Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2020 Apr 9;15(4):e0231321. doi: 10.1371/journal.pone.0231321

Adaptive responses of histone modifications to resistance exercise in human skeletal muscle

Changhyun Lim 1,#, Junya Shimizu 2,#, Fuminori Kawano 2,3,*, Hyo Jeong Kim 4, Chang Keun Kim 5,6
Editor: Stephen E Alway7
PMCID: PMC7145008  PMID: 32271843

Abstract

Exercise training causes epigenetic changes in skeletal muscle, although it is unclear how resistance exercise (RE) affects histone modifications. The present study was carried out to investigate the effects of acute RE and RE training on gene expression profiles and histone modifications in human skeletal muscle. Healthy male adults were assigned to acute RE (n = 9, age = 20.5±4.3yr, BMI = 28.0±6.8kg/m2) or RE training (n = 21, age = 23.7±2.5yr, BMI = 24.2±2.7kg/m2) groups. Biopsy samples were obtained from the vastus lateralis muscle before and three hours after a single bout of acute RE, or 3-days after 10 weeks of RE training. RNA sequencing analysis revealed that 153 genes with GO terms including muscle development, stress response, metabolism, cell death, and transcription factor were significantly up-regulated (+291% vs. pre-acute RE) upon acute RE. Expressions of these genes were also greater (+9.6% vs. pre-RE training, p<0.05) in RE trained subjects. Significant up-regulation of acetylated histone 3 (H3) (+235%) and H3 mono-methylated at lysine 4 (+290%) and tri-methylated at lysine 27 (+849%), whereas down-regulation of H3.3 variant (−39%) distributions relative to total H3 were observed at transcriptionally activated loci after acute RE compared to pre-acute RE levels. Interestingly, the distribution of acetylated H3 was found to be up-regulated as compared to the level of total H3 after RE training (+40%, p<0.05). These results indicate that a single bout of RE drastically alters both gene expressions and histone modifications in human skeletal muscle. It is also suggested that enhanced histone acetylation is closely related to up-regulation of gene expressions after RE training.

Introduction

Gain of exercise-induced effects on skeletal muscles differs between individuals. Bamman et al. [1] reported that subjects were classified into extreme responders, modest responders, and non-responders depending on the magnitude of muscle fiber hypertrophy induced by resistance exercise (RE) training. It was also reported that the up-regulation of mechano-growth factor and myogenin gene expression was heightened in both extreme and modest responders after RE training. Previous studies [2, 3] further reported muscle mass gain responses after RE training are positively correlated with the expression levels of a particular microRNA, miR-378. Therefore, we hypothesized that epigenetic regulation causes the differences in the responsiveness of skeletal muscle to exercise training.

Histone modification is regarded as one of the epigenetic systems that plays a crucial role in the transcriptional activity in the cell nucleus. Slow- and fast-twitch skeletal muscles have different histone modification patterns. Transcriptionally active histone modifications, such as acetylation and tri-methylation at lysine 4 of histone 3 (H3), were found to be prevalent at the loci with higher expression in fast-twitch muscles of adult rats, although no relationship between histone modifications and gene expression was seen in slow-twitch muscles [4]. Masuzawa et al. [5] also reported that in response to the acute running exercise using a treadmill, the transcriptional activation of peroxisome proliferator-activated receptor gamma coactivator 1-alpha gene in rats was greater in the fast-twitch muscles in which the acetylation of histones was more prevalent as compared to that in the slow-twitch muscles. Begue et al. [6] demonstrated that fiber type-specific DNA methylation in human skeletal muscle, showing CpG sites of genes selectively expressed in type 1 or IIa myosin heavy chain fibers were hypomethylated. These data suggest that epigenetic regulation based on muscle fiber type characteristics affected the responsiveness of genes to exercise.

We further reported that endurance exercise training decreased the responsiveness of genes to muscular unloading in association with enhanced incorporation of histone variant H3.3 into the nucleosomes in the plantaris muscle of rats. This indicates that endurance exercise training stimulated the turnover of histones [7], but it is currently unclear how RE affects the distribution of histones and their modification patterns in animal models. Furthermore, even less research has been conducted on the epigenetic response to RE in human skeletal muscle [8–11]. Therefore, the present study is built upon the animal model literature, and aims to investigate the response of gene expression profiles and histone modifications in human muscle before and after acute RE and chronic RE training, respectively.

Materials and methods

Experimental design and ethical approval

In the present study, we analyzed skeletal muscle biopsy samples obtained after two different experiments, acute RE and RE trainings. Both experiments were approved by the Sport Ethics Committees of Hochiminh City University (33/QD-TDTTHCM-SDH), and the Bioethics Committee of Korea National Sport University (1263-201706-BR-002-01), respectively. Changhyun Lim, Hyo Jeong Kim, and Chang Keun Kim performed the experiments and sample collections for acute RE experiment in Hochiminh City University, Vietnam, and for RE training experiment in Korea National Sport University, Korea. Since their affiliation was with Korea National Sport University when they performed these experiments, the research proposal was approved by the Bioethics Committee of Korea National Sport University for RE training experiment. The acute RE experiment was a collaboration study with Hochiminh City University, therefore the ethical approval was obtained in Hochiminh City University. Original data obtained in these studies have been published [12, 13]. We combined the samples obtained from these studies to analyze for additional data shown in the present study. The original studies were also carried out in compliance with the Declaration of Helsinki. All subjects were informed about the purpose of the study, the experimental procedures, possible risks and discomforts they might experience during experiments, and written informed consent from all subjects were obtained. We analyzed human samples in a fully anonymized and randomized manner, only Changhyun Lim, Hyo Jeong Kim, and Chang Keun Kim had access to subjects’ information. Although the present study reports the results for gene expression patterns and epigenetic changes upon acute RE and RE training experiments, a portion of the results has been published [12 and 13]. Therefore, detailed information of subjects and exercise protocols are briefly mentioned in the following sections.

Experiment 1

Subjects

Nine male weight lifters (age = 20.5±4.3yr, BMI = 28.0±6.8kg/m2, mean ± SD) participated in Experiment 1 (acute RE). All subjects were weightlifters of national caliber of H City team including a London Olympic medalist. They have been in the same training for at least seven years, and shared similar living condition for diet, nutrition, and dormitory.

Exercise protocol

A week prior to the test, subjects completed a 10-repeated maximum (RM) squat and bench press test to ensure appropriate exercise intensity (172.2 ± 38 kg, 82.6 ± 16.4 kg, 1RM of squat and bench press, mean ± SD, respectively). Intensity of exercise was then set at 60% of their 1RM weight and subjects completed three sets of 6-repetitions during each session of exercise. This RE consisted of squat, single leg lunge, and deadlift, and was repeated twice by all subjects.

Collection of muscle biopsy samples

Muscle biopsy samples were obtained using local anesthesia (1% lidocaine) administrated into the mid belly of the vastus lateralis muscle immediately before (pre-acute RE), and three hours after (post-acute RE) exercise. Muscle biopsy samples were frozen in liquid nitrogen and stored at −80°C until further analysis. Nine biopsy samples were combined to analyze for gene expressions in Experiment 1. Further, three out of nine biopsies were selected for the histone modifications analysis. Throughout Experiment 1, biopsies of pre- and post-acute RE were selected from the same subjects.

Experiment 2

Subjects

Effects of RE training were examined in 21 males (age = 23.7±2.5yr, BMI = 24.2±2.7kg/m2) who had no record of medical disorders in the musculoskeletal, cardiovascular, and respiratory systems and had not undergone any regular resistance exercise in the last two years. The subjects were separated into three groups; 80FAIL (n = 7, age = 24.5±1.8yr, BMI = 25.9±3.9kg/m2), 30WM (n = 7, age = 23.1±2.0yr, BMI = 25.0±3.1kg/m2), and 30FAIL (n = 7, age = 23.0±1.2yr, BMI = 24.4±1.3kg/m2).

Exercise protocol

In Experiment 2, all subjects performed three repeated sets of leg press, leg extension, and leg curl, three times per week for 10 weeks. Considering the risk of injury to subjects who had not performed any resistance exercise before, 1RM was determined by the indirect measurement method suggested in a previous report [14]. The 80FAIL group exercised at 80% of 1RM until they could not achieve muscular contractions in every set, the 30WM group performed the total workload matching that of the 80FAIL, and the 30FAIL group exercised at 30% of 1RM until failure. For example, total work volume performed in leg press was 2,358–3,030; 2,495–3,060; and 2,995–3,588 kg/set in 80FAIL, 30WM, and 30FAIL, respectively [12].

Collection of muscle biopsy samples

Muscle biopsy was sampled from the mid belly of the vastus lateralis muscle by aforementioned procedures prior to training (pre-RE training), and 72 hours after the final session of RE (post-RE training). Our earlier study has reported that there was significant difference in the muscle fiber size by time (pre vs. post) in all groups by two-way ANOVA [12]. Therefore, in the present study nine biopsy samples from individuals subjected to RE training were randomly collected from the three groups (21 subjects) and were analyzed for gene expressions. Further, three out of nine biopsies were selected for histone modifications analysis. Biopsies of pre- and post-RE training were selected from the same subjects in Experiment 2.

RNA sequencing (RNA-seq)

Pieces of frozen muscle samples for each group (~100 mg in total) were pooled and homogenized in 1 mL ISOGEN (NIPPON GENE, Tokyo, Japan). RNA extraction was performed according to manufacturer’s instructions. RNA-seq analysis was performed through commercial service (Novogene, Chula Vista, CA). mRNAs were enriched with oligo(dT) beads and randomly fragmented in the fragmentation buffer, followed by cDNA synthesis using random hexamers and reverse transcriptase. After the first-strand synthesis, a custom second-strand synthesis buffer (Illumina, San Diego, CA) was added along with dNTPs, RNase H, and Escherichia coli polymerase I to generate the second strand by nick translation. The final cDNA library was prepared after purification, terminal repair, A-tailing, ligation of sequencing adapters, size selection, and PCR enrichment. The HiSeq-PE150 system (Illumina) was used to obtain reads of 150-bp paired ends. Approximately 50 million reads for each group were mapped to the human whole genome database using the TopHat2 software, and the fragments per kilobase of exon per million mapped fragments (FPKM) value was calculated for the exons of all known loci. Raw data for RNA-seq are available in the National Center for Biotechnology Information (NCBI) Bio Project (ID: PRJNA560308) database.

Gene ontology (GO) analysis was performed for genes that were up- or down-regulated with more than 2-fold differences when compared between the pre- and post-acute RE samples. Genes encoding for mitochondrial DNA were excluded from the GO analysis, because mitochondrial DNA does not form chromatin structure that is essential for subsequent analysis of histone distributions. Furthermore, the up-regulated genes annotating for at least three out of five major GO terms, stress response, muscle development, cell death, metabolic process, and transcription factor, were targeted for histone distributions analysis.

Chromatin extraction

Chromatin extraction was performed as described previously [4]. Three randomly chosen muscle samples from the same subjects between the pre- and post-experiment of each group were pooled. The pooled muscle samples (~80 mg) were homogenized in cooled PBS. After centrifugation at 12,000 × g, the pellet was fixed in 1% paraformaldehyde on ice for 10 min followed by quenching in 200 mM glycine. The pellet was then resuspended in lysis buffer (50 mM Tris-HCl, 1% SDS, and 10 mM EDTA, pH 8.0) and sonicated using Sonifier 250 (Branson, Swedesboro, NJ). In order to obtain an average DNA fragment size of 500 bp, 24 s of continuous sonication followed by 30 s cooling on ice was repeated four times. After centrifugation at 12,000 × g, the supernatant was stored as the chromatin-rich extract at −80°C until further analysis.

Chromatin immunoprecipitation (ChIP)

ChIP was also performed as described previously [4]. Chromatin samples extracted from each group were diluted to contained around 700 ng DNA. Chromatin was incubated overnight at 4°C with antibodies diluted at 1:50 for: anti-H3.3 (ab176840, Abcam, Cambridge, UK), anti-pan-acetyl H3 (39139, Active Motif, Carlsbad, CA), anti-H3 mono-methylated at lysine 4 (H3K4me1, 5326S, Cell Signaling Technology, Danvers, MA), anti-H3 tri-methylated at lysine 27 (H3K27me3, 9733S, Cell Signaling Technology), or anti-total H3 (4620S, Cell Signaling Technology), followed by subsequent reaction with protein G agarose beads (9007, Cell Signaling Technology; 20 μl for each reaction) for 4 h at 4°C. Beads were washed and incubated with proteinase K (Takara Bio, Shiga, Japan) for 1 h at 65°C. DNA was extracted by adding phenol-chloroform solution (25:24) and by centrifugation at 12,000 × g for 10 min at 20°C. The supernatant was collected, and ethanol precipitation was performed using Ethachinmate (NIPPON GENE). The final pellet was resuspended in tris-EDTA buffer and stored at −20°C. The amount of input DNA in the chromatin utilized for ChIP reaction was estimated with the same procedure but without any antibodies.

Quantitative PCR (qPCR)

In order to quantify the distribution of histones at the target loci, qPCR was performed using StepOne Real Time PCR System (Thermo Fisher Scientific, Waltham, MA). The THUNDERBIRD qPCR Mix (TOYOBO, Osaka, Japan) was used for the PCR reaction according to manufacturer-recommended dilution procedures. Primer pairs of 1 kbp downstream from the transcription start site (TSS) of 16 target genes were designed (Table 1). Quantification of qPCR results was performed by normalizing cycle-to-threshold (Ct) of the target amplification with Ct of the respective input DNA (% input). Results were normalized further using the median within each gene, and averaged for the 16 target genes.

Table 1. List of target genes and sequences of primer pairs for ChIP-qPCR analysis.

Gene symbol Forward primer Reverse primer
Ankrd1 TTACTTCGGTTCCCAGGTTG CAGCTTGGTGATTTGGAGGT
Atf3 CCTTGACATTCCTGCCTGTT CTCCAGGGCTTTTCCTCTCT
Btg2 ACAATTTGGAGTCCCAGTGC CGGGCTGCTTATCTCTTCAC
Cryab AGTGAGAGCAACGAGGGTGT ACCGTTTGTGAGGGTCTCAG
Csrp3 GCTAGCATTGAGGACCCAAA GCCTCCATCCCTAACCTTTC
Dnajb ACAAACACACGCTTGCACTC CCACCTCCTTGGACTCTCAG
Fos GGGACGCTCCAGTAGATGAG AGTGCAGACCAGAGGTTGCT
Hspa1b TGGTGCTGACCAAGATGAAG CCCAGGTCAAAGATGAGCAC
Junb TGGAACAGCCCTTCTACCAC GAAGAGGCGAGCTTGAGAGA
Lmcd1 CACGCACGCAGTTTCTTTAG TCCTGTGCAGGAGTTTACCC
Myf6 AGAGAAAATCTGCCCCCACT GCATCTTCTCCTGCTGATCC
Socs3 ATTCGGGACCAGGTAGGAAG GTGTGGACGGAGGGAGAAAC
Ubc ATCGCTGTGATCGTCACTTG CCACCTTGTTTCAACGACCT
Vegfa TCCGGGTTTTATCCCTCTTC ACCCCGTCTCTCTCTTCCTC
Vgll2 CCACCAGGTACGTGTCTCCT TAGCAGGGCTTAGCTGCTTC
Zep36 CAGCTTGGTGATTTGGAGGT CTGAGACTTCAGCCCCAGAG
Open in a new tab

Western blotting

Three muscle samples were randomly selected from each group to analyze for protein expression levels. Total histone was extracted using the Epiquik Total Histone Extraction Kit (Epigentek, Farmingdale, NY). Total histone obtained from the 25 mg muscle sample from each group was extracted in 500 μL lysis buffer packaged in the kit, centrifuged at 12,000 × g for 5 min at 4°C, of which 300 μL supernatant was collected and mixed with 90 μL balance buffer packaged in the kit. The total histone extract was further dissolved in an equal amount of 2X SDS sample buffer (20% glycerol, 12% 2-mercaptoethanol, 4% sodium dodecyl sulfate, 100 mM tris-HCl, and 0.05% bromophenol blue, pH 6.7). Western blotting was carried out as described previously [4]. Antibodies specific to H3.3 (ab176840, Abcam), pan-acetyl H3 (39139, Active Motif), H3K4me1 (5326S, Cell Signaling Technology), H3K27me3 (9733S, Cell Signaling Technology), or total H3 (4620S, Cell Signaling Technology) were used to detect each protein. Antibody-bound protein was detected using a chemiluminescence based method using the Western BLoT Hyper HRP Substrate (Takara Bio). Quantification of bands was performed using the image analyzing software (Image J). Protein levels were quantified based on the integrated density of the band, which was calculated as the mean density multiplied by the band area. The values of band intensity were further normalized with respective total H3 levels.

Statistical analysis

Statistical analysis was performed using BellCurve for Excel (Social Survey Research Information Co., Ltd.). For the data analysis of RNA-seq, all FPKM values were compared for the same genes between all experimental groups, and a correlation coefficient (R2) was calculated (Fig 1). FPKM values were normalized using the median within each gene, and averaged for the up- or down-regulated genes (Fig 2). For ChIP data, a boxplot was used to display the distribution of the data obtained from each gene (Fig 5 and 6). Values plotted in the Figs 2, 5, 6, and 7 were compared to determine the significant differences only for between pre- and post of acute RE or RE training. Because the data of pre- and post-groups were obtained from the same subjects in both Experiment 1 and 2, significant differences were examined using a paired t-test. Differences were considered significant at p < 0.05.

Fig 1. Correlation of gene expression among all experimental groups.

Fig 1

Open in a new tab

Expressions of all genes identified by RNA sequencing were compared. Numbers shown in squares indicate the coefficient of each comparison. Denser color indicates higher correlation in the gene expression profiles of samples.

Fig 2. Responses of gene expressions to acute RE.

Fig 2

Open in a new tab

Quantitative analysis of 153 up-regulated (A) and 29 down-regulated (B) genes before (Pre) and after (Post) acute RE. FPKM values obtained from RNA-seq were used to calculate the mean expression levels in both groups. To normalize the differences in the distribution of data among the genes, the median value was calculated within each gene and expressed as 1. Mean ± SE. *: p < 0.05 vs. respective pre group, examined by paired t-test.

Fig 5. Responses of gene expressions to RE training.

Fig 5

Open in a new tab

Expressions of genes that were up- (A) or down- (B) regulated in response to acute RE were analyzed before (Pre) and after (Post) RE training. FPKM values obtained from RNA-seq were used to calculate the mean expression levels in both groups. To normalize the differences in the distribution of data among the genes, the median value was calculated within each gene and expressed as 1. Mean ± SE. *: p < 0.05 vs. respective pre group, examined by paired t-test.

Fig 6. Changes in histone distribution after acute RE.

Fig 6

Open in a new tab

Chromatin immunoprecipitation was performed with antibodies specific for H3.3 (A and F), pan-acetyl H3 (B and G), H3K4me1 (C and H), H3K27me3 (D and I), total H3 (E) followed by quantitative PCR. The distributions were analyzed at 1 kbp downstream from transcription start site of 16 target genes shown in Table 1, and expressed as a box plot. G-I: The values normalized by respective total H3 distributions. To normalize the differences in the distribution of data among the genes, the median value was calculated within each gene and expressed as 1. Mean ± SE. *: p < 0.05 vs. respective pre group, examined by paired t-test.

Fig 7. Changes in histone distribution after RE training.

Fig 7

Open in a new tab

Chromatin immunoprecipitation was performed with antibodies specific for H3.3 (A and F), pan-acetyl H3 (B and G), H3K4me1 (C and H), H3K27me3 (D and I), total H3 (E) followed by quantitative PCR. See Fig 6 for the details. Mean ± SE. *: p < 0.05 vs. respective pre group, examined by paired t-test.

Results

Gene expression

Fig 1 shows the correlation of gene expression among all experimental groups. Relatively lower correlation was observed between pre- and post-acute RE (R2 = 0.967) as compared to that between pre- and post-RE training (R2 = 0.987). In Experiment 1, expression levels were significantly up-regulated (+291% vs. pre-acute RE, Fig 2A) for 153 genes, and down-regulated (−72% vs. pre-acute RE, Fig 2B) for 29 genes. However, only nine genes were significantly up- (4 genes) or down- (5 genes) regulated in the RE training groups of Experiment 2. The complete list of genes and FPKM values are available in the supporting information on the journal web site (S1–S3 Files). Results of GO analysis showed that the major GO terms including genes up-regulated upon acute RE, were muscle development, stress response, metabolism, cell death, and transcription factor (Fig 3). Terms for down-regulated genes included collagen, and extracellular matrix (Fig 4). The levels of gene expressions were analyzed for the same gene sets in both Experiment 1 and 2. Expression levels of the up-regulated genes were significantly greater (+9.6%) in post-RE training than that in pre-RE training, although no changes were observed after RE training in the down-regulated genes (Fig 5).

Fig 3. Results of GO analysis in up-regulated genes.

Fig 3

Open in a new tab

153 genes were targeted for analyzing their GO terms. Significant enrichment was found in 28 terms of biological process (orange), and 2 terms of cellular component (green). Note that the up-regulated genes frequently include the terms such as muscle development, stress response, metabolism, cell death, and transcription factor.

Fig 4. Results of GO analysis in down-regulated genes.

Fig 4

Open in a new tab

29 genes were targeted for analyzing their GO terms. Significant enrichment was found in 14 terms of biological process (orange), 12 terms of cellular component (green), and 4 terms of molecular function (blue). Note that the up-regulated genes frequently include the terms such as collagen, and extracellular matrix.

Distribution of histones

In the present study we analyzed the distribution of histones at the loci of 16 targeted genes that were up-regulated upon acute RE and related to more GO terms in biological processes,. These genes were selected based on two requirements: genes that showed high FPKM values and bore the downstream regions of TSS that could be amplified using PCR; and genes that conformed to at least three major GO terms like stress response, muscle development, cell death, metabolic process, and transcription factor.

Histone variant H3.3

The distribution of H3.3 was decreased (−86% and −39% in absolute and relative levels to total H3 vs. pre-acute RE, respectively; p < 0.05) in post-acute RE (Fig 6A and 6F). Absolute H3.3 distribution was also lowered after RE training (−25% vs. pre-training), however, levels of H3.3 distribution were similar to the pre-RE training group levels when values were normalized using total H3 distribution (Fig 7A and 7F).

Acetylated H3

Considering the absolute level of acetylated H3, the distribution of pan-acetyl H3 was unchanged in response to both acute RE and RE trainings (Figs 6B and 7B). However, the relative distribution of total H3 was significantly greater after acute RE and RE trainings (+235% and +40% vs. respective pre-groups, Figs 6G and 7G).

H3K4me1

The absolute level of H3K4me1 distribution was unchanged upon acute RE, although the relative distribution was significantly increased (+290% vs. pre-acute RE) in response to acute RE (Fig 6C and 6H). Absolute level of H3K4me1 distribution was also increased (−39% vs. pre-training, p < 0.05) after RE training (Fig 7C). However, it appeared to decrease (−23% vs. pre-training) after RE training when values were normalized using total H3 distribution (p = 0.05, Fig 7H).

H3K27me3

A drastic increase in H3K27me3 distribution was observed after acute RE at target loci (+153% and +849% in absolute and relative levels to total H3 vs. pre-acute RE, p < 0.05, respectively; Fig 6D and 6I). Although the absolute levels of H3K27me3 distribution were similar between pre- and post-RE training groups (Fig 7D), the relative distribution of H3K27me3 appeared to be greater (+54% vs. pre-training) after RE training (p = 0.05, Fig 7I).

Total H3

Levels of total H3 distribution were also altered upon stimulation induced by exercise (Figs 6E and 7E). H3 distribution was significantly decreased (−76% and −19% vs. respective pre-groups) after acute RE and RE training.

Western blotting

Levels of H3.3, pan-acetyl H3, H3K4me1, and H3K27me3 expression were unchanged upon acute RE or RE training when values were normalized using total H3 levels (Fig 8).

Fig 8. Effects of acute RE and RE training on protein expressions.

Fig 8

Open in a new tab

A: Typical band images of histones obtained in western blotting. Same samples used in Figs 6 and 7 were analyzed. B and C: Quantitative analysis of band intensities in Experiment 1 (acute RE) (B) and 2 (RE training) (C). The values were normalized into the mean level of respective pre group was 1.

Discussion

Limitations of analysis

The present study combined human biopsy samples with the previous research group of which data for the histochemical characteristics and protein expression were published [12 and 13]. However, due to the limited volume of remaining samples, we could not analyze all the samples individually. Therefore, nine biopsies were randomly chosen in Experiment 2, and three were selected for ChIP and western blot analysis in both experiments. The biopsies of pre- and post-groups in both Experiment 1 and 2 were obtained from the same subjects.

Epigenetic regulation differs between muscle fiber types [6]. For consistency in analyzing data, in the present study histone modifications should have been analyzed for single muscle fibers. However, that was not practically because such single muscle fiber based analysis would need more muscle tissue volume per subject. Therefore, the results of the present study are discussed as changes of the whole muscle homogenate including both slow- and fast-twitch fibers.

Gene expression profiles

The regulation of skeletal muscle size is largely dependent on the dynamic balance between protein synthesis and degradation [15, 16]. It is also known that the mammalian target of rapamycin (mTOR) signaling pathway plays a crucial role in the skeletal muscle protein synthesis [17]. Ogasawara et al. [18] reported that the administration of mTOR kinase inhibitor, but not that of an mTOR-specific inhibitor, completely repressed the resistance exercise-induced muscle protein synthesis. We previously reported that in the same muscle samples used in the present study acute RE significantly stimulated the mTOR-induced signal cascade [13]. Furthermore, the present study showed that some factors including genes that contribute to muscle hypertrophy were up-regulated upon acute RE. For example, stress-responsive proteins coded by genes such as Cryab, Dnajb, Hspa1a and Hspb1 function as molecular chaperones, are reported to be up- or down-regulated in the hypertrophic or atrophic conditions in the skeletal muscles of rodents [19–22]. It was also reported that an overexpression of the proto-oncogene Junb due to up-regulated upon acute RE, induced the marked hypertrophy of both myotubes and adult mouse muscles by stimulating the overall protein synthesis and myosin expression [23]. Therefore, it was suggested that the up-regulation of these genes was closely related to the induction of anabolic pathways. Ubc and Trim63, which play a role in the proteolytic system, were also up-regulated upon acute RE. The E3 ubiquitin ligase Trim63, also known as muscle RING finger protein 1, was reportedly up-regulated during muscle inactivation owing to bedrest in humans [24] and tail suspension in rodents [25]. These results also indicate that RE stimulates the expression of genes which negatively regulate muscle mass.

Satellite cells, a postnatal source for growth and regeneration of skeletal muscles, differentiate into muscle fibers following proliferation and fusion and/or incorporation into the resident fibers [26]. In this experiment, the number of satellite cells and centrally nucleated fibers significantly increased after RE training, indicating that repeated RE caused muscle fiber damage [12]. Lim et al. [13] also reported that acute RE resulted in the proliferative activation of satellite cells. In the present study, we found that some genes with GO terms including cell death were among the genes up-regulated by acute RE. For example, Btg2 a tumor suppressor, which arrests cells at the G1/S and the G2/M transition, increases apoptosis [27]. Socs3 is reportedly induced by IL-6, but inhibits the IL-6-mediated JAK-STAT pathway, and suppresses inflammation [28]. These results indicate that RE led to not only muscle damage followed by inflammation but also to anti-inflammatory processes.

Interestingly, the expression of genes with GO terms which are associated with metabolism, such as Nr4a1, Pdk4, Ppargc1a and Vegf, was elevated upon acute RE in the present study. It was reported that these genes were also up-regulated in the human skeletal muscle upon endurance exercise, and are closely related to mitochondrial biogenesis [29–32]. Porter et al. [33] reported that 12 weeks of RE training enhanced mitochondrial coupled respiration in human skeletal muscle, a finding that could be explained by an increased expression of complex I proteins. These results indicate that RE also stimulates pathways enhancing endurance capacity in skeletal muscle, although it is unknown whether this signaling is necessary to induce skeletal muscle hypertrophy, or is an additional response to RE.

It has been reported that chronic RE training induces skeletal muscle hypertrophy in both human [3, 8, 12] and rodent [34] models. The present study successfully induced hypertrophy of muscle fibers after RE training, based on the histochemical analysis results of the muscle samples used for the present study [12]. The present study also showed that transcription of the genes up-regulated upon acute RE was activated after RE training. This shows that repeated RE enhanced the responses of genes to physiological stimuli and is linked to the hypertrophy of muscle fibers.

Epigenetic regulations

Results of the present study showed a drastic loss of total H3 levels at the loci transcriptionally activated after acute RE (Fig 6E). We speculate that nucleosomes were dissembled in association with the up-regulation of gene transcription upon RE. The distribution of histone H3.3 variant also decreased at the loci after acute RE (Fig 6A and 6F). These results suggest that dissembling nucleosomes preceded transcriptional activation, which was stimulated by the dissociation of H3.3. We previously reported that endurance training decreased nucleosome formation and promoted incorporation of histone H3.3 variant into the nucleosomes in the plantaris muscle of adult rats, indicating that exercise training stimulates the turnover of histones [7, 35]. However, results of the present study suggested that RE training did not cause the turnover of histones, although the number of nucleosomes was lower after RE training.

Acetylation of histone residues is known as a modification in the transcriptional activation, and is associated with euchromatin. Previous studies [36, 37] have demonstrated that hyperacetylation of histones was induced at the loci of genes transcriptionally activated after a single bout of swimming exercise. Smith et al. [36] reported that activation of the calcium/calmodulin-dependent protein kinase was indispensable for the hyperacetylating and binding of myocyte enhancer factor 2A at the glucose transporter 4 promoter, which preceded up-regulation of the glucose transporter 4 gene expression in response to exercise. Results of the present study also showed an increase in H3 acetylation after acute RE (Fig 6B and 6G), suggesting that histone acetylation occurs at the loci transcriptionally activated upon exercise regardless of the type of exercise. Furthermore, Ohsawa et al. [35] demonstrated that exercise training promotes the turnover of histones at the transcriptionally activated loci of rat skeletal muscle and inhibited the accumulation of acetylated histones after long-term training; although skeletal muscle of rats displayed lower turnover of histones and acetylated histones were accumulated in this tissue. This result also supports our suggestion that the limitation in histone turnover actually promoted the accumulation of acetylated histones during repeated RE stimulation. The accumulation of acetylated histones might reduce nucleosome formation, maintain the loci at transcriptionally active status, and enhance gene expressions after RE training. We also observed that the increase in histone acetylation was not resulted from the changes in the net acetylation rate, which is in accordance with the expression levels of histone modifications were not affected by RE as seen in western blotting results.

H3K4me1 and H3K27me3 are positively and negatively correlated with gene transcription levels in a wide range of cell types, respectively [38]. Blum et al. [39] reported that both H3K4me1 and acetylation at H3K27 are highly conserved at the myogenic factor MyoD-binding sites in the myoblasts and myotubes, leading to the muscle-specific gene expression. Acute RE promoted both H3K4me1 and H3K27me3 at the transcriptionally activated loci, suggesting that these loci were bivalently modified during transcriptional activation. However, the distributions of H3K4me1 and H3K27me3 at these loci were not significantly changed after RE training (Fig 7H and 7I). The results again suggest that the increased distribution of acetylated H3 is closely related to the enhanced expressions in a subset of genes after RE training.

Recently, it has been reported that DNA methylation is also affected by RE in human skeletal muscles [8, 9]. Seaborne et al. [8] reported that the frequency of genome-wide hypomethylation at the CpG sites in human skeletal muscle was increased after chronic RE training (9,153 sites), maintained during the detraining period (8,891 sites), and further enhanced in response to reloading (18,816 sites). Turner et al. [9] further reported that the expression of 592 of 5,262 genes that were hypomethylated at their CpG sites after chronic RE training was up-regulated. These results indicate that RE training altered the status of genes activation, in agreement with our present results which show an enhancement of the hallmarks of active transcription in histone distributions after RE training.

The up-regulation of protein synthesis in rat skeletal muscle in response to RE gradually decreased during the period of RE training [40, 41]. These studies also reported that acute responses of mTOR signaling, such as the phosphorylation of p70S6K and ribosomal protein S6, were reduced if the RE stimulus was repeatedly provided. These results indicate a reduced responsiveness of the skeletal muscle after chronic RE training, whereas the results of previous studies [8, 9] and our present study consistently show that there is an enhancement of the transcriptionally active hallmarks in the epigenome of skeletal muscle after RE training. When RE training leads to an increased transcriptional activation of genes; genes that negatively regulate the skeletal muscle mass are also considered to be transcriptionally activated in the late period of training upon RE stimulation. Further studies are necessary to understand the relationship between epigenome and responsiveness of genes, and the associated changes in the epigenome after exercise training.

Supporting information

S1 File

(ZIP)

Click here for additional data file. (18.6MB, zip)
S2 File

(XLSX)

Click here for additional data file. (389KB, xlsx)
S3 File

(XLSX)

Click here for additional data file. (24.5KB, xlsx)
S1 Raw images

(PDF)

Click here for additional data file. (1.7MB, pdf)

Data Availability

Raw data for RNA-seq are available in the National Center for Biotechnology Information (NCBI) Bio Project (ID: PRJNA560308) database. Summary of full data obtained from RNA-seq is also available in Supporting Information.

Funding Statement

The present study was supported by Japan Society for the Promotion of Science KAKENHI Grant-in-Aid 16H03263 and 18H04987 to F. Kawano.

References

  • 1.Bamman MM, Petrella JK, Kim J-S, Mayhew DL, Cross JM. Cluster analysis tests the importance of myogenic gene expression during myofiber hypertrophy in humans. J Appl Physiol. 2007; 102: 2232–2239. 10.1152/japplphysiol.00024.2007 [DOI] [PubMed] [Google Scholar]
  • 2.Davidsen PK, Gallagher IJ, Hartman JW, Tarnopolsky MA, Dela F, Helge JW, et al. High responders to resistance exercise training demonstrate differential regulation of skeletal muscle microRNA expression. J Appl Physiol. 2011; 110: 309–317. 10.1152/japplphysiol.00901.2010 [DOI] [PubMed] [Google Scholar]
  • 3.Ogasawara R, Akimoto T, Umeno T, Sawada S, Hamaoka T, Fujita S. MicroRNA expression profiling in skeletal muscle reveals different regulatory patterns in high and low responders to resistance training. Physiol Genomics. 2016; 48: 320–324. 10.1152/physiolgenomics.00124.2015 [DOI] [PubMed] [Google Scholar]
  • 4.Kawano F, Nimura K, Ishino S, Nakai N, Nakata K, Ohira Y. Differences in histone modifications between slow- and fast-twitch muscle of adult rats and following overload, denervation, or valproic acid administration. J Appl Physiol. 2015; 119: 1042–1052. 10.1152/japplphysiol.00289.2015 [DOI] [PubMed] [Google Scholar]
  • 5.Masuzawa R, Konno R, Ohsawa I, Watanabe A, Kawano F. Muscle type-specific RNA polymerase II recruitment during PGC-1α gene transcription after acute exercise in adult rats. J Appl Physiol. 2018; 125: 1238–1245. [DOI] [PubMed] [Google Scholar]
  • 6.Begue G, Raue U, JemioloB, Trappe S. DNA methylation assessment from human slow- and fast-twitch skeletal muscle fibers. J Appl Physiol. 2017; 122: 952–967. 10.1152/japplphysiol.00867.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Nakamura K, Ohsawa I, Konno R, Masuzawa R, Kawano F. Running training experience attenuates disuse atrophy in fast-twitch skeletal muscles of rats. J Appl Physiol. 2017; 123: 902–913. 10.1152/japplphysiol.00289.2017 [DOI] [PubMed] [Google Scholar]
  • 8.Seaborne RA, Strauss J, Cocks M, Shepherd S, O’Brien TD, van Someren KA, et al. Human skeletal muscle possesses an epigenetic memory of hypertrophy. Sci Rep. 2018; 8: 1898 10.1038/s41598-018-20287-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Turner DC, Seaborne RA, Sharples AP. Comparative transcriptome and methylome analysis in human skeletal muscle anabolism, hypertrophy and epigenetic memory. Sci Rep. 2019; 9: 4251 10.1038/s41598-019-40787-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bagley JR, Burghardt KJ, McManus R, Howlett B, Costa PB, Coburn JW, et al. Epigenetic responses to acute resistance exercise in trained vs. sedentary men. J Strength Cond Res. 2019; in press. 10.1519/JSC.0000000000003185 [DOI] [PubMed] [Google Scholar]
  • 11.Romero MA, Mobley CB, Mumford PW, Roberson PA, Haun CT, Kephart WC, et al. Acute and chronic resistance training downregulates select LINE-1 retrotransposon activity markers in human skeletal muscle. Am J Physiol Cell Physiol. 2018; 314: C379–C388. 10.1152/ajpcell.00192.2017 [DOI] [PubMed] [Google Scholar]
  • 12.Lim CH, Kim HJ, Morton RW, Harris R, Philips SM, Jeong TS, et al. Resistance exercise-induced changes in muscle metabolism are load-dependent. Med Sci Sports Exerc. 2019; 51: 2578–2585. 10.1249/MSS.0000000000002088 [DOI] [PubMed] [Google Scholar]
  • 13.Lim CH, Luu TS, Phoung LQ, Jeong TS, Kim CK. Satellite cell activation and mTOR signaling pathway response to resistance and combined exercise in elite weight lifters. Eur J Appl Physiol. 2017; 117: 2355–2363. 10.1007/s00421-017-3722-x [DOI] [PubMed] [Google Scholar]
  • 14.Dohoney P, Chromiak JA, Lemire D, Abadie BR. Prediction of one repetition maximum (1-RM) strength from a 4–6 RM and a7-10 RM submaximal strength test in healthy young adult males. J Exp Physiol. 2002; 5: 54–59. [Google Scholar]
  • 15.Gordon BS, Kelleher AR, Kimball SR. Regulation of muscle protein synthesis and the effects of catabolic states. Int J Biochem Cell Biol. 2013; 45: 2147–2157. 10.1016/j.biocel.2013.05.039 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Glass DJ. Skeletal muscle hypertrophy and atrophy signaling pathways. Int J Biochem Cell Biol. 2005; 37: 1974–1984. 10.1016/j.biocel.2005.04.018 [DOI] [PubMed] [Google Scholar]
  • 17.Bodine SC, Stitt TN, Gonzalez M, Kline WO, Stover GL, Bauerlein R, et al. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat Cell Biol. 2001; 3: 1014–1019. 10.1038/ncb1101-1014 [DOI] [PubMed] [Google Scholar]
  • 18.Ogasawara R, Suginohara T. Rapamycin-insensitive mechanistic target of rapamycin regulates basal and resistance exercise-induced muscle protein synthesis. FASEB J. 2019; in press. 10.1096/fj.201701422R [DOI] [PubMed] [Google Scholar]
  • 19.Kawano F, Matsuoka Y, Oke Y, Higo Y, Terada M, Wang XD, et al. Role(s) of nucleoli and phosphorylation of ribosomal protein S6 and/or HSP27 in the regulation of muscle mass. Am J Physiol Cell Physiol. 2007; 293: C35–44. 10.1152/ajpcell.00297.2006 [DOI] [PubMed] [Google Scholar]
  • 20.Yasuhara K, Ohno Y, Kojima A, Uehara K, Beppu M, Sugiura T, et al. Absence of heat shock transcription factor 1 retards the regrowth of atrophied soleus muscle in mice. J. Appl. Physiol. 2011; 111: 1142–1149. 10.1152/japplphysiol.00471.2011 [DOI] [PubMed] [Google Scholar]
  • 21.Dimauro I, Antonioni A, Mercatelli N, Caporossi D. The role of αB-crystallin in skeletal and cardiac muscle tissues. Cell Stress Chaperones. 2018; 23: 491–505. 10.1007/s12192-017-0866-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Claeys KG, Sozanska M, Martin JJ, Lacene E, Vignaud L, Stockholm D, et al. DNAJB2 expression in normal and diseased human and mouse skeletal muscle. Am J Pathol. 2010; 176: 2901–2910. 10.2353/ajpath.2010.090663 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Raffaello A, Milan G, Masiero E, Carnio S, Lee D, Lanfranchi G, et al. JunB transcription factor maintains skeletal muscle mass and promotes hypertrophy. J Cell Biol. 2010; 191: 101–113. 10.1083/jcb.201001136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Salanova M, Schiffl G, Püttmann B, Schoser BG, Blottner D. Molecular biomarkers monitoring human skeletal muscle fibres and microvasculature following long-term bed rest with and without countermeasures. J Anat. 2008; 212: 306–318. 10.1111/j.1469-7580.2008.00854.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Baehr LM, West DWD, Marshall AG, Marcotte GR, Baar K, Bodine SC. Muscle-specific and age-related changes in protein synthesis and protein degradation in response to hindlimb unloading in rats. J Appl Physiol. 2017; 122: 1336–1350. 10.1152/japplphysiol.00703.2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Collins CA, Olsen I, Zammit PS, Heslop L, Petrie A, Partridge TA, et al. Stem cell function, self-renewal, and behavioral heterogeneity of cells from the adult muscle satellite cell niche. Cell. 2005; 122: 289–301. 10.1016/j.cell.2005.05.010 [DOI] [PubMed] [Google Scholar]
  • 27.Mao B, Zhang Z, Wang G. BTG2: a rising star of tumor suppressors (review). Int J Oncol. 2015; 46: 459–464. 10.3892/ijo.2014.2765 [DOI] [PubMed] [Google Scholar]
  • 28.Carow B, Rottenberg ME. SOCS3, a Major Regulator of Infection and Inflammation. Front Immunol. 2014; 19; 5: 58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Osbaldeston NJ, Lee DM, Cox VM, Hesketh JE, Morrison JFJ, Blair GE, et al. The temporal and cellular expression of c-fos and c-jun in mechanically stimulated rabbit latissimus dorsi muscle. Biochem. J. 1995; 308: 465–471. 10.1042/bj3080465 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mahoney DJ, Parise G, Melov S, Safdar A, Tarnopolsky MA. Analysis of global mRNA expression in human skeletal muscle during recovery from endurance exercise. FASEB J. 2005; 19: 1498–1500. 10.1096/fj.04-3149fje [DOI] [PubMed] [Google Scholar]
  • 31.Strömberg A, Rullman E, Jansson E, Gustafsson T. Exercise-induced upregulation of endothelial adhesion molecules in human skeletal muscle and number of circulating cells with remodeling properties. J Appl Physiol. 2017; 122: 1145–1154. 10.1152/japplphysiol.00956.2016 [DOI] [PubMed] [Google Scholar]
  • 32.Apró W, Wang L, Pontén M, Blomstrand E, Sahlin K. Resistance exercise induced mTORC1 signaling is not impaired by subsequent endurance exercise in human skeletal muscle. Am J Physiol Endocrinol Metab. 2013; 305: E22–32. 10.1152/ajpendo.00091.2013 [DOI] [PubMed] [Google Scholar]
  • 33.Porter C, Reidy PT, Bhattarai N, Sidossis LS, Rasmussen BB. Resistance exercise training alters mitochondrial function in human skeletal muscle. Med Sci Sports Exerc. 2015; 47: 1922–1931. 10.1249/MSS.0000000000000605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ogasawara R, Fujita S, Hornberger TA, Kitaoka Y, Makanae Y, Nakazato K, et al. The role of mTOR signalling in the regulation of skeletal muscle mass in a rodent model of resistance exercise. Sci Rep. 2016; 6: 31142 10.1038/srep31142 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ohsawa I, Konno R, Masuzawa R, Kawano F. Amount of daily exercise is an essential stimulation to alter the epigenome of skeletal muscle in rats. J Appl Physiol. 2018; 125: 1097–1104. 10.1152/japplphysiol.00074.2018 [DOI] [PubMed] [Google Scholar]
  • 36.Smith JA, Kohn TA, Chetty AK, Ojuka EO. CaMK activation during exercise is required for histone hyperacetylation and MEF2A binding at the MEF2 site on the Glut4 gene. Am J Physiol Endocrinol Metab. 2008; 295: E698–704. 10.1152/ajpendo.00747.2007 [DOI] [PubMed] [Google Scholar]
  • 37.Joseph JS, Ayeleso AO, Mukwevho E. Exercise increases hyper-acetylation of histones on the Cis-element of NRF-1 binding to the Mef2a promoter: implications on type 2 diabetes. Biochem Biophys Res Commun. 2017; 486: 83–87. 10.1016/j.bbrc.2017.03.002 [DOI] [PubMed] [Google Scholar]
  • 38.Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z, et al. High-resolution profiling of histone methylations in the human genome. Cell. 2007; 129: 823–837. 10.1016/j.cell.2007.05.009 [DOI] [PubMed] [Google Scholar]
  • 39.Blum R, Vethantham V, Bowman C, Rudnicki M, Dynlacht BD. Genome-wide identification of enhancers in skeletal muscle: the role of MyoD1. Genes Dev. 2012; 26: 2763–2779. 10.1101/gad.200113.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ato S, Tsushima D, Isono Y, Suginohara T, Maruyama Y, Nakazato K, et al. The effect of changing the contraction mode during resistance training on mTORC1 signaling and muscle protein synthesis. Front Physiol. 2019; 10: 406 10.3389/fphys.2019.00406 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ogasawara R, Kobayashi K, Tsutaki A, Lee K, Abe T, Fujita S, et al. mTOR signaling response to resistance exercise is altered by chronic resistance training and detraining in skeletal muscle. J Appl Physiol. 2013; 114: 934–940. 10.1152/japplphysiol.01161.2012 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Stephen E Alway

12 Dec 2019

PONE-D-19-25531

Adaptive responses of histone modifications to resistance exercise in human skeletal muscle

PLOS ONE

Dear Dr Kawano,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Specifically, the experts have suggested ways to improve the abstract , clarify the Methods and providing more detail for the statistics and clarify several places in the discussion. The Reviewers have done a nice job of providing the concerns and ways to address them. Finally, the figures should be redone at a high resolution to make them clear.

We would appreciate receiving your revised manuscript by Jan 26 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Stephen E Alway, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

1. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For more information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide.

2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

4. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded) as separate "supporting information" files

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Lim and colleagues investigated what genes are altered in human skeletal muscle in response to an acute bout of resistance exercise or resistance exercise training using RNA-seq. qPCR and Western blot was used to validate the response in a subset of genes and/or proteins. Many genes showed similar expression patterns following acute resistance exercise and resistance exercise training. The authors reported intriguing changes in histones that are related to the active genes.

The technical aspects of this manuscript are quite good. The data is physiologically relevant as coming from human muscle biopsies. The manuscript is written in a manner that is easy to read and understand. There are some limitations to the study, but a good follow-up approach maximizing samples from another published work.

The following are some recommendations to strengthen the manuscript for publication:

1) Abstract: The abstract reads a little ambiguous. Can the authors provide percent changes and p-values to the abstract? The conclusion statement is a bit strong. The results suggest histone acetylation may play a role in the active status of genes, but remember, the current data is correlative regarding that matter, not cause and effect.

2) Methods: the methodology relating to the biopsy samples needs to be detailed. What time after the last bout of exercise was the biopsy taken? What are the differences between the 80FAIL, 30WM, and 30FAIL? What was the statistical measure used to determine these groups could be grouped together, from which 9 biopsies in total were analyzed for this current study? While 9 biopsies were taken at random, post-hoc analysis can now be used to determine any variability in the samples related to the outcome measurements of the subjects from the first study.

3) Statistics: the statistics for RNA-Seq, ChIP, typically are more complex than those reported in the statistical analysis section. Please provide enough detail so that the RNA-seq data could be analyzed to a similar conclusion in different hands. Is the paired t-test used because of the within-subjects analysis, i.e., biopsies from same individuals at different times? Please add more detail for clarity

4) Discussion: please clarify when data is being discussed from the previous publication related to these biopsy samples. I think the discussion requires a Limitations paragraph that addresses the sample decisions made by the authors. For example, only 9 biopsies from 30 participants, and only 3 biopsies analyzed for ChIP and Western Blot. This reduces the Power of the study and should be acknowledged. And again, I think the conclusion needs to be less forceful. Even if all the samples were analyzed, the data is still a relationship between histone acetylation, exercise, and gene expression, not cause and effect.

5) Figures: all the figures downloaded a little blurry. Might have been on my end, but please check the resolution.

Reviewer #2: General Comments:

This study investigated skeletal muscle histone modifications in two groups of men: One group Pre- vs Post- acute RE, and another group Pre- vs Post- RE training.

Understanding the muscle epigenetic responses to RE in humans is an emerging topic, and the authors are commended on this work. However, a more elegant study design could have been conducted in this case. While the data presented here is useful, a more controlled approach would have been to: Do “pre- vs post- acute RE” biopsies, then do an RE training intervention on all men, then do “pre- vs post- acute RE” biopsies after RE training as well (4 time points in the same group). In the current article, authors should make it more clear that this is really two separate groups being studied, and thus, two separate experiments. Simple changes in the manuscript wording could be implemented to make this distinction, such as adding numbers in the abstract to show there are two separate experiments: “The present study was carried out to investigate the effects of 1) acute RE and 2) RE training on gene expression profiles and histone modifications in human skeletal muscle.”

That said, I still feel that this work is well written, and data are well presented. The article will be a good addition to the human RE epigenetics literature.

Specific comments/suggestions:

Please add page numbers to make review more efficient.

Abstract:

Please indicate the number of subjects, age, height, and body mass of each group of men. Example: “Healthy male adults were assigned to acute RE (n= , age= y, BIM= kg/m2) or RE training (n= , age= y, BIM= kg/m2) groups.”

Please add more informative data to the results sections of the abstract. Please indicate the fold-increase/decrease (or percent change) of significant variables to give the readers more information up front. Example: “Up-regulation of acetylated histone 3 (H3) (+235%) and H3 …”.

Introduction:

Paragraph 1, Line 3: Amend sentence to: “…muscle fiber hypertrophy induced upon by resistance exercise (RE) training.”

Paragraph 2: It is described here that different fiber types show different histone modification patterns. Fiber type distributions differ significantly among humans (even in the same muscle), and fiber type was not reported in the current article. Homogenizing samples with different fiber type proportions could have confounding effects on the data. In future studies, fiber type should be reported between pre vs post RE training groups, or single fibers should be isolated and pooled to get a more accurate representation of what is happening at the muscle cell level (see this paper that did fiber type specific analysis of DNA methylation in human muscle: (Begue, et al. 2017: https://www.physiology.org/doi/full/10.1152/japplphysiol.00867.2016 ). The limitation of analyzing homogenized samples should be mentioned in the Methods or discussion.

In the last paragraph of the introduction, there is a disconnect between going from animal studies, to human studies. I feel that a sentence or two need to be added stressing that very few studies have been conducted investigating epigenetics in human muscle after acute RE and/or RE training.

Example of last paragraph highlighting the little work done in humans: “We further reported that endurance exercise training decreased the responsiveness of genes to muscular unloading in association with enhanced incorporation of histone variant H3.3 into nucleosomes in the plantaris muscle of rats. This indicated that endurance exercise training stimulated turnover of histones [6], but it is currently unclear how RE affects the distribution of histones and their modification patterns in animal models. Furthermore, even less research has been conducted on the epigenetic response to RE in human skeletal muscle (Cite 29, 36, article below). Therefore, the present study built upon the animal literature, and aimed to investigate the response of histones in human muscle before and after 1) acute RE and 2) chronic RE.”

Cite these articles on epigenetics after RE in humans:

Bagley et al. (2019) https://journals.lww.com/nsca-jscr/Abstract/publishahead/Epigenetic_Responses_to_Acute_Resistance_Exercise.94813.aspx

Romero et a. (2018) https://www.ncbi.nlm.nih.gov/pubmed/29351416

Statistical Analysis:

Please indicate the static at software package used to analyze these data.

Discussion:

Paragraph 1: Add a period after this sentence: “however, are reportedly up- or downregulated

in hypertrophic or atrophic conditions in skeletal muscles of rodents [14-17].”

Figures:

Write “RE Training” throughout all figures (to be similar to “Acute AE”).

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Jarrod A Call, PhD

Reviewer #2: Yes: James R. Bagley

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Apr 9;15(4):e0231321. doi: 10.1371/journal.pone.0231321.r002

Author response to Decision Letter 0

24 Dec 2019

Responses to the Reviewer #1

1) Abstract: The abstract reads a little ambiguous. Can the authors provide percent changes and p-values to the abstract? The conclusion statement is a bit strong. The results suggest histone acetylation may play a role in the active status of genes, but remember, the current data is correlative regarding that matter, not cause and effect.

Responses:

Abstract was revised as including the percent changes and p values. Sentences on the bottom of abstract were also re-phrased stating conclusion directly suggested by the current results as “These results indicated that a single bout of RE drastically alter both gene expressions and histone modifications in human skeletal muscle. It was also suggested that enhanced histone acetylation closely related to up-regulation of gene expressions after RE training.” in line 17-19 of page 2.

2) Methods: the methodology relating to the biopsy samples needs to be detailed. What time after the last bout of exercise was the biopsy taken? What are the differences between the 80FAIL, 30WM, and 30FAIL? What was the statistical measure used to determine these groups could be grouped together, from which 9 biopsies in total were analyzed for this current study? While 9 biopsies were taken at random, post-hoc analysis can now be used to determine any variability in the samples related to the outcome measurements of the subjects from the first study.

Responses:

More precise statements were added to find the differences between 80FAIL, 30WM, and 30FAIL groups as “The 80FAIL group exercised at 80% of 1RM until they could not keep producing muscular contractions in every set, the 30WM group performed the total workload matching that of the 80FAIL, and the 30FAIL group exercised at 30% of 1RM until failure. For example, total work volume performed in leg press was 2,358-3,030, 2,495-3,060, and 2,995-3,588 kg/set in 80FAIL, 30WM, and 30FAIL, respectively (see Ref. 12 for more details).” in line 5-10 of page 6.

Experiment 1 (acute RE) and 2 (RE training) used different subjects. In Experiment 1, all biopsies (n=9) were combined to use for gene expression analysis, and 3 of 9 biopsies were chosen for histone modification analysis. In Experiment 2, 9 biopsies were randomly selected from 21 subjects for the gene expression analysis, and 3 of 9 biopsies were chosen for histone modification analysis. The effect of exercise method and time on the muscle fiber size was examined in Ref. 12, which showed that the two variables did not cause any interactive effect on the muscle fiber size (F=2.448, p=0.115). Therefore, the main effect test was done, which found difference by time (F=20.831, p<0.001), so that the present study selected the samples for analysis randomly from 3 groups. The sentences were revised as “Nine biopsy samples were randomly collected from 3 groups (21 subjects) as samples from individuals subjected to RE training, and were used to analyze gene expressions in the present study, because the main effect test by two-way ANOVA tested in all groups found difference in muscle fiber size by time (pre vs. post) (see Ref. 12 for precise results of each group). Further, 3 of 9 biopsies were selected to analyze histone modifications. Throughout the analysis of biopsies obtained from Experiment 2, biopsies of pre- and post-RE training were selected from same subjects.” in line 13-19 of page 6.

3) Statistics: the statistics for RNA-Seq, ChIP, typically are more complex than those reported in the statistical analysis section. Please provide enough detail so that the RNA-seq data could be analyzed to a similar conclusion in different hands. Is the paired t-test used because of the within-subjects analysis, i.e., biopsies from same individuals at different times? Please add more detail for clarity

Responses:

Statistics section was revised as “Statistical analysis was performed using BellCurve for Excel (Social Survey Research Information Co., Ltd.). For the data analysis of RNA-seq, all FPKM values were compared in same genes between all experimental groups, and calculate a correlation coefficient (R2) (Fig. 1). FPKM values were normalized using the median within each gene, and averaged in up- or down-regulated genes (Fig. 2). For ChIP data, a boxplot was used to display the distribution of the data obtained from each gene (Figs. 5 and 6). Values plotted in the figures 2, 5, 6, and 7 were compared to determine the significant differences only between pre- and post-acute RE or RE training. Because the data of pre- and post-groups were obtained from same subjects in both Experiment 1 and 2, significant differences were examined using a paired t-test. Differences were considered significant at p<0.05.” in line 21 of page 9 to line 3 of page 10.

4) Discussion: please clarify when data is being discussed from the previous publication related to these biopsy samples. I think the discussion requires a Limitations paragraph that addresses the sample decisions made by the authors. For example, only 9 biopsies from 30 participants, and only 3 biopsies analyzed for ChIP and Western Blot. This reduces the Power of the study and should be acknowledged. And again, I think the conclusion needs to be less forceful. Even if all the samples were analyzed, the data is still a relationship between histone acetylation, exercise, and gene expression, not cause and effect.

Responses:

Thank you for the suggestion. New sub-section “Limitation of analysis” was added in discussion, and stated as “The present study shared human biopsy samples with the original research group, whose data were published in Ref. 12 and 13. Since scientific significance would be maximized if histone modifications were measured using the samples that was enough analyzed in histochemical characteristics, and protein expressions, the present study was motivated to analyze the remaining biopsy samples. However, because of limited volume of samples remaining, we could not analyze all samples individually. Therefore, 9 biopsies were randomly chosen in Experiment 2, furthermore, 3 of 9 biopsies were selected for ChIP and western blot analysis in both experiments. But, the biopsies of pre- and post-groups in both Experiment 1 and 2 were selected from same subjects.

Epigenetic regulation differs between muscle fiber types [6]. For an essential manner analyzing data, in the present study histone modifications should have analyzed in single muscle fibers. However, that was technically difficult because the analysis needed much tissue volume. Therefore, the results of the present study discuss as changes of whole muscle homogenate including both slow- and fast-twitch fibers.” in line 2-14 of page 12.

Discussion was revised to that the data were discussed a relationship between histone acetylation, exercise, and gene expression. Further, discussion was revised to avoid a direct relationship between the results of acute RE and RE training, because these experiments targeted different subjects.

5) Figures: all the figures downloaded a little blurry. Might have been on my end, but please check the resolution.

Responses:

I have confirmed that current version of figures was rendered by 600 dpi resolution.

 

Responses to the Reviewer #2

Responses to the general comments:

Thank you for positive comments. As pointed by the reviewer, manuscript was revised as that acute RE and RE training were completely separated into two different experiments. Sentence in introduction was revised as “Therefore, the present study built upon the animal literature, and aimed to investigate the response of gene expression profiles and histone modifications in human muscle before and after 1) acute RE and 2) chronic RE training.” in line 2-5 of page 4. Experimental designs were shown in methods as “

Experiment 1

Subjects: Nine male weight lifters (age=20.5±4.3yr, BMI=28.0±6.8kg/m2, mean ± SD) participated in Experiment 1 (acute RE). All subjects were national caliber weightlifters of H City team including a London Olympic medalist. They had been training at least 7 years and had a similar living condition such as diet, nutrition and living in the same dormitory.

Exercise protocol: A week prior to the test, subjects completed a 10 repeated maximum (RM) squat and bench press test to ensure appropriate exercise intensity (172.2±38kg, 82.6±16.4kg, 1RM of squat and bench press, mean ± SD, respectively). Intensity of exercise was then set at 60% of their 1RM weight and subjects competed 3 sets of 6 repetitions during each session of exercise. RE consisted of squat, single leg lunge, and deadlift which was repeated twice by all subjects.

Collection of muscle biopsy samples: Muscle biopsy samples were obtained using local anesthesia (1% lidocaine) administrated into the mid belly of the vastus lateralis muscle immediately before (pre-acute RE), and 3 hours (post-acute RE) after exercise. Muscle biopsy samples were frozen in liquid nitrogen and stored at −80°C until analysis. Nine biopsy samples were combined to analyze gene expressions and histone modifications in Experiment 1. Further, 3 of 9 biopsies were selected to analyze histone modifications. Throughout the analysis of biopsies obtained from Experiment 1, biopsies of pre- and post-acute RE were selected from same subjects.

Experiment 2

Subjects: Effects of RE training were examined in 21 males (age=23.7±2.5yr, BMI=24.2±2.7kg/m2) who had no special medical disorders in musculoskeletal, cardiovascular, and respiratory systems and had not done any regular resistance exercise in the last 2 years. The subjects were separated into 3 groups; 80FAIL (n=7, age=24.5±1.8yr, BMI=25.9±3.9kg/m2), 30WM (n=7, age=23.1±2.0yr, BMI=25.0±3.1kg/m2), and 30FAIL (n=7, age=23.0±1.2yr, BMI=24.4±1.3kg/m2).

Exercise protocol: All subjects performed 3 repeated sets of leg press, leg extension, and leg curl three times per week for 10 weeks in Experiment 2. Considering the risk of injury to subjects who had not performed resistance exercise before, 1RM was determined by using the indirect measurement method suggested in a previous report [14]. The 80FAIL group exercised at 80% of 1RM until they could not keep producing muscular contractions in every set, the 30WM group performed the total workload matching that of the 80FAIL, and the 30FAIL group exercised at 30% of 1RM until failure. For example, total work volume performed in leg press was 2,358-3,030, 2,495-3,060, and 2,995-3,588 kg/set in 80FAIL, 30WM, and 30FAIL, respectively (see Ref. 12 for more details).

Collection of muscle biopsy samples: Muscle biopsy was sampled from the mid belly of the vastus lateralis muscle by aforementioned procedures prior to training (pre-RE training), and 72 hours after the final session of RE (post-RE training). Nine biopsy samples were randomly collected from 3 groups (21 subjects) as samples from individuals subjected to RE training, and were used to analyze gene expressions in the present study, because the main effect test by two-way ANOVA tested in all groups found difference in muscle fiber size by time (pre vs. post) (see Ref. 12 for precise results of each group). Further, 3 of 9 biopsies were selected to analyze histone modifications. Throughout the analysis of biopsies obtained from Experiment 2, biopsies of pre- and post-RE training were selected from same subjects.” in line 5 of page 5 to line 19 of page 6.

Comments:

Please add page numbers to make review more efficient.

Responses:

We are sorry to miss page numbers. The revised version of manuscript was added page numbers.

Comments:

Please indicate the number of subjects, age, height, and body mass of each group of men. Example: “Healthy male adults were assigned to acute RE (n= , age= y, BIM= kg/m2) or RE training (n= , age= y, BIM= kg/m2) groups.”

Responses:

Physical information of subjects were added in abstract as “Healthy male adults were assigned to acute RE (n=9, age=20.5±4.3yr, BMI=28.0±6.8kg/m2) or RE training (n=21, age=23.7±2.5yr, BMI=24.2±2.7kg/m2) groups.” in line 5-7 of page 2.

Comments:

Please add more informative data to the results sections of the abstract. Please indicate the fold-increase/decrease (or percent change) of significant variables to give the readers more information up front. Example: “Up-regulation of acetylated histone 3 (H3) (+235%) and H3 …”.

Responses:

Abstract was revised to include more informative data as “RNA sequencing analysis revealed that 153 genes with GO terms including muscle development, stress response, metabolism, cell death, and transcription factor were significantly up-regulated (+291% vs. pre-acute RE) upon acute RE. Expressions of these genes were also greater (+9.6% vs. pre-RE training, p<0.05) after RE trained subjects. Significant up-regulation of acetylated histone 3 (H3) (+235%) and H3 mono-methylated at lysine 4 (+290%) and tri-methylated at lysine 27 (+849%), and down-regulation of H3.3 variant (−39%) distributions relative to total H3 were observed at transcriptionally activated loci after acute RE compared to pre-acute RE levels. Interestingly, the distribution of acetylated H3 was found to be up-regulated as compared to the level of total H3 after RE training (+40%, p<0.05).” in line 8-17 of page 2.

Comments:

Paragraph 1, Line 3: Amend sentence to: “…muscle fiber hypertrophy induced upon by resistance exercise (RE) training.”

Responses:

The sentence was revised to “Bammam et al. [1] reported that subjects were classified into extreme responders, modest responders, and non-responders depending on the magnitude of muscle fiber hypertrophy induced upon by resistance exercise (RE) training.” in line 2-5 of page 3.

Comments:

Paragraph 2: It is described here that different fiber types show different histone modification patterns. Fiber type distributions differ significantly among humans (even in the same muscle), and fiber type was not reported in the current article. Homogenizing samples with different fiber type proportions could have confounding effects on the data. In future studies, fiber type should be reported between pre vs post RE training groups, or single fibers should be isolated and pooled to get a more accurate representation of what is happening at the muscle cell level (see this paper that did fiber type specific analysis of DNA methylation in human muscle: (Begue et al. 2017). The limitation of analyzing homogenized samples should be mentioned in the Methods or discussion.

Responses:

Sentences were added in second paragraph of introduction as “Begue et al. [6] demonstrated fiber type-specific DNA methylation in human skeletal muscle, showing CpG sites of genes selectively expressed in type 1 or IIa myosin heavy chain fibers were hypomethylated. These data suggested that epigenetic regulation based on muscle fiber type characteristics affected the responsiveness of genes to exercise.” in line 20-23 of page 3.

New sub-section “Limitation of analysis” was also added in discussion, and stated as “The present study shared human biopsy samples with the original research group, whose data were published in Ref. 12 and 13. Since scientific significance would be maximized if histone modifications were measured using the samples that was enough analyzed in histochemical characteristics, and protein expressions, the present study was motivated to analyze the remaining biopsy samples. However, because of limited volume of samples remaining, we could not analyze all samples individually. Therefore, 9 biopsies were randomly chosen in Experiment 2, furthermore, 3 of 9 biopsies were selected for ChIP and western blot analysis in both experiments. But, the biopsies of pre- and post-groups in both Experiment 1 and 2 were selected from same subjects.

Epigenetic regulation differs between muscle fiber types [6]. For an essential manner analyzing data, in the present study histone modifications should have analyzed in single muscle fibers. However, that was technically difficult because the analysis needed much tissue volume. Therefore, the results of the present study discuss as changes of whole muscle homogenate including both slow- and fast-twitch fibers.” in line 2-14 of page 12.

Comments:

In the last paragraph of the introduction, there is a disconnect between going from animal studies, to human studies. I feel that a sentence or two need to be added stressing that very few studies have been conducted investigating epigenetics in human muscle after acute RE and/or RE training.

Responses:

Thank you for suggesting the example of sentences. The last paragraph of introduction was revised as “We further reported that endurance exercise training decreased the responsiveness of genes to muscular unloading in association with enhanced incorporation of histone variant H3.3 into nucleosomes in the plantaris muscle of rats. This indicated that endurance exercise training stimulated turnover of histones [7], but it is currently unclear how RE affects the distribution of histones and their modification patterns in animal models. Furthermore, even less research has been conducted on the epigenetic response to RE in human skeletal muscle [8-11]. Therefore, the present study built upon the animal literature, and aimed to investigate the response of gene expression profiles and histone modifications in human muscle before and after 1) acute RE and 2) chronic RE training.” in line 24 of page 3 to line 5 of page 4.

Comments:

Please indicate the static at software package used to analyze these data.

Responses:

Statistics section was revised as “Statistical analysis was performed using BellCurve for Excel (Social Survey Research Information Co., Ltd.). For the data analysis of RNA-seq, all FPKM values were compared in same genes between all experimental groups, and calculate a correlation coefficient (R2) (Fig. 1). FPKM values were normalized using the median within each gene, and averaged in up- or down-regulated genes (Fig. 2). For ChIP data, a boxplot was used to display the distribution of the data obtained from each gene (Figs. 5 and 6). Values plotted in the figures 2, 5, 6, and 7 were compared to determine the significant differences only between pre- and post-acute RE or RE training. Because the data of pre- and post-groups were obtained from same subjects in both Experiment 1 and 2, significant differences were examined using a paired t-test. Differences were considered significant at p<0.05.” in line 21 of page 9 to line 3 of page 10.

Comments:

Paragraph 1: Add a period after this sentence: “however, are reportedly up- or downregulated

in hypertrophic or atrophic conditions in skeletal muscles of rodents [14-17].”

Responses:

The sentence was revised as “For example, stress-responsive proteins coded by genes such as Cryab, Dnajb, Hspa1a and Hspb1 function as molecular chaperones, however, are reportedly up- or down-regulated in hypertrophic or atrophic conditions in skeletal muscles of rodents [19-22].” in the bottom line of page 12.

Comments:

Write “RE Training” throughout all figures (to be similar to “Acute AE”).

Responses:

“Training” was reworded to “RE training” throughout all figures.

Attachment

Submitted filename: Responses to Reviewer 2 12-23-2019.docx

Click here for additional data file. (21.9KB, docx)

Decision Letter 1

Stephen E Alway

17 Feb 2020

PONE-D-19-25531R1

Adaptive responses of histone modifications to resistance exercise in human skeletal muscle

PLOS ONE

Dear Dr Kawano,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit and both expert Reviewers provided positive support for your paper. However, a few minor things remain to be addressed which means that the paper does not fully meet PLOS ONE’s publication criteria as it currently stands yet but we believe that it will with the accompanying revisions. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Apr 02 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Stephen E Alway, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

Reviewer #2: The authors have successfully addressed my previous comments/concerns.

However, this manuscript contains numerous grammatical errors (see examples below). I reccomend that the paper be re-reviewed for grammar by a native English speaker.

Examples:

Abstract

Remove "in the": "Exercise training causes epigenetic changes in skeletal muscle, although it is unclear how

resistance exercise (RE) affects in the histone modifications."

Should be "alters": "These results indicated that a single bout of RE drastically alter both

gene expressions and histone modifications in human skeletal muscle."

Add "is" to this sentence: " It was also suggested that enhanced histone acetylation closely related to up-regulation of gene expressions after RE training."

Discussion:

A lot of the "Limitations of analysis" section needs to be reworded to be grammatically correct. Example sentence that does not make sense: "Since scientific significance would be maximized if histone modifications were measured using the samples that was enough analyzed in histochemical characteristics, and protein expressions, the present study was motivated to analyze the remaining biopsy samples."

The section titled "Fundings" should just be "Funding".

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Jarrod A Call

Reviewer #2: Yes: James R. Bagley, PhD

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Apr 9;15(4):e0231321. doi: 10.1371/journal.pone.0231321.r004

Author response to Decision Letter 1

22 Feb 2020

Responses to Reviewer 2:

Thank you for your advice for English grammar of our manuscript. Grammatical errors were corrected using a commercial English editing service. Certificate of the service is also attached to this revision.

Comment:

Remove "in the": "Exercise training causes epigenetic changes in skeletal muscle, although it is unclear how resistance exercise (RE) affects in the histone modifications."

Response:

The sentence was revised to “Exercise training causes epigenetic changes in skeletal muscle, although it is unclear how resistance exercise (RE) affects histone modifications.” in line 2-3 of page 2.

Comment:

Should be "alters": "These results indicated that a single bout of RE drastically alter both

gene expressions and histone modifications in human skeletal muscle."

Response:

The sentence was revised to “These results indicate that a single bout of RE drastically alters both gene expressions and histone modifications in human skeletal muscle.” in line 17-18 of page 2.

Comment:

Add "is" to this sentence: " It was also suggested that enhanced histone acetylation closely related to up-regulation of gene expressions after RE training."

Response:

The sentence was revised to “It is also suggested that enhanced histone acetylation is closely related to up-regulation of gene expressions after RE training.” in line 18-19 of page 2.

Comment:

A lot of the "Limitations of analysis" section needs to be reworded to be grammatically correct. Example sentence that does not make sense: "Since scientific significance would be maximized if histone modifications were measured using the samples that was enough analyzed in histochemical characteristics, and protein expressions, the present study was motivated to analyze the remaining biopsy samples."

Response:

This sentence was deleted from the Discussion.

Comment:

The section titled "Fundings" should just be "Funding".

Response:

The section title was corrected to “FUNDING” in page 17.

Attachment

Submitted filename: Responses to Reviewer 2 2-22-2020.docx

Click here for additional data file. (15.7KB, docx)

Decision Letter 2

Stephen E Alway

23 Mar 2020

Adaptive responses of histone modifications to resistance exercise in human skeletal muscle

PONE-D-19-25531R2

Dear Dr. Kawano,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Stephen E Alway, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: Yes: James R. Bagley

Acceptance letter

Stephen E Alway

25 Mar 2020

PONE-D-19-25531R2

Adaptive responses of histone modifications to resistance exercise in human skeletal muscle

Dear Dr. Kawano:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Stephen E Alway

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 File

    (ZIP)

    Click here for additional data file. (18.6MB, zip)
    S2 File

    (XLSX)

    Click here for additional data file. (389KB, xlsx)
    S3 File

    (XLSX)

    Click here for additional data file. (24.5KB, xlsx)
    S1 Raw images

    (PDF)

    Click here for additional data file. (1.7MB, pdf)
    Attachment

    Submitted filename: Responses to Reviewer 2 12-23-2019.docx

    Click here for additional data file. (21.9KB, docx)
    Attachment

    Submitted filename: Responses to Reviewer 2 2-22-2020.docx

    Click here for additional data file. (15.7KB, docx)

    Data Availability Statement

    Raw data for RNA-seq are available in the National Center for Biotechnology Information (NCBI) Bio Project (ID: PRJNA560308) database. Summary of full data obtained from RNA-seq is also available in Supporting Information.

    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES