Abstract
Bacillus velezensis FZB42 is a Gram-positive, endospore-forming rhizobacterium that is associated with plant roots and promotes plant growth. It was used as host to isolate phage vB_BveM-Goe7 (Goe7). Goe7 exhibits a Myoviridae morphology with a contractile tail and an icosahedral head. Its genome is 158,674 bp in size and contains 5137-bp-long terminal repeats (LTRs). It also contains five tRNA-encoding genes and 251 coding DNA sequences (CDS), of which 65 were annotated. The adsorption constant of Goe7 is 6.1 ± 0.24 × 10−8 ml/min, with a latency period of 75 min and a burst size of 114 particles per burst. A BLASTn sequence comparison against the non-redundant nucleotide database of NCBI revealed that Goe7 is most similar to Bacillus subtilis phage vB_BsuM-Goe3.
Electronic supplementary material
The online version of this article (10.1007/s00705-020-04546-1) contains supplementary material, which is available to authorized users.
Bacillus velezensis FZB42 is a rod-shaped aerobic soil bacterium [1]. This member of the B. subtilis species complex [2] was originally proposed as the type strain of Bacillus amyloliquefaciens subsp. plantarum before it was recognized as B. velezensis [3]. Many strains of this group are root-associated and are able to promote plant growth [4]. We used strain FZB42 as host for the isolation of phage vB_BveM-Goe7 (Goe7) from the Göttingen municipal sewage plant (Göttingen, Germany, 51° 33′ 15.4′′ N 9°55′06.4′′ E). For this, an overlay plaque assay was used. Goe7 could be isolated as a clear plaque in the bacterial layer, indicating a lytic life style. The morphology of Goe7 was determined via electron microscopy, using a Jeol 1101 electron microscope (Eching, Munich, Germany) as described previously [5]. TEM micrographs revealed a Caudovirales-related head-tail morphology (Fig. 1) and a Myoviridae-like contractile tail (Fig. 1A) [6]. A double baseplate upon tail contraction (Fig. 1A) indicates a morphological relatedness to the SPO1-like phages [7]. The icosahedral head is 88.2 nm ± 4 nm in diameter and the tail is 216 nm ± 10.4 nm long and 16.4 nm ± 1.9 nm wide.
Fig. 1.
vB_BveM-Goe7 micrographs. (A) Goe7 with contracted tail sheath. The baseplate reveals a double stack structure. (B) Complete infectious Goe7 particle
Genome sequencing and quality assessment of the obtained sequence reads were done as described previously [5]. Initial assembly was performed with SPAdes version 3.10.1 [8]. The ends of the long terminal repeats (LTR) were resolved via Sanger sequencing as described for phage vB_BsuM-Goe2 (Goe2) and VB_BsuM-Goe3 (Goe3) [9] using the primers Goe3_P4 (5’GCGGTATGTCTGAATAAGGG) and PP004 (5’GCACATGACAGGGATTCAAC).
The genome of Goe7 consists of a linear, double-stranded DNA chromosome with a size of 158,674 bp and a GC-content of 41.84%. Automatic annotation using the Prokka pipeline [10] identified five tRNA-encoding genes and 251 coding DNA sequence (CDS). A domain search using InterProScan [11] (Supplemental Table S1) was used to improve the initial annotation of Prokka and led to the annotation of 65 protein coding genes (Supplemental Table S2). About three quarters of the protein genes remained hypothetical, indicating hitherto unknown genes and functions.
BLASTn comparison of Goe7 with the non-redundant nucleotide database of NCBI revealed the highest similarity to Bacillus phage vB_BsuM-Goe3 [9]. It showed 96% query coverage with 98.92% identity. Further related phages with a query coverage of >20% were Bacillus phage BSP38 (MH606185.1) [12], SBSphiJ (LT960608.1), Grass (KF669652.1) [13] and phiNIT1 (AP013029.1), all of which are members of the lytic group of SPO1-related phages [7]. Average nucleotide identity (ANI) values [14] were calculated using the average_nucleotide_identity.py (https://github.com/widdowquinn/pyani) script with the ANIm option employing MUMer3 [15]. The genome sequence of Goe7 was compared with those of members of the phage family Herelleviridae, which infect members of the genus Bacillus [16]. The results revealed Goe7 to be a unique isolate, with 98.18% overall genome sequence identity to B. subtilis phage Goe3, indicating that it belongs to the same species (Fig. 2 and Supplemental Table S3). ANIm alignment lengths (Supplemental Table S4) perfectly reassembled all genera of the subfamilies Bastillevirinae and Spounavirinae as proposed by Barylski et al. [16]. In this context it becomes evident that Goe7 and Goe3 form a separate genus. This new genus fits into the subfamily Bastillevirinae, as Goe7 shows similarities to members of the genera Agatevirus (Bobb 86.7% and Bp8p 87.1%) and Nitunavirus (Grass 84.1%, SPG24 83.7%, phiNIT1 83.1%) (Supplemental Table S3).
Fig. 2.
Average nucleotide identity and alignment length analysis of Goe7. Genera as described by Barylski et al. [16] were used for this investigation and are indicated with shaded gray bars (1 = Bequatrovirus, 2 = Bastillevirus, 3 = Caeruleovirus, 4 = Wphvirus, 5 = Nitunavirus, 6= Siminovitchvirus, 8 = Agatevirus, 9 = Tsarbombavirus, 10 = Okubovirus, 11 = recently unassigned strains). The average nucleotide identity values were calculated with the ANIm option. Percentage identity values are visualized on the left. A reddish color indicates the same species with an ANI value >95%. White indicates an ANI value of ~95% and the species boundary. A bluish color indicates an ANI value of 70–95% and a high degree of relatedness. Alignment lengths are visualized on the right. The brighter the color from black over red and yellow to white, the longer is the related alignment. Goe7 is of the same species as Goe3 due to 98% genome identity (left). Both strains form a new genus (7), as indicated by the alignment length of the ANIm analysis (right)
The adsorption constant of Goe7 is 6.1 × 0.24−8 ml/min and was determined as described by A. M. Kropinski [17]. A latency period of 75 min and a burst size of 114 particles per burst were observed in a one-step growth experiment carried out as described by Hyman and Abedon [18] in a 250-ml conical flask with 25 ml of LB with vigorous shaking at 30 °C (see Table S5). Goe3, which infects B. subtilis, a close relative of B. velezensis, differs from Goe7 in its effect on its host [9]. Although Goe7 has an identical burst size (114 particles per burst), it adsorbs more efficiently to its host than Goe3 (adsorption constant, 8 × 10−11 ml/min) and requires more time for replication than Goe3 latency period (55 min).
The final genome sequence of Goe7 is publicly available in the GenBank database with the accession number MN043730. Biological samples of vB_BveM-Goe7 with the sample number DSM109177 are available in the German Collection of Microorganisms and Cell Cultures (DSMZ).
Electronic supplementary material
Below is the link to the electronic supplementary material.
Acknowledgements
Open Access funding provided by Projekt DEAL. We would like to thank Professor Dr. Rolf Daniel for scientific advice and guidance, and Dr. Anja Poehlein for sequencing. We thank Birthe Nordmann and Tobias Schilling for their help in the lab, and Avril von Hoyningen-Huene for proofreading the manuscript. This project was funded by the Volkswagen Foundation (Re. 94045).
Compliance with ethical standards
Conflict of interest
The authors have no conflict of interest to declare.
Ethical approval
This article does not contain any studies with human participants or animals performed by any of the authors.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Chen XH, Koumoutsi A, Scholz R, Eisenreich A, Schneider K, Heinemeyer I, Morgenstern B, Voss B, Hess WR, Reva O, et al. Comparative analysis of the complete genome sequence of the plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42. Nat. Biotechnol. 2007;25:1007–1014. doi: 10.1038/nbt1325. [DOI] [PubMed] [Google Scholar]
- 2.Fan B, Blom J, Klenk HP, Borriss R. Bacillus amyloliquefaciens, Bacillus velezensis, and Bacillus siamensis form an “Operational Group B. amyloliquefaciens” within the B. subtilis species complex. Front Microbiol. 2017;8:1–15. doi: 10.3389/fmicb.2017.00022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Dunlap CA, Kim S-J, Kwon S-W, Rooney AP. Bacillus velezensis is not a later heterotypic synonym of Bacillus amyloliquefaciens; Bacillus methylotrophicus, Bacillus amyloliquefaciens subsp. plantarum and ‘Bacillus oryzicola’ are later heterotypic synonyms of Bacillus velezensis based on phylogenom. Int J Syst Evol Microbiol. 2016;66:1212–1217. doi: 10.1099/ijsem.0.000858. [DOI] [PubMed] [Google Scholar]
- 4.Fan B, Wang C, Song X, Ding X, Wu L, Wu H, Gao X, Borriss R. Bacillus velezensis FZB42 in 2018: the gram-positive model strain for plant growth promotion and biocontrol. Front Microbiol. 2018;9:1–14. doi: 10.3389/fmicb.2018.00001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Nordmann B, Schilling T, Hoppert M, Hertel R. Complete genome sequence of the virus isolate vB_BthM-Goe5 infecting Bacillus thuringiensis. Arch Virol. 2019;164:1485–1488. doi: 10.1007/s00705-019-04187-z. [DOI] [PubMed] [Google Scholar]
- 6.Ackermann H-W, Prangishvili D. Prokaryote viruses studied by electron microscopy. Arch Virol. 2012;157:1843–1849. doi: 10.1007/s00705-012-1383-y. [DOI] [PubMed] [Google Scholar]
- 7.Klumpp J, Lavigne R, Loessner MJ, Ackermann HW. The SPO1-related bacteriophages. Arch Virol. 2010;155:1547–1561. doi: 10.1007/s00705-010-0783-0. [DOI] [PubMed] [Google Scholar]
- 8.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–477. doi: 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Willms IM, Hoppert M, Hertel R. Characterization of Bacillus subtilis Viruses vB_BsuM-Goe2 and vB_BsuM-Goe3. Viruses. 2017;9:146. doi: 10.3390/v9060146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30:2068–2069. doi: 10.1093/bioinformatics/btu153. [DOI] [PubMed] [Google Scholar]
- 11.Jones P, Binns D, Chang H-Y, Fraser M, Li W, McAnulla C, McWilliam H, Maslen J, Mitchell A, Nuka G, et al. InterProScan 5: genome-scale protein function classification. Bioinformatics. 2014;30:1236–1240. doi: 10.1093/bioinformatics/btu031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ghosh K, Kim K-P. Complete nucleotide sequence analysis of a novel Bacillus subtilis-infecting phage, BSP38, possibly belonging to a new genus in the subfamily Spounavirinae. Arch Virol. 2019;164:875–878. doi: 10.1007/s00705-018-4110-5. [DOI] [PubMed] [Google Scholar]
- 13.Miller SY, Colquhoun JM, Perl AL, Chamakura KR, Kuty Everett GF. Complete genome of Bacillus subtilis myophage grass. Genome Announc. 2013;1:30257. doi: 10.1128/genomeA.00857-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Richter M, Rosselló-Móra R. Shifting the genomic gold standard for the prokaryotic species definition. Proc Natl Acad Sci. 2009;106:19126–19131. doi: 10.1073/pnas.0906412106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, Salzberg SL. Versatile and open software for comparing large genomes. Genome Biol. 2004;5:R12. doi: 10.1186/gb-2004-5-2-r12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Barylski J, Enault F, Dutilh BE, Schuller MB, Edwards RA, Gillis A, Klumpp J, Knezevic P, Krupovic M, Kuhn JH, et al. Analysis of spounaviruses as a case study for the overdue reclassification of tailed phages. Syst Biol. 2020;69(1):110–123. doi: 10.1093/sysbio/syz036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kropinski AM. Measurement of the rate of attachment of bacteriophage to cells. Methods Mol Biol. 2009;501:151–155. doi: 10.1007/978-1-60327-164-6_15. [DOI] [PubMed] [Google Scholar]
- 18.Hyman P, Abedon ST. Practical methods for determining phage growth parameters. Methods Mol Biol. 2009;501:175–202. doi: 10.1007/978-1-60327-164-6_18. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.


