Abstract
Introduction:
Several studies have reported that the single nucleotide polymorphism rs693 of Apo lipoprotein B gene is associated with high levels of plasma lipids and high body mass index, which are risk factors for cardiovascular diseases. The distribution of this single nucleotide polymorphism and its association with the phenotype depend on the genetic background of each population.
Objective:
To evaluate the distribution of single nucleotide polymorphism rs693 and its association with lipid profile and body mass index in a sample of Colombian Caribbeans.
Methods:
108 non-related adult subjects of both gender were included in this study. Body mass index and lipid profile that included total cholesterol, triglycerides, Low Density Lipoprotein and High Density Lipoprotein were determined. The single nucleotide polymorphism rs693 was determined by Polymerase Chain Reaction/Restriction Fragment Length Polymorphism from genomic DNA followed by digestion with the restriction enzyme XbaI. The chi-square test was used to analyze the genotype distribution of rs693 and the genotype-phenotype association was evaluated through different inheritance model.
Results:
The genotype frequencies for single nucleotide polymorphism rs693 were CC (45.0%), TT (16.5%) and CT (38.5%). The allele frequencies were C (64.0%) and T (36.0%). The single nucleotide polymorphism was in Hardy-Weinberg equilibrium in the studied sample. No association of the single nucleotide polymorphism rs693 with lipid profile nor the body mass index was found (p >0.05).
Conclusion:
There is no significant association between single nucleotide polymorphism rs693 and body mass index nor lipid profile, in a sample of Colombian Caribbeans.
Keywords: B, lipid profile, body mass index, polymorphism, genotyping
Resumen
Introducción:
Varios estudios han informado que el polimorfismo de un solo nucleótido rs693 del gen de la apolipoproteína B se asocia con altos niveles de lípidos plasmáticos e índice de masa corporal, los cuales son factores de riesgo para enfermedades cardiovasculares. La distribución de este polimorfismo y su asociación con el fenotipo dependen del antecedente genético de cada población. La población caribeña colombiana es producto de la mezcla de tres grupos étnicos principales: africano, amerindio y caucásico.
Objetivo:
Evaluar la distribución del polimorfismo rs693 y su asociación con el perfil lipídico y el índice de masa corporal en una muestra de sujetos caribeños colombianos.
Métodos:
Fueron incluidos en este estudio 108 sujetos adultos de ambos sexos y no relacionados. Se determinaron el índice de masa corporal y el perfil lipídico; de éste se incluyó colesterol total, triglicéridos, lipoproteínas de baja densidad y lipoproteína de alta densidad. El polimorfismo rs693 se determinó mediante Reacción en Cadena de la Polimerasa del ADN genómico seguida por digestión con la enzima de restricción XbaI. Se utilizó la prueba de ji cuadrado para analizar la distribución del genotipo de rs693 y se evaluó la asociación genotipo-fenotipo a través de diferentes modelos de herencia.
Resultados:
Las frecuencias genotípicas para rs693 fueron CC (45.0%), TT (16.5%) y TC (38.5%). Las frecuencias alélicas fueron C (64.0%) y T (36.0%). El polimorfismo rs693 estaba en equilibrio de Hardy-Weinberg en la muestra estudiada y no presentó asociación con el perfil lipídico ni con el índice de masa corporal (p >0.05).
Conclusión:
No existe asociación significativa del polimorfismo rs693 con el índice de masa corporal ni con el perfil lipídico en una muestra de caribeños colombianos.
Palabras clave: apolipoproteína B, perfil lipídico, índice de masa corporal, polimorfismo, genotipificación
Remark
| 1) Why was this study conducted? |
| The present study was done to explore the association of SNP C/T7673 with dyslipidemia and overweight/obesity in a sample of the Colombian Caribbean population. The development of this study contributed to the field of potential biomarkers of risk of cardiovascular disease (CVD) in the Colombian population. |
| 2) What were the most relevant results of the study? |
| The distribution of SNP C/T7673 is in Hardy-Weinberg equilibrium in the studied population and the genotypic frequencies are similar to those reported by studies conducted in other Colombian populations and Latin American countries. Finally, it is suggested that the SNP C/T7673 does not influence the lipid profile and BMI in the studied population. |
| 3) What do these results contribute? |
| In Colombia, there are few studies on the possible association of polymorphism C/T7673 with dyslipidemias and overweight/obesity. These results contribute to new knowledge of biomarkers to identify the risk of CVD. |
Introduction
Cardiovascular diseases (CVD) are recognized as the leading cause of death worldwide; with a percentage of 30%, equal to that reported for Colombia 1 , 2 . Obesity and dyslipidemia are some of the main CVD risk factors 3 - 5 , the respective indicators are the Body Mass Index (BMI) and lipid profile. The determination of these indicators is important for the prevention, diagnosis and monitoring of cardiovascular disease in an individual 6 - 8 .
Lipid profile comprises determining triglycerides (TG), total cholesterol (TC), cholesterol linked to low density lipoproteins (LDL-C,Low Density Lipoprotein-Cholesterol) and cholesterol linked to High Density Lipoprotein (HDL-C,High Density Lipoprotein-Cholesterol) 7 , 8 . The protein component (apoprotein) plays a pivotal role in the structure and function of the lipoproteins; therefore, variations in the gene encoding the apoprotein can cause structural or functional effects 9 - 10 . Apolipoprotein B (ApoB) is the main protein component of LDL, VLDL (Very Low Density Lipoprotein) and chylomicrons 11 . ApoB is essential for the assembly and secretion of VLDL in the liver and has the domain to bind LDL to its receptor; therefore, it is the key for the transport and metabolism of lipids 12 , 13 . ApoB is encoded by a gene of 43 kpb located on the short arm of chromosome 2 (2p24) and comprises 29 exons and 28 introns 14 , 15 . This gene is polymorphic 16 , 17 and some polymorphisms are related to dyslipidemia 18 - 21 .
One of the most studied polymorphisms has been the single nucleotide polymorphism (SNP) rs693,also called XbaI and C/T7673 22 . It is located in exon 26 of the apoB gene at codon 2488 and results from the substitution of cytosine by thymine at the third position (ACC → ACT), creating a silent mutation, as both codons encoding threonine. The presence of thymine generates the restriction site and gives the name to the resulting T allele, also known as X+ allele. However, in the absence of T allele, it is identified as C or X- allele 23 .
Although the SNP rs693 does not imply change in the amino acid sequence of the protein, it is associated with dyslipidemia, obesity and cardio-cerebrovascular diseases in populations from Brazil 23 , China 24 and European countries 25 . The association would favor the possibility of using the SNP rs693 as a predictor of risk of these diseases in the indicated populations 23 . However, in other populations, very low association has been found, for example, in Northern India 26 .
The genotypic and allelic distributions of rs693 in the Colombian population are not completely known. Historically, this population has been regarded as the mixture of three main ethnicities: Africans, Amerindians, and Caucasians 27 , 28 . In Andean population from Armenia-Colombia, Loango et al. 29 , evaluated the association between this polymorphism with plasmatic lipids in children and their parents. However, the admixture between the three ethnicities has different extent in each region of Colombia. This is why, the study of rs693 in a sample of Colombian Caribbean population is justified 28 . Furthermore, because clinical implications of the polymorphism rs693 on the cardiovascular risk factors are not universal, it is important to explore this variant in different populations 25 . The present study aims to determine the association of apoB rs693 polymorphism with the lipid profile and BMI in a sample of the Colombian Caribbean population.
Materials and Methods
Study group
This analytical cross-sectional study was performed from an initial group of 331 unrelated adult subjects, both gender, different ages and schooling and born in the Colombian Caribbean like their ancestors to the third degree of consanguinity. After applying a questionnaire and performing a medical interview at Universidad Libre from Barranquilla, smokers, vegetarians, pregnant women, diabetics and all those who were or had been under pharmacological treatment for cardio-cerebrovascular disease, dyslipidemia, hypertension, cancer, liver disease, endocrine disorders or kidney disease were excluded. Thus, the initial group was reduced to 108 subjects (mean age 52 ±11 years), 34 men (31.5%) and 74 women (68.5%).
The study was approved by the local ethics committee at Universidad Libre from Barranquilla and informed written consent was obtained from all study subjects before their participation.
Anthropometric measurements and lipid profile
Anthropometric measurements included the recording of weight and height by standard methods. Body Mass Index (BMI) was determined according to the traditional formula of Quetelet: weight in kilograms divided by the square of the height (Kg/m2). The criteria of the clinical guidelines of the NIH-USA were taken into account to classify the subjects according to the BMI into two categories: normal weight (values range from 18.5 to 24.99 Kg/m2) and overweight/obesity (values ≥ 25 Kg/m2) 8 .
For biochemical studies, a blood sample was drawn by venipuncture from an antecubital vein, following an overnight fast, from each subject under study. Serum was collected from all samples after centrifugation at room temperature. Serum levels of total cholesterol (TC), triglycerides (TGC), HDL cholesterol (HDL-C) and LDL cholesterol (LDL-C) were determined by using COBAS C501 equipment (Roche®, Switzerland), following the manufacturer’s instructions.
Genotyping of the SNP rs693
The genomic DNAs of all the subjects were extracted from 600 µL of whole blood with Wizard® Genomic Kit (Promega®, USA) following the manufacturer’s instructions. The genotyping of the SNP rs693 was done by Polymerase Chain Reaction (PCR) followed by digestion with restriction enzyme XbaI. The DNA fragment containing the SNP rs693 was amplified using a sense primer (5 'GGAGACTATTCAGAAGCTAA 3') and an antisense primer (5 'GAAGAGCCTGAAGACTGACT 3'). The PCR reaction was performed in a PTC-100 (MJ Research®,Canada) thermocycler, in a final volume of 25 µL containing 25 mM of each primer, 5 µL of DNA and master mix MangoMix (Bioline®, England) which provided MgCl22.5 mM and 200 mM dNTPs. The PCR conditions consisted of an initial denaturation step at 95° C for 10 min, followed by 30 cycles of denaturation at 95° C for 1 min, annealing at 49° C for 1 min, and extension at 72° C for 1 min, with a final elongation at 72° C for 8 min. The PCR product was a 710 bp band which was digested with the enzyme XbaI (New England Biolabs®,USA) following the instructions of the enzyme manufacturer. The digestion products were then visualized by gel electrophoresis with polyacrylamide 8% and staining with ethidium bromide. When the T allele was present in the restriction site, two bands (433 bp and 277 bp) were obtained. If after the digestion a single band of 710 bp was obtained it was interpreted as CC genotype; if three bands (433 bp, 710 bp and 277pb) were obtained it was interpreted as CT genotype,and if two bands (433 bp and 277 bp) were obtained it was interpreted as TT genotype.
Quality control
The quality of the biochemical tests was verified using commercial serum, normal and abnormal controls (Roche, Switzerland). Reagent controls were used in each amplification to monitor contamination in the molecular analysis. Genotyping was confirmed by repeating at random 40% of the analyzes performed.
Statistical analysis
The Statistical Package for Social Studies SPSS version 20.0 was used to conduct all data analyses. The total population was grouped according to the values of the lipid profile (subjects with normal and abnormal levels) and the BMI (normal weight and overweight/obese). The data obtained are presented as mean ± SD or percentages. Student’s t-test was used to compare means and Chi-square test was applied to compare proportions.
The genotype frequencies and the Hardy-Weinberg were determined with Arlequin version 3.11 software 30 . The data were further grouped according to the three genotypes of the SNP rs693. The chi-square test was used to analyze the distribution of the rs693 genotype and the genotype-phenotype association was evaluated through different inheritance models: co-dominant, dominant, recessive and additive. A value of p <0.05 was considered statistically significant.
Ethics approval and consent to participate
The ethical approval for this study was obtained from local ethics committee at Universidad Libre from Barranquilla. Written informed consent was obtained from all study subjects before their participation.
Results
Anthropometric characteristics and lipid profile
The anthropometric characteristics and the lipid profile of the study subjects classified by gender are presented in Table 1. When comparing means with Student’s t-test, there was statistically significant difference between the average weight (p= 0.007) and height (p= 0.008) between men and women; but not difference was found between the mean age (p= 0.06). The average body mass index (n= 108) was 26.21 ±3.72 Kg/m2and no statistically significant difference was found between the average BMI of women (25.74 ±3.50 Kg/m2) and men (27.25 ±4.00 Kg/m2), (p= 0.3435).
Table 1. Anthropometric characteristics and lipid profile of the subjects under study.
| Variable | Gender | (n=108) Mean ± SD | |
|---|---|---|---|
| Female (n=74) Mean ± SD | Male (n=34) Mean ± SD | ||
| Age (year) | 53 ± 10 | 50 ± 11 | 52±11 |
| Height (m) | 1.61 ± 0.07 | 1.71 ± 0,07 | 1.64 ± 0.08 |
| Weight (kg) | 66.71 ± 9.51 | 79.97 ± 13.54 | 70.89 ± 12.51 |
| Total cholesterol (mg/dL) | 190.35 ± 40.74 | 178 ± 25.86 | 186.46 ± 37.04 |
| High Density Lipoprotein-Cholesterol (mg/dL) | 47.16 ± 12.02 | 42.85 ± 9.66 | 45.81 ± 11.47 |
| Low Density Lipoprotein-Cholesterol (mg/dL) | 119.09 ± 34.98 | 117.88 ± 23.12 | 118.71 ± 31.62 |
| Triglycerides (mg/dL) | 158.91 ± 128.72 | 131.74 ± 58.76 | 150.35 ± 111.94 |
| Body mass index (Kg/m2) | 25.74 ± 3.50 | 27.25 ± 4.00 | 26.21 ± 3.72 |
Total cholesterol in men) ≥170; in women) ≥180
Triglycerides ≥150;
High Density Lipoprotein-Cholesterol in men ˂40; in women ˂50
Low Density Lipoprotein-Cholesterol ≥100 were considered abnormal values.
With regard to the lipid profile, the averages of the parameters evaluated in all individuals are presented in Table 1. The subjects were grouped according to National Lipid Association recommendations 7 . After using Chi-square test, significant differences were not found between men and women when comparing the corresponding frequencies for each parameter of the lipid profile (p >0.05) (Table 2).
Table 2. Frequency of abnormal body mass index and lipid profile with respect to the gender.
| Variables | Gender | |
|---|---|---|
| Female n=74 (%) | Male n=34 (%) | |
| Body mass index | 40 (54.1) | 23 (67.6) |
| Triglycerides | 26 (35.1) | 8 (23.5) |
| Total Cholesterol | 44 (59.5) | 23 (67.6) |
| High Density Lipoprotein-Cholesterol | 38 (51.4) | 18 (52.9) |
| Low Density Lipoprotein-Cholesterol | 53 (71.6) | 27 (79.4) |
Genotype and allele frequencies of SNP rs693.
Of the 108 genotyped subjects, 49 (45.0%) presented CC genotype; 41 (38.5%) presented CT genotype and the remaining 18 (16.5%) presented TT genotype. These data show that the C allele was majority; in fact, the allele frequencies were 139 (64.0%) for C allele and 77 (36.0%) for the T allele.The distribution of the genotype frequencies was in Hardy-Weinberg equilibrium (p >0.05). Genotype and allele frequencies were compared with other Latin American populations (Table 3).
Table 3. Comparison of the genotypic and allelic frequencies in the present study with other Latin American populations.
| Genotype | Colombian Caribbeans (present study) n= 108 | Brazilian population 23 n= 192 | Mexican population 31 n=246 | Colombian Andeans from Armenia 29 n= 148 |
|---|---|---|---|---|
| CC 7673 | 45.0% | 33% | 47% | 28%* |
| CT 7673 | 38.5% | 50% | 38% | 65%* |
| TT 7673 | 16.5% | 17% | 15% | 7% |
| Alleles | ||||
| C 7673 | 65% | 58% | 66% | 61% |
| T 7673 | 35% | 42% | 34% | 39% |
*p <0.05 compared to Caribbeans-Colombia (present study).
Genotype frequencies regarding lipid profile and BMI
The genotype frequencies with respect to lipid profile and BMI are shown in table 4. None of the inheritance models showed a significant increase in the odds of alterations in BMI or lipid profile parameters (Table 4). There were also no significant differences in these outcomes when gender and age variables were included in these models.
Table 4. Analysis of the association between the genotype and alterations in the lipid profile and BMI, depending on the inheritance model. Data are presented as frequencies and percentages of subjects with abnormal values* .
| Variable (N=108) | Model | Genotype | n | % | OR | CI (95%) |
|---|---|---|---|---|---|---|
| Body Mass Index (n=63) | co-dominant | CC7673 | 26 | 41.3 | 1 | |
| CT7673 | 26 | 41.3 | 0.712 | 0.321-1.579 | ||
| TT7673 | 11 | 17.5 | 0.871 | 0.309-2.453 | ||
| dominant | CC7673 | 26 | 41.3 | 1 | ||
| CT7673/ TT7673 | 37 | 58.7 | 0.672 | 0.311-1.452 | ||
| Recessive | CC7673/ CT7673 | 52 | 82.5 | 1 | ||
| TT7673 | 11 | 17.5 | 0.871 | 0.309-2.453 | ||
| additive | 0.719 | 0.239-2.164 | ||||
| Triglycerides (n=34) | co-dominant | CC7673 | 13 | 38.2 | 1 | |
| CT7673 | 16 | 47.1 | 0.574 | 0.251-1.314 | ||
| TT7673 | 5 | 14.7 | 1.236 | 0.402-3.797 | ||
| dominant | CC7673 | 13 | 38.2 | 1 | ||
| CT7673/ TT7673 | 21 | 61.8 | 0.653 | 0.285-1.496 | ||
| recessive | CC7673/ CT7673 | 29 | 85.3 | |||
| TT7673 | 5 | 14.7 | 1.236 | 0.402-3.797 | ||
| additive | 0.939 | 0.280-3.151 | ||||
| Total Cholesterol (n=67) | co-dominant | CC7673 | 30 | 44.8 | 1 | |
| CT7673 | 29 | 43.3 | 0.542 | 0.237-1.241 | ||
| TT7673 | 8 | 11.9 | 2.379 | 0.852-6.639 | ||
| dominant | CC7673 | 30 | 44.8 | 1 | ||
| CT7673/ TT7673 | 37 | 55.2 | 0.939 | 0.430-2.048 | ||
| recessive | CC7673/ CT7673 | 59 | 88.1 | 1 | ||
| TT7673 | 8 | 11.9 | 2.379 | 0.852-6.639 | ||
| additive | 1.974 | 0.662-5.888 | ||||
| High Density Lipoprotein-Cholesterol (n=56) | co-dominant | CC7673 | 25 | 44.6 | 1 | |
| CT7673 | 24 | 42.9 | 0.648 | 0.295-1.419 | ||
| TT7673 | 7 | 12.5 | 1.878 | 0.667-5.284 | ||
| dominant | CC7673 | 25 | 44.6 | 1 | ||
| CT7673/ TT7673 | 31 | 55.4 | 0.941 | 0.441-2.008 | ||
| recessive | CC7673/ CT7673 | 49 | 87.5 | 1 | ||
| TT7673 | 7 | 12.5 | 1.878 | 0.667-5.284 | ||
| additive | 1.637 | 0.544-4.921 | ||||
| Low Density Lipoprotein-Cholesterol (n=80) | co-dominant | CC7673 | 33 | 41.3 | 1 | |
| CT7673 | 34 | 42.5 | 0.451 | 0.172-1.182 | ||
| TT7673 | 13 | 16.3 | 1.12 | 0.360-3.486 | ||
| dominant | CC7673 | 33 | 41.3 | 1 | ||
| CT7673/ TT7673 | 47 | 58.8 | 0.527 | 0.220-1.258 | ||
| recessive | CC7673/ CT7673 | 67 | 83.8 | 1 | ||
| TT7673 | 13 | 16.3 | 1.12 | 0.360-3.486 | ||
| additive | 0.793 | 0.241-2.612 |
* No association of the single nucleotide polymorphism rs693 with lipid profile nor the body mass index was found (p >0.05).
Discussion
Polymorphisms in genes associated with dyslipidemia or obesity may be genetic predictors of CVD in populations where the association is obvious 21 - 24 . In this study, the genotypic and allelic frequencies were determined for the SNP rs693 such as its relationship with lipid profile and BMI in a sample of the Colombian Caribbean population, a product of the ancestral mixture of African black, Amerindian and European white 28 .
Genotypic analysis of polymorphism revealed: first, that in the sample studied the distribution of genotypes was not significantly different from the expected distribution for a population in Hardy-Weinberg equilibrium; second, that all possible genotypes for rs693 (TT, TC and CC) were present; and third, that the TT genotype was minority. Furthermore, the allelic analysis revealed that C was majority (64%) versus T (36%).
The T allele frequency found in this study is in agreement with those reported in a sample of mestizo Colombian Andean population from Armenia-Colombia 29 , in a sample of Brazilian people 23 , and in a sample of Mexican people 31 . However, there are notable differences with respect to the allelic frequencies found in European, Asian and African populations. In European populations, the frequency of T allele is higher (~53%) (32-35), except Norwegians (~27%) 32 , while it is lower in Asians (~12%) 36 - 39 and Africans (~21%) 40 - 42 .
Distribution of genotypes in Colombian Caribbeans differed from that of Colombian Andeans from Armenia 29 . The frequencies of CT and CC were higher in Colombian Andeans and a significant difference was found when the genotype distribution was compared between these two populations. However, no significant differences in genotype frequencies were observed when comparing Colombian Caribbeans to other Latin American populations (Brazilians and Mexicans) 23 , 31 (Table 3). This phenomenon is typical in Colombian population and is the product of historical events that gave rise to it 43 . The admixture between European, African, and Amerindian populations has a different extent in each region of Colombia. In central and Eastern Colombia, including Armenia, European and Amerindian ancestry predominate; in coastal regions, including Caribbean population in the present study, European, Amerindian and African ancestors all significantly contributed to this population 44 .
On the other hand, in the sample studied, the SNP rs693 does not appears to influence plasma lipid levels. Indeed, there was no significant association with the TT and CT genotypes,or the mutant allele T7673; p-value was always >0.05. This finding agrees with that reported in other Colombian study 29 , when they did not find statistically significant differences (TC p= 0.47, HDL-C p= 0.23; LDL-C p= 0.40; TG p= 0.10). It is also in agreement with the findings in a sample of the Brazilian population 26 , and in Indians 45 ; in these cases, in all comparisons p >0.05.
By contrast, our results differ from the findings in Egyptians 46 , who reported association of the T allele with increased cholesterol levels (p= 0.041) and LDL-C (p= 0.021); in a population of Mongolia 38 , when found significant association with triglyceride levels since these were significantly higher in men with genotype CT7673than in men with CC genotype (p= 0.047); in China 37 that CT genotype carriers tend to have high LDL levels, but low levels of HDL-C (p <0.05) and, finally, the results also in China 47 , when reported that subjects with T allele exhibited,significantly higher levels of LDL-C, TC and TG, compared to subjects with C allele (p <0.05).
For BMI, our results showed no significant association with genotypes nor with the mutant T allele (p >0.05). This result agrees with that reported in Colombian mestizos 29 , found no significant differences (p= 0.08) among subjects with T allele and subjects with C allele. Our study agrees with Egyptian subjects 46 , who found no significant differences in BMI of with TT, CT and CC genotypes and the lack of association (p >0.05) 26 . However, our result is discordant with the findings in China, who found significantly higher values (p <0.05) in subjects with T allele than in subjects with C allele 47 .
In this study the genotype-phenotype association with respect to wild-type C allele (X-) was also studied. Unlike the findings about positive association of this allele with coronary artery disease and myocardial infarction 23 , 48 , in this study no association (p >0.05) was found.
The similarity of our results with those of another study conducted in Colombia, in a far and different geographical area leads us to infer that the characteristic ancestral mixture of the two samples studied was the key factor to reproduce the result, despite environmental factors and lifestyle.
Environmental factors, however, can contribute to differences that are mainly due to ethnic variability. Indeed, biochemical phenotypes such as levels of plasma lipids, anthropometric parameters such as weight, demographic variables such as gender and age, environmental conditions such as food or cigarette smoking, and specific factors of the study as the sample size or the criteria for inclusion and exclusion, can influence the differences between the results of this study and others already referenced.
In this study, the wide age range of subjects, the differences in lifestyle and the sample size constituted limitations. However, the findings of this exploratory work should be validated in the future, with a study of a representative sample of the population of the Colombian Caribbean, under the case-control design.
Conclusion
This study suggests that there is no influence of the polymorphism on lipid profile parameters or on BMI.
Acknowledgements
The authors extend their thanks to Laboratorio Clínico Continental from Barranquilla, Colombia, for the determination of tests lipid profile. Roche Colombia for their support with the reagents and equipment to determine the parameters of the lipid profile.
Footnotes
Funding The study was funded by Universidad Libre Barranquilla, Colombia (CONV-INT-2011-P001.N.S.P.S. ). held Young researcher grant from COLCIENCIAS, Colombia with contract number PS-2012-000353. E.M:T held a PhD scholarship from COLCIENCIAS 55248166 PDBCEx.
References
- 1.Roth GA, Huffman MD, Moran AE, Feigin V, Mensah GA, Naghavi M. Global and regional patterns in cardiovascular mortality from 1990 to 2013. Circulation. 2015;132:1667–1678. doi: 10.1161/CIRCULATIONAHA.114.008720. [DOI] [PubMed] [Google Scholar]
- 2.Bolívar-Mejía A, Vesga-Angarita BE. Chapter 19 Burden of cardiovascular disease in Colombia. In: Rodriguez-Morales AJ, editor. Current Topics in Public Health. Intech-Open; 2013. [DOI] [Google Scholar]
- 3.Zalesin KC, Franklin BA, Miller WM, Peterson ED, McCullough PA. Impact of obesity on cardiovascular disease. Med Clin North Am. 2011;95:919–937. doi: 10.1016/j.mcna.2011.06.005. [DOI] [PubMed] [Google Scholar]
- 4.Bray GA, Heisel WE, Afshin A, Jensen MD, Dietz WH, Long M. The Science of obesity management an Endocrine Society Scientific statement. Endocr Rev. 2018;39(2):79–132. doi: 10.1210/er.2017-00253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Tietge UJ. Hyperlipidemia and cardiovascular disease inflammation, dyslipidemia, and atherosclerosis. Curr Opin Lipidol. 2014;25(1):94–95. doi: 10.1097/MOL.0000000000000051. [DOI] [PubMed] [Google Scholar]
- 6.Dyrbus K, Osadnik T, Desperak P, Desperak A, Gasior M, Banach M. Evaluation of dyslipidaemia and the impact of hypolipidemic therapy on prognosis in high and very high risk patients through the Hyperlipidaemia Therapy in Tertiary Cardiological Center (TERCET) Registry. Pharmacol Res. 2018;132:204–210. doi: 10.1016/j.phrs.2017.12.015. [DOI] [PubMed] [Google Scholar]
- 7.Jacobson TA, Ito MK, Maki KC, Orringer CE, Bays HE, Jones PH. et?al National Lipid Association recommendations for patient-centered management of dyslipidemia Part 1- executive summary. J Clin Lipidol. 2014;8(5):473–488. doi: 10.1016/j.jacl.2014.07.007. [DOI] [PubMed] [Google Scholar]
- 8.NHLBI Obesity Education Initiative Expert Panel on the Identification, Evaluation, and Treatment of Obesity in Adults . Clinical guidelines on the identification, evaluation, and treatment of overweight and obesity in adults: The evidence report. Bethesda(MD) National Heart, Lung, and Blood Institute; 1998. http://www.ncbi.nlm.nih.gov/books/NBK2003/ [Google Scholar]
- 9.Benn M. Apolipoprotein B levels, APOB alleles, and risk of ischemic cardiovascular disease in the general population, a review. Atherosclerosis. 2009;206(1):17–30. doi: 10.1016/j.atherosclerosis.2009.01.004. [DOI] [PubMed] [Google Scholar]
- 10.Shatwan IM, Winther KH, Ellahi B, Elwood P, Ben-Shlomo Y, Givens I. Association of apolipoprotein E gene polymorphisms with blood lipids and their interaction with dietary factors. Lipids Health Dis. 2018;17(1):98–98. doi: 10.1186/s12944-018-0744-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Packard CJ, Demant T, Stewart JP, Bedford D, Caslake MJ, Schwertfeger G. Apolipoprotein B Metabolism and the distribution of VLDL and LDL subfractions. J Lipid Res. 2000;41(2):305–318. [PubMed] [Google Scholar]
- 12.Martínez-Oliván J, Arias-Moreno X, Velazquez-Campoy A, Millet O, Sancho J. LDL receptor/lipoprotein recognition endosomal weakening of ApoB and A poE binding to the convex face of the LR5 repeat. FEBS J. 2014;281(6):1534–1546. doi: 10.1111/febs.12721. [DOI] [PubMed] [Google Scholar]
- 13.Twisk J, Gillian-Daniel DL, Tebon A, Wang L, Barrett PHR, Attie AD. The role of the LDL receptor in apolipoprotein B secretion. J Clin Invest. 2000;105:521–532. doi: 10.1172/JCI8623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Blackhart BD, Ludwig EM, Pierotti VR, Caiati L, Onasch MA, Wallis SC. Structure of the human apolipoprotein B gene. J Biol Chem. 1986;261(33):15364–15367. [PubMed] [Google Scholar]
- 15.Knott TJ, Rall SC, Jr, Innerarity TL, Jacobson SF, Urdea MS, Levy-Wilson B. Human apolipoprotein B Structure of carboxyl- terminal domains, sites of gene expression and chromosomal localization. Science. 1985;230(4721):37–43. doi: 10.1126/science.2994225. [DOI] [PubMed] [Google Scholar]
- 16.Ng TW, Ooi EM, Watts GF, Chan DC, Barrett PH. Genetic determinants of apolipoprotein B-100 kinetics. Curr Opin Lipidol. 2010;21(2):141–147. doi: 10.1097/MOL.0b013e3283378e5a. [DOI] [PubMed] [Google Scholar]
- 17.Li YY. ApoB gene SpIns/Del, XbaI polymorphisms and myocardial infarction a meta-analysis of 7169 participants. J Cardiovasc Med (Hagerstown) 2014;15(9):717–726. doi: 10.2459/JCM.0b013e328364be64. [DOI] [PubMed] [Google Scholar]
- 18.Gu W, Zhang M, Wen S. Association between the APOB XbaI and EcoRI polymorphisms and lipids in Chinese a meta-analysis. Lipids Health Dis. 2015;14:123–123. doi: 10.1186/s12944-015-0125-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Timirci O, Darendeliler F, Bas F, Arzu EH, Umit Z, Isbir T. Comparison of lipid profiles in relation to APOB EcoRI polymorphism in obese children with hyperlipidemia. In Vivo. 2010;24(1):65–69. [PubMed] [Google Scholar]
- 20.Niu C, Luo Z, Yu L, Yang Y, Chen Y, Luo X. Associations of the ApoB rs693 and rs17240441 polymorphisms with plasma ApoB and lipid levels a meta-analysis. Lipids Health Dis. 2017;16(1):166–166. doi: 10.1186/s12944-017-0558-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Al-Bustan SA, Alnaqeeb MA, Annice BG, Ebrahim GA, Refai TM. Genetic association of APOB polymorphisms with variation in serum lipid profile among the Kuwait population. Lipids Health Dis. 2014;13:157–157. doi: 10.1186/1476-511X-13-157. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Daneshpour MS, Faam B, Hedayati M, Eshraghi P, Azizi F. ApoB (XbaI) polymorphism and lipid variation in Teharnian population. Eur J Lipid Sci Technol. 2011;113:436–440. doi: 10.1002/ejlt.201000346. [DOI] [Google Scholar]
- 23.Scartezini M, Zago MA, Chautar-Freire-Maia EA, Pazin-Filho A, Marin-Neto JA, Hotta JKS. The X-X-/E+E+ genotype of the XbaI/EcoRI polymorphisms of the apolipoprotein B gene as a marker of coronary artery disease in a Brazilian sample. Braz J Med Biol Res. 2003;36(3):369–375. doi: 10.1590/S0100-879X2003000300012. [DOI] [PubMed] [Google Scholar]
- 24.Zhang L, Zeng Y, Ma M, Yang Q, Hu Z, Du X. Association study Between C7673T polymorphism in apolipoprotein B gene and cerebral infarction with family history in a Chinese population. Neurol India. 2009;57(5):584–588. doi: 10.4103/0028-3886.57805. [DOI] [PubMed] [Google Scholar]
- 25.Turner PR, Talmud PJ, Visvikis S, Ehnholm C, Tiret L. DNA polymorphisms of the apoprotein B gene are altered plasma lipoprotein associated with concentrations but not with perceived risk of cardiovascular disease European Atherosclerosis Research Study. Atherosclerosis. 1995;116(2):221–234. doi: 10.1016/0021-9150(94)05550-3. [DOI] [PubMed] [Google Scholar]
- 26.Srivastava N, Prakash J, Srivastava A, Agarwal CG, Pant DC, Mittal B. Association of apolipoprotein B gene polymorphism XbaI and lipid profile in northern Indian obese. Indian J Hum Genet. 2013;19(1):26–31. doi: 10.4103/0971-6866.112880. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Bedoya G, Montoya P, García J, Soto I, Bourgeois S, Carvajal L. Admixture dynamics in Hispanics A shift in the nuclear genetic ancestry of a South American population isolate. Proc Natl Acad Sci USA. 2006;103:7234–7239. doi: 10.1073/pnas.0508716103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Carvajal-Carmona LG, Soto ID, Pineda N, Ortiz-Barrientos D, Duque C, Ospina-Duque J. Strong Amerind/Caucasoid gender bias and evidence of a contribution sephardic among the founders of a population in North West Colombia. Am J Hum Genet. 2000;67:1287–1295. doi: 10.1016/S0002-9297(07)62956-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Loango N. B Restrepo Torres AL.Landázuri P Plasma lipids and XbaI polymorphism on apob-100 gene in a group of children and their parents. Rev Invest Univ Quíndio. 2010;20:179–186. [Google Scholar]
- 30.Excoffier L, Laval G, Schneider S. Arlequin see 3.0: an integrated software package for population genetics data analysis. Evol Bioinform Online. 2005;1:47–50. [PMC free article] [PubMed] [Google Scholar]
- 31.Gallegos-Arreola MP, Valdez Y, Zúñiga-Corona M, Figuera LE, Arnaud-López L, Robles-Cervantes JA. Association between the Xba I polymorphism of APOB gene and plasma lipid level in Mexican patients with coronary artery disease. Asia Pac J Clin Nutr. 2012;21(2):312–318. [PubMed] [Google Scholar]
- 32.Delghandi M, Thangarajah R, Nilsen M, Grimsgaard S, Bønaa KH, Tonstad S. DNA polymorphisms of the apolipoprotein B gene (XbaI, EcoRI, and MspI RFLPs) in Norwegians at risk of atherosclerosis and healthy controls. Acta Cardiol. 1999;54:215–225. [PubMed] [Google Scholar]
- 33.Horvath A, Chorbov V, Zaharova B, Ganev V. Five polymorphisms of the apolipoprotein B gene in healthy Bulgarians. Hum Biol. 2003;75:69–80. doi: 10.1353/hub.2003.0022. [DOI] [PubMed] [Google Scholar]
- 34.De Benedictis G, Leone O, Falcone E, Rose G, Brancati C, Carotenuto L. RFLPs of the Apo B gene comparative study between Greeks and southern Italian peoples. Hum Biol. 1993;65(3):401–411. [PubMed] [Google Scholar]
- 35.Series JJ, Gaffney D, Packard CJ, Shepherd J. Frequency of the XbaI, EcoRI, PvuII and MspI polymorphisms of the apolipoprotein B gene in relation to hypercholesterolemia in the general population. Clin Chim Acta. 1993;215:89–98. doi: 10.1016/0009-8981(93)90252-Y. [DOI] [PubMed] [Google Scholar]
- 36.Zaman MM, Ikemoto S, Yoshiike N, Date C, Yokoyama T, Tanaka H. Association of apolipoprotein genetic polymorphisms with plasma cholesterol in a Japanese rural population The Shibata study. Arterioscler Thromb Vasc Biol. 1997;17(12):3495–3504. doi: 10.1161/01.ATV.17.12.3495. [DOI] [PubMed] [Google Scholar]
- 37.Liu YL, Zhang YB, Li Y, Ma RL, Cai WW, Lin-Jiang L. Correlation between the Xba I polymorphism of apoB gene and serum lipid profiles in Li ethnic group. Asian Pac J Trop Med. 2014;7(1):63–66. doi: 10.1016/S1995-7645(13)60193-5. [DOI] [PubMed] [Google Scholar]
- 38.Tsunoda K, Harihara S, Tanabe Y, Dashnyam B. Polymorphism of the apolipoprotein B gene and association with plasma lipid and lipoprotein levels in the Mongolian Buryat. Biochem Genet. 2012;50(3-4):249–268. doi: 10.1007/s10528-011-9468-y. [DOI] [PubMed] [Google Scholar]
- 39.Gajra B, Candlish JK, Heng CK, Mak JW, Saha N. Genotype associations among seven apolipoprotein B polymorphisms in a population of Orang Asli of western Malaysia. Hum Biol. 1997;69(5):629–640. [PubMed] [Google Scholar]
- 40.Kodogo V, Zhou DT, Oektedalen O, Duri K, Stray-Pedersen B, Gomo E. Apolipoprotein B Gene Polymorphisms and Dyslipidemia in HIV Infected Adult Zimbabweans. Open AIDS J. 2016;10:190–198. doi: 10.2174/1874613601610010190. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Anderson JL, Bunker CH, Aston CE, Kamboh MI. Relationship of two apolipoprotein B polymorphisms with serum lipoprotein and lipid levels in African blacks. Hum Biol. 1997;69:793–807. [PubMed] [Google Scholar]
- 42.Kallel A, Jemaa R, Feki M, El Asmi M, Souissi M, Sanhaji H. XbaI polymorphism of apolipoprotein B gene in a Tunisian population alleles frequencies and relationship with plasma lipid parameters. Ann Biol Clin (Paris) 2007;65(3):265–270. doi: 10.1684/abc.2007.0127. [DOI] [PubMed] [Google Scholar]
- 43.Rodas C, Gelvez N, Keyeux G. Mitochondrial DNA studies show asymmetrical Amerindian admixture in Afro-Colombian and Mestizo populations. Hum Biol. 2003;75:13–30. doi: 10.1353/hub.2003.0026. [DOI] [PubMed] [Google Scholar]
- 44.Rojas W, Parra MV, Campo O, Caro MA, Lopera JG, Arias W. Genetic make-up and structure of Colombian populations by means of uniparental and biparental DNA markers. Am J Phys Anthropol. 2010;143:13–20. doi: 10.1002/ajpa.21270. [DOI] [PubMed] [Google Scholar]
- 45.Misra A, Nishanth S, Pasha ST, Pandey RM, Sethi P, Rawat DS. Relationship of Xba1 and EcoR1 polymorphisms of apolipoprotein-B gene to dyslipidemia and obesity in Asian Indians in North India. Indian Heart J. 2001;53(2):177–183. [PubMed] [Google Scholar]
- 46.Bogari NM, Azza M, Abdel-Latif AM, Hassan MA, Fawzy A. Apolipoprotein B (XbaI) allele frequencies in an egyptian population impact on blood lipids. Int J Med Biol Res. 2014;5(2):3981–3987. [Google Scholar]
- 47.Hu P, Qin YH, Jing CX, Lu L, Hu B, Du PF. Effect of apolipoprotein B polymorphism on body mass index, serum protein and lipid profiles in children of Guangxi, China. Ann Hum Biol. 2009;36(4):411–420. doi: 10.1080/03014460902882475. [DOI] [PubMed] [Google Scholar]
- 48.Bohn M, Bakken A, Erikssen J, Berg K. XbaI polymorphism in DNA at the apolipoprotein B locus is associated with myocardial infarction (MI) Clin Genet. 1993;44(5):241–248. doi: 10.1111/j.1399-0004.1993.tb03890.x. [DOI] [PubMed] [Google Scholar]
