Abstract
Growth traits, largely determined by muscle growth, are the most critical economic traits in shrimp breeding. Myostatin (Mstn) is a conserved inhibitor of muscle growth in vertebrates, but until now solid evidence supporting a similar function of Mstn in invertebrates has been lacking. In the present study, we examined the Mstn expression along with growth trait data in a Fenneropenaeus chinensis population, to establish a potential correlation between Mstn and growth. The heritabilities of FcMstn expression, body weight at 190 days of culture, body weight and length at 230 days of culture, and average daily gain were estimated using 773 individuals and a thirteen-generation pedigree. The results showed FcMstn expression was negatively correlated with the growth traits, and the mean FcMstn expression in females was significantly lower than that of males, indicating Mstn negatively regulates muscle growth in shrimp, and its lower expression may underscore the faster growth of females. Low heritabilities were detected for FcMstn expression, suggesting that the expression of Mstn might be heritable in shrimp. These results provide strong support for a growth inhibitory function of Mstn in F. chinensis, and suggest a potential method for selective breeding of this species without substantial experimental resources and labor force.
Subject terms: Animal breeding, Gene expression, Heritable quantitative trait, Quantitative trait
Introduction
Shrimp is an important aquaculture species with high single output values, which takes a great role in the economic development of the world. To improve the production has always been the important goal in shrimp farming. Faster growth is essential for increasing production, which could make for more economic benefits and sustainable development for shrimp breeding. Selective breeding is an important propelling force for the development of efficient and sustainable production1. In the beginning, mass selection was the most commonly used method for selection breeding in aquaculture, because it was easy to manipulate2. Afterwards, family-based selection became the alternative methods in aquatic species due to its effect for all types of traits3. The family-based selective breeding programs have improved the target traits a lot and made great contributions to the development of shrimp industry4–6. However, there were still some difficulties in family-based selective breeding, such as the high investment and operational costs7, and long and complex test periods. Therefore, new methods and technologies are urgently required for accelerating the genetic improvement of important traits in shrimp.
Along with the development of molecular biology technology, marker assisted selection (MAS) and genome-wide selection (GWS) were suggested as effective methods for selecting for target traits8,9. However, the markers used for MAS need to be closely linkaged with the larger effective quantitative trait locus (QTL) of the target trait, and GWS needs large number of markers to be genotyped in large scale samples. Although the costs of MAS and GWS technologies are gradually decreasing as new breakthroughs in methodology, they are still unacceptable and unsustainable for shrimp selection programs. Consequently, we need a quick and cheap method for selective breeding.
Robinson et al.10 suggested to use the gene expression profiles with larger sample sizes as an indirect parameter for the target traits as an alternative method for selective breeding. Oleksiak et al.11 observed statistically significant differences in gene expression within and among populations in fish, and Robinson and Hayes12 have modeled the use of gene expression as an alternative method for improving disease resistance in selective breeding of fish. Gene expression has been studied as heritable and quantitative traits in genetic studies, and quantitative geneticists have long been interested in the heritability of the gene expression13. To dissect such traits, a fundamental question is what proportion of the variation of the gene expression among individuals in a population can be attributed to genetic factors, but rather than environmental and random differences14. In the previous studies, a significant heritable component of gene expression has been found in yeast15, mice16, flies17, fish18 and human19. However, because of experimental shortfalls most of these studies did not provide a direct estimate of heritability, mainly due to the small sample scales and lower genetic tie among individuals.
Chinese shrimp, Fenneropenaeus chinensis, is one of the most valuable maricultural species. Our group has initiated a selective breeding program for F. chinensis in 2004 using the family-based selection method to increase production6. Until now, the selection for F. chinensis is still in progress and the population has been selected for thirteen generations. The deep pedigree enables a high level of genetic tie among the families and individuals. Consequently, this shrimp population provided ideal materials for heritability estimate of gene expression.
Muscle tissue as the main edible part accounted for the majority mass of shrimp tissue, which plays a decisive role in shrimp growth. Myostatin (Mstn) is predominantly expressed in the muscle tissues and essentially inhibits muscle growth in vertebrates. For example, there was a dramatic increase in the skeletal muscle mass after knocking out Mstn in mouse20, and the muscle size of the cattle with function loss of Mstn would increase 20% compared to the normal cows21. In addition, “double-muscled” phenotype was observed in sheep and cattle with mutation in Mstn22–25. Because Mstn affected muscle mass and the increased musculature would transform into higher production, it also attracted much research interest on its function in invertebrates, among which including shrimp, such as Penaeus monodon26, Litopenaeus vannamei27, F. merguiensis27–29 and F. chinensis (the data has not been published). Preliminary results suggest that Mstn also involved in muscle growth in shrimp. However, until now solid evidence supporting a similar function of Mstn has been lacking in invertebrates.
The main objectives of the present study were to establish a potential correlation between Mstn and muscle growth with large scale sample in shrimp. We are also very curious to know whether the expression of Mstn was heritable, how heritable is Mstn, and how is variation of Mstn expression within the population of shrimp. Consequently, we examined the expression of Mstn along with growth trait data in 773 individuals from 44 full-sib families of the population of F. chinensis. In order to investigate the potential use of the expression of Mstn as an indirect parameter for growth traits as an alternative method for selective breeding, the expression level of Mstn was treated as a quantitative trait and its heritability was estimated using a thirteen-generation deep pedigree. In addition, we estimated the heritabilities of body weight (BW1) at 190 days of culture (DOC), body weight (BW2) and body length (BL2) at 230 DOC, and average daily gain (ADG) for this population. The results would provide important information for use of Mstn in the breeding of shrimp.
Results
Descriptive statistics
Finally, a total of 773 individual records from 44 full-sib families, including 383 females and 390 males were analyzed in the present study. The number of observations, mean value, maximum and minimum, standard deviation and coefficient of variation for BW1, BW2 and BL2, ADG, and FcMstn expression at individual (all individuals, females, and males, respectively) and family (family mean with all individuals, females, and males, respectively) levels are shown in Table 1. The 25th percentiles, median percentiles, 75th percentiles, minima and maxima of the five traits at individual and family levels are displayed in Fig. 1. The results revealed the BW1, BW2, ADG, and FcMstn expression values both varied substantially among the individuals and families, but the BL2 has lower variance at the two levels. However, the variance was higher when analyzed at the individual level than the family level as indicated by the higher standard deviation (SD) and coefficient of variation (CV) for all the traits (Table 1). For the growth traits (BW1, BW2, BL2, and ADG), the means of females were significantly higher than those of males at both of individual and family levels (P < 0.001). However, for the FcMstn expression, the mean of females was significantly lower than that of males at the two levels (P < 0.001).
Table 1.
Numbers of samples/families (N) and the means, minima, maxima, standard deviations, and coefficients variation of the five traits.
| Traits | N | Minimum | Maximum | Mean | Standard deviation | Coefficient variation (%) | |
|---|---|---|---|---|---|---|---|
| Body Weight 1 (BW1, g) | All individuals | 773 | 6.20 | 29.40 | 18.33 | 4.03 | 22.00 |
| Female individuals | 383 | 6.30 | 29.40 | 20.09 | 4.33 | 21.55 | |
| Male individuals | 390 | 6.20 | 23.70 | 16.60 | 2.77 | 16.69 | |
| All families | 44 | 13.97 | 20.68 | 18.32 | 1.58 | 8.62 | |
| Female families | 44 | 13.10 | 24.52 | 20.11 | 2.78 | 13.82 | |
| Male families | 44 | 13.81 | 19.11 | 16.49 | 1.29 | 7.82 | |
| Body Weight 2 (BW2, g) | All individuals | 773 | 6.20 | 39.40 | 22.43 | 5.68 | 25.32 |
| Female individuals | 383 | 7.80 | 39.40 | 25.83 | 5.63 | 21.80 | |
| Male individuals | 390 | 6.20 | 35.70 | 19.09 | 3.23 | 16.92 | |
| All families | 44 | 17.07 | 25.44 | 22.41 | 1.89 | 8.43 | |
| Female families | 44 | 16.83 | 32.03 | 25.84 | 3.43 | 13.27 | |
| Male families | 44 | 15.76 | 21.63 | 18.96 | 1.40 | 7.38 | |
| Average daily gain (ADG, g) | All individuals | 773 | 0.00 | 0.41 | 0.14 | 0.08 | 57.14 |
| Female individuals | 383 | 0.00 | 0.41 | 0.19 | 0.07 | 36.84 | |
| Male individuals | 390 | 0.00 | 0.40 | 0.08 | 0.05 | 60.55 | |
| All families | 44 | 0.09 | 0.18 | 0.14 | 0.02 | 14.29 | |
| Female families | 44 | 0.12 | 0.26 | 0.19 | 0.03 | 15.79 | |
| Male families | 44 | 0.05 | 0.12 | 0.08 | 0.02 | 25.00 | |
| Body length2 (BL2, cm) | All individuals | 773 | 8.20 | 18.90 | 12.54 | 1.11 | 8.85 |
| Female individuals | 383 | 8.60 | 18.70 | 13.03 | 1.13 | 8.67 | |
| Male individuals | 390 | 8.20 | 18.90 | 12.06 | 0.85 | 7.05 | |
| All families | 44 | 11.34 | 13.22 | 12.54 | 0.39 | 3.11 | |
| Female families | 44 | 11.24 | 14.28 | 13.03 | 0.66 | 5.07 | |
| Male families | 44 | 11.46 | 12.92 | 12.05 | 0.32 | 2.66 | |
| FcMstn expression | All individuals | 773 | 0.00 | 6.46 | 3.17 | 1.09 | 34.50 |
| Female individuals | 383 | 0.00 | 5.83 | 2.99 | 1.04 | 34.76 | |
| Male individuals | 390 | 0.00 | 6.46 | 3.35 | 1.12 | 33.37 | |
| All families | 44 | 2.67 | 3.69 | 3.17 | 0.26 | 8.30 | |
| Female families | 44 | 2.17 | 3.80 | 2.97 | 0.38 | 12.82 | |
| Male families | 44 | 2.53 | 4.24 | 3.36 | 0.40 | 11.78 | |
Figure 1.
Violin plots of the body weight (BW1 and BW2) (a), average daily gain (ADG) (b), body length (BL2) (c), and the expression of FcMstn (d) at individual and family level.
Variance components and heritability estimations
Estimates of the variance component and heritability for BW1, BW2, ADG, BL2, and FcMstn expression at all-individual, female-individual, and male-individual levels are provided in Table 2. For BW1, BW2, and BL2, the females have the highest heritabilities, followed by all individuals, but the males have the lowest heritabilities. Excepting for BL2 in males, the heritability estimates of the five traits (BW1, BW2, BL2, ADG, and FcMstn expression) were all significantly different from zero at the three levels (P < 0.05). According to the classification reported by Cardellino and Rovira30 (i.e., low, 0.05–0.19; medium, 0.20–0.44; high, 0.45–0.64; and very high, >0.65), the FcMstn expression have low heritabilities (0.05 ± 0.03, 0.06 ± 0.06, and 0.08 ± 0.06, respectively) at all-individual, female-individual, and male-individual levels; the heritability estimates of BW1 (0.75 ± 0.14) and BW2 (0.66 ± 0.13) in females were very high; the heritability of BL2 (0.59 ± 0.13) in females was high; the heritability estimates of BW1 (0.35 ± 0.09), BW2 (0.34 ± 0.09), BL2 (0.22 ± 0.07), and ADG (0.22 ± 0.08) in all individuals, and BW1 (0.25 ± 0.09), BW2 (0.26 ± 0.10), and ADG (0.44 ± 0.11) in males were medium. The heritabilities of BW1 were not significantly different from those of BW2 at all the three levels (P > 0.05). The heritability estimates of BW1, BW2, and BL2 in females were significantly greater than those in all individuals and males (P < 0.05), but there was no significant difference between all individuals and males (P > 0.05). For the heritabilities of ADG and FcMstn expression, there was no significant difference among the three levels (P > 0.05). For the five traits, the females were positively correlated with males (P < 0.05).
Table 2.
Variance components and heritabilities of for the traits.
| Traits | Variance components | Heritability | Genetic correlation | |||
|---|---|---|---|---|---|---|
| ± SE | rg | |||||
| BW1 | All individuals | 4.86 | 8.86 | 13.72 | 0.35 ± 0.09*,b | |
| Female individuals | 15.88 | 5.23 | 21.11 | 0.75 ± 0.14*,a | 0.39 ± 0.02* | |
| Male individuals | 1.88 | 5.79 | 7.67 | 0.25 ± 0.09*,b | ||
| BW2 | All individuals | 7.50 | 14.54 | 22.04 | 0.34 ± 0.09*,b | |
| Female individuals | 22.84 | 11.94 | 34.81 | 0.66 ± 0.13*,a | 0.44 ± 0.02* | |
| Male individuals | 2.81 | 7.89 | 10.71 | 0.26 ± 0.10*,b | ||
| BL2 | All individuals | 0.23 | 0.80 | 1.02 | 0.22 ± 0.07*,b | |
| Female individuals | 0.81 | 0.57 | 1.38 | 0.59 ± 0.13*,a | 0.36 ± 0.05* | |
| Male individuals | 0.06 | 0.67 | 0.73 | 0.08 ± 0.07b | ||
| ADG | All individuals | 0.82E-03 | 0.29E-02 | 0.37E-02 | 0.22 ± 0.08* | |
| Female individuals | 0.90E-03 | 0.39E-02 | 0.48E-02 | 0.19 ± 0.09* | 0.71 ± 0.04* | |
| Male individuals | 0.12E-02 | 0.15E-02 | 0.27E-02 | 0.44 ± 0.11* | ||
| All individuals | 82.92 | 1646.52 | 1729.40 | 0.05 ± 0.03 | ||
| FcMstn expression | Female individuals | 79.68 | 1331.06 | 1410.70 | 0.06 ± 0.06 | 0.35 ± 0.05* |
| Male individuals | 157.74 | 1905.51 | 2063.20 | 0.08 ± 0.06 | ||
*Estimate is significantly different from zero (P < 0.05). a,bRepresents the significant differences among the all-individual, female-individual, and male-individual levels of the same trait. The variance component terms are as follows: is the additive genetic variance, is the random residual error variance, and is the phenotypic variance. rg, genetic correlation between female and male.
Genetic and phenotypic correlation analysis
The correlation analysis based on phenotypic and breeding values between traits at all-individual, female-individual, and male-individual levels are given in Table 3. Importantly, there were significant negative genetic correlations between FcMstn expression and other growth traits (BW1, BW2, BL2, and ADG) at the three levels, excepting for the non-significant negative genetic correlation with ADG in males. Especially, there were extremely significant genetic correlation between FcMstn expression and BW1 (−0.91), BW2 (−0.97), BL2 (−0.98), and ADG (−0.84) in females, and there were also significant genetic correlation between FcMstn expression and BW1 (−0.86), BW2 (−0.85), and BL2 (−0.64) in males. In generally, there are significantly positive correlations between the growth traits, and rg values were higher than rp values; females have the highest rg and rp values, followed in all individuals, but the males have the lowest correlation values, and almost all of the correlations were significantly different from zero (Table 3). BW2 is significantly correlated with BL2 (rg was 0.99, 1.00, and 0.91, respectively), BW1 (rg was 0.97, 1.00, and 0.81, respectively) and ADG (rg was 0.71, 0.94, and 0.63, respectively) in all individuals, females, and males. In addition, BW1 is significantly correlated with BL2 (rg was 0.98, 1.00, and 0.84, respectively) in all individuals, females, and males, and BL2 is also significantly correlated with ADG (rg was 0.76, 0.95, and 0.57, respectively) at the three levels.
Table 3.
Genetic and phenotypic correlation between the five traits for all, female, and male individuals.
| Traits | BW1 | BW2 | ADG | BL2 | FcMstn expression | |
|---|---|---|---|---|---|---|
| All individuals | BW1 | – | 0.94 ± 0.01* | 0.38 ± 0.04* | 0.83 ± 0.01* | −0.30 ± 0.03* |
| BW2 | 0.97 ± 0.02* | – | 0.68 ± 0.02* | 0.86 ± 0.01* | −0.32 ± 0.03* | |
| ADG | 0.52 ± 0.19* | 0.71 ± 0.12* | – | 0.55 ± 0.03* | −0.21 ± 0.04* | |
| BL2 | 0.98 ± 0.02* | 0.99 ± 0.01* | 0.76 ± 0.12* | – | −0.32 ± 0.03* | |
| FcMstn expression | −0.32 ± 0.09* | −0.38 ± 0.09* | −0.37 ± 0.04* | −0.29 ± 0.03* | – | |
| BW1 | BW2 | ADG | BL2 | FcMstn expression | ||
| Female individuals | BW1 | – | 0.95 ± 0.01* | 0.51 ± 0.04* | 0.87 ± 0.01* | −0.51 ± 0.04* |
| BW2 | 1.00 ± 0.01* | – | 0.75 ± 0.03* | 0.92 ± 0.05* | −0.54 ± 0.04* | |
| ADG | 0.91 ± 0.11* | 0.94 ± 0.07* | – | 0.67 ± 0.03* | −0.39 ± 0.04* | |
| BL2 | 1.00 ± 0.02* | 1.00 ± 0.03* | 0.95 ± 0.08* | – | −0.52 ± 0.04* | |
| FcMstn expression | −0.91 ± 0.11* | −0.97 ± 0.19* | −0.84 ± 0.13* | −0.98 ± 0.19* | – | |
| BW1 | BW2 | ADG | BL2 | FcMstn expression | ||
| Male individuals | BW1 | – | 0.89 ± 0.01* | 0.12 ± 0.06* | 0.71 ± 0.03* | −0.20 ± 0.05* |
| BW2 | 0.81 ± 0.09* | – | 0.55 ± 0.04* | 0.74 ± 0.02* | −0.22 ± 0.05* | |
| ADG | 0.05 ± 0.07 | 0.63 ± 0.16* | – | 0.32 ± 0.05* | −0.10 ± 0.05 | |
| BL2 | 0.84 ± 0.19* | 0.91 ± 0.12* | 0.57 ± 0.16* | – | −0.22 ± 0.05 | |
| FcMstn expression | −0.86 ± 0.17* | −0.85 ± 0.15* | −0.02 ± 0.05 | −0.64 ± 0.02* | – | |
*Estimate is highly significantly different from zero (P < 0.05). The phenotypic correlations are above the diagonal, and the genetic correlations are under the diagonal.
Discussion
Growth traits, largely determined by muscle growth, are the most concerned economic traits in the shrimp breeding31. Sexual dimorphism for growth of shrimp is very distinct; specifically, females tend to grow faster and bigger than males, such as in F. chinens6, L. vannamei4,32, and P. monodon33,34. Mstn is a conserved inhibitor of muscle growth in vertebrates, but until now solid evidence supporting a similar function of Mstn in invertebrates has been lacking. In the present study, we firstly to establish a potential correlation between the expression of Mstn and growth using a large sample size in shrimp, containing the difference of its expression level between females and males. In addition, we firstly estimated the heritability of the FcMstn expression with the large sample size and a deep pedigree.
According to the classification reported by Cardellino and Rovira30, the growth trait has medium to high heritability (0.24–0.52) in shrimp5,6,35,36, which was consistent with our results, illustrating that the genetic factor played important role during their growing process. Some scholars pointed out that variation in gene expression may play more important roles than differences between variant forms of proteins for evolution37. The DNA region that affects gene expression is highly variable, containing more than 0.6% polymorphism38. The naturally occurring polymorphisms of nucleotides could affect the gene expression in vivo39–41. In the present study, the growth rates varied substantially among the individuals and among the families even their growth were selected for thirteen generations, and females generally grew faster than males (Table 1). This phenomenon may be related to different expression levels of some genes among the individuals and between females and males.
In the previous studies of F. merguiensis29 and F. chinens (the results would be published in our other study named “Identification of myostatin and investigation of its inhibitory function on myogenesis and muscle growth in Chinese Shrimp, Fenneropenaeus chinensis”), significantly higher expression level of Mstn in muscle tissue was observed in the smaller shrimp than in the larger shrimp with about 10 individuals for each group. In the present study, we analyzed the expression of FcMstn in a large-scale sample (383 females and 390 males), and the results showed its expression varied substantially among individuals and among families (Table 1), which has provided important precondition and foundation for growth selection by analyzing its expression. Importantly, significantly negative genetic correlation was detected between the expression level of FcMstn and the growth traits (BW1, BW2, BL2, and ADG), especially in the females (rg ranged from −0.84 to −0.98) (Table 3). In addition, the mean expression of Mstn in females was significantly lower than that of males at individual and family levels (P < 0.001). These results further demonstrate that Mstn negatively regulates muscle growth in shrimp, and its lower expression may underscore the faster growth of females. On this point, the results were found out some resemblance to the study on F. merguiensis Mstn that knock-down of FmMstn gene by RNAi can cause a stronger muscle development in F. merguiensis29. However, the study on P. monodon Mstn showed that shrimp with reduced expression level of Mstn mRNA displayed a slow growth rate compared with the control groups26, which might be caused by the effects of molt from the small sample scale and short experiment period. Because silencing of Mstn increased premolt duration, but the higher PmMstn expression in premolt stage led to slow growth26. Zhuo et al.29 detected high polymorphism and identified several potential SNPs in Mstn of F. merguiensis. In addition, two alternative splicing isoforms of Mstn was found in F. merguiensis29 and F. chinens (the results would be published in our other study named “Identification of myostatin and investigation of its inhibitory function on myogenesis and muscle growth in Chinese Shrimp, Fenneropenaeus chinensis”). Shin et al.42 reported alternative splicing isoforms of Mstn could negatively regulate pro-myostatin processing in muscle cells and prevent Mstn mediated inhibition of myogenesis in avian species. Consequently, we deduced that the variation in the expression of Mstn affected the growth rate of the shrimp, which might result from the difference of polymorphic nucleotides and alternative splicing isoforms among the individuals/families and between females and males. In the future study, we will carry out research to further verify the relationship between the polymorphic nucleotides or alternative splicing isoforms and the expression level of Mstn.
To investigate the potential use of the Mstn expression as quantitative trait for improving growth by selective breeding in shrimp, the heritability of its expression was estimated in the present study. In the previous heritability studies of gene expression, they all suggested a strong component of differential expression among genotypes15–19. However, because of the small sample sizes and lower genetic tie among individuals, most of these studies did not provide a direct estimate of heritability. The previous studies demonstrated that sample sizes of 100 individuals were too small to support robust estimates of heritability13,43. In the present study, we used a large scale sample (773 individuals from 44 full-sib families) and a thirteen generation pedigree for estimating the heritability of the expression of Mstn. Low heritability estimations were detected for the expression of Mstn at all-individual, female-individual, and male-individual levels, suggesting that the expression of Mstn might be heritable in shrimp. In addition, the significantly negative correlated between the expression of Mstn and the body weight and average daily gain indicated that there was selective potential for improving growth performance by analyzing the expression of Mstn at early stage before substantial experimental resources and labor force are invested. In future study, we will use more stages including the juvenile at rapid growth stage to verify the heritability of the expression of Mstn and its correlation with later stages.
Traditionally, the heritability estimates for growth were mainly focused on harvest body weight in shrimp6,35,44. In the present study, the heritabilities of harvest body weight (BW1), body weight (BW2) and body length (BL2) of later stage, and average daily gain (ADG) were estimated for the G13 of F. chinensis. In our previous study, the heritabilities of harvest body weight for the G3-G5 of this population were 0.23–0.36, 0.22–0.36, 0.37–0.38 at all-individual, female-individual, and male-individual levels, respectively6, and the heritabilities in males were higher than those of females. In the present study, the heritabilities of BW1 for the G13 were 0.35, 0.75, and 0.25 at the three levels. There was no significant difference between the heritabilities of G3-G5 and that of G13 both at all-individual and male-individual levels, but the heritability of BW1 for the G13 was significantly higher than those of the G3-G5 in females6 (Table 2). In the present study, the heritabilities of BW1, BW2, and BL2 in females were also significantly higher than those in males, which were consistent with the results of previous studies in M. rosenbergii45,46. They also reported heritabilities were higher in females than those in males45,47,48. When the females and males were treated as a separate trait, they have significant positive genetic correlations (Table 2), indicating that the growth of females and males are controlled by the same genes, such as Mstn. There was no significant difference for heritability estimates between BW1 and BW2 at the three levels, and BW1 has significant genetic correlations with BW2, BL2, and ADG, indicating the later growth could be selected by the harvest body weight.
In summary, we analyzed the expression of Mstn along with growth trait data in 773 individuals (383 females and 390 males) from 44 full-sib families of a F. chinensis population, to establish a potential correlation between Mstn and growth in this study. In addition, the expression of Mstn was treated as a quantitative trait, and its heritability was estimated using these 773 samples and a thirteen generation pedigree. The results provide strong support for a growth inhibitory function of Mstn in shrimp, and its lower expression may underscore the faster growth of females. The result also demonstrated that the expression of Mstn might be heritable in shrimp, suggesting that there might be potential for improving growth performance by analyzing the expression of Mstn at early stage. The heritabilities of body weight and body length in females were significantly higher than those in males, indicating the females have higher selection potential. The high genetic correlations between females and males indicated that the growth of females and males are controlled by the same genes, such as Mstn.
Methods
Experimental materials
The experiment was conducted in the Mariculture Research Station of Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, located in Qingdao City, Shandong Province, China in 2018. The experimental shrimp were selected from 105 full-sib families (including 28 half sib families) of the 13th generation (G13) of the selected population from our selective breeding program of F. chinensis. A nested mating design was used to produce the full- and half-sib families, and two females mated with one male to produce the half-sib families. The origin and the selection procedure of this selected population of F. chinensis, processes of family construction, hatching, and larvae rearing were described detailedly in our previous study6. The 105 families were reared separately in 200-L larvae-culture tanks after they were constructed. At the post-larvae stage in 35 days, 200 individuals of each family were moved to a larger tank (3 m3), and the families were still separately reared. When the average body weight reached about 2.0 g, each family was tagged with a unique family code by injecting visible implant fluorescent elastomers (VIE) at three locations on the 6th and 5th abdominal segment. After tagging for each family, 60 healthy tagged individuals were randomly selected and equally divided into four concrete tanks (100 m2) for rearing. During the rearing period, water was exchanged about 30% daily. The shrimp were fed with formulated diets four times every day, and a total daily supply accounted for 5% wet weight and adjusted daily. All the shrimp were individually tagged with numbered ring set on one ocular peduncle, and the family VIE tag, individual body weight (BW1) and sex were recorded at 190 days of culture (DOC).
In shrimp, the females grow faster than the males. In order to use enough females and males of each family for the next expression analysis, the families with lower survival rates (<50%) and with fewer females or males were eliminated. Finally, 44 full-sib families were selected, and about 20 individuals with a 1:1 sex ratio were selected from each family. All these selected individuals were moved to a cement tank (27 m2) with close recirculation system for communal rearing. During the rearing period, the temperature was 22–24 °C. In the same way, the shrimp were fed with formulated diets according to their wet weight and fresh Ruditapes philippinarum. The family VIE, individual tag, sex, body weight (BW2), and body length (BL2) were recorded at 230 DOC. At the same time, the muscle tissue of the healthy survival individuals was separately dissected and frozen immediately in liquid nitrogen, and after that they were stored at −80 °C until RNA extraction. Average daily gain (ADG) of body weight was calculated for each individual based on BW2 and BW1.
RNA extraction and cDNA synthesis
RNA was extracted from muscle using the Trizol reagent (TAKARA, Japan) and phenol chloroform. The purity and concentration of the RNA was checked using a ND-1000 spectrophotometer (NANO DROP TECHNOLOGIES, USA), and the integrity of the RNA was monitored by electrophoresis on 1.5% agarose gel. Single-stand cDNA was synthesized from total RNA (1 μg) using PrimeScript RT reagent kit (TAKARA, Japan) following the manufacturer’s protocol. Then cDNA products were stored at −80 °C until the Real-time quantitative PCR (qRT-PCR).
Expression analysis of FcMstn
The expression levels of the F. chinensis Mstn (FcMstn) in the muscle of the sampled individuals were analyzed by qRT-PCR. The specific primers (F: GATGCGACTGGCTTGAAACT, R: CGAATGAAGGAAGCTCCGAA, and Ta: 54 °C) of FcMstn for qRT-PCR were designed according to the open reading frame sequence of its complete cDNA (Accession number: MG437236, unreleased). The 18 S ribosomal RNA gene (F: TATACGCTAGTGGAGCTGGAA, R: GGGGAGGTAGTGACGAAAAAT, and Ta: 54 °C) of F. chenensis was used as the internal control49. Primers were tested to ensure specific amplification of single discrete band with no primer dimers. To detect optimal efficiency of the primer pair, the cDNA was analyzed with serial fold dilutions (1, 1/10, 1/20, 1/40 and 1/80). The qRT-PCR was performed in an ABI 7500 Sequence Detection System (ABI, USA) using a SYBR PrimeScript RT reagent Kit (TAKARA, Japan). Each reaction was performed in triplicate with the following conditions: 95 °C for 3 min, followed by 35 cycles of 95 °C for 30 s, 54 °C for 20 s, and 72 °C for 25 s. In order to ensure specificity of PCR product, melting curve determination was set at the end of each PCR reaction. The relative gene expression level of FcMstn for each individual was analyzed using the 2−ΔΔCT method50.
Variance components and heritability estimates
In order to modify the residual distribution, the FcMstn expression data were performed natural logarithm transformation. The descriptive statistics analysis for BW1, BW2, BL2, ADG, and FcMstn expression was carried out using the SPSS software (version 17.0). Means of BW1, BW2, BL2, ADG, and FcMstn expression between females and males were analyzed by independent sample t-test, respectively.
The analysis of variance indicated that sex showed significant effects on BW1, BW2, BL2, ADG, and FcMstn expression (P < 0.001). Age, pond and the initial body weight had no significant effect on BW1, BW2, BL2, ADG, and FcMstn expression (P > 0.05). In addition, body weight has a significant effect on FcMstn expression (P < 0.001), so BW1 as a covariate was included in the analysis model for FcMstn expression. The complete pedigree from G0 to G12 was used in the following analysis to account for the genetic relationships among the families and individuals.
The variance components and heritabilities for BW1, BW2, BL2, ADG, and FcMstn expression were estimated using ASREML 4.051 at all-individual, female-individual, and male-individual levels, respectively. The fitted model for BW1, BW2, BL2, and ADG was Model 1, and that for FcMstn expression was Model 2, which were showed as follows:
| Model 1 |
| Model 2 |
where yij is the observed value of BW1, BW2, BL2, ADG, or FcMstn expression of the jth individual, is the overall mean, Sexi is the fixed effect of the ith gender, BW1j is the covariate of the jth body weight when the individual was sampled for gene expression analysis, b is the regression coefficient, aj is the additive genetic effect of the jth individual, and eij is the random residual error of the jth individual, e ~ (0, I ). The phenotypic variance () was taken as the sum of all of the variance components as follows: . The heritability (h2) was calculated as the ratio between the genetic variance and the total phenotypic variance ().
The z-scores were used to test whether the heritability estimates were significantly different from each other at all-individual, female-individual, and male-individual levels for each trait, and whether the heritability estimates were significantly different from zero52.
where and are the heritability estimates all-individual, female-individual, or male-individual levels, and and are their respective standard errors. Both and were set to be zero when testing whether an estimate was significantly different from zero. The resulting z-score was then tested against a large-sample normal distribution.
The phenotypic and genetic correlation estimates
The phenotypic (rp) and genetic (rg) correlations among BW1, BW2, BL2, ADG, and FcMstn expression, and rg between females and males for the five traits were estimated using the bivariate animal model with the ASREML package51. The rp and rg were calculated for the above five traits at all-individual, female-individual, and male-individual levels, respectively. The statistical significances of rg between the above traits at the three levels were estimated using the confidence intervals (CIs), which were calculated using 1.96 (i.e., [rg − 1.96 × SE, rg + 1.96 × SE]). If zero was contained within the CI, the difference between the rg and zero was not significant. The statistical significances of rp between the above traits at the three levels were also assessed using the confidence intervals (CIs).
Acknowledgements
This project was financially supported by the National Key R&D Program of China (No. 2018YFD0900103); the National Natural Science Foundation of China (Nos. U1706203; 41676148; 31602151); Central Public interest Scientific Institution Basal Research Fund, Yellow Sea Fisheries Research Institute, CAFS (NO. 20603022017001).
Author contributions
X.L., J. K. and S. L. – conceptualization; X.L., P.D. and G.Q. – clinical data analysis; Y.Y., X.M., B.C. (Chen), B.C. (Cao), K.L. – investigation; X.L. and Y.Y – wrote original draft; J.K. and X.L. – review and editing; X.L., J. K. and X.M. – funding acquisition. All authors reviewed the manuscript.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
These authors contributed equally: Jie Kong and Yunjun Yan.
Contributor Information
Jie Kong, Email: kongjie@ysfri.ac.cn.
Xia Lu, Email: luxia@ysfri.ac.cn.
References
- 1.Wang QC, et al. Effects of marker density and population structure on the genomic prediction accuracy for growth trait in Pacific white shrimp Litopenaeus vannamei. BMC Genet. 2017;18:45. doi: 10.1186/s12863-017-0507-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gjerde B, Gjøen HM, Villanueva B. Optimum designs for fish breeding programmes with constrained inbreeding Mass selection for a normally distributed trait. Livestock Production Science. 1996;47:59–72. doi: 10.1016/S0301-6226(96)01000-7. [DOI] [Google Scholar]
- 3.Morten, R. Current status and prospects for the application of genetic improvement in aquaculture species. 9th Biennial Symposium of the Brazilian Society of Animal Breeding, Brazil (2012).
- 4.Argue BJ, Arce SM, Lotz JM, Moss SM. Selective breeding of Pacific white shrimp (Litopenaeus vannamei) for growth and resistance to Taura Syndrome Virus. Aquaculture. 2002;204:447–460. doi: 10.1016/S0044-8486(01)00830-4. [DOI] [Google Scholar]
- 5.Andriantahina F, Liu X, Huang H, Xiang J. Response to selection, heritability and genetic correlations between body weight and body size in Pacific white shrimp,Litopenaeus vannamei. Chinese Journal of Oceanology & Limnology. 2012;30:506–506. doi: 10.1007/s00343-012-1004-3. [DOI] [Google Scholar]
- 6.Sui J, et al. Genetic parameters and response to selection of harvest body weight of the Chinese shrimp Fenneropenaeus chinensis after five generations of multi-trait selection. Aquaculture. 2016;50:1–15. [Google Scholar]
- 7.Gjedrem T, Robinson N, Rye M. The importance of selective breeding in aquaculture to meet future demands for animal protein: A review. Aquaculture. 2012;350–353:117–129. doi: 10.1016/j.aquaculture.2012.04.008. [DOI] [Google Scholar]
- 8.Meuwissen TH, Hayes BJ, Goddard ME. Prediction of total genetic value using genome-wide dense marker maps. Genetics. 2001;157:1819–1829. doi: 10.1093/genetics/157.4.1819. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hayes B, Baranski M, Goddard ME, Robinson N. Optimisation of marker assisted selection for abalone breeding programs. Aquaculture. 2007;265:61–69. doi: 10.1016/j.aquaculture.2007.02.016. [DOI] [Google Scholar]
- 10.Robinson N, Goddard M, Hayes B. Use of gene expression data for predicting continuous phenotypes for animal production and breeding. Animal. 2008;2:1413–1420. doi: 10.1017/S1751731108002632. [DOI] [PubMed] [Google Scholar]
- 11.Oleksiak MF, Churchill GA, Crawford DL. Variation in gene expression within and among natural populations. Nat. Genet. 2002;32:261–266. doi: 10.1038/ng983. [DOI] [PubMed] [Google Scholar]
- 12.Robinson N, Hayes B. Modelling the use of gene expression profiles with selective breeding for improved disease resistance in Atlantic salmon (Salmo salar) Aquaculture. 2008;285:38–46. doi: 10.1016/j.aquaculture.2008.08.016. [DOI] [Google Scholar]
- 13.Gibson G, Weir B. The quantitative genetics of transcription. Trends Genet. 2005;21:616–623. doi: 10.1016/j.tig.2005.08.010. [DOI] [PubMed] [Google Scholar]
- 14.Chesler EJ, et al. Complex trait analysis of gene expression uncovers polygenic and pleiotropic networks that modulate nervous system function. Nat. Genet. 2005;37:233. doi: 10.1038/ng1518. [DOI] [PubMed] [Google Scholar]
- 15.Townsend JP, Duccio C, Hartl DL. Population genetic variation in genome-wide gene expression. Mol. biol. evol. 2003;20:955–963. doi: 10.1093/molbev/msg106. [DOI] [PubMed] [Google Scholar]
- 16.Pavlidis P, Noble WS. Analysis of strain and regional variation in gene expression in mouse brain. Genome Biology. 2001;2:1–15. doi: 10.1186/gb-2001-2-10-research0042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Rifkin SA, Junhyong K, White KP. Evolution of gene expression in the Drosophila melanogaster subgroup. Nat. Genet. 2003;33:138–144. doi: 10.1038/ng1086. [DOI] [PubMed] [Google Scholar]
- 18.Oleksiak MF, Roach JL, Crawford DL. Natural variation in cardiac metabolism and gene expression in Fundulus heteroclitus. Nat. Genet. 2005;37:67. doi: 10.1038/ng1483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Radich JP, et al. Individual-specific variation of gene expression in peripheral blood leukocytes. Genomics. 2004;83:0–988. doi: 10.1016/j.ygeno.2003.12.013. [DOI] [PubMed] [Google Scholar]
- 20.McPherron AC, Lawler AM, Lee SJ. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature. 1997;387:83. doi: 10.1038/387083a0. [DOI] [PubMed] [Google Scholar]
- 21.Kambadur R, Sharma M, Smith TPL, Bass JJ. Mutations in myostatin (GDF8) in Double-Muscled Belgian Blue and Piedmontese Cattle. Genome Res. 1997;7:910–916. doi: 10.1101/gr.7.9.910. [DOI] [PubMed] [Google Scholar]
- 22.Grobet, L. et al. deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat. Genet.17, 71 (1997). [DOI] [PubMed]
- 23.Laville E, et al. Effects of a quantitative trait locus for muscle hypertrophy from Belgian Texel sheep on carcass conformation and muscularity. J. Anim. Sci. 2004;82:3128–3137. doi: 10.2527/2004.82113128x. [DOI] [PubMed] [Google Scholar]
- 24.Mcpherron AC, Lee SJ. Double muscling in cattle due to mutations in the myostatin gene. Proceedings of the National Academy of Sciences of the United States of America. 1997;94:12457–12461. doi: 10.1073/pnas.94.23.12457. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kambadur R, Sharma M, Smith TP, Bass JJ. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 1997;7:910. doi: 10.1101/gr.7.9.910. [DOI] [PubMed] [Google Scholar]
- 26.Christian DS, et al. Growing backwards: an inverted role for the shrimp ortholog of vertebrate myostatin and GDF11. J. Exp. Biol. 2011;214:2671–2677. doi: 10.1242/jeb.056374. [DOI] [PubMed] [Google Scholar]
- 27.Qian Z, et al. cDNA cloning and expression analysis of myostatin/GDF11 in shrimp, Litopenaeus vannamei. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2013;165:30–39. doi: 10.1016/j.cbpa.2013.02.001. [DOI] [PubMed] [Google Scholar]
- 28.Christian DS, et al. Growing backwards: an inverted role for the shrimp ortholog of vertebrate myostatin and GDF11. J. Exp. Biol. 2011;214:2671–2677. doi: 10.1242/jeb.056374. [DOI] [PubMed] [Google Scholar]
- 29.Zhuo RQ, Zhou TT, Yang SP, Chan SF. Characterization of a molt-related myostatin gene (FmMstn) from the banana shrimp Fenneropenaeus merguiensis. General & Comparative Endocrinology. 2017;248:55. doi: 10.1016/j.ygcen.2017.03.010. [DOI] [PubMed] [Google Scholar]
- 30.Cardellino, R. & Rovira, J. Mejoramiento genético animal. Hemisferio Sur, Buenos Airesp 253 (1987).
- 31.Yu, Y. et al. Genome Scan for Genomic Regions and Genes Associated with Growth Trait in Pacific White Shrimp Litopeneaus vannamei. Mar. Biotechnol. (2019). [DOI] [PubMed]
- 32.Pérez‐Rostro CI, Ibarra AM. Heritabilities and genetic correlations of size traits at harvest size in sexually dimorphic Pacific white shrimp (Litopenaeus vannamei) grown in two environments. Aquacult. Res. 2015;34:1079–1085. doi: 10.1046/j.1365-2109.2003.00913.x. [DOI] [Google Scholar]
- 33.Primavera JH, Parado-Estepa FD, Lebata JL. Morphometric relationship of length and weight of giant tiger prawn Penaeus monodon according to life stage, sex and source. Aquaculture. 1998;164:67–75. doi: 10.1016/S0044-8486(98)00177-X. [DOI] [Google Scholar]
- 34.Gopal C, et al. Weight and time of onset of female-superior sexual dimorphism in pond reared Penaeus monodon. Aquaculture. 2010;300:237–239. doi: 10.1016/j.aquaculture.2010.01.007. [DOI] [Google Scholar]
- 35.Castillo-Juárez H, et al. Heritability for body weight at harvest size in the Pacific white shrimp, Penaeus (Litopenaeus) vannamei, from a multi-environment experiment using univariate and multivariate animal models. Aquaculture. 2007;273:42–49. doi: 10.1016/j.aquaculture.2007.09.023. [DOI] [Google Scholar]
- 36.Li WJ, et al. Genetic parameters and genotype by environment interaction for cold tolerance, body weight and survival of the Pacific white shrimp Penaeus vannamei at different temperatures. Aquaculture. 2015;441:8–15. doi: 10.1016/j.aquaculture.2015.02.013. [DOI] [Google Scholar]
- 37.King MC, Wilson AC. Evolution at two levels in humans and chimpanzees. Science. 1975;188:107–116. doi: 10.1126/science.1090005. [DOI] [PubMed] [Google Scholar]
- 38.Stephens JC, et al. Haplotype variation and linkage disequilibrium in 313 human genes. Science. 2001;293:489–493. doi: 10.1126/science.1059431. [DOI] [PubMed] [Google Scholar]
- 39.Beaty JS, West KA, Nepom GT. Functional effects of a natural polymorphism in the transcriptional regulatory sequence of HLA-DQB1. Molecular & Cellular Biology. 1995;15:4771–4782. doi: 10.1128/MCB.15.9.4771. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Crawford DL, Segal JA, Barnett JL. Evolutionary analysis of TATA-less proximal promoter function. Molecular Biology &. Evolution. 1999;16:194–207. doi: 10.1093/oxfordjournals.molbev.a026102. [DOI] [PubMed] [Google Scholar]
- 41.Segal JA, Barnett JL, Crawford DL. Functional analyses of natural variation in Sp1 binding sites of a TATA-less promoter. J. Mol. Evol. 1999;49:736–749. doi: 10.1007/PL00006596. [DOI] [PubMed] [Google Scholar]
- 42.Shin S, et al. A novel mechanism of myostatin regulation by its alternative splicing variant during myogenesis in avian species. Am. J. Physiol. Cell Physiol. 2015;309:C650. doi: 10.1152/ajpcell.00187.2015. [DOI] [PubMed] [Google Scholar]
- 43.Koning DJD, Haley CS. Genetical genomics in humans and model organisms. Trends Genet. 2005;21:377–381. doi: 10.1016/j.tig.2005.05.004. [DOI] [PubMed] [Google Scholar]
- 44.Andriantahina F, Liu X, Huang H, Liu Z. Genetic Map Construction and Quantitative Trait Locus (QTL) Detection of Growth-Related Traits in Litopenaeus vannamei for Selective Breeding Applications. Plos One. 2013;8:e75206. doi: 10.1371/journal.pone.0075206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Thanh NM, et al. Evaluation of growth performance in a diallel cross of three strains of giant freshwater prawn (Macrobrachium rosenbergii) in Vietnam. Aquaculture. 2009;287:75–83. doi: 10.1016/j.aquaculture.2008.10.051. [DOI] [Google Scholar]
- 46.Luan S, et al. Genetic parameters and response to selection for harvest body weight of the giant freshwater prawn Macrobrachium rosenbergii. Aquaculture. 2012;362–363:88–96. doi: 10.1016/j.aquaculture.2012.05.011. [DOI] [Google Scholar]
- 47.Malecha, S. R. Research and development in freshwater prawn, Macrobrachium rosenbergii, culture in the United States: current status and biological constraints with emphasis on breeding and domestication. Proceedings of the 9th UJNR Conference, Kyoto26–27 May 1980 (1984).
- 48.Kitcharoen N, Rungsin W, Koonawootrittriron S, Na‐Nakorn U. Heritability for growth traits in Giant freshwater prawn, Macrobrachium rosenbergii (de Mann 1879) based on BLUP method. Aquacult. Res. 2015;43:19–25. doi: 10.1111/j.1365-2109.2011.02796.x. [DOI] [Google Scholar]
- 49.Zhang Q, et al. cDNA cloning, characterization and expression analysis of the antioxidant enzyme gene, catalase, of Chinese shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol. 2008;24:584–591. doi: 10.1016/j.fsi.2008.01.008. [DOI] [PubMed] [Google Scholar]
- 50.Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔ C T Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 51.Gilmour, A. R., Gogel, B. J., Cullis, B. R., Welham, S. J. & Thompson, R. Asreml User Guide Release 4.1 Functional Specification. Available at, www.vsni.co.uk Accessed November 12, 2016 (2015).
- 52.NguyenNguyen NH, et al. Can sexual dimorphism and body shape be altered in Nile tilapia (Oreochromis niloticus) by genetic means? Aquaculture. 2007;272(S1):S38–S46. doi: 10.1016/j.aquaculture.2007.08.013. [DOI] [Google Scholar]

