Skip to main content
PLOS One logoLink to PLOS One
. 2020 Apr 9;15(4):e0230579. doi: 10.1371/journal.pone.0230579

Tick-borne pathogens in Ixodes ricinus ticks collected from migratory birds in southern Norway

Benedikte N Pedersen 1,*, Andrew Jenkins 1,*, Vivian Kjelland 2,3,¤
Editor: Brian Stevenson4
PMCID: PMC7145107  PMID: 32271774

Abstract

Birds are important hosts for the first life stages of the Ixodes ricinus tick and they can transport their parasites over long distances. The aim of this study was to investigate the prevalence of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Neoehrlichia mikurensis and Rickettsia helvetica in ticks collected from migratory birds in Norway. A total of 815 Ixodes ricinus ticks from 216 birds trapped at Lista Bird Observatory in southern Norway during spring and autumn migration in 2008 were analysed by real-time PCR. B. burgdorferi s. l. was the most prevalent pathogen, detected in 6.1% of the ticks. The prevalence of N. mikurensis, A. phagocytophilum and R. helvetica was 1.2%, 0.9% and 0.4% respectively. In addition, one sample (0.1%) was positive for B. miyamotoi. In total, 8.2% of the ticks were infected with at least one pathogen. Co-infection with B. burgdorferi s. l. and N. mikurensis or A. phagocytophilum was found in 6.0% of the infected ticks. Our results show that all the known major tick-borne bacterial pathogens in Norway are subject to transport by migratory birds, potentially allowing spread to new areas. Our study showed a surprisingly high number of samples with PCR inhibition (57%). These samples had been extracted using standard methodology (phenol-chloroform extraction). This illustrates the need for inhibition controls to determine true prevalence rates.

Introduction

The tick Ixodes ricinus is the main vector of several pathogens important for human and animal health in Europe. Passerine birds are significant hosts for the first life stages of I. ricinus and migratory birds may transport parasites across continents along the migration routes [1, 2]. Several studies from Europe have investigated tick-borne pathogens transported by migrating birds and Borrelia burgdorferi sensu lato (s. l.), Rickettsia helvetica, Anaplasma phagocytophilum and Neoehrlichia mikurensis are some of the pathogens detected in I. ricinus ticks feeding on birds [36].

One of the most important tick-borne pathogens and the causative agent of Lyme disease is B. burgdorferi s. l. The prevalence of the spirochete in I. ricinus feeding on birds is normally lower than 30% [69], however, infection rates exceeding this has been reported occasionally [3, 5]. B. garinii and B. valaisiana are the most prevalent of the Borrelia species detected in ticks feeding on birds [3, 6], and the blackbird (Turdus merula) and song thrush (T. philomeus) are assumed to be reservoir hosts for these species [10, 11].

One of the most prevalent tick-borne pathogens in questing I. ricinus in Norway is N. mikurensis [1214], although, so far only one case of neoehrlichiosis has been reported in this country [15]. N. mikurensis is detected in I. ricinus collected from birds, and the prevalence is typically below 5% [3, 5, 16], but N. mikurensis has so far not been detected in blood samples from passerine birds [17]. Furthermore, a study investigating the great tit (Parus major) failed to find evidence of amplification and transmission [18].

Tick-borne fever, or anaplasmosis, in ruminants is caused by A. phagocytophilum. Tick-borne fever is common in sheep in Norway, and the disease is found in herds grazing on tick infested pastures [19, 20]. The prevalence of the bacterium in I. ricinus ticks feeding on birds is typically below 5% [3, 57]. A. phagocytophilum has also been detected in blood samples from passerine birds, suggesting they are capable of transmitting the bacterium to ticks [17, 21]. However, the importance of birds for the infectious cycle of A. phagocytophilum is unclear.

The only bacterium in the spotted fever group Rickettsiae detected in Norway so far is R. helvetica [22], Kjelland, Myre, Pedersen, Kloster, & Jenkins, Submitted manuscript). Although the bacterium is present in questing ticks in Norway no cases of rickettsiosis have been reported so far. Prevalences ranging from about 10% to 20% of R. helvetica in I. ricinus collected from birds are reported in Europe [3, 57]. It has been demonstrated that the great tit (Parus major) facilitates transmission of R. helvetica to I. ricinus [18]. The bacterium has been detected in blood samples from other passerine birds, indicating a potential reservoir capacity [17]. Although further research is necessary to determine to which degree birds contribute to the infection of ticks, they are important for the epidemiological distribution of R. helvetica.

Previously in Norway, three studies have investigated tick-borne pathogens transported by migrating birds, focusing on B. burgdorferi s. l. or A. phagocytophilum [4, 8, 23]. Studies of more recently identified pathogens in this region are absent. Kjelland et al. [4] have previously studied the prevalence of B. burgdorferi s. l. in ticks collected from migratory birds in southern Norway. The present work is an extension of the latter study, aimed at bird contribution to dispersal of tick-borne bacteria, by further investigating the same sample material for A. phagocytophilum, N. mikurensis and R. helvetica, and determining the prevalence of co-infection.

Materials and methods

Bird trapping, collection of ticks and preparation of samples have been described previously by Kjelland et al. [4]. Briefly, 6538 birds were trapped at Lista Bird Observatory in southern Norway during spring (April to June) and autumn (July to November) migration in 2008. The birds were trapped for ringing and an ethics approval was not needed. Birds were examined and ticks were removed from both migratory and resident species. The sample material included a total of 815 ticks, whereof 201 ticks were collected from 64 birds during spring migration and 614 ticks were collected from 152 birds during autumn migration. Only larval and nymphal I. ricinus were found. DNA was extracted by the phenol-chloroform method and analysed for B. burgdorferi s. l.

In the present study, the ticks were investigated for N. mikurensis, R. helvetica, and A. phagocytophilum. Real-time PCR methods for detection of the pathogens were performed as described previously [12, 24, Kjelland, Myre, Pedersen, Kloster, & Jenkins, Submitted manuscript]. Synthetic plasmids were used as positive controls for A. phagocytophilum and N. mikurensis real-time PCR; a synthetic plasmid or a known positive sample was used as control for R. helvetica in real-time PCR and pyrosequencing. Nuclease free water was used as negative control and included in all analyses. All primers and probes used in this study are listed in Table 1.

Table 1. Sequences for primers and probes used in present study.

Primers and probes Sequence 5’ to 3’ Reference
N. mikurensis forward primer (Neo2F) GCAAATGGAGATAAAAACATAGGTAGTAAA [12]
N. mikurensis reverse primer (Neo2R) CATACCGTCAGTTTTTTCAACTTCTAA [12]
N. mikurensis probe (Neo2M) FAM-TTACAGTTGAGGAAAGTAAGGGA(MGB) [12]
R. helvetica forward primer (RhF) CCGTTTAGGTTAATAGGCTTCGG Kjelland, Myre, Pedersen, Kloster, & Jenkins, Submitted manuscript
R. helvetica forward primer, biotin labelled CCGTTTAGGTTAATAGGCTTCGG Kjelland, Myre, Pedersen, Kloster, & Jenkins, Submitted manuscript
R. helvetica reverse primer (RhR) CCGAGTTCCTTTAATACTTCCTTACA Kjelland, Myre, Pedersen, Kloster, & Jenkins, Submitted manuscript
R. helvetica probe (RhM) VIC-CGATCCACGTGCCGCAGTACT(MGB) Kjelland, Myre, Pedersen, Kloster, & Jenkins, Submitted manuscript
A. phagocytophilum forward primer (ApF) TTTTGGGCGCTGAATACGAT [24]
A. phagocytophilum reverse primer (ApR) TCTCGAGGGAATGATCTAATAACGT [24]
A. phagocytophilum probe (ApM) FAM-TGCCTGAACAAGTTATG(MGB) [24]
B. burgdorferi s. l. 16S rDNA forward primer (LBf) GCTGTAAACGATGCACACTTGGT [25]
B. burgdorferi s. l. reverse 16S rDNA primer (LBr) GGCGGCACACTTAACACGTTAG [25]
B. burgdorferi s. l. probe 16S rDNA (LBp) FAM-TTCGGTACTAACTTTTAGTTAA(MGB) [25]
Borrelia spp forward primer 1 (IGS F) GTATGTTTAGTGAGGGGGGTG [26]
Borrelia spp reverse primer 1 (IGS R) GGATCATAGCTCAGGTGGTTAG [26]
Borrelia spp nested forward primer 2(IGS Fn) AGGGGGGTGAAGTCGTAACAAG [26]
Borrelia spp nested reverse primer 2 (IGS Rn) GTCTGATAAACCTGAGGTCGGA [26]

Samples found negative for all pathogens were tested for inhibition. This was done by performing the A. phagocytophilum real-time PCR on the sample, using a master mix spiked with positive control, to ensure a positive result in non-inhibitory samples. All samples with Ct-values higher than the control itself were considered inhibitory. These samples were diluted 1:10, rechecked again for inhibition and thereafter reanalysed for all pathogens. The assays for detection of R. helvetica and A. phagocytophilum were at this point optimized for multiplexing. Every multiplex reaction was 15μl and included 7.5μl of 2x TaqMan Universal MasterMix (Applied Biosystems, Foster City, CA), 300nM of ApF and ApR, 250nM of ApM-FAM, 250nM of RhF and RhR, 300nM RhM-VIC, and 3μl of template DNA. The cycling parameters were as follows: 2 min at 50°C, 95°C for 10 min, then 45 cycles of 95°C for 15 s and 60°C for 1 min.

For confirmation, samples positive in the multiplex assay were reanalysed for both bacteria in individual reactions. Real-time PCR for detection of R. helvetica were performed with biotin labelled RhF and positive samples were subject to pyrosequencing on the Pyromark Q24 (Qiagen GmbH, Hilden, Germany) using Pyrogold reagents and primer RhR as previously described (Kjelland, Myre, Pedersen, Kloster, & Jenkins, Submitted manuscript). Inhibitory samples were also reanalysed for B. burgdorferi s. l. by real-time PCR and positive samples were confirmed by sequencing as previously described [4].

The chi-square test was performed using R v3.6.1 to determine significant difference in pathogen prevalence between spring and autumn migration.

Results

In total, 17.1% (37/216) of the birds carried infected ticks, and 8.2% (67/815) of the ticks harboured tick-borne pathogen(s). The prevalence of pathogens was 10.9% (22/201) and 7.3% (45/614) during spring and autumn migration, respectively. This difference was not statistically significant (p = 0.1052). Because of the low number of positive samples, statistical testing for the individual pathogens was not attempted.

Initially, 771 of 815 samples were negative for all pathogens and of these 467 inhibited the PCR reaction, representing more than half (57%) of the material. Reanalysis of the inhibitory samples after dilution revealed additional pathogen-infected ticks. This increased the prevalence of B. burgdorferi s. l. from 4.4%, as previously published [4], to 6.1% (50/815).

The prevalence of B. burgdorferi s. l. during spring and autumn migration was 5.5% (11/201) and 6.4% (39/614), respectively (Tables 2 and 3). Both larvae (34%) and nymphs (66%) were infected. The genospecies of B. burgdorferi s. l. included B. garinii (60%), B. valaisiana (18%), B. afzelii (18%) and B. burgdorferi s. s. (2%). One sample could not be differentiated between B. afzelii or B. spielmanii due to low sequence quality and few differences in the sequenced region between the two Borrelia species. Ticks infected with B. burgdorferi s. l. were collected from eleven bird species (Table 4).

Table 2. Tick parasitisation of birds and prevalence of Neoehrlichia mikurensis, Rickettsia helvetica, Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato in Ixodes ricinus collected from birds, spring 2008.

Bird species No of birds parasitised/ no of birds a No. of nymphs examined No. of larva examined N. mikurensis (nymphs/larvae) R. helvetica (nymphs/larvae) A. phagocytophilum (nymphs/larvae) B. burgdorferi s. l. (nymphs/larvae)
Migrating birds
Acrocephalus arundinaceus 1/1 1 1 (1/-)
Acrocephalus palustris 1/5 1
Acrocephalus scirpaceus 1/3 1
Sylvia borin 1/17 1
Sylvia communis 3/28 4 1
Luscinia svecica 1/1 1
Carduelis cannabina 1/19 1
Carduelis cabaret 1/1 1
Carpodacus erythrinus 1/4 1
Coccothraustes coccothraustes 1/1 2
Phylloscopus collybita b 1/65 1
Sylvia atricapilla b 1/43 1
Erithacus rubecula b 24/232 22 27 2 (2/-) 1 (1/-)
Turdus iliacus b 1/4 7 1 3 (3/-) 2 (2/-)
Turdus merula b 12/77 69 14 2 (2/-) 1 (1/-) 1 (1/-) 5 (5/-)
Turdus pilaris b 3/29 4 1 (1/-)
Turdus philomelos b 2/17 11 3
Fringilla coelebs b 1/14 1
Prunella modularis b 5/32 20 3 1 (1/-) 2 (2/-)
Sturnus vulgaris b 1/16 1
Resident birds
Carduelis carduelis 1/5 1 1 (1/-)
Total 64/614 149 52 4 (4/-) 3 (3/-) 5 (5/-) 11 (11/-)

a The number of parasitised birds was previously published by Kjelland et al. (4).

b Migratory birds, but some individuals may overwinter.

Table 3. Tick parasitisation of birds and prevalence of Neoehrlichia mikurensis, Rickettsia helvetica, Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato in Ixodes ricinus collected from birds, autumn 2008.

Bird species No. of birds parasitised/ no. of birds a No. of nymphs examined No. of larvae examined N. mikurensis (nymphs/larvae) R. helvetica (nymphs/larvae) A. phagocytophilum (nymphs/larvae) B. burgdorferi s. l. (nymphs/larvae) B. miyamotoi (nymphs/larvae)
Migrating birds    
Acrocephalus scirpaceus 1/5 1
Phylloscopus trochilus 24/440 23 21 1 (1/-) 2 (2/-)
Sylvia curruca 3/32 1 3
Sylvia communis 17/93 18 31 3 (2/1)
Motacilla flava 1/3 1
Oenanthe oenanthe 1/99 1
Carduelis cabaret 2/8 2 2
Carduelis cannabina 1/41 1
Anthus trivialis 7/19 10 8 1 (1/-)
Sylvia atricapilla b 6/135 5 10
Erithacus rubecula b 5/179 4 10
Turdus iliacus b 2/64 12 4 10 (7/3)
Turdus pilaris b 2/48 7
Turdus philomelos b 3/48 8 9 2 (-/2)
Turdus merula b 10/161 32 12 3 (3/-) 1 (1/-) 10 (7/3)
Emberiza schoeniclus b 2/26 2 1
Fringilla coelebs b 50/258 39 314 3 (2/1) 10 (3/7) 1 (-/1)
Fringilla montifringilla b 1/48 1 2
Anthus pratensis b 2/59 1 1
Resident birds
Cyanistes caeruleus 4/1325 5 1
Lophophanes cristatus 1/52 1
Parus major 1/147 1
Carduelis chloris 1/99 1
Troglodytes troglodytes 4/150 1 5 1 (-/1)
Not identified 1/1 2
Total 152/3539 174 440 6 (5/1) 0 2 (2/-) 39(22/17) 1 (-/1)

a The number of parasitised birds was previously published by Kjelland et al. (4).

b Migratory birds, but some individuals may overwinter.

Table 4. Borrelia species in Borrelia infected Ixodes ricinus ticks.

Bird species Borrelia infected ticks B. garinii (nymphs/larvae) B. valaisiana (nymphs/larvae) B. afzelii (nymphs/larvae) B. burgdorferi s. s. (nymphs/larvae) B. miyamotoi (nymphs/larvae) Undetermined (nymphs/larvae)
Anthus trivialis 1 1 (1/-)
Erithacus rubecula 1 1 (1/-)
Fringilla coelebs 11 9(2/7) 1 (1/-) 1 (-/1)
Phylloscopus trochilus 2 1 (1/-) 1 (1/-)
Prunella modularis 2 1 (1/-) 1 (1/-)
Sylvia communis 3 1 (1/-) 1 (1/-) 1 (1/-)
Troglodytes troglodytes 1 1 (-/1)
Turdus iliacus 12 12 (9/3)
Turdus merula 15 3 (2/1) 9 (7/2) 3 (3/-)
Turdus philomelos 2 2 (-/2)
Turdus pilaris 1 1 (1/-)
Total 51 30 (17/13) 9 (7/2) 9 (8/1) 1 (1/-) 1 (-/1) 1 (1/-)

In total, 1.2% (10/815) of the ticks were infected with N. mikurensis. The prevalence during spring and autumn migration was 2.0% (4/201) and 1.0% (6/614), respectively. One of the positive ticks was a larva co-infected with B. garinii. It was collected from a chaffinch (Fringilla coelebs). Nine other ticks were found on the same bird, but all were uninfected. In two cases, two positive nymphs were found on the same bird, a blackbird (Turdus merula) and a chaffinch (F. coelebs), respectively. Nymphs infected with N. mikurensis were also found on dunnock (Prunella modularis) and great reed warbler (Acrocephalus arundinaceus).

Anaplasma phagocytophilum was detected in 0.9% (7/815) of the ticks, whereof all were nymphs. The prevalence was 2.5% (5/201) and 0.3% (2/614) during spring and autumn migration, respectively. Three of the infected ticks collected during spring migration were collected from the same bird, a redwing (T. iliacus), which hosted a total of eight ticks. A. phagocytophilum infected ticks were also collected from goldfinch (Carduelis carduelis), blackbird (T. merula) and willow warbler (Phylloscopus trochilus).

The prevalence of R. helvetica was 0.4% (3/815). All three infected ticks were nymphs collected during spring migration. The ticks were collected from the bird species blackbird (T. merula) and European robin (Erithacus rubecula).

Although the Borrelia real-time PCR used targets the Lyme Borreliae (B. burgdorferi s. l.), one sample infected with a relapsing fever Borrelia (B. miyamotoi) was also detected. This tick larva was collected from a chaffinch (F. coelebs) during autumn migration. This bird had the highest tick infestation (n = 56) in the study. One other tick (a nymph) from this bird was infected with B. afzelii.

The prevalence of co-infection in infected ticks was 6.0% (4/67). These ticks were co-infected with either B. garinii and N. mikurensis (n = 2, 1 nymph, 1 larva), B. garinii and A. phagocytophilum (n = 1, nymph), or B. afzelii and N. mikurensis (n = 1, nymph).

Discussion

Ticks collected from birds during spring and autumn migration in southern Norway were investigated for infection with B. burgdorferi s. l., A. phagocytophilum, N. mikurensis and R. helvetica. So far, only a few studies have investigated the tick-borne pathogens transported by avian hosts in this region, and the current study adds new information to this subject. Our study is the first to report N. mikurensis, R. helvetica and B. miyamotoi infection in ticks collected from birds in Norway.

The sample material has previously been investigated for B. burgdorferi s. l. and in the original study [4], DNA from the ticks was extracted using the phenol-chloroform method. However, a high percentage of PCR inhibition with this method has previously been reported [12]. For this reason, the samples were tested for inhibition, diluted and reanalysed for B. burgdorferi s. l. This enabled the detection of the spirochete in an additional 14 ticks, increasing the prevalence from 4.4%, as previously published [4], to 6.1%. Phenol and ethanol are PCR inhibitors if not completely removed during extraction [27]. This DNA extraction method is widely used [12, 2830], and underestimation of prevalence of tick-borne pathogens in studies using this procedure is possible, unless methods to detect inhibition are applied. Further, engorged ticks contain blood, and blood also contains factors that may lead to inhibition of the PCR reaction [27]. Hence, quality control of the sample material to exclude inhibition is important for true prevalence estimations and reliable results.

The prevalence of B. burgdorferi s. l. detected in this study (6.1%) is lower than what is reported in ticks collected from birds from other European countries [3, 5, 6, 11]. A previous study investigating B. burgdorferi s. l. in ticks collected from migratory birds captured at the same site as in the present study reported a prevalence of 6.1% (8), which corresponds exactly with our results. The same study reported a higher prevalence at more easterly located bird observatories (13.3%) and concluded that this difference might be due to the low prevalence of B. burgdorferi s. l. in Great Britain [8, 31], whence many of the birds trapped at Lista Bird Observatory most likely migrate. The prevalence of B. burgdorferi s. l. in questing ticks in southern Norway ranges from 15% to 30% depending on study area [14, 32], and if the ticks were locally recruited by reservoir host birds for B. burgdorferi s. l. a higher prevalence might have been expected, although a borreliacidal effect of bird blood [33] cannot be excluded.

Of the Borrelia species investigated in this study, B. garinii was the most prevalent (60%) which is in accordance with other European studies [3, 6]. The blackbird and song thrush (both Turdus species) are known reservoir hosts for B. garinii [10, 11], and other bird species may have the same potential. In present study, larvae and nymphs infected with B. garinii were collected from eight bird species, whereof four were Turdus species. The other species were dunnock (Prunella modularis), chaffinch (F. coelebs), tree pipit (Anthus trivialis) and whitethroat (Sylvia communis). The infected larvae were collected from chaffinch (F. coelebs), in addition to Turdus species. Transovarial transmission of B. burgdorferi s. l. is rare or absent [34, 35], and the larvae are most likely infected through feeding, indicating that also chaffinch (F. coelebs) may contribute to the transmission of B. garinii. Of the pathogens investigated here, transovarial transmission has only been demonstrated for R. helvetica [36], and to a lesser extent B. miyamotoi [34], and for A. phagocytophilum only in the tick Dermacentor albipictus [37]. Apart from R. helvetica, the transmission rate for these pathogens is low, and the main route of infection is by feeding.

In the present study, the detected prevalence of N. mikurensis was 1.2%. In European countries, between 1.7% and 4.4% of ixodid ticks feeding on birds are infected with N. mikurensis [3, 5, 6, 16]. The prevalence in questing ticks in European countries, including Norway, ranges from <1 to >20%, depending on study area [1214, 38]. However, N. mikurensis has not been detected in ticks in Great Britain [31, 39, 40], and migration from Great Britain may consequently lead to a low prevalence of the pathogen in ticks from birds trapped at Lista Bird Observatory during spring migration. However, in addition to blackbirds (T. merula), which mainly migrate to Norway from low prevalence areas in Great Britain, ticks infected with N. mikurensis were also collected from other bird species (e. g. P. modularis) which mainly migrate from mainland Europe [41] and a low prevalence of N. mikurensis infected ticks were seen also in these birds.

In the current study, N. mikurensis was detected in a larva collected from a common chaffinch (F. coelebs). N. mikurensis-infected larval I. ricinus feeding on Eurasian wren (Troglodytes troglodytes) and redwing (T. iliacus) have previously been reported by Heylen et al. [3]. Since transovarial transmission of N. mikurensis is assumed not to occur, infection is likely to have occurred during feeding [12, 16, 40]. Ticks cluster around the bird’s beak which may facilitate co-feeding [42]. If the larva did not acquire the bacterium from the bird, it might be explained by transmission via co-feeding, where an infected nymph may have transmitted the pathogen to the larvae and dropped off before tick-collection. However, evidence of birds facilitating co-feeding transmission or as reservoir hosts for N. mikurensis is lacking [17, 18], and more studies are needed to understand the importance of birds for the epidemiology of this pathogen. Furthermore, the low prevalence of N. mikurensis in ticks feeding on birds during autumn migration compared to the prevalence in questing ticks in the region, raise the question if passerine birds are incompetent reservoir hosts or not part of the transmission cycle of this pathogen. It has been suggested that B. afzelii are killed in I. ricinus that feed on pheasants [33], but whether similar mechanisms apply for N. mikurensis and passerine birds needs to be investigated.

Prevalence found in previous studies of A. phagocytophilum in ticks collected from birds in Europe ranges from 0 to 5% [3, 5, 6]. Our finding (0.9%) is within that range. Prevalence in questing ticks in Western Europe, including the UK, is typically below 10%, but prevalence >20% is also reported [19]. In southern Norway, prevalences between 1% and 2% have been found in questing ticks [14, 43]. In this study, A. phagocytophilum was detected in three ticks collected from a single redwing (T. iliacus), which may be a result of the host being infectious or, alternatively, a result of co-feeding. However, they were all nymphs and may have been infected during their previous blood meal. A few cases of birds infected with A. phagocytophilum have been reported [17, 44], which indicates the possibility of transmission to feeding ticks. However, the importance of birds for the infection cycle of A. phagocytophilum seems to be minor, although this is unclear and needs further investigation.

Only three ticks (0.4%) were infected with R. helvetica, all collected during spring migration. The three nymphs were collected from European robin (E. rubecula) and blackbird (T. merula), which mainly migrate to Norway from Great Britain and Western Europe [41]. The prevalence, 0.4%, is low compared to studies conducted in Europe, both in questing ticks [45, 46] and in ticks collected from birds [3, 17]. In Great Britain, a study reported a widespread distribution of R. helvetica in 4/116 questing I. ricinus [47]. Studies from southern Norway indicate that less than 2% of questing ticks are infected in the region where this current study was conducted (22, Kjelland, Myre, Pedersen, Kloster, & Jenkins, Submitted manuscript).

A larva collected from a chaffinch (F. coelebs) was infected with B. miyamotoi. This was a chance observation as the applied method is not optimized to detect this species; systematic investigations are thus likely to detect higher prevalences. B. miyamotoi has previously been found in spleen from a great tit (P. major) and a European greenfinch (Carduelis chloris) indicating systemic infection [48]. However, low prevalence (< 1%) is reported in ticks collected from different bird species [3, 6], demonstrating low transmission efficiency. Further studies are necessary to determine the importance of birds for the transmission cycle of this bacterium. B. miyamotoi is widespread in questing ticks in southern Norway, however a low prevalence (less than 1.5%) is reported [14, 49], and the reported prevalence in Europe is less than 4% [31, 45, 50, 51].

In humans, simultaneous infection with B. burgdorferi s. l. and other tick-borne pathogens are reported and this is suggested to make the disease more severe and/or prolonged [52, 53]. We observed ticks co-infected with N. mikurensis and B. burgdorferi s. l, and A. phagocytophilum and B. burgdorferi s. l. A previous study of questing ticks in Norway detected a high prevalence of co-infection with N. mikurensis and B. afzelii [14]. Correlation between N. mikurensis and B. burgdorferi s. l. has also been detected in ticks from birds [3]. We detected only three ticks with this combination and no association could be established. However, due to the small number of infections detected, such an association cannot be excluded.

Although all but one (a goldfinch, Carduelis carduelis) of the birds on which ticks were found were migratory species, it is not necessarily the case that the ticks were acquired outside Norway. Members of some migratory species remain in the country, while newly arrived birds may acquire ticks locally. The difference in pathogen prevalence between spring and autumn migration was not significant and, assuming the birds acquired their parasites along their migration route no difference in export and import of tick-borne pathogens is indicated. The prevalence of all the pathogens investigated here is lower than for the reported prevalence in questing ticks in Norway [13, 14, 32, 43]. These findings suggest that birds play a relatively minor part in the infectious cycle of tick-borne pathogens in Norway, although, since all pathogens investigated were found, they may be important in pathogen spread.

Only I. ricinus were found on birds in this present study, which is consistent with other results [5, 11]. This is the dominant tick species in Norway and Great Britain [54, 55], and the most common species found on passerine birds in Europe [3, 57, 9, 11, 16]. Another study investigating ticks on birds in Norway found 99% I. ricinus [56].

Conclusion

The study demonstrates that all the known major tick-borne bacterial pathogens in southern Norway are subject to transport by migratory birds, potentially allowing introduction and establishment in new areas. This study is the first to report N. mikurensis, R. helvetica and B. miyamotoi in ticks collected from birds in Norway.

Supporting information

S1 File

(PDF)

Acknowledgments

The authors would like to thank Philip Neset for contributing with parts of the laboratory work, and Katrine M. Paulsen for reading the manuscript and giving constructive feedback.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

The study was partly funded by the ScandTick project (grant number 167226) supported by EU Interreg IV A program and the ScandTick Innovation project (grant number 20200422) supported by EU Interreg V program. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Hasle G. Transport of ixodid ticks and tick-borne pathogens by migratory birds. Frontiers in cellular and infection microbiology. 2013;3:48 10.3389/fcimb.2013.00048 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ogden NH, Lindsay LR, Hanincová K, Barker IK, Bigras-Poulin M, Charron DF, et al. Role of migratory birds in introduction and range expansion of Ixodes scapularis ticks and of Borrelia burgdorferi and Anaplasma phagocytophilum in Canada. Appl Environ Microbiol. 2008;74(6):1780–90. 10.1128/AEM.01982-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Heylen D, Fonville M, Docters van Leeuwen A, Stroo A, Duisterwinkel M, van Wieren S, et al. Pathogen communities of songbird-derived ticks in Europe's low countries. Parasites & vectors. 2017;10(1):497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kjelland V, Stuen S, Skarpaas T, Slettan A. Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from migratory birds in Southern Norway. Acta veterinaria Scandinavica. 2010;52:59 10.1186/1751-0147-52-59 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Klitgaard K, Hojgaard J, Isbrand A, Madsen JJ, Thorup K, Bodker R. Screening for multiple tick-borne pathogens in Ixodes ricinus ticks from birds in Denmark during spring and autumn migration seasons. Ticks and tick-borne diseases. 2019;10(3):546–52. 10.1016/j.ttbdis.2019.01.007 [DOI] [PubMed] [Google Scholar]
  • 6.Lommano E, Dvorak C, Vallotton L, Jenni L, Gern L. Tick-borne pathogens in ticks collected from breeding and migratory birds in Switzerland. Ticks and tick-borne diseases. 2014;5(6):871–82. 10.1016/j.ttbdis.2014.07.001 [DOI] [PubMed] [Google Scholar]
  • 7.Capligina V, Salmane I, Keiss O, Vilks K, Japina K, Baumanis V, et al. Prevalence of tick-borne pathogens in ticks collected from migratory birds in Latvia. Ticks and tick-borne diseases. 2014;5(1):75–81. 10.1016/j.ttbdis.2013.08.007 [DOI] [PubMed] [Google Scholar]
  • 8.Hasle G, Bjune GA, Midthjell L, Roed KH, Leinaas HP. Transport of Ixodes ricinus infected with Borrelia species to Norway by northward-migrating passerine birds. Ticks and tick-borne diseases. 2011;2(1):37–43. 10.1016/j.ttbdis.2010.10.004 [DOI] [PubMed] [Google Scholar]
  • 9.Pajoro M, Pistone D, Varotto Boccazzi I, Mereghetti V, Bandi C, Fabbi M, et al. Molecular screening for bacterial pathogens in ticks (Ixodes ricinus) collected on migratory birds captured in northern Italy. Folia parasitologica. 2018;65. [DOI] [PubMed] [Google Scholar]
  • 10.Humair PF, Postic D, Wallich R, Gern L. An avian reservoir (Turdus merula) of the Lyme borreliosis spirochetes. Zentralblatt fur Bakteriologie: international journal of medical microbiology. 1998;287(4):521–38. [PubMed] [Google Scholar]
  • 11.Taragel'ová V, Koči J, Hanincová K, Kurtenbach K, Derdáková M, Ogden NH, et al. Blackbirds and Song Thrushes Constitute a Key Reservoir of Borrelia garinii, the Causative Agent of Borreliosis in Central Europe. Applied and environmental microbiology. 2008;74(4):1289–93. 10.1128/AEM.01060-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jenkins A, Raasok C, Pedersen BN, Jensen K, Andreassen ÅK, Soleng A, et al. Detection of Candidatus Neoehrlichia mikurensis in Norway up to the northern limit of Ixodes ricinus distribution using a novel real time PCR test targeting the groEL gene. BMC Microbiology. 2019;19(1):199 10.1186/s12866-019-1502-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Pedersen BN, Jenkins A, Paulsen KM, Okbaldet YB, Edgar KS, Lamsal A, et al. Distribution of Neoehrlichia mikurensis in Ixodes ricinus ticks along the coast of Norway: The western seaboard is a low-prevalence region. Zoonoses and public health. 2020;67(2):130–7. 10.1111/zph.12662 [DOI] [PubMed] [Google Scholar]
  • 14.Kjelland V, Paulsen KM, Rollum R, Jenkins A, Stuen S, Soleng A, et al. Tick-borne encephalitis virus, Borrelia burgdorferi sensu lato, Borrelia miyamotoi, Anaplasma phagocytophilum and Candidatus Neoehrlichia mikurensis in Ixodes ricinus ticks collected from recreational islands in southern Norway. Ticks and tick-borne diseases. 2018;9(5):1098–102. 10.1016/j.ttbdis.2018.04.005 [DOI] [PubMed] [Google Scholar]
  • 15.Frivik JO, Noraas S, Grankvist A, Wenneras C, Quarsten H. A man in his sixties from Southern Norway with intermittent fever. Tidsskrift for den Norske laegeforening: tidsskrift for praktisk medicin, ny raekke. 2017;137(23–24):1900–2. [DOI] [PubMed] [Google Scholar]
  • 16.Labbe Sandelin L, Tolf C, Larsson S, Wilhelmsson P, Salaneck E, Jaenson TG, et al. Candidatus Neoehrlichia mikurensis in Ticks from Migrating Birds in Sweden. PloS one. 2015;10(7):e0133250 10.1371/journal.pone.0133250 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hornok S, Kovats D, Csorgo T, Meli ML, Gonczi E, Hadnagy Z, et al. Birds as potential reservoirs of tick-borne pathogens: first evidence of bacteraemia with Rickettsia helvetica. Parasites & vectors. 2014;7:128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Heylen D, Fonville M, van Leeuwen AD, Sprong H. Co-infections and transmission dynamics in a tick-borne bacterium community exposed to songbirds. Environmental microbiology. 2016;18(3):988–96. 10.1111/1462-2920.13164 [DOI] [PubMed] [Google Scholar]
  • 19.Stuen S, Granquist EG, Silaghi C. Anaplasma phagocytophilum—a widespread multi-host pathogen with highly adaptive strategies. Frontiers in cellular and infection microbiology. 2013;3:31 10.3389/fcimb.2013.00031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Stuen S, Bergstrom K. Serological investigation of granulocytic Ehrlichia infection in sheep in Norway. Acta veterinaria Scandinavica. 2001;42(3):331–8. 10.1186/1751-0147-42-331 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.De La Fuente J, Naranjo V, Ruiz-Fons F, Hofle U, Fernandez De Mera IG, Villanua D, et al. Potential vertebrate reservoir hosts and invertebrate vectors of Anaplasma marginale and A. phagocytophilum in central Spain. Vector borne and zoonotic diseases (Larchmont, NY). 2005;5(4):390–401. [DOI] [PubMed] [Google Scholar]
  • 22.Quarsten H, Skarpaas T, Fajs L, Noraas S, Kjelland V. Tick-borne bacteria in Ixodes ricinus collected in southern Norway evaluated by a commercial kit and established real-time PCR protocols. Ticks and tick-borne diseases. 2015;6(4):538–44. 10.1016/j.ttbdis.2015.04.008 [DOI] [PubMed] [Google Scholar]
  • 23.Paulauskas A, Radzijevskaja J, Rosef O. Anaplasma in ticks feeding on migrating birds and questing ticks in Lithuania and Norway. Clinical Microbiology and Infection. 2009;15:34–6. 10.1111/j.1469-0691.2008.02164.x [DOI] [PubMed] [Google Scholar]
  • 24.Henningsson AJ, Hvidsten D, Kristiansen BE, Matussek A, Stuen S, Jenkins A. Detection of Anaplasma phagocytophilum in Ixodes ricinus ticks from Norway using a realtime PCR assay targeting the Anaplasma citrate synthase gene gltA. BMC Microbiol. 2015;15:153 10.1186/s12866-015-0486-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tsao JI, Wootton JT, Bunikis J, Luna MG, Fish D, Barbour AG. An ecological approach to preventing human infection: vaccinating wild mouse reservoirs intervenes in the Lyme disease cycle. Proceedings of the National Academy of Sciences of the United States of America. 2004;101(52):18159–64. 10.1073/pnas.0405763102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bunikis J, Garpmo U, Tsao J, Berglund J, Fish D, Barbour AG. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology (Reading, England). 2004;150(Pt 6):1741–55. [DOI] [PubMed] [Google Scholar]
  • 27.Schrader C, Schielke A, Ellerbroek L, Johne R. PCR inhibitors—occurrence, properties and removal. Journal of applied microbiology. 2012;113(5):1014–26. 10.1111/j.1365-2672.2012.05384.x [DOI] [PubMed] [Google Scholar]
  • 28.Oporto B, Gil H, Barral M, Hurtado A, Juste RA, Garcia-Perez AL. A survey on Anaplasma phagocytophila in wild small mammals and roe deer (Capreolus capreolus) in Northern Spain. Annals of the New York Academy of Sciences. 2003;990:98–102. 10.1111/j.1749-6632.2003.tb07344.x [DOI] [PubMed] [Google Scholar]
  • 29.Biernat B, Cieniuch S, Stanczak J. Detection of TBEV RNA in Ixodes ricinus ticks in north-eastern Poland. Annals of agricultural and environmental medicine: AAEM. 2014;21(4):689–92. 10.5604/12321966.1129915 [DOI] [PubMed] [Google Scholar]
  • 30.Adelson ME, Rao RV, Tilton RC, Cabets K, Eskow E, Fein L, et al. Prevalence of Borrelia burgdorferi, Bartonella spp., Babesia microti, and Anaplasma phagocytophila in Ixodes scapularis ticks collected in Northern New Jersey. Journal of clinical microbiology. 2004;42(6):2799–801. 10.1128/JCM.42.6.2799-2801.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hansford KM, Fonville M, Jahfari S, Sprong H, Medlock JM. Borrelia miyamotoi in host-seeking Ixodes ricinus ticks in England. Epidemiology and infection. 2015;143(5):1079–87. 10.1017/S0950268814001691 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kjelland V, Stuen S, Skarpaas T, Slettan A. Prevalence and genotypes of Borrelia burgdorferi sensu lato infection in Ixodes ricinus ticks in southern Norway. Scandinavian journal of infectious diseases. 2010;42(8):579–85. 10.3109/00365541003716526 [DOI] [PubMed] [Google Scholar]
  • 33.Kurtenbach K, Schafer SM, Sewell HS, Peacey M, Hoodless A, Nuttall PA, et al. Differential survival of Lyme borreliosis spirochetes in ticks that feed on birds. Infection and immunity. 2002;70(10):5893–5. 10.1128/IAI.70.10.5893-5895.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Richter D, Debski A, Hubalek Z, Matuschka FR. Absence of Lyme disease spirochetes in larval Ixodes ricinus ticks. Vector borne and zoonotic diseases (Larchmont, NY). 2012;12(1):21–7. [DOI] [PubMed] [Google Scholar]
  • 35.Rollend L, Fish D, Childs JE. Transovarial transmission of Borrelia spirochetes by Ixodes scapularis: a summary of the literature and recent observations. Ticks and tick-borne diseases. 2013;4(1–2):46–51. 10.1016/j.ttbdis.2012.06.008 [DOI] [PubMed] [Google Scholar]
  • 36.Burgdorfer W, Barbour AG, Hayes SF, Péter O, Aeschlimann A. Ixodes ricinus: vector of a hitherto undescribed spotted fever group agent in Switzerland. Acta tropica. 1979;36:357–67. [PubMed] [Google Scholar]
  • 37.Baldridge GD, Scoles GA, Burkhardt NY, Schloeder B, Kurtti TJ, Munderloh UG. Transovarial transmission of Francisella-like endosymbionts and Anaplasma phagocytophilum variants in Dermacentor albipictus (Acari: Ixodidae). Journal of medical entomology. 2009;46(3):625–32. 10.1603/033.046.0330 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Silaghi C, Beck R, Oteo JA, Pfeffer M, Sprong H. Neoehrlichiosis: an emerging tick-borne zoonosis caused by Candidatus Neoehrlichia mikurensis. Experimental & applied acarology. 2016;68(3):279–97. [DOI] [PubMed] [Google Scholar]
  • 39.Tijsse-Klasen E, Hansford KM, Jahfari S, Phipps P, Sprong H, Medlock JM. Spotted fever group rickettsiae in Dermacentor reticulatus and Haemaphysalis punctata ticks in the UK. Parasites & vectors. 2013;6:212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Jahfari S, Fonville M, Hengeveld P, Reusken C, Scholte EJ, Takken W, et al. Prevalence of Neoehrlichia mikurensis in ticks and rodents from North-west Europe. Parasites & vectors. 2012;5:74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bakken V, Runde OJ, Tjørve E, Norsk ornitologisk f, Høgskolen i L, Universitetets naturhistoriske museer og botanisk h, et al. Norsk ringmerkingsatlas: Vol. 2: Duer—Spurvefugler. Stavanger: Stavanger museum; 2006. [Google Scholar]
  • 42.Randolph SE, Gern L, Nuttall PA. Co-feeding ticks: Epidemiological significance for tick-borne pathogen transmission. Parasitology Today. 1996;12(12):472–9. 10.1016/s0169-4758(96)10072-7 [DOI] [PubMed] [Google Scholar]
  • 43.Jenkins A, Kristiansen BE, Allum AG, Aakre RK, Strand L, Kleveland EJ, et al. Borrelia burgdorferi sensu lato and Ehrlichia spp. in Ixodes ticks from southern Norway. Journal of clinical microbiology. 2001;39(10):3666–71. 10.1128/JCM.39.10.3666-3671.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Jahfari S, Coipan EC, Fonville M, van Leeuwen AD, Hengeveld P, Heylen D, et al. Circulation of four Anaplasma phagocytophilum ecotypes in Europe. Parasites & vectors. 2014;7:365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Michelet L, Delannoy S, Devillers E, Umhang G, Aspan A, Juremalm M, et al. High-throughput screening of tick-borne pathogens in Europe. Frontiers in cellular and infection microbiology. 2014;4:103 10.3389/fcimb.2014.00103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Minichova L, Hamsikova Z, Mahrikova L, Slovak M, Kocianova E, Kazimirova M, et al. Molecular evidence of Rickettsia spp. in ixodid ticks and rodents in suburban, natural and rural habitats in Slovakia. Parasit Vectors. 2017;10(1):158 10.1186/s13071-017-2094-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Tijsse-Klasen E, Jameson LJ, Fonville M, Leach S, Sprong H, Medlock JM. First detection of spotted fever group rickettsiae in Ixodes ricinus and Dermacentor reticulatus ticks in the UK. Epidemiology & Infection. 2011;139(4):524–9. [DOI] [PubMed] [Google Scholar]
  • 48.Wagemakers A, Jahfari S, de Wever B, Spanjaard L, Starink MV, de Vries HJC, et al. Borrelia miyamotoi in vectors and hosts in The Netherlands. Ticks and tick-borne diseases. 2017;8(3):370–4. 10.1016/j.ttbdis.2016.12.012 [DOI] [PubMed] [Google Scholar]
  • 49.Kjelland V, Rollum R, Korslund L, Slettan A, Tveitnes D. Borrelia miyamotoi is widespread in Ixodes ricinus ticks in southern Norway. Ticks and tick-borne diseases. 2015;6(4):516–21. 10.1016/j.ttbdis.2015.04.004 [DOI] [PubMed] [Google Scholar]
  • 50.Diaz P, Arnal JL, Remesar S, Perez-Creo A, Venzal JM, Vazquez-Lopez ME, et al. Molecular identification of Borrelia spirochetes in questing Ixodes ricinus from northwestern Spain. Parasites & vectors. 2017;10(1):615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Cochez C, Heyman P, Heylen D, Fonville M, Hengeveld P, Takken W, et al. The Presence of Borrelia miyamotoi, A Relapsing Fever Spirochaete, in Questing Ixodes ricinus in Belgium and in The Netherlands. Zoonoses and public health. 2015;62(5):331–3. 10.1111/zph.12154 [DOI] [PubMed] [Google Scholar]
  • 52.Krause PJ, Telford SR 3rd, Spielman A, Sikand V, Ryan R, Christianson D, et al. Concurrent Lyme disease and babesiosis. Evidence for increased severity and duration of illness. Jama. 1996;275(21):1657–60. [PubMed] [Google Scholar]
  • 53.Zaiem F, Alkhawam H, Lee S, Fabisevich M. Severe symptomatic babesiosis co-infection with Lyme disease. QJM: monthly journal of the Association of Physicians. 2016;109(3):195–6. [DOI] [PubMed] [Google Scholar]
  • 54.Mehl R. The distribution and host relations of Norwegian ticks (Acari, Ixodides). Fauna norwgica series B. 1983;30:46–51. [Google Scholar]
  • 55.Jameson LJ, Medlock JM. Tick Surveillance in Great Britain. Vector-Borne and Zoonotic Diseases. 2010;11(4):403–12. 10.1089/vbz.2010.0079 [DOI] [PubMed] [Google Scholar]
  • 56.Hasle G, Bjune G, Edvardsen E, Jakobsen C, Linnehol B, Roer JE, et al. Transport of ticks by migratory passerine birds to Norway. The Journal of parasitology. 2009;95(6):1342–51. 10.1645/GE-2146.1 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File

(PDF)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES