Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2020 Apr 9;202(9):e00653-19. doi: 10.1128/JB.00653-19

Increased Excess Intracellular Cyclic di-AMP Levels Impair Growth and Virulence of Bacillus anthracis

Jia Hu a, Gaobo Zhang a,b, Leiqin Liang a,b, Chengfeng Lei a, Xiulian Sun a,✉
Editor: Michael Y Galperinc
PMCID: PMC7148140  PMID: 32071095

Anthrax is an ancient and deadly disease caused by the spore-forming bacterial pathogen Bacillus anthracis. Vegetative cells of this species produce anthrax toxin proteins and S-layer components during infection of mammalian hosts. So far, how the expression of these virulence factors is regulated remains largely unknown. Our results suggest that excess elevated c-di-AMP levels inhibit bacterial growth and reduce expression of S-layer components and anthracis toxins as well as reduce virulence in a mouse model of disease. These results indicate that c-di-AMP signaling plays crucial roles in B. anthracis biology and disease.

KEYWORDS: Bacillus anthracis, cyclic di-AMP, surface-layer protein, virulence factors

ABSTRACT

Cyclic di-AMP (c-di-AMP) is a recently identified bacterial second messenger that regulates biological processes. In this study, we found that inactivation of two c-di-AMP phosphodiesterases (PDEs), GdpP and PgpH, resulted in accumulation of 3.8-fold higher c-di-AMP levels than in the parental strain Sterne in Bacillus anthracis and inhibited bacterial growth. Moreover, excess c-di-AMP accumulation decreased bacterial toxin expression, increased sensitivity to osmotic stress and detergent, and attenuated virulence in both C57BL/6J and A/J mice. Complementation of the PDE mutant with a plasmid carrying gdpP or pgpH in trans from a Pspac promoter restored bacterial growth, virulence factor expression, and resistance to detergent. Our results indicate that c-di-AMP is a pleiotropic signaling molecule in B. anthracis that is important for host-pathogen interaction.

IMPORTANCE Anthrax is an ancient and deadly disease caused by the spore-forming bacterial pathogen Bacillus anthracis. Vegetative cells of this species produce anthrax toxin proteins and S-layer components during infection of mammalian hosts. So far, how the expression of these virulence factors is regulated remains largely unknown. Our results suggest that excess elevated c-di-AMP levels inhibit bacterial growth and reduce expression of S-layer components and anthracis toxins as well as reduce virulence in a mouse model of disease. These results indicate that c-di-AMP signaling plays crucial roles in B. anthracis biology and disease.

INTRODUCTION

Bacillus anthracis is a spore-forming, anthrax-causing Gram-positive bacterium which belongs to the Bacillus cereus group of the Bacillus genus. B. anthracis alternates between vegetative and endospore morphologies depending on nutrient availability. The virulence of B. anthracis is mainly due to two factors, the anthrax toxin and the antiphagocytic capsule. The tripartite anthrax toxin is composed of protective antigen (PA), the lethal factor (LF), and edema factor (EF), which are encoded by endogenous plasmid genes pagA, lef, and cya, respectively (1). In addition to the capsule and toxin, the surface layer (S-layer) and S-layer proteins enhance B. anthracis virulence by promoting cell adhesion and colonization (2). In B. anthracis, S-layers composed of surface array protein (Sap) or extractable antigen 1 (EA1) sequentially appear at the cell surface during exponential and stationary phases. A recent report showed that the disintegration of the S-layer attenuates the growth of B. anthracis and the pathology of anthrax in vivo (3). The expression of both endotoxin and the S-layer proteins was mediated by the major transcriptional activator AtxA (4). The atxA-null mutant was found to be avirulent in a murine model of anthrax (5, 6).

Nucleotide second messengers have been implicated in regulating numerous physiological activities in bacteria (7, 8). Among such nucleotides, cyclic di-3′,5′-AMP (c-di-AMP) is a widespread bacterial second messenger, playing essential roles in both bacterial physiology and host-pathogen interactions (9–12). Maintaining a balanced c-di-AMP level is crucial for normal bacterial physiology and virulence. c-di-AMP is synthesized from two molecules of ATP by diadenylate cyclase (DAC) and is hydrolyzed to phosphoadenylyl adenosine (pApA) or AMP by phosphodiesterases (PDEs). c-di-AMP appears to be an essential molecule in Bacillus subtilis, and mutating all DACs is impossible under standard conditions (13). In B. subtilis, deletion of c-di-AMP-specific PDEs results in cell lysis and creates a selective pressure for reducing the c-di-AMP levels (14). Studies of c-di-AMP-specific PDE-defective mutants have shown that increased intracellular c-di-AMP levels correlate with attenuated virulence in several pathogenic bacterial species (15–21). In Streptococcus pneumoniae, higher concentrations of c-di-AMP significantly decreased adhesion to epithelial cells and attenuated virulence in mice (22), and higher concentrations in Streptococcus suis decreased the hemolytic activity, adherence, and invasion of Hep-2 cells (17). Elevated c-di-AMP levels caused defective production of the major virulence factor OspC of Borrelia burgdorferi and reduced its ability to infect mammals (16). In addition, c-di-AMP promoted induction of type I interferon responses and significantly attenuated virulence and colonization in murine models of infection by Listeria monocytogenes and Mycobacterium tuberculosis (18, 19, 23, 24). While c-di-AMP-dependent virulence suppression has been identified in several pathogens, the underlying mechanisms appear to be organism specific and remain to be explored for most pathogens.

Two distinct classes of PDEs are implicated in c-di-AMP degradation (14). The first class is characterized by a catalytically active Asp-His-His (DHH) motif, and the second class contains a His-Asp motif in the active center (HD domain). Genome analysis showed that B. anthracis contains two proteins (GdpP and PgpH) which share homology with the c-di-AMP degradation enzymes of other species. Yet, the roles of these proteins have never been investigated in B. anthracis. In the present study, we performed genetic and biochemistry analyses with these c-di-AMP PDEs and evaluated their roles in B. anthracis virulence. Our results suggest that excess elevated c-di-AMP levels inhibit bacterial growth and reduce expression of S-layer components and virulence factors as well as reduce virulence in a mouse model of disease.

RESULTS

B. anthracis BA_5719 and BA_4528 are c-di-AMP PDEs.

Based on the similarities of their predicted amino acid sequences, we identified two putative c-di-AMP PDEs in B. anthracis. BA_5719 is a homolog of the GdpP proteins from Bacillus subtilis and Staphylococcus aureus, whereas BA_4528 is a homolog of the PgpH proteins from Listeria monocytogenes and B. subtilis. Therefore, we designated BA_5719 as GdpP and BA_4528 as PgpH. The amino acid sequence of B. anthracis GdpP shares 62% identity with B. subtilis GdpP (formerly YybT). B. anthracis PgpH shares 49% sequence identity with B. subtilis PgpH and 39% identity with L. monocytogenes PgpH. To determine whether these two proteins were c-di-AMP PDEs, a C-terminal His-tagged fragment of GdpP (spanning residues 84 to 657 and containing atypical GGDEF and DHH/DHHA1 domains) and the HD domain from PgpH were expressed in Escherichia coli BL21 and purified from cell extracts (Fig. 1A). High-performance liquid chromatography (HPLC) showed that both GdpP and PgpH-HD were c-di-AMP PDEs (Fig. 1B), indicated by cleavage of c-di-AMP to pApA by either protein. GdpP degraded 100 μM c-di-AMP within 30 min. In contrast, PgpH-HD exhibited weaker PDE activity in vitro and degraded only a minor portion of c-di-AMP within 2 h (Fig. 1B).

FIG 1.

FIG 1

PDE activities of the B. anthracis proteins GdpP and PgpH-HD. (A) The purified GdpP84-657-6×His and PgpH-HD-MBP proteins. Lane 1, GdpP84-657-6×His; 2, PgpH-HD-MBP. (B) Cyclic di-AMP hydrolysis by GdpP/PgpH-HD monitored by HPLC. GdpP84-657 and PgpH-HD (1 μM) were incubated with 100 μM c-di-AMP (Sigma) in 100 mM Tris (pH 8.3) containing 20 mM KCl and 0.5 mM MnCl2; 100 μM c-di-AMP (Sigma) and 100 μM pApA were also incubated in the same buffer as a control. The reaction was carried out at 37°C. Nucleotides were separated and analyzed by reversed-phase HPLC.

Both GdpP and PgpH influence bacterial c-di-AMP levels.

To explore the biological functions of GdpP and PgpH in B. anthracis, we generated the following mutant strains: ΔgdpP, ΔpgpH-HD, and ΔΔPDE (ΔgdpP ΔpgpH). Because the deletion of either gdpP or pgpH-HD by replacement with a drug resistance marker may cause polar effects, we used I-SceI-mediated markerless gene knockout (25). All mutants were verified by PCR (see Fig. S1 in the supplemental material).

Earlier work demonstrated that brain heart infusion (BHI) broth supplemented with 0.8% NaHCO3 induced both S-layer protein and toxin expression in B. anthracis (26). To investigate the role of c-di-AMP signaling in bacterial virulence, we measured the intracellular c-di-AMP levels of mutants and parental strain cultivated in BHI broth (0.8% NaHCO3). As expected, deletion of either gdpP or pgpH-HD resulted in an around 2-fold increase in c-di-AMP levels compared with that in the parental Sterne strain (Fig. 2). Consistently, deletion of both genes resulted in approximately 4-fold higher levels of c-di-AMP accumulation (Fig. 2). Two complemented strains were constructed by transforming ΔΔPDE with a plasmid pDG148 carrying gdpP or pgpH in trans from a Pspac promoter. Our results demonstrated that complementation of ΔΔPDE with either gene reduces c-di-AMP levels to lower than in the single mutants (Fig. 2).

FIG 2.

FIG 2

Intracellular c-di-AMP concentrations. Means and standard errors of the means (SEMs) are shown; n = 3. *, P < 0.05. All data were analyzed by using one-way analysis of variance followed by Turkey’s posttest analysis.

Deletion of both GdpP and PgpH results in a growth defect.

To evaluate if the accumulation of c-di-AMP influence cell growth of B. anthracis, the ΔgdpP and ΔpgpH mutants were grown in BHI broth (0.8% NaHCO3), and the optical density at 600 nm (OD600) was monitored hourly (Fig. 3A). Their growth curves were indistinguishable from that of the parental strain. However, the double mutant, ΔΔPDE, showed a growth defect, extended lag time (∼6 times) (Fig. 3A) and generation time (∼1.5 times) (Fig. 3B), suggesting an essential role of c-di-AMP in regulating B. anthracis growth. Additionally, expression of either gdpP or pgpH alone fully restored the growth of the ΔΔPDE strain, further demonstrating that accumulation of excess c-di-AMP impaired bacterial growth, which was consistent with previous report in B. subtilis (27). The ΔΔPDE strain also formed small colonies on LB plates (Fig. 3C), which was complemented by pgdpP and ppgpH.

FIG 3.

FIG 3

Double PDE inactivation impairs B. anthracis growth. (A) Growth curves of B. anthracis strains in BHI (0.8% NaHCO3) medium. Means and SEMs are shown; n = 3. (B) The doubling times of B. anthracis strains in BHI (0.8% NaHCO3) medium. Means and SEMs are shown; n = 3. *, P < 0.05; **, P < 0.01; ns, not significant. All data were analyzed by using one-way analysis of variance followed by Turkey’s posttest analysis. (C) Representative images of the B. anthracis colonies on LB plates after overnight growth in BHI (0.8% NaHCO3) medium.

c-di-AMP PDE gene inactivation affects virulence factor expression at stationary phase.

To examine the S-layer components in the c-di-AMP-accumulating mutants, S-layer proteins from overnight cultures (18 h) of these cells in BHI broth (0.8% NaHCO3) were isolated and subjected to SDS-PAGE. The results showed that the ΔgdpP and ΔpgpH-HD strains formed S-layers similarly to the parental strain, whereas the ΔΔPDE strain did not form detectable S-layers (Fig. 4A). We used immunoblotting with anti-EA1 and anti-Sap antibodies to analyze the subcellular locations of the S-layer proteins of extracellular, S-layer, and cellular fractions of B. anthracis cultures. The ribosomal protein L6 was used as a loading control. We found that excess accumulation of c-di-AMP decreased the expression of EA1 and Sap (Fig. 4A). BslA, an S-layer-associated protein, is the only cell surface adhesion molecule identified in B. anthracis (28). Fewer BslA proteins in the ΔΔPDE strain were detected by immunoblotting in the pellets than in the supernatant (Fig. 4A). We proposed that the S-layer formation defect in the ΔΔPDE mutant allowed more BslA proteins to be secreted into the supernatant of this strain.

FIG 4.

FIG 4

Depletion of c-di-AMP PDEs affects B. anthracis virulence factors expression. (A) Cyclic di-AMP PDE inactivation resulted in decreased expression of virulence factors. B. anthracis Sterne strain and c-di-AMP PDE mutants were grown in BHI (0.8% NaHCO3) medium for 18 h. Cultures were fractionated into medium (M), S-layer (S), and cellular (C) fractions. Proteins were separated by 10% SDS-PAGE and stained with Coomassie blue. Immunoblotting was performed with antibodies raised against purified EA1, Sap, L6, BslA, and PA. L6 was the internal control. Arrow, S-layer. (B) qRT-PCR was used to measure transcript abundance of toxin genes, S-layer genes, and regulator genes in B. anthracis. RNA was isolated from bacteria grown to stationary phase in BHI medium (0.8% NaHCO3). Expression levels of each gene were normalized to gapdh. Means and SEMs are shown; n = 3. *, P < 0.05, **, P < 0.01. All data were analyzed by using Kruskal-Wallis one-way ANOVA followed by Dunn’s multiple-comparison test. (C) Immunoblotting results demonstrated that c-di-AMP accumulation impaired virulence factor expression. Sterne strain and c-di-AMP PDE mutants were grown for 18 h in BHI medium (0.8% NaHCO3) and separated into supernatants and pellets. Then, the supernatants were subjected to immunoblotting with antisera raised against PA and LF. The pellets were subjected to immunoblotting with antisera raised against EA1, BslA, and L6. (D) Overexpression c-di-AMP PDEs complement the virulence factor expression deficiency. Sterne strain, the ΔΔPDE mutant, and two complement strains were grown for 18 h in BHI medium (0.8% NaHCO3) and separated into supernatants and pellets. Then, the supernatants were subjected to immunoblotting with antisera raised against PA and LF. The pellets were subjected to immunoblotting with antisera raised against EA1 and L6.

To explore whether elevated c-di-AMP levels impaired virulence factor expression at the transcriptional level, we compared the expression of toxins genes and the S-layer genes (eag and sap) by quantitative reverse transcription-PCR (qRT-PCR) in Sterne and PDE mutants. Inactivation of gdpP and pgpH significantly downregulated the expression of toxin genes (pagA, lef, and cya) and the S-layer genes (eag and sap) at the transcriptional level (Fig. 4B). These results suggested excess accumulation of c-di-AMP impaired S-layer formation at stationary phase. Consistent with the qRT-PCR results, immunoblotting showed that expression of the anthrax toxin proteins (PA and the LF) and S-layer protein EA1 was undetectable in the ΔΔPDE strain. (Fig. 4C).

To evaluate the role of PDE in anthrax virulence factor expression, the pDG148-gdpP/pDG148-pgpH plasmid was introduced into the ΔΔPDE mutant strain. The subsequent immunoblotting results revealed that production of PA, LF, and EA1 in the ΔΔPDE mutant was restored by complementation in trans with pDG148-gdpP/pDG148-pgpH (Fig. 4D). Thus, the defect in anthrax toxin and S-layer protein EA1 accumulation in the ΔΔPDE strain must result from the absence of c-di-AMP PDEs.

AtxA has been reported to be a direct regulator of toxin genes and an indirect regulator of S-layer genes (sap and eag). Our qRT-PCR results indicated that the transcriptional level of atxA significantly decreased when excess c-di-AMP accumulated in cells (Fig. 4B). To identify whether excess c-di-AMP accumulation repressed virulence factor (anthrax toxins and S-layer protein EA1) expression by downregulating atxA, we introduced pDG148-atxA into the ΔΔPDE strain, and IPTG (isopropyl-β-d-thiogalactopyranoside) was used to induce the expression of AtxA. As expected, immunoblotting results indicated that overexpression of AtxA makes PA and LF expression independent of the presence of the PDEs (Fig. 5A). However, EA1 expression was not enhanced in an AtxA-overexpressing strain.

FIG 5.

FIG 5

A role for abrB in PDE-mediated control of toxin and eag. (A) Overexpression AtxA enhanced the expression of anthrax toxins. The strains were subjected to immunoblotting with antisera raised against EA1, PA, LF, and L6. (B) qRT-PCR was used to measure differences in transcript abundance of toxin genes, eag, and atxA between B. anthracis ΔΔPDE and ΔΔPDE ΔabrB mutants. Means and SEMs are shown; n = 3. *, P < 0.05 by two-tailed Student's t test. (C) abrB inactivation resulted in increased expression of EA1. (Left) The strains were subjected to immunoblotting with antisera raised against EA1, PA, and L6. The blots are the representative of three replicates. (Right) Gray values of the bands. Means and SEMs are shown; n = 3. *, P < 0.05 by two-tailed Student's t test.

AbrB is a major repressor of AtxA in B. anthracis (29). Moreover, our results showed that mRNA levels of abrB were increased around 6-fold in the ΔΔPDE strain compared with that in the parental strain (Fig. 4B). To analyze a role for abrB in PDE-mediated control of toxin and eag, we next compared the expression levels of virulence-related genes in the ΔΔPDE and ΔΔPDE ΔabrB strains. Transcription of atxA rebounded in the ΔΔPDE ΔabrB mutant but did not reach wild-type levels, whereas the transcription of anthrax toxin genes (pag, lef, and cya) was not significantly increased (Fig. 5B). Immunoblotting showed that the ΔabrB mutant exhibited enhanced toxin expression in comparison with that in the Sterne strain (Fig. 5C, left). However, consistent with transcriptional levels, there was no detectable increase in toxin production in the ΔΔPDE ΔabrB mutant strain compared with that in the ΔΔPDE strain (Fig. 5C, right). Therefore, we propose that AbrB might not be the only repressor of atxA in the ΔΔPDE strain. For S-layer component EA1 regulation, our results showed expression of the S-layer protein EA1 was significantly enhanced in the ΔΔPDE ΔabrB strain (Fig. 5C, left). Thus, excess c-di-AMP accumulation repressed S-layer protein EA1 expression by upregulating AbrB.

Elevated levels of c-di-AMP result in increased susceptibility to different stresses.

Elevated levels of c-di-AMP result in increased susceptibility to osmotic stress (18). Previous studies in the Gram-positive bacteria Lactococcus lactis and L. monocytogenes revealed that c-di-AMP-specific PDE mutants were unable to grow at high salt concentrations (19–21). We therefore tested the growth of our mutants in the presence of increased concentrations of NaCl (Fig. 6A). In contrast to the Sterne strain, both mutants grew slowly at a high salt concentration. The ΔΔPDE mutants were unable to grow even at a mild salt concentration. These results indicate that both GdpP and PgpH are important for osmoregulation in B. anthracis.

FIG 6.

FIG 6

Elevated levels of c-di-AMP result in increased susceptibility to different stresses. (A) Representative growth kinetics of B. anthracis and the PDE mutants in BHI broth supplemented with 2.5%, 3.5%, and 4.5% NaCl. The OD600 at the indicated time points was measured. (B) Association rates of B. anthracis attached to RAW 264.7 cells. Association assays were performed as described in Materials and Methods. RAW 264.7 cells were incubated with Sterne-pDG148, ΔΔPDE-pDG148, and two complemented strains ΔΔPDE-gdpP and ΔΔPDE-pgpH (multiplicity of infection [MOI], 10) for 2 h. Means and SEMs are shown; n = 6. **, P < 0.01, ***, P < 0.001. All data were analyzed by using one-way analysis of variance followed by Turkey’s posttest analysis. (C) Representative images of 2 μl of Sterne-pDG148, ΔΔPDE-pDG148, and two complemented strains from stationary-phase cultures pretreated with or without 0.1% Triton X-100 for 0.5 h and spotted onto LB plates.

To investigate the effect of c-di-AMP accumulation on the virulence of B. anthracis in vitro, we determined the association efficiency of Sterne, the ΔΔPDE strain, and two complemented strains (ΔΔPDE-gdpP and ΔΔPDE-pgpH) within RAW 264.7 cells. As shown in Fig. 6B, the strains with elevated c-di-AMP levels showed significantly impaired macrophage association, whereas the complementation ΔΔPDE-gdpP and ΔΔPDE-pgpH strains adhered more efficiently than the ΔΔPDE strain (Fig. 6B). To determine if the decrease in recoverable CFU from RAW 264.7 cells is due to decreased cell association or exposure to Triton X-100 to lyse the host cells, we performed a Triton X-100 sensitivity assay. The ΔΔPDE mutant was likewise more sensitive to 0.1% Triton X-100 than the Sterne strain (Fig. 6C). We pursued this further and compared cell association levels obtained when using phosphate-buffered saline (PBS) to lyse the RAW 264.7 cells at the end of cell association assay. There were similar cell association rates between Sterne and ΔΔPDE strains (data not shown), suggesting that the association defect of this mutant observed in Fig. 6B is a reflection of this sensitivity.

Elevated c-di-AMP levels inhibit bacterial virulence in mice.

To determine whether elevated c-di-AMP levels affected B. anthracis virulence in vivo, we subcutaneously inoculated mice with Sterne, ΔgdpP, ΔpgpH-HD, or ΔΔPDE vegetative cells. The median lethal dose (LD50) for B. anthracis Sterne strain is reported to be 103 spores for A/J mice and 106 spores for C57BL/6J mice (30). Groups of 10 C57BL/6J mice per strain were infected with 107 vegetative cells. At 3 days postinfection, all mice inoculated with the Sterne, ΔgdpP, or ΔpgpH-HD strains had succumbed to infection. In contrast, significant virulence attenuation was observed in mice infected with the ΔΔPDE strain (χ2 = 29.45, P < 0.0001) (Fig. 7). Groups of eight A/J mice per strain were infected with 104 vegetative cells. At 4 days postinfection, 50% of the mice inoculated with the Sterne strain had succumbed to the infection, whereas at 5 to 6 days postinfection, 30% of the mice inoculated with ΔgdpP vegetative cells had succumbed to infection (Fig. 7). All A/J mice infected with ΔpgpH-HD or ΔΔPDE vegetative cells survived the challenge. The survival curves for A/J mice inoculated with ΔpgpH-HD or ΔΔPDE strains were significantly different from those of mice inoculated with the Sterne strain (χ2 = 9.843, P = 0.0073).

FIG 7.

FIG 7

Infection of mice with B. anthracis c-di-AMP PDE mutant strains. (Left) C57BL/6J mice were inoculated subcutaneously with approximately 107 CFU of the Sterne, ΔgdpP, ΔpgpH-HD, and ΔΔPDE strains in 200 μl of PBS and subsequently monitored for 10 days. ***, P < 0.001 from log rank (Mantel-Cox) tests for each mutant compared with the parental strain using Prism 5. (Right) A/J mice were inoculated subcutaneously with approximately 104 CFU of the Sterne, ΔgdpP, ΔpgpH-HD, and ΔΔPDE strains in 200 μl of PBS and subsequently monitored for 10 days. **, P < 0.01 from log rank (Mantel-Cox) tests for ΔpgpH-HD and ΔΔPDE mutants compared with the parental strain using Prism 5. The survival curves of ΔpgpH-HD and ΔΔPDE overlapped.

DISCUSSION

Our in vitro studies showed that PgpH-HD activity is low. However, in vivo experiments demonstrated that PgpH is a c-di-AMP phosphodiesterase, as more than 2-fold increased intracellular c-di-AMP levels were detected in pgpH-HD mutant cells. To test whether a different tag would affect the enzymatic activity, we constructed and purified an N-His-HD (see Fig. S1A in the supplemental material). But after incubating the same concentration of proteins with 200 μM c-di-AMP for 1 h, our results suggested that the N-maltose binding protein (MBP)-tagged version was better than the N-His-tag version (Fig. S1B). Differences between the in vivo and in vitro experiments may be due to the different assay conditions or because PgpH needs other cofactors to work. Both PgpH and GdpP are functional PDEs, since either pDG148-pgpH or pDG18-gdpP was able to complement the growth, macrophage association, and virulence factor production defects of the ΔΔPDE mutant.

Moreover, it appears that c-di-AMP levels exceeding a threshold significantly impair bacterial phenotypes. For instance, expression of the S-layer protein EA1 and Sap were unchanged in the ΔgdpP or ΔpgpH-HD single mutants when these were cultivated in 0.8% NaHCO3 medium but were significantly decreased in the ΔΔPDE mutants. PagR is the activator of eag and a repressor of sap. AtxA activates PagR and thus prevents Sap expression. AtxA is negatively regulated by AbrB, which is also being repressed by phosphorylated Spo0A. Overexpression of AbrB would be expected to lead to an increase in the expression of Sap. However, our qRT-PCR results indicated that in the ΔΔPDE strain, spo0A expression was significantly decreased (data not shown). A previous publication showed that deletion of spo0A led to a reduction in the amount of Sap (31). Our interpretation is that in the double-mutant strain, the significantly decreased expression of spo0A might contribute to the reduced amount of Sap.

The mechanism through which c-di-AMP modulates virulence remains unclear. Our results showed that as the repressor of anthrax toxin master regulator AtxA and S-layer protein EA1, abrB expression was significantly enhanced in the ΔΔPDE strain. AbrB has been well studied as a transition state regulator associated with cellular development in B. subtilis (32). A previous paper showed that abrB expression was growth-phase dependent. It is possible that growth inhibition enhanced AbrB expression in the ΔΔPDE strain. Previous reports also demonstrated that phosphorylated Spo0A repressed abrB (33). Another study found that DisA (a c-di-AMP diadenylate cyclase) delays sporulation by affecting the phosphorylation status of Spo0A in B. subtilis (34). c-di-AMP might also regulate AbrB expression by altering the phosphorylation state of the master transcriptional regulator Spo0A.

To examine if AbrB was the only factor controlling atxA transcription in the ΔΔPDE mutants, we created the ΔΔPDE ΔabrB mutant. qRT-PCR and immunoblotting suggested that there may be additional atxA repressors other than abrB induced in c-di-AMP-accumulating strains. Previous research reported that an additional trans-acting unknown protein(s) bound specifically to the atxA promoter region and negatively impacted transcription (35). It would be interesting to decipher whether these two factors are one and the same.

Despite the observation that the association-defective phenotype of PDE mutant is a reflection of its sensitivity to Triton X-100, the strain nevertheless is attenuated in C57BL/6J and A/J mice when administered subcutaneously, suggesting that c-di-AMP signaling is critical for bacterial virulence. Furthermore, we found the ΔΔPDE strain does not result in strongly increased beta interferon (IFN-β) following infection of RAW 264.7 cells (see Fig. S2). Therefore, the high mortality observed in anthrax infections might be caused by the combined effects of bacterial growth (bacteremia) and bacterial toxin (toxemia) (36). The ΔΔPDE mutant was more sensitive than the parental strain to different stresses, and this sensitivity may contribute to the attenuated phenotype of this mutant. It is likely that excess elevated c-di-AMP signaling reduced the virulence of B. anthracis by impairing bacterial growth and S-layer formation and downregulating the expression of its toxin genes. Our results also demonstrate that high levels of c-di-AMP impair S-layer protein EA1 expression by upregulating the expression of AbrB. We proposed that c-di-AMP accumulation reduced anthrax toxin expression by downregulating the expression of atxA, which was mediated by AbrB and other unknown factors. Nonetheless, obtaining more information on the effector proteins and signal transduction pathways involved in virulence will require further investigations. Understanding the molecular basis of the c-di-AMP signaling pathway has the potential to provide new insights into the control of B. anthracis infection.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids are listed in Table S1 in the supplemental material. Parental B. anthracis Sterne(pXO1+, pXO2−) and its mutants were grown in either Luria broth (LB) or brain heart infusion (BHI) broth (Oxoid) under aerobic conditions at 37°C. The ΔgdpP, ΔpgpH-HD, and ΔΔPDE strains were generated by a previously described method (25, 37). The markerless gene replacement method was utilized with modifications. Briefly, for deletion of gdpP, the pRP1028-gdpPUD construct was created by cloning two 1-kb fragments containing gdpP locus flanking regions in the Mlu site of pRP1028. pRP1028-gdpPUD was first transferred into B. anthracis through conjugation with the help of pSS1827. The mating mixture was incubated on a BHI plate for 24 h at 25°C. Then, the mixture was transferred to BHI broth containing 250 μg ml−1 spectinomycin and 65 units ml−1 polymyxin B and incubated for 2 days at 25°C. During this period, pRP1028-gdpPUD was integrated into the Sterne genome. The redundant plasmid pRP1028-gdpPUD was eliminated by shifting the temperature to 37°C. pSS4332 was introduced into the single-crossover insertion strain through the second conjugation with the help of plasmid pSS1827. The conjugation time was reduced to 6 to 8 h, and the selection plates were changed to BHI broth containing 20 μg ml−1 kanamycin and 65 units ml−1 polymyxin B. pRP1028-gdpPUD was used to make the ΔgdpP mutant by allelic exchange. The expression of I-SecI by pSS4332 caused a double break in the Sterne-pRP1028-gdpPUD, resulting in either the ΔgdpP strain or restoring the parental strain. The ΔgdpP mutation was confirmed by PCR amplification (see Fig. S3). Finally, the redundant plasmid pSS4332 was eliminated by continuous passage at 37°C.

Complemented strains were generated using the shuttle vector pDG148 (38). For the complementation, the gdpP or pgpH gene with the Shine-Dalgarno (SD) sequence was amplified with PCR and inserted into pDG148 that can express under the Pspac promoter. The insertion was performed by the fast cloning method. The plasmids pDG148-gdpP and pDG148-pgpH were transferred into the ΔΔPDE strain to make the complemented strains ΔΔPDE-gdpP and ΔΔPDE-pgpH. The complementary experiments were performed in the absence of IPTG due to a small amount of leaky expression of Pspac promoter (39). To generate the expression plasmid pDG148-atxA, the atxA gene with SD sequence was amplified from genomic DNA by primers (pDG148atxAF, AAGCTTAAAGGAGGAAGCAGGTATGCTAACACCGATATCCATCGAA; pDG148atxAR2, GCATGCTTATATTATCTTTTTGATTTCATGAAAATCTCTTTCT) and inserted into HindIII- and SphI-digested plasmid pDG148.

The fidelity of all molecular constructs was confirmed by PCR and DNA sequencing. Primers for PCR used in this study are listed in Table S2.

Determination of doubling time.

Strains were grown overnight in LB medium and diluted 1:100 in 10 ml fresh BHI (0.8% NaHCO3) medium. The optical density at 600 nm (OD600) of the culture was measured hourly. The OD600 values in the exponential-phase log10(OD600) demonstrated a linear increase over time: r = (ln [OD2/OD1])/(T2 − T1). Doubling time corresponds to ln2/r. The reported data represent the means and standard errors derived from three independent assays. Lag times were determined by measuring the time to reach the exponential phase from inoculation.

S-layer fractionation.

Overnight growth bacterial cultures were diluted 1:1,000 in BHI medium (0.8% NaHCO3). The cultures were incubated at 37°C for 18 h. One milliliter of culture was sedimented by centrifugation at 170,000 × g for 3 min. The supernatant (the medium fraction) was separated from the sedimented cells. The cells were washed twice with PBS and suspended in 1 ml PBS supplemented with 3 M urea. The solution was heated for 10 min at 95°C to extract S-layer and S-layer associated protein (S-layer fragment). After centrifugation (10,000 × g, 10 min), the supernatant containing the S-layer fragment was transferred to a new tube. The remaining cells were washed twice with PBS and mechanically lysed by sonication. After centrifugation (10,000 × g, 10 min), the supernatant (cellular fraction) was transferred to a new tube. Proteins in the medium, S-layer, and cellular fractions were precipitated overnight at 4°C with 10% trichloroacetic acid (TCA). Precipitates were collected by centrifugation (10,000 × g, 15 min), resuspended in 100 μl of 1 M Tris-HCl (pH 8.8), and mixed with equal volumes of sample buffer (4% SDS, 1% β-mercaptoethanol, 10% glycerol, 50 mM Tris-HCl [pH 7.5], bromophenol blue). The protein samples were separated on 10% SDS-PAGE gels and analyzed by Coomassie staining and immunoblotting.

Assay of anthrax toxin in supernatants.

Sterne strain and deletion mutants were inoculated in 5 ml LB broth and incubated overnight at 37°C. Secondary inoculation (0.1%) was performed in 5 ml BHI medium (0.8% NaHCO3). The cultures were incubated at 37°C for 18 h. One milliliter of cultures was precipitated at 17,000 × g for 15 min, and supernatants were collected. Proteins were precipitated overnight at 4°C with 10% TCA. Precipitates were collected by centrifugation (10,000 × g, 15 min), resuspended in 100 μl of 1 M Tris-HCl (pH 8.8), and mixed with equal volumes of sample buffer. The protein samples were separated on 10% SDS-PAGE gels and analyzed by immunoblotting. For the immunoblotting assay, protein samples were separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). Membranes were blotted with antibodies against EA1 (1:500 dilution; provided by Xian-En Zhang, Institute of Biophysics, CAS) (40), LT (1:500 dilution; Abcam catalog number ab13805, RRID:AB_300649), PA (1:1,000 dilution, Abcam catalog number ab13808, RRID:AB_300652), BslA (provided by Chun-Jie Liu, Beijing Institute of Biotechnology; 1:1,000 dilution) (41), and L6 (provided by Chun-Jie Liu, Beijing Institute of Biotechnology; a ribosomal protein in the cytoplasm, 1:1,000 dilution) (Wang et al. [42]), and then with goat anti-mouse (only EA1) or anti-rabbit IgG horseradish peroxidase (HRP)-conjugated secondary antibody (1:5,000 dilution).

Quantitative real-time PCR.

Total mRNA was extracted from B. anthracis Sterne strain and deletion mutants, which were grown in BHI medium (0.8% NaHCO3), with a Bacteria RNA extraction kit (R403-01; Vazyme Biotech Co., Ltd.) and reversed transcribed using a QuantiTect reverse transcription kit (Qiagen, Valencia, CA). cDNAs were used as the templates for real-time quantitative reverse transcription (qRT)-PCR analysis of selected genes with a CFX96 real-time PCR detection system (Bio-Rad, CA). iQ SYBR green Supermix (Bio-Rad, CA) was used for all RT-PCRs. Primers used are listed in Table S2. gapdh was used as the internal control. The amplification efficiency was 0.9 to 0.99.

Protein expression and purification.

The cytoplasmic portion of GdpP84-657 was first amplified from the genomic DNA and cloned into pET28a between the NcoI and XhoI restriction sites. The plasmid was then transformed into the Escherichia coli BL21(DE3) strain. The GdpP-6×His fusion protein was expressed in BL21(DE3) and purified as previous described (43). Briefly, 1 liter of bacterial culture in LB was grown to an OD600 of 0.8 before inducing with 0.8 mM isopropyl β-d-thiogalactopyranoside (IPTG) for 16 h at 16°C. Cells were pelleted and resuspended in 20 ml lysis buffer (50 mM Tris [pH 8.0], 150 mM NaCl, 5% glycerol, 0.1% mercaptoethanol, and 1 mM phenylmethylsulfonyl fluoride). Cells were subjected to disruption by sonication on ice for 30 min. Crude cell extracts were centrifuged at 17,000 × g for 30 min, and the supernatant was filtered and loaded onto Co2+ resin for affinity purification. After washing, proteins were eluted with elution buffer containing 50 mM Tris (pH 8.0), 150 mM NaCl, and 80 mM imidazole. After analysis by SDS-PAGE, fractions with >90% purity were pooled and dialyzed overnight at 4°C in 50 mM Tris (pH 8.0) and 150 mM NaCl. Five percent glycerol was added before storage at −80°C. The protein concentration was determined by the Bradford assay method. Maltose binding protein (MBP)-tagged B. anthracis HD protein was purified from 1 liter of induced E. coli BL21(DE3) culture containing the pMal-c2x expression plasmid. Protein induction and purification were performed as previously described (19).

Enzymatic assay.

The phosphodiesterase assay conditions were conducted as described previously, in which 1 μM GdpP84-657 and PgpH-HD were incubated with 100 μM c-di-AMP (Sigma) in buffer (100 mM Tris [pH 8.3], 20 mM KCl, 0.5 mM MnCl2). The reaction was carried out at 37°C for up to 2 h. The reaction was terminated by boiling for 5 min, and the mixture was filtered to remove the denatured protein.

The supernatants (each 20 μl) were injected into the LC C18 column and separated by reversed-phase HPLC (Agilent 1200). The following buffers were used in the gradient program: buffer A (50 mM KH2PO4, 4 mM tetrabutyl ammonium hydrogen sulfate) and buffer B (75% buffer A, 25% methanol). The following protocol was used for separation: 0.0 min, 0% buffer B; 2.5 min, 0% B; 5.0 min, 30% B; 10.0 min, 60% B; 14.0 min, 100% B; 21.0 min, 100% B; 22.0 min, 50% B; 35.0 min, 0% B at a flow rate of 0.7 ml min−1. Nucleotides were detected at a wavelength of 260 nm.

Quantification of intracellular c-di-AMP concentration.

The Sterne strain and three different PDE mutants were cultivated in 10 ml BHI (0.8% NaHCO3) medium at 37°C for 18 h. Five milliliters of the cultures was harvested immediately by centrifugation at 4°C, and the cell pellets were extracted by the nucleotide extraction method reported previously (44, 45). Pellets were resuspended in 1 ml methanol (filtered at 0.22 μm). Ten microliters was used for ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) analysis, which was performed on Shimadzu UPLC-LC20AD coupled to an AB API4000 LC-MS/MS with an RP C18 column (250 mm by 4.6 mm, Thermo Hypersil GOLD). The following buffers were used in the isocratic elution with a flow rate at 0.3 ml min−1: buffer A consisted of 10 mM ammonium acetate (NH4AC; pH 5.5) and buffer B contained 100% methanol. The intracellular c-di-AMP concentration was determined based on a c-di-AMP (MCM) standard plotting peak areas versus concentrations and was presented as picomoles of c-di-AMP per milligram wet weight Bacillus anthracis. Measurements were repeated in triplicates, with the same retention time as for c-di-AMP.

Macrophage association assay.

RAW 264.7 cell lines (RRID:CVCL_0493) were purchased from Cell bank, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences. RAW 264.7 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco).

For the association assay, 104 cells were cultivated for 2 days in 24-well plates (46). The cells were washed twice with PBS prior to the adhesion assay. The strains were grown in 5 ml BHI (0.8% NaHCO3) medium for 18 h and diluted in DMEM (1% FBS, 80 μM IPTG) to a concentration of 5 × 105 CFU ml−1. Six hundred microliters of bacterial suspension was added to each well. The cells and bacteria were cocultured at 37°C with 5% CO2 for 2 h. Then, the cell monolayers were washed with PBS three times and lysed with 0.1% Triton X-100. The associated bacteria were calculated as the percentage of initial inoculum and adjusted to be expressed as percent change compared to the parental strain.

Salt stress adaptation.

Stationary-phase bacteria were diluted 1:100 (vol/vol) in 5 ml of fresh BHI broth at 37°C with shaking at 200 rpm. When an OD600 of 0.5 was reached, the culture was inoculated into BHI broth supplemented with mild (2.5% or 3.5%) and severe (4.5%) salt at a starting OD600 of 0.01. The cultures were inoculated at 37°C with shaking at 200 rpm, and the growth was monitored for 9 h.

Dilution spot test to check sensitivity to Triton X-100.

Stationary-phase cells were resuspended with PBS or PBS with 0.1% Triton X-100 for 0.5 h. The cells were subjected to 10-fold serial dilution, and 2 μl of each dilution was spotted on LB plates for incubation at 37°C overnight.

Mouse challenge experiment.

All mouse experiments were conducted in a biosafety level 2 (ABSL2) laboratory with the approval of the animal experiments committee of Wuhan Institute of Virology, Chinese Academy of Sciences (approval number WIVA18030E). Animals were randomized, and each cage housed 3 or 4 mice. Seven- to nine-week-old C57BL/6J mice (n = 10) or A/J mice (n = 8) were injected with 10× median lethal dose (LD50) of vegetative cells of the Sterne strain or ΔgdpP, ΔpgpH-HD, or ΔΔPDE isogenic mutants in a 200-μl volume. Colony counts were verified by plating. The mice were monitored for 10 days. Survival curves were generated and analyzed using the Kaplan-Meier method.

Statistical analysis.

Data in Fig. 5 were analyzed by two-tailed Student's t test. Data in Fig. 2, 3, and 6 were analyzed by using one-way analysis of variance (ANOVA) followed by Turkey’s posttest analysis. Kruskal-Wallis one-way ANOVA followed by Dunn’s multiple-comparison test was used for comparisons in Fig. 4. The log rank test was used for survival analysis in the mouse model shown in Fig. 7.

Supplementary Material

Supplemental file 1
JB.00653-19-s0001.pdf (875.2KB, pdf)
Supplemental file 2
JB.00653-19-s0002.pdf (558.2KB, pdf)

ACKNOWLEDGMENT

This work was supported by the National Natural Science Foundation of China (grant number 31600112).

We thank Xuefang An from the Core Facility and Technique Support, Wuhan Institute of Virology, for assistance with animal experiments. We also thank Youling Zhu from the Core Facility and Technique Support, Wuhan Institute of Virology, for assistance with Sap antibody preparation. We thank Xian-En Zhang at Institute of Biophysics, CAS, Chun-Jie Liu, Beijing Institute of Biotechnology, Xiaomin Hu (Zhimin Yuan’s lab) from Wuhan Institute of Virology, and Jin He, Huazhong Agricultural University, for their generous gifts of EA1 antibodies, L6 and BslA antibodies, Sterne strain, and plasmids (pRP1028, pRP4332, and pRP1827), respectively.

J.H. and X.S. designed this study; J.H., G.Z., L.L., and C.L. performed the experiments; and J.H. and X.S. wrote the manuscript.

We declare no conflicts of interest with the contents of this article.

Footnotes

Supplemental material is available online only.

REFERENCES

  • 1.Moayeri M, Leppla SH, Vrentas C, Pomerantsev AP, Liu S. 2015. Anthrax pathogenesis. Annu Rev Microbiol 69:185–208. doi: 10.1146/annurev-micro-091014-104523. [DOI] [PubMed] [Google Scholar]
  • 2.Missiakas D, Schneewind O. 2017. Assembly and function of the Bacillus anthracis S-layer. Annu Rev Microbiol 71:79–98. doi: 10.1146/annurev-micro-090816-093512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Fioravanti A, Van Hauwermeiren F, Van der Verren SE, Jonckheere W, Goncalves A, Pardon E, Steyaert J, De Greve H, Lamkanfi M, Remaut H. 2019. Structure of S-layer protein Sap reveals a mechanism for therapeutic intervention in anthrax. Nat Microbiol 4:1805–1814. doi: 10.1038/s41564-019-0499-1. [DOI] [PubMed] [Google Scholar]
  • 4.Mignot T, Mock M, Fouet A. 2003. A plasmid-encoded regulator couples the synthesis of toxins and surface structures in Bacillus anthracis. Mol Microbiol 47:917–927. doi: 10.1046/j.1365-2958.2003.03345.x. [DOI] [PubMed] [Google Scholar]
  • 5.Mignot T, Couture-Tosi E, Mesnage S, Mock M, Fouet A. 2004. In vivo Bacillus anthracis gene expression requires PagR as an intermediate effector of the AtxA signalling cascade. Int J Med Microbiol 293:619–624. doi: 10.1078/1438-4221-00306. [DOI] [PubMed] [Google Scholar]
  • 6.Raynor MJ, Roh JH, Widen SG, Wood TG, Koehler TM. 2018. Regulons and protein-protein interactions of PRD-containing Bacillus anthracis virulence regulators reveal overlapping but distinct functions. Mol Microbiol 109:1–22. doi: 10.1111/mmi.13961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gomelsky M. 2011. cAMP, c-di-GMP, c-di-AMP and now cGMP: bacteria use them all! Mol Microbiol 79:562–565. doi: 10.1111/j.1365-2958.2010.07514.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Pulschen AA, Sastre DE, Machinandiarena F, Crotta Asis A, Albanesi D, de Mendoza D, Gueiros-Filho FJ. 2017. The stringent response plays a key role in Bacillus subtilis survival of fatty acid starvation. Mol Microbiol 103:698–712. doi: 10.1111/mmi.13582. [DOI] [PubMed] [Google Scholar]
  • 9.Huynh TN, Woodward JJ. 2016. Too much of a good thing: regulated depletion of c-di-AMP in the bacterial cytoplasm. Curr Opin Microbiol 30:22–29. doi: 10.1016/j.mib.2015.12.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Manikandan K, Prasad D, Srivastava A, Singh N, Dabeer S, Krishnan A, Muniyappa K, Sinha KM. 2018. The second messenger cyclic di-AMP negatively regulates the expression of Mycobacterium smegmatis recA and attenuates DNA strand exchange through binding to the C-terminal motif of mycobacterial RecA proteins. Mol Microbiol 109:600–614. doi: 10.1111/mmi.13991. [DOI] [PubMed] [Google Scholar]
  • 11.Townsley L, Yannarell SM, Huynh TN, Woodward JJ, Shank EA. 2018. Cyclic di-AMP acts as an extracellular signal that impacts Bacillus subtilis biofilm formation and plant attachment. mBio 9:e00341-18. doi: 10.1128/mBio.00341-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gundlach J, Rath H, Herzberg C, Mader U, Stulke J. 2016. Second messenger signaling in Bacillus subtilis: accumulation of cyclic di-AMP inhibits biofilm formation. Front Microbiol 7:804. doi: 10.3389/fmicb.2016.00804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Commichau FM, Heidemann JL, Ficner R, Stulke J. 2019. Making and breaking of an essential poison: the cyclases and phosphodiesterases that produce and degrade the essential second messenger cyclic di-AMP in bacteria. J Bacteriol 201:e00462-18. doi: 10.1128/JB.00462-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gundlach J, Mehne FM, Herzberg C, Kampf J, Valerius O, Kaever V, Stulke J. 2015. An essential poison: synthesis and degradation of cyclic di-AMP in Bacillus subtilis. J Bacteriol 197:3265–3274. doi: 10.1128/JB.00564-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bai Y, Yang J, Eisele LE, Underwood AJ, Koestler BJ, Waters CM, Metzger DW, Bai G. 2013. Two DHH subfamily 1 proteins in Streptococcus pneumoniae possess cyclic di-AMP phosphodiesterase activity and affect bacterial growth and virulence. J Bacteriol 195:5123–5132. doi: 10.1128/JB.00769-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ye M, Zhang JJ, Fang X, Lawlis GB, Troxell B, Zhou Y, Gomelsky M, Lou Y, Yang XF. 2014. DhhP, a cyclic di-AMP phosphodiesterase of Borrelia burgdorferi, is essential for cell growth and virulence. Infect Immun 82:1840–1849. doi: 10.1128/IAI.00030-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Du B, Ji W, An H, Shi Y, Huang Q, Cheng Y, Fu Q, Wang H, Yan Y, Sun J. 2014. Functional analysis of c-di-AMP phosphodiesterase, GdpP, in Streptococcus suis serotype 2. Microbiol Res 169:749–758. doi: 10.1016/j.micres.2014.01.002. [DOI] [PubMed] [Google Scholar]
  • 18.Yang J, Bai Y, Zhang Y, Gabrielle VD, Jin L, Bai G. 2014. Deletion of the cyclic di-AMP phosphodiesterase gene (cnpB) in Mycobacterium tuberculosis leads to reduced virulence in a mouse model of infection. Mol Microbiol 93:65–79. doi: 10.1111/mmi.12641. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Huynh TN, Luo S, Pensinger D, Sauer JD, Tong L, Woodward JJ. 2015. An HD-domain phosphodiesterase mediates cooperative hydrolysis of c-di-AMP to affect bacterial growth and virulence. Proc Natl Acad Sci U S A 112:E747–E756. doi: 10.1073/pnas.1416485112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Teh WK, Dramsi S, Tolker-Nielsen T, Yang L, Givskov M. 2019. Increased intracellular cyclic-di-AMP levels sensitize Streptococcus gallolyticus subsp. gallolyticus to osmotic stress, and reduce biofilm formation and adherence on intestinal cells. J Bacteriol 201:e00597-18. doi: 10.1128/JB.00597-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Fahmi T, Faozia S, Port GC, Cho KH. 2019. The second messenger c-di-AMP regulates diverse cellular pathways involved in stress response, biofilm formation, cell wall homeostasis, SpeB expression, and virulence in Streptococcus pyogenes. Infect Immun 87:e00149-19. doi: 10.1128/IAI.00147-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Cron LE, Stol K, Burghout P, van Selm S, Simonetti ER, Bootsma HJ, Hermans PW. 2011. Two DHH subfamily 1 proteins contribute to pneumococcal virulence and confer protection against pneumococcal disease. Infect Immun 79:3697–3710. doi: 10.1128/IAI.01383-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Witte CE, Whiteley AT, Burke TP, Sauer JD, Portnoy DA, Woodward JJ. 2013. Cyclic di-AMP is critical for Listeria monocytogenes growth, cell wall homeostasis, and establishment of infection. mBio 4:e00282-13. doi: 10.1128/mBio.00282-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Dey B, Dey RJ, Cheung LS, Pokkali S, Guo H, Lee JH, Bishai WR. 2015. A bacterial cyclic dinucleotide activates the cytosolic surveillance pathway and mediates innate resistance to tuberculosis. Nat Med 21:401–406. doi: 10.1038/nm.3813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zheng C, Ma Y, Wang X, Xie Y, Ali MK, He J. 2015. Functional analysis of the sporulation-specific diadenylate cyclase CdaS in Bacillus thuringiensis. Front Microbiol 6:908. doi: 10.3389/fmicb.2015.00908. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Nguyen-Mau SM, Oh SY, Schneewind DI, Missiakas D, Schneewind O. 2015. Bacillus anthracis SlaQ promotes S-layer protein assembly. J Bacteriol 197:3216–3227. doi: 10.1128/JB.00492-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mehne FM, Gunka K, Eilers H, Herzberg C, Kaever V, Stulke J. 2013. Cyclic di-AMP homeostasis in Bacillus subtilis: both lack and high level accumulation of the nucleotide are detrimental for cell growth. J Biol Chem 288:2004–2017. doi: 10.1074/jbc.M112.395491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kern J, Schneewind O. 2010. BslA, the S-layer adhesin of B. anthracis, is a virulence factor for anthrax pathogenesis. Mol Microbiol 75:324–332. doi: 10.1111/j.1365-2958.2009.06958.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Saile E, Koehler TM. 2002. Control of anthrax toxin gene expression by the transition state regulator abrB. J Bacteriol 184:370–380. doi: 10.1128/jb.184.2.370-380.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Welkos SL, Keener TJ, Gibbs PH. 1986. Differences in susceptibility of inbred mice to Bacillus anthracis. Infect Immun 51:795–800. doi: 10.1128/IAI.51.3.795-800.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Plaut RD, Beaber JW, Zemansky J, Kaur AP, George M, Biswas B, Henry M, Bishop-Lilly KA, Mokashi V, Hannah RM, Pope RK, Read TD, Stibitz S, Calendar R, Sozhamannan S. 2014. Genetic evidence for the involvement of the S-layer protein gene sap and the sporulation genes spo0A, spo0B, and spo0F in phage AP50c infection of Bacillus anthracis. J Bacteriol 196:1143–1154. doi: 10.1128/JB.00739-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Strauch MA, Hoch JA. 1993. Transition-state regulators: sentinels of Bacillus subtilis post-exponential gene expression. Mol Microbiol 7:337–342. doi: 10.1111/j.1365-2958.1993.tb01125.x. [DOI] [PubMed] [Google Scholar]
  • 33.Fujita M, Sadaie Y. 1998. Feedback loops involving Spo0A and AbrB in in vitro transcription of the genes involved in the initiation of sporulation in Bacillus subtilis. J Biochem 124:98–104. doi: 10.1093/oxfordjournals.jbchem.a022103. [DOI] [PubMed] [Google Scholar]
  • 34.Bejerano-Sagie M, Oppenheimer-Shaanan Y, Berlatzky I, Rouvinski A, Meyerovich M, Ben-Yehuda S. 2006. A checkpoint protein that scans the chromosome for damage at the start of sporulation in Bacillus subtilis. Cell 125:679–690. doi: 10.1016/j.cell.2006.03.039. [DOI] [PubMed] [Google Scholar]
  • 35.Dale JL, Raynor MJ, Dwivedi P, Koehler TM. 2012. cis-Acting elements that control expression of the master virulence regulatory gene atxA in Bacillus anthracis. J Bacteriol 194:4069–4079. doi: 10.1128/JB.00776-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tang WJ, Guo Q. 2009. The adenylyl cyclase activity of anthrax edema factor. Mol Aspects Med 30:423–430. doi: 10.1016/j.mam.2009.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Plaut RD, Stibitz S. 2015. Improvements to a markerless allelic exchange system for Bacillus anthracis. PLoS One 10:e0142758. doi: 10.1371/journal.pone.0142758. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Stragier P, Bonamy C, Karmazyn-Campelli C. 1988. Processing of a sporulation sigma factor in Bacillus subtilis: how morphological structure could control gene expression. Cell 52:697–704. doi: 10.1016/0092-8674(88)90407-2. [DOI] [PubMed] [Google Scholar]
  • 39.Vagner V, Dervyn E, Ehrlich SD. 1998. A vector for systematic gene inactivation in Bacillus subtilis. Microbiology 144:3097–3104. doi: 10.1099/00221287-144-11-3097. [DOI] [PubMed] [Google Scholar]
  • 40.Wang DB, Yang R, Zhang ZP, Bi LJ, You XY, Wei HP, Zhou YF, Yu Z, Zhang XE. 2009. Detection of B. anthracis spores and vegetative cells with the same monoclonal antibodies. PLoS One 4:e7810. doi: 10.1371/journal.pone.0007810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Wang Y, Wei Y, Yuan S, Tao H, Dong J, Zhang Z, Tian W, Liu C. 2016. Bacillus anthracis S-layer protein BslA binds to extracellular matrix by interacting with laminin. BMC Microbiol 16:183. doi: 10.1186/s12866-016-0802-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Wang YC, Yuan SL, Tao HX, Wang LC, Zhang ZS, Liu CJ. 2015. Production and cell surface display of recombinant anthrax protective antigen on the surface layer of attenuated Bacillus anthracis. World J Microbiol Biotechnol 31:345–352. doi: 10.1007/s11274-014-1786-x. [DOI] [PubMed] [Google Scholar]
  • 43.Rao F, See RY, Zhang D, Toh DC, Ji Q, Liang ZX. 2010. YybT is a signaling protein that contains a cyclic dinucleotide phosphodiesterase domain and a GGDEF domain with ATPase activity. J Biol Chem 285:473–482. doi: 10.1074/jbc.M109.040238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Corrigan RM, Abbott JC, Burhenne H, Kaever V, Grundling A. 2011. c-di-AMP is a new second messenger in Staphylococcus aureus with a role in controlling cell size and envelope stress. PLoS Pathog 7:e1002217. doi: 10.1371/journal.ppat.1002217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Hu J, Wang B, Fang X, Means WJ, McCormick RJ, Gomelsky M, Zhu MJ. 2013. c-di-GMP signaling regulates E. coli O157:H7 adhesion to colonic epithelium. Vet Microbiol 164:344–351. doi: 10.1016/j.vetmic.2013.02.023. [DOI] [PubMed] [Google Scholar]
  • 46.Hu J, Ross BN, Cieza RJ, Torres AG. 2015. Finding regulators associated with the expression of the long polar fimbriae in enteropathogenic Escherichia coli. J Bacteriol 197:3658–3665. doi: 10.1128/JB.00509-15. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
JB.00653-19-s0001.pdf (875.2KB, pdf)
Supplemental file 2
JB.00653-19-s0002.pdf (558.2KB, pdf)

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES