 10.1128/JCM.39.11.3969-3975.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alfieri A.F., Alfieri A.A., Barreiros M.A., Leite J.P., Richtzenhain L.J. G and P genotypes of group A rotavirus strains circulating in calves in Brazil, 1996–1999. Vet. Microbiol. 2004;99:167–173. doi: 10.1016/j.vetmic.2003.10.029. [DOI] [PubMed] [Google Scholar]
  4. Bohl E.H., Theil K.W., Saif L.J. Isolation and serotyping of porcine rotaviruses and antigenic comparison with other rotaviruses. J. Clin. Microbiol. 1984;19:105–111. doi: 10.1128/jcm.19.2.105-111.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brandt C.D., Kim H.W., Rodriguez W.J., Arrobio J.O., Jeffries B.C., Parrott R.H. Rotavirus gastroenteritis and weather. J. Clin. Microbiol. 1982;16:478–482. doi: 10.1128/jcm.16.3.478-482.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chang K.O., Parwani A.V., Saif L.J. The characterization of VP7 (G type) and VP4 (P type) genes of bovine group A rotaviruses from field samples using RT-PCR and RFLP analysis. Arch. Virol. 1996;141:1727–1739. doi: 10.1007/BF01718295. [DOI] [PubMed] [Google Scholar]
  7. Ciarlet M., Estes M.K. Rotaviruses: basic biology, epidemiology and methodologies. In: Bitton G., editor. Encyclopedia of Environmental Microbiology. John Wiley and Sons; New York: 2002. pp. 2753–2773. [Google Scholar]
  8. Clark H.F., Hoshino Y., Bell L.M., Groff J., Hess G., Bachman P., Offit P.A. Rotavirus isolate WI61 representing a presumptive new human serotype. J. Clin. Microbiol. 1987;25:1757–1762. doi: 10.1128/jcm.25.9.1757-1762.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cunliffe N.A., Gondwe J.S., Broadhead R.L., Molyneux M.E., Woods P.A., Bresee J.S., Glass R.I., Gentsch J.R., Hart C.A. Rotavirus G and P types in children with acute diarrhea in Blantyre, Malawi, from 1997 to 1998: predominance of novel P[6]G8 strains. J. Med. Virol. 1999;57:308–312. [PubMed] [Google Scholar]
  10. Das B.K., Gentsch J.R., Hoshino Y., Ishida S., Nakagomi O., Bhan M.K., Kumar R., Glass R.I. Characterization of the G serotype and genogroups of New Delhi newborn rotavirus strain 116E. Vrology. 1993;197:99–107. doi: 10.1006/viro.1993.1570. [DOI] [PubMed] [Google Scholar]
  11. Estes M.K., Kapikian A.Z. Rotaviruses. In: Knipe D.M., Griffin D.E., Lamb R.A., Straus S.E., Howley P.M., Martin M.A., Roizman B., editors. Fields Virology. fifth edition. Lippincott Williams & Wilkins; Philadelphia, PA: 2007. pp. 1917–1974. [Google Scholar]
  12. Fischer T.K., Page N.A., Griffin D.D., Eugen-Olsen J., Pedersen A.G., Valentiner-Branth P., Mølbak K., Sommerfelt H., Nielsen N.M. Characterization of incompletely typed rotavirus strains from Guinea-Bissau: identification of G8 and G9 types and a high frequency of mixed infections. Virology. 2003;311:125–133. doi: 10.1016/s0042-6822(03)00153-3. [DOI] [PubMed] [Google Scholar]
  13. Fukai K., Saito T., Inoue K., Sato M. Molecular characterization of novel P[14],G8 bovine group A rotavirus, Sun9, isolated in Japan. Virus Res. 2004;105:101–106. doi: 10.1016/j.virusres.2004.04.016. [DOI] [PubMed] [Google Scholar]
  14. Gentsch J.R., Laird A.R., Bielfelt B., Griffin D.D., Bányai K., Ramachandran M., Jain V., Cunliffe N.A., Nakagomi O., Kirkwood C.D., Fischer T.K., Parashar U.D., Bresee J.S., Jiang B., Glass R.I. Serotype diversity and reassortment between human and animal rotavirus strains: implications for rotavirus vaccine programs. J. Infect. Dis. 2005;192(Suppl. 1):S146–S159. doi: 10.1086/431499. [DOI] [PubMed] [Google Scholar]
  15. Gentsch J.R., Glass R.I., Woods P., Gouvea V., Gorziglia M., Flores J., Das B.K., Bhan M.K. Identification of group A rotavirus gene 4 types by polymerase chain reaction. J. Clin. Microbiol. 1992;30:1365–1373. doi: 10.1128/jcm.30.6.1365-1373.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Glass R.I., Bressee J.S., Parashar U., Miller M., Gentsch J.R. Rotavirus vaccines at the threshold. Nat. Med. 1997;3:1324–1325. doi: 10.1038/nm1297-1324. [DOI] [PubMed] [Google Scholar]
  17. Gouvea V., Santos N., Timenetsky, Mdo C. VP4 typing of bovine and porcine group A rotaviruses by PCR. J. Clin. Microbiol. 1994;32:1333–1337. doi: 10.1128/jcm.32.5.1333-1337.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ha T.P., Kim H.J., Saif L.J., Jeong Y.J., Kim H.H., Kwon H.J., Park S.J., Cho K.O. Sequence analysis of unusual P[7]G5 bovine rotavirus strains reveals evidence of interspecies transmission. J. Clin. Microbiol. 2009;47:3329–3332. doi: 10.1128/JCM.01583-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Jain V., Das B.K., Bhan M.K., Glass R.I., Gentsch J.R. Great diversity of group A rotavirus strains and high prevalence of mixed rotavirus infections in India. J. Clin. Microbiol. 2001;39:3524–3529. doi: 10.1128/JCM.39.10.3524-3529.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jeong C., Park S.I., Park S.H., Kim H.H., Park S.J., Jeong J.H., Choy H.E., Saif L.J., Kim S.K., Kang M.I., Hyun B.H., Cho K.O. Genetic diversity of porcine sapoviruses. Vet. Microbiol. 2007;122:246–257. doi: 10.1016/j.vetmic.2007.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kang J.O., Kilgore P., Kim J.S., Nyambat B., Kim J., Suh H.S., Yoon Y., Jang S., Chang C., Choi S., Kim M.N., Gentsch J., Bresee J., Glass R. Molecular epidemiological profile of rotavirus in South Korea, July 2002 through June 2003: emergence of G4P[6] and G9P[8] strains. J. Infect. Dis. 2005;192(Suppl. 1):S57–S63. doi: 10.1086/431502. [DOI] [PubMed] [Google Scholar]
  22. Khamrin P., Maneekarn N., Peerakome S., Chan-it W., Yagyu F., Okitsu S., Ushijima H. Novel porcine rotavirus of genotype P[27] shares new phylogenetic lineage with G2 porcine rotavirus strain. Virology. 2007;361:243–252. doi: 10.1016/j.virol.2006.12.004. [DOI] [PubMed] [Google Scholar]
  23. Kobayashi N., Ishino M., Wang Y.-H., Chawla-Sarkar M., Krishnan T., Naik T.N. Diversity of G-type and P-type of human and animal rotaviruses and its genetic background. In: Mendez-Vilas A., editor. Communicating Current Research and Educational Topics and Trends in Applied Microbiology. second edition. FORMATEX; Badajoz, Spain: 2007. pp. 847–858. [Google Scholar]
  24. La T., Phillips N.D., Hampson D.J. Development of a duplex PCR assay for detection of Brachyspira hyodysenteriae and Brachyspira pilosicoli in pig feces. J. Clin. Microbiol. 2003;41:3372–3375. doi: 10.1128/JCM.41.7.3372-3375.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Leite J.P., Alfieri A.A., Woods P.A., Glass R.I., Gentsch J.R. Rotavirus G and P types circulating in Brazil: characterization by RTPCR, probe hybridization, and sequence analysis. Arch. Virol. 1996;141:2365–2374. doi: 10.1007/BF01718637. [DOI] [PubMed] [Google Scholar]
  26. Martella V., Bányai K., Ciarlet M., Iturriza-Gómara M., Lorusso E., De Grazia S., Arista S., Decaro N., Elia G., Cavalli A., Corrente M., Lavazza A., Baselga R., Buonavoglia C. Relationship among procine and human P[6] rotaviruses: evidence that the different human P[6] lineages have originated from multiple interspecies transmission events. Virology. 2006;344:509–519. doi: 10.1016/j.virol.2005.08.029. [DOI] [PubMed] [Google Scholar]
  27. Martella V., Ciarlet M., Bányai K., Lorusso E., Cavalli A., Corrente M., Elia G., Arista S., Camero M., Desario C., Decaro N., Lavazza A., Buonavoglia C. Identification of a novel VP4 genotype carried by a serotype G5 porcine rotavirus strain. Virology. 2005;346:301–311. doi: 10.1016/j.virol.2005.11.001. [DOI] [PubMed] [Google Scholar]
  28. Matthijnssens J., Ciarlet M., Rahman M., Attoui H., Bányai K., Estes M.K., Gentsch J.R., Iturriza-Gómara M., Kirkwood C.D., Martell V., Mertens P.P., Nakagomi O., Patton J.T., Ruggeri F.M., Saif L.J., Santos N., Steyer A., Taniguchi K., Desselberger U., Van Ranst M. Recommendations for the classification of group A rotaviruses using all 11 genomic RNA segments. Arch. Virol. 2008;153:1621–1629. doi: 10.1007/s00705-008-0155-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Matthijnssens J., Rahman M., Yang X., Delbeke T., Arijs I., Kabue J.P., Muyembe J.J., Van Ranst M. G8 rotavirus strains isolated in the Democratic Republic of Congo belong to the DS-1-like genogroup. J. Clin. Microbiol. 2006;44:1801–1809. doi: 10.1128/JCM.44.5.1801-1809.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Morin M., Turgeon D., Jolette J., Robinson Y., Phaneuf J.B., Sauvageau R., Beauregard M., Teuscher E., Higgins R., Larivière S. Neonatal diarrhea of pigs in Quebec: infectious causes of significant outbreaks. Can. J. Comp. Med. 1983;47:11–17. [PMC free article] [PubMed] [Google Scholar]
  31. Nakagomi T., Ohshima A., Akatani K., Ikegami N., Katsushima N., Nakagomi O. Isolation and molecular characterization of a serotype 9 human rotavirus strain. Microbiol. Immunol. 1990;34:77–82. doi: 10.1111/j.1348-0421.1990.tb00994.x. [DOI] [PubMed] [Google Scholar]
  32. Palombo E.A., Clark R., Bishop R.F. Characterization of a “European-like” serotype G8 human rotavirus isolated in Australia. J. Med. Virol. 2000;60:56–62. [PubMed] [Google Scholar]
  33. Parashar U.D., Gibson C.J., Bresse J.S., Glass R.I. Rotavirus and severe childhood diarrhea. Emerg. Infect. Dis. 2006;12:304–306. doi: 10.3201/eid1202.050006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Park S.H., Saif L.J., Jeong C., Lim G.K., Park S.I., Kim H.H., Park S.J., Kim Y.J., Jeong J.H., Kang M.I., Cho K.O. Molecular characterization of novel G5 bovine rotavirus strains. J. Clin. Microbiol. 2006;44:4101–4112. doi: 10.1128/JCM.01196-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Parra G.I., Vidales G., Gomez J.A., Fernandez F.M., Parreño V., Bok K. Phylogenetic analysis of porcine rotavirus in Argentina: increasing diversity of G4 strains and evidence of interspecies transmission. Vet. Microbiol. 2008;126:243–250. doi: 10.1016/j.vetmic.2007.06.006. [DOI] [PubMed] [Google Scholar]
  36. Phan T.G., Okitsu S., Maneekarn N., Ushijima H. Genetic heterogeneity, evolution and recombination in emerging G9 rotaviruses. Infect. Genet. Evol. 2007;7:656–663. doi: 10.1016/j.meegid.2007.05.001. [DOI] [PubMed] [Google Scholar]
  37. Rácz M.L., Kroeff S.S., Munford V., Caruzo T.A., Durigon E.L., Hayashi Y., Gouvea V., Palombo E.A. Molecular characterization of porcine rotaviruses from the southern region of Brazil: characterization of an atypical genotype G[9] strain. J. Clin. Microbiol. 2000;38:2443–2446. doi: 10.1128/jcm.38.6.2443-2446.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ramachandran M., Kirkwood C.D., Unicomb L., Cunliffe N.A., Ward R.L., Bhan M.K., Clark H.F., Glass R.I., Gentsch J.R. Molecular characterization of serotype G9 rotavirus strains from a global collection. Virology. 2000;278:436–444. doi: 10.1006/viro.2000.0682. [DOI] [PubMed] [Google Scholar]
  39. Rosen B.I., Parwani A.V., Lopez S., Flores J., Saif L.J. Serotypic differentiation of rotaviruses in field samples from diarrheic pigs by using nucleic acid probes specific for porcine VP4 and human and porcine VP7 genes. J. Clin. Microbiol. 1994;32:311–317. doi: 10.1128/jcm.32.2.311-317.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Santos N., Hoshino Y. Global distribution of rotavirus serotypes/genotypes and its implication for the development and implementation of an effective rotavirus vaccine. Rev. Med. Virol. 2005;15:29–56. doi: 10.1002/rmv.448. [DOI] [PubMed] [Google Scholar]
  41. Steele A.D., Parker S.P., Peenze I., Pager C.T., Taylor M.B., Cubitt W.D. Comparative studies of human rotavirus serotype G8 strains recovered in South Africa and the United Kingdom. J. Gen. Virol. 1999;80:3029–3034. doi: 10.1099/0022-1317-80-11-3029. [DOI] [PubMed] [Google Scholar]
  42. Svensmark B., Jorsal S.E., Nielsen K., Willeberg P. Epidemiological studies of piglet diarrhoea in intensively managed Danish sow herds. I. Pre-weaning diarrhoea. Acta Vet. Scand. 1989;30:43–53. doi: 10.1186/BF03548067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Tamura K., Dudley J., Nei M., Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]
  44. Timenetsky, Mdo C., Santos N., Gouvea V. Survey of rotavirus G and P types associated with human gastroenteritis in Sao Paulo, Brazil, from 1986 to 1992. J. Clin. Microbiol. 1994;32:2622–2624. doi: 10.1128/jcm.32.10.2622-2624.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Unicomb L.E., Podder G., Gentsch J.R., Woods P.A., Hasan K.Z., Faruque A.S., Albert M.J., Glass R.I. Evidence of high-frequency genomic reassortment of group A rotavirus strains in Bangladesh: emergence of type G9 in 1995. J. Clin. Microbiol. 1999;37:1885–1891. doi: 10.1128/jcm.37.6.1885-1891.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Urasawa S., Hasegawa A., Urasawa T., Taniguchi K., Wakasugi F., Suzuki H., Inouye S., Pongprot B., Supawadee J., Suprasert S. Antigenic and genetic analysis of human rotaviruses in Chiang Mai, Thailand: evidence for a close relationship between human and animal rotaviruses. J. Infect. Dis. 1992;166:227–234. doi: 10.1093/infdis/166.2.227. [DOI] [PubMed] [Google Scholar]
  47. Ursu K., Kisfali P., Rigó D., Ivanics É., Erdélyi K., Dán Á., Melegh B., Martella V., Bányai K. Molecular analysis of the VP7 gene of pheasant rotaviruses identifies a new genotype, designated G23. Arch. Virol. 2009;154:1365–1369. doi: 10.1007/s00705-009-0439-0. [DOI] [PubMed] [Google Scholar]
  48. Wieler L.H., Ilieff A., Herbst W., Bauer C., Vieler E., Bauerfeind R., Failing K., Klös H., Wengert D., Baljer G., Zahner H. Prevalence of enteropathogens in suckling and weaned piglets with diarrhoea in Southern Germany. J. Vet. Med. B: Infect. Dis. Vet. Public Health. 2001;48:151–159. doi: 10.1111/j.1439-0450.2001.00431.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Will L.A., Paul P.S., Proescholdt T.A., Aktar S.N., Flaming K.P., Janke B.H., Sacks J., Lyoo Y.S., Hill H.T., Hoffman L.J., Wu L.L. Evaluation of rotavirus infection and diarrhea in Iowa commercial pigs based on an epidemiologic study of a population represented by diagnostic laboratory cases. J. Vet. Diagn. Invest. 1994;6:416–422. doi: 10.1177/104063879400600403. [DOI] [PubMed] [Google Scholar]
  50. Zaberezhny A.D., Lyoo Y.S., Paul P.S. Prevalence of P types among porcine rotaviruses using subgenomic VP4 gene probes. Vet. Microbiol. 1994;39:97–110. doi: 10.1016/0378-1135(94)90090-6. [DOI] [PubMed] [Google Scholar]
  51. Zizdić S., Ridjanović Z., Masić I. Newly discovered rotavirus serotypes in 4 years of collecting samples from children with diarrheal syncromes. Med. Arh. 1992;46:15–18. [PubMed] [Google Scholar]

Articles from Veterinary Microbiology are provided here courtesy of Elsevier

RESOURCES