Abstract
The role of Legionella spp. in the aetiology of acute respiratory infections (ARIs) is largely unknown. In this case‐control study, conducted in a general practitioner setting during 2000 and 2001, nose and throat samples from patients presenting with ARIs (n = 230) and controls (n = 200) were analysed for the presence of Legionella spp. by real‐time PCR. Legionella DNA was not detected in any of the cases or controls. Thus, Legionella spp. do not seem to play a role in patients presenting with ARIs, nor were they present in patients who visited their general practitioner for complaints other than ARIs.
Keywords: Acute respiratory infections, general practice, Legionella spp., real‐time PCR, respiratory tract infection
Legionella spp. are an important cause of community‐acquired and nosocomial pneumonia. Since the first description of Legionella pneumophila, more than 40 species of Legionella have been identified, approximately half of which have been isolated from patients [1]. Infection with Legionella spp. can present as a severe pneumonia, with or without multisystem disease and high mortality, but can also present as a self‐limiting influenza‐like illness. Many individuals who seroconvert to Legionella are entirely asymptomatic [1, 2].
Acute respiratory infections (ARIs) are a major cause of morbidity and mortality worldwide. Various infectious agents, especially viruses, have been associated with clinical syndromes ranging from mild disease, such as the common cold, to more severe conditions, such as pneumonia. However, no aetiological agent is found in a large percentage of cases [3]. Although ARIs are very common, there is only one report on the prevalence of Legionella spp. as a cause of community‐acquired infections in general practice [4]. This may be because the diagnosis is not considered, existing diagnostic tests are insensitive, or legionellosis is distributed unevenly across the world. In The Netherlands, c. 200 cases of severe legionellosis are reported annually to the health authorities [5].
The aim of this study was to assess the frequency of Legionella spp. in nose and throat samples of patients presenting with ARIs in general practice. In The Netherlands, more than 100 general practitioners (GPs) participate in nationwide surveillance of respiratory pathogens and influenza‐like illnesses, coordinated by the Netherlands Institute for Health Services Research (NIVEL, Utrecht, The Netherlands) [6]. The GPs register all patients with influenza‐like illness and other ARIs. ARIs without influenza‐like illness are defined as respiratory infections with acute onset (< 5 days) and coryza, sore throat and/or cough. Twenty GPs participated in the present study and were requested to collect a nose and throat sample from patients with ARIs without influenza‐like illness (case). A corresponding control was also sampled within 7 days, defined as an individual who consulted the GP for a complaint other than ARIs, who was in the same age category as the case (0–4, 5–14, 15–24, 25–44, 45–64 or > 65 years), was not a member of the same household as the case, and had not received antibiotics or antiviral therapy in the preceding 14 days. A nose and a throat swab were placed together in 4 mL of Hanks' balanced salt solution containing gelatin, lactalbumin, yeast and antibiotics (GLY medium), and sent to the central laboratory by regular mail. Swabs for bacterial culture were also taken.
The primers and probes of the Legionella PCR assay were based on the 16S rRNA gene as described previously [7]. In brief, nucleic acid isolation was performed with a proteinase K lysis protocol, and primers Leg1 (5′‐TACCTACCCTTGACATACAGTG‐3′) and Leg2 (5′‐CTTCCTCCGGTTTGTCAC‐3′) were used to obtain a 200‐bp amplicon. Real‐time detection of the fragment was done with a Legionella genus‐specific fluorescent probe conjugated to a minor groove binder (LSPP‐VIC: 5′‐GGTTGCGTCGTTACG‐3′). An L. pneumophila‐specific fluorescent minor groove binder probe was used on the complementary DNA strand (LPN‐FAM: 5′‐GAGTCCCCACCATCACATG‐3′). Inhibition was monitored in a separate assay by amplifying a phocine herpes virus, and negative controls were included to monitor processing and cross‐contamination. Sensitivity controls comprised ten‐fold dilutions of L. pneumophila DNA (1000 fg to 10 fg), while 1000 fg of Legionella bozemanii DNA served as a control for discrimination between L. pneumophila and other Legionella spp.
Real‐time PCR was performed with an ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA).
Nose and throat samples from 230 cases and 200 controls were collected between October 2000 and November 2001. The median age of the cases was 35 years (range 0–87 years), and 104 (45%) of them were male. The median age of the control patients was 36 years (range 0–86 years), and 76 (38%) of them were male. Evidence of at least one infectious agent was found by standard techniques in 146 (63%) of the cases, compared to 44 (22%) of the controls (Table 1). Real‐time PCR failed to detect Legionella DNA in any of the samples from either the patients with ARI or the control group. Inhibition of the PCR occurred with one sample.
Table 1.
Frequency of detection of specific infectious agents in 230 cases of acute respiratory tract infection and 200 control patients
| Pathogen | Cases n (%) | Controls n (%) |
|---|---|---|
| Influenza virus A | 25 (10) | 2 (1) |
| Influenza virus B | 7 (3) | 0 (0) |
| Parainfluenza virus 1 | 3 (1) | 0 (0) |
| Parainfluenza virus 2 | 0 (0) | 0 (0) |
| Parainfluenza virus 3 | 2 (1) | 0 (0) |
| Rhinovirus | 61 (25) | 23 (11) |
| Adenovirus | 2 (1) | 0 (0) |
| Coronavirus | 20 (8) | 11 (5) |
| Respiratory syncytial virus | 6 (3) | 2 (1) |
| Human metapneumovirus | 5 (2) | 0 (0) |
| Enterovirus | 7 (3) | 3 (1) |
| Chlamydia pneumoniae | 2 (1) | 0 (0) |
| Mycoplasma pneumoniae | 3 (1) | 1 (0) |
| β‐Haemolytic streptococci | 20 (9) | 4 (2) |
| One or more of the above | 146 (63) | 44 (22) |
| Negative | 84 (37) | 156 (78) |
| Total | 230 (100) | 200 (100) |
ARIs are the most common diseases seen in the community and a frequent reason to consult a GP. Knowledge of the causes of respiratory infections continues to evolve, with recognition of new pathogens [8], but no aetiological diagnosis is established in a large percentage of cases [3]. It might be expected that Legionella spp. could play a role in ARIs, as they are ubiquitous in the aquatic environment and artificial water systems, and can cause a variety of diseases, ranging from asymptomatic cases to severe life‐threatening pneumonia [1, 9]. Upper respiratory signs and symptoms, such as a dry cough and sore throat, have been reported in cases of Legionnaires' disease [10], and a previous study [4] found serological evidence of infection with Legionella spp. in 11.2% of patients who presented with a febrile respiratory tract infection. However, observations based solely on antibody seroconversion should be viewed with scepticism, as the sensitivity and specificity of serology for Legionella spp. other than L. pneumophila have not been validated, and cross‐reactions with other organisms may occur [1, 11, 12].
Culture on buffered charcoal yeast extract (BCYE) plates is the standard method for the laboratory diagnosis of Legionella infections, but has its limitations. Isolates are identified by a combination of colony and Gram's stain morphology, and reactions with specific antibodies. However, because of the fastidious nature of the organism and problems inherent in specimen collection, culture of clinical specimens may have a sensitivity as low as 10%[11]. Moreover, several non‐pneumophila Legionella spp. tend to grow poorly on BCYE agar [13]. Nucleic acid amplification techniques are attractive tools for detection of Legionella spp. in clinical samples, as they are able to detect all legionellae and provide results rapidly. Several studies have found that PCR methods have a higher rate of detection than culture‐based methods [14, 15, 16]. In the present study, the assay sensitivity was 10 fg for all Legionella spp., equivalent to two bacterial cells/reaction.
Throat swabs have been used successfully to detect respiratory pathogens such as Mycoplasma pneumoniae[17], Chlamydia pneumonia[17, 18] and Legionella spp. [16, 17] by PCR. In contrast to a previous report based on serological observations [4], Legionella spp. were not detected in the nose or throat of patients with ARIs in general practice, and no evidence was found for asymptomatic carriage of Legionella spp. in the upper respiratory tract.
Acknowledgements
Phocine herpes virus was kindly provided by H. Niesters, Erasmus Medical Center, Rotterdam, The Netherlands.
References
- 1. Fields BS, Benson RF, Besser RE. Legionella and Legionnaires' disease: 25 years of investigation. Clin Microbiol Rev 2002; 15: 506–526.DOI: 10.1128/CMR.15.3.506-526.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Boshuizen HC, Neppelenbroek SE, Van Vliet H et al. Subclinical Legionella infection in workers near the source of a large outbreak of Legionnaires' disease. J Infect Dis 2000; 184: 515–518. [DOI] [PubMed] [Google Scholar]
- 3. Lieberman D, Shvartzman P, Lieberman D et al. Etiology of respiratory tract infection in adults in a general practice setting. Eur J Clin Microbiol Infect Dis 1998; 17: 685–689.DOI: 10.1007/s100960050161 [DOI] [PubMed] [Google Scholar]
- 4. Lieberman D, Lieberman D, Korsonsky I, Ben‐Yaakov M, Lazarovich Z, Boldur I. Legionella species infection in adult febrile respiratory tract infections in the community. Scand J Infect Dis 2002; 34: 1–4.DOI: 10.1080/00365540110076831 [DOI] [PubMed] [Google Scholar]
- 5. Den Boer JW, Friesema IH, Hooi JD. Reported cases of Legionella pneumonia in the Netherlands, 1987–2000. Ned Tijdschr Geneeskd 2002; 146: 315–320. [PubMed] [Google Scholar]
- 6. Heijnen MLA, Dorigo‐Zetsma JW, Bartelds AM, Wilbrink B, Sprenger MJW. Surveillance of respiratory pathogens and influenza‐like illnesses in general practices—The Netherlands, winter 1997/98. Eurosurveillance 1999; 4: 81–84. [DOI] [PubMed] [Google Scholar]
- 7. Van Der Zee A, Verbakel H, De Jong C et al. Novel PCR‐probe assay for detection of and discrimination between Legionella pneumophila and other Legionella species in clinical samples. J Clin Microbiol 2002; 40: 1124–1125.DOI: 10.1128/JCM.40.3.1124-1127.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Van Den Hoogen BG, De Jong JC, Groen J et al. A newly discovered human pneumovirus isolated from young children with respiratory tract disease. Nat Med 2001; 7: 719–724.DOI: 10.1038/89098 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Diederen BMW, De Jong CMA, Aarts I, Peeters MF, Van Der Zee A. Molecular evidence for the ubiquitous presence of Legionella species in Dutch potable water systems [abstract N‐149] In: Abstracts of the 104th General Meeting of the American Society for Microbiology. Washington, DC: American Society for Microbiology, 2004;. 423. [Google Scholar]
- 10. O'Mahony MC, Stanwell‐Smith RE, Tillett HE et al. The Stafford outbreak of Legionnaires' disease. Epidemiol Infect 1990; 104: 361–380. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Murdoch R. Diagnosis of Legionella infection. Clin Infect Dis 2003; 36: 64–69.DOI: 10.1086/345529 [DOI] [PubMed] [Google Scholar]
- 12. Harrison TG, Taylor AG. A laboratory manual for Legionella, 1st edn Chichester: Wiley, 1988. [Google Scholar]
- 13. Lee TC, Vickers RM, Yu VL, Wagener MM. Growth of 28 Legionella species on selective culture media: a comparative study. J Clin Microbiol 1993; 31: 2764–2768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Hayden RT, Uhl JR, Qian X et al. Direct detection of Legionella species from bronchoalveolar lavage and open lung biopsy specimens: comparison of LightCycler PCR, in situ hybridization, direct fluorescence antigen detection, and culture. J Clin Microbiol 2001; 39: 2618–2626.DOI: 10.1128/JCM.39.7.2618-2626.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Koide M, Saito A. Diagnosis of Legionella pneumophila infection by polymerase chain reaction. Clin Infect Dis 1995; 21: 199–201. [DOI] [PubMed] [Google Scholar]
- 16. Templeton KE, Scheltinga SA, Sillekens P et al. Development and clinical evaluation of an internally controlled, single‐tube multiplex real‐time PCR assay for detection of Legionella pneumophila and other Legionella species. J Clin Microbiol 2003; 41: 4016–4021.DOI: 10.1128/JCM.41.9.4016-4021.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Ramirez JA, Ahkee S, Tolentino A, Miller RD, Summersgill JT. Diagnosis of Legionella pneumophila, Mycoplasma pneumoniae, or Chlamydia pneumoniae lower respiratory infection using the polymerase chain reaction on a single throat swab specimen. Diagn Microbiol Infect Dis 1996; 24: 7–14.DOI: 10.1016/0732-8893(95)00254-5 [DOI] [PubMed] [Google Scholar]
- 18. Gaydos CA, Quinn TC, Eiden JJ. Identification of Chlamydia pneumoniae by DNA amplification of the 16S rRNA gene. J Clin Microbiol 1992; 30: 796–800. [DOI] [PMC free article] [PubMed] [Google Scholar]