Skip to main content
PMC home page
Elsevier - PMC COVID-19 Collection logoLink to Elsevier - PMC COVID-19 Collection
. 2005 Oct 21;214(2):437–453. doi: 10.1016/0022-2836(90)90192-O

Conformation of an RNA pseudoknot

Joseph D Puglisi 1,†, Jacqueline R Wyatt 1, Ignacio Tinoco Jr 1,‡
PMCID: PMC7131512  PMID: 1696318

Abstract

The structure of the 5′ GCGAUUUCUGACCGCUUUUUUGUCAG 3′ RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3′-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

Keywords: TYMV, turnip yellow mosaic virus; n.m.r., nuclear magnetic resonance; NOE, nuclear Overhauser enhancement; NOESY, 2-dimensional nuclear Overhauser effect spectroscopy; s.w., sweep width; COSY, 2-dimensional correlated spectroscopy; DQF, double-quantum filtered; p.p.m., parts per million; DEP, diethylpyrocarbonate

Footnotes

This work was supported in part by National Institutes of Health grant GM10840 and the Department of Energy, Office of Energy Research, Office of Health and Environmental Research under grant DE-FG03-86ER60406.

References

  1. Akins R.A., Lambowitz A.M. Cell. 1987;50:331–345. doi: 10.1016/0092-8674(87)90488-0. [DOI] [PubMed] [Google Scholar]
  2. Altona C. Recl. Trav. Chim. Pays-Bas. 1982;101:413–434. [Google Scholar]
  3. Arnott S., Hukins D.W.L., Dover S.D., Fuller W., Hodgson A.R. J. Mol. Biol. 1973;81:107–122. doi: 10.1016/0022-2836(73)90183-6. [DOI] [PubMed] [Google Scholar]
  4. Auron P.E., Weber L.D., Rich A. Biochemistry. 1982;21:4700–4706. doi: 10.1021/bi00262a028. [DOI] [PubMed] [Google Scholar]
  5. Bax A., Lerner L. J. Magn. Reson. 1988;79:429–438. [Google Scholar]
  6. Benevides J.M., Lemeur D., Thomas G.J., Jr Biopolymers. 1984;23:1011–1024. doi: 10.1002/bip.360230604. [DOI] [PubMed] [Google Scholar]
  7. Bodenhausen G., Kogler H., Ernst R.R. J. Magn. Reson. 1984:370–388. doi: 10.1016/j.jmr.2011.08.033. [DOI] [PubMed] [Google Scholar]
  8. Braunschweiler L., Bodenhausen G., Ernst R.R. Mol. Phys. 1983;48:535–560. [Google Scholar]
  9. Brierley I., Digard P., Inglis S.C. Cell. 1989;57:537–547. doi: 10.1016/0092-8674(89)90124-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Brush C.K., Stone M.P., Harris T.M. Biochemistry. 1988;27:115–122. doi: 10.1021/bi00401a019. [DOI] [PubMed] [Google Scholar]
  11. Chazin W.J., Wu¨thrich K., Hyberts S., Rance M., Denny W.A., Leupin W. J. Mol. Biol. 1986;190:439–453. doi: 10.1016/0022-2836(86)90014-8. [DOI] [PubMed] [Google Scholar]
  12. Chou S.-H., Flynn P., Reid B. Biochemistry. 1989;28:2422–2435. doi: 10.1021/bi00432a013. [DOI] [PubMed] [Google Scholar]
  13. Clore G.M., Gronenborn A.M., Piper E.A., McLaughlin L.W., Graeser E., van Boom J.H. Biochem. J. 1984;221:737–751. doi: 10.1042/bj2210737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Davenloo P., Rosenberg A.H., Dunn J.J., Sudier F.W. Vol. 81. 1984. pp. 2035–2039. (Proc. Nat. Acad. Sci., U.S.A.). [Google Scholar]
  15. Davies R.W., Waring R.B., Ray J.A., Brown T.A., Scazzocchio C. Nature (London) 1982;300:719–724. doi: 10.1038/300719a0. [DOI] [PubMed] [Google Scholar]
  16. Davis P.W., Adamiak R.W., Tinoco I., Jr Biopolymers. 1990;29:109–122. doi: 10.1002/bip.360290116. [DOI] [PubMed] [Google Scholar]
  17. Delahodde A., Goguel V., Becam A.M., Creusot F., Perea J., Banroques J., Jacq C. Cell. 1989;56:431–441. doi: 10.1016/0092-8674(89)90246-8. [DOI] [PubMed] [Google Scholar]
  18. Dreher T.W., Hall T.C. J. Mol. Biol. 1988;201:31–40. doi: 10.1016/0022-2836(88)90436-6. [DOI] [PubMed] [Google Scholar]
  19. Dreher T.W., Hall T.C. J. Mol. Biol. 1988;201:41–55. doi: 10.1016/0022-2836(88)90437-8. [DOI] [PubMed] [Google Scholar]
  20. Dumas P., Moras D., Florentz C., Giege´ R., Verlaan P., van Belkum A., Pleij C.W.A. J. Biomol. Struct. Dynam. 1987;4:707–728. doi: 10.1080/07391102.1987.10507674. [DOI] [PubMed] [Google Scholar]
  21. Florentz C., Giege´ R. J. Mol. Biol. 1986;191:117–130. doi: 10.1016/0022-2836(86)90427-4. [DOI] [PubMed] [Google Scholar]
  22. Florentz C., Briand J.P., Romby P., Hirth L., Ebel J.P., Giege´ R. EMBO J. 1982;1:269–276. doi: 10.1002/j.1460-2075.1982.tb01158.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Gewirth D.T., Moore P.B. Nucl. Acids Res. 1988;16:10717–10732. doi: 10.1093/nar/16.22.10717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gorenstein D.G. Annu. Rev. Biophys. Bioeng. 1981;10:355–386. doi: 10.1146/annurev.bb.10.060181.002035. [DOI] [PubMed] [Google Scholar]
  25. Guerrier-Takada C., van Belkum A., Pleij C.W.A., Altman S. Cell. 1988;53:267–272. doi: 10.1016/0092-8674(88)90388-1. [DOI] [PubMed] [Google Scholar]
  26. Haasnoot C.A.G., Westerink H.P., van der Marel G.A., van Boom J.H. J. Biomol. Struct. Dynam. 1984;2:345–360. doi: 10.1080/07391102.1984.10507572. [DOI] [PubMed] [Google Scholar]
  27. Haenni A.-L., Joshi S., Chapeville F. Prog. Nucl. Acids Res. Mol. Biol. 1982;27:85–104. doi: 10.1016/s0079-6603(08)60598-x. [DOI] [PubMed] [Google Scholar]
  28. Hall K.B., Sampson J.R., Uhlenbeck O.C., Redfield A.G. Biochemistry. 1989;28:5794–5801. doi: 10.1021/bi00440a014. [DOI] [PubMed] [Google Scholar]
  29. Happ C.S., Happ E., Nilges M., Gronenborn A.M., Clore G.M. Biochemistry. 1988;27:1735–1743. doi: 10.1021/bi00405a053. [DOI] [PubMed] [Google Scholar]
  30. Hare D.R., Wemmer D.E., Chou S.-H., Drobny G., Reid B.R. J. Mol. Biol. 1983;171:319–336. doi: 10.1016/0022-2836(83)90096-7. [DOI] [PubMed] [Google Scholar]
  31. Hayatsu H., Wataya Y., Kai K., Iida S. Biochemistry. 1970;9:2858–2865. doi: 10.1021/bi00816a016. [DOI] [PubMed] [Google Scholar]
  32. Heerschap A. Catholic University of Nijmegen; 1985. (Ph.D. thesis). [Google Scholar]
  33. Hore P.J. J. Magn. Reson. 1983;55:283–300. [Google Scholar]
  34. James B.D., Olsen G.J., Liu J., Pace N.R. Cell. 1988;52:19–26. doi: 10.1016/0092-8674(88)90527-2. [DOI] [PubMed] [Google Scholar]
  35. Joshi R.L., Joshi S., Chapeville F., Haenni A.L. EMBO J. 1983;2:1123–1127. doi: 10.1002/j.1460-2075.1983.tb01556.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Keepers J.W., James T.L. J. Magn. Reson. 1984;57:404–426. [Google Scholar]
  37. Kuchino Y., Watanabe S., Harada F., Nishimura S. Biochemistry. 1980;19:2085–2089. doi: 10.1021/bi00551a013. [DOI] [PubMed] [Google Scholar]
  38. Leontis N.B., Moore P.B. Biochemistry. 1986;25:3916–3925. doi: 10.1021/bi00361a027. [DOI] [PubMed] [Google Scholar]
  39. McPheeters D.S., Stormo G.D., Gold L. J. Mol. Biol. 1988;201:517–535. doi: 10.1016/0022-2836(88)90634-1. [DOI] [PubMed] [Google Scholar]
  40. Milligan J.F., Groebe D.R., Witherell G.W., Uhlenbeck O.C. Nucl. Acids Res. 1987;15:8783–8798. doi: 10.1093/nar/15.21.8783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Moazed D., Noller H.F. Nature (London) 1987;327:389–394. doi: 10.1038/327389a0. [DOI] [PubMed] [Google Scholar]
  42. Nishimura S., Harada F., Narushima U., Seno T. Biochim. Biophys. Acta. 1967;142:133–148. doi: 10.1016/0005-2787(67)90522-9. [DOI] [PubMed] [Google Scholar]
  43. Olson W.K. J. Amer. Chem. Soc. 1982;104:278–286. [Google Scholar]
  44. Olson W.K., Sussman J.L. J. Amer. Chem. Soc. 1982;104:270–278. [Google Scholar]
  45. Peattie D.A., Gilbert W. Vol. 77. 1980. pp. 4679–4682. (Proc. Nat. Acad. Sci., U.S.A.). [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Piantini U., Sørensen O.W., Ernst R.R. J. Amer. Chem. Soc. 1982;104:6800–6801. [Google Scholar]
  47. Pleij C.W.A., Rietveld K., Bosch L. Nucl. Acids Res. 1985;13:1717–1731. doi: 10.1093/nar/13.5.1717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Pleij C.W.A., van Belkum A., Rietveld K., Bosch L. In: Structure and Dynamics of RNA. Knippenberg P.H., Hilbers C.W., editors. Plenum Press; New York: 1986. pp. 87–98. [Google Scholar]
  49. Puglisi J.D., Wyatt J.R., Tinoco I., Jr Nature (London) 1988;331:283–286. doi: 10.1038/331283a0. [DOI] [PubMed] [Google Scholar]
  50. Puglisi J.D., Wyatt J.R., Tinoco I., Jr Biochemistry. 1990;29:4215–4226. doi: 10.1021/bi00469a026. [DOI] [PubMed] [Google Scholar]
  51. Reid B.R. Annu. Rev. Biochem. 1981;50:969–996. doi: 10.1146/annurev.bi.50.070181.004541. [DOI] [PubMed] [Google Scholar]
  52. Rietveld K., van Poelgeest R., Pleij C.W.A., van Boom J.H., Bosch L. Nucl. Acids Res. 1982;10:1929–1946. doi: 10.1093/nar/10.6.1929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Rietveld K., Pleij C.W.A., Bosch L. EMBO J. 1983;2:1079–1085. doi: 10.1002/j.1460-2075.1983.tb01549.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Rietveld K., Linschooten K., Pleij C.W.A., Bosch L. EMBO J. 1984;3:2613–2619. doi: 10.1002/j.1460-2075.1984.tb02182.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Saenger W. Springer-Verlag; New York: 1984. (Principles of Nucleic Acid Structure). [Google Scholar]
  56. Sampson J.R., Uhlenbeck O.C. Vol. 85. 1988. pp. 1033–1037. (Proc. Nat. Acad. Sci., U.S.A.). [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Schimmel P. Cell. 1989;58:9–12. doi: 10.1016/0092-8674(89)90395-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Studnicka G.M., Rahn G.M., Cummings I.W., Salser W.A. Nucl. Acids Res. 1978;5:3365–3387. doi: 10.1093/nar/5.9.3365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Tang C.K., Draper D.E. Cell. 1989;57:531–536. doi: 10.1016/0092-8674(89)90123-2. [DOI] [PubMed] [Google Scholar]
  60. van Belkum A., Verlaan P., Kun J.B., Pleij C., Bosch L. Nucl. Acids Res. 1988;16:1931–1950. doi: 10.1093/nar/16.5.1931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. van Belkum A., Wiersema P.J., Joordens J., Pleij C., Hilbers C.W., Bosch L. Eur. J. Biochem. 1989;183:591–601. doi: 10.1111/j.1432-1033.1989.tb21088.x. [DOI] [PubMed] [Google Scholar]
  62. van den Hoogen F. University of Leiden; 1988. (Ph.D Thesis). [Google Scholar]
  63. Varani G., Wimberly B., Tinoco I., Jr Biochemistry. 1989;28:7760–7772. doi: 10.1021/bi00445a036. [DOI] [PubMed] [Google Scholar]
  64. Wataya Y., Hayatsu H. Biochemistry. 1972;11:3583–3588. doi: 10.1021/bi00769a014. [DOI] [PubMed] [Google Scholar]
  65. Weiner A.M., Maizels N. Vol. 84. 1987. pp. 7383–7387. (Proc. Nat. Acad. Sci., U.S.A.). [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Widmer H., Wu¨thrich K. J. Magn. Reson. 1987;74:316–336. [Google Scholar]
  67. Wu¨thrich K. John Wiley and Sons; New York: 1986. (NMR of Proteins and Nucleic Acids). [Google Scholar]
  68. Wyatt J.R., Puglisi J.D., Tinoco I., Jr J. Mol. Biol. 1990;214:455–470. doi: 10.1016/0022-2836(90)90193-P. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Molecular Biology are provided here courtesy of Elsevier

RESOURCES