Abstract
Background:
The presence and diversity of Staphylococcus species and their enterotoxin-encoding genes in foodstuffs have not been comprehensively studied in some developing countries. This study aimed to assess the frequency of Staphylococcus spp. and their related virulence factors in foodstuffs in Isfahan, Iran.
Methods:
Overall, 139 foodstuff samples, collected from Isfahan City (center of Iran) from Sep 2015 to Oct 2016, were processed for the presence of Staphylococcus spp. using standard bacteriological procedures and sequence analysis of 16S rRNA gene. Antimicrobial susceptibilities and prevalence of mecA and toxin-encoded genes (sea, seb, sed, see and tsst1) were tested for all of the Staphylococcal isolates.
Results:
Forty-four Gram-positive cocci were recovered from 139 dairy and meat samples. The most prevalent species were S. vitulinus 25.0% (11/44) and S. aureus 20.5% (9/44); respectively. The most prevalent antimicrobial resistance was noted towards penicillin, cefoxitin and tetracycline. The sec, sea, see and tsst1 genes were found in 19%, 9.5%, 3.5%, and 3.5% of the isolates, respectively.
Conclusion:
Numerous virulence factors were detected in different Staphylococcus spp. isolated from foodstuffs, more attention should be paid to the presence of the bacteria. Proper hygienic and management practices should be considered in order to increase food safety and prevent extra treatment costs.
Keywords: Staphylococcal food poisoning, Antibiotic resistance, Sequence analysis, Enterotoxins
Introduction
Food-borne diseases (FBD) are defined by WHO as “diseases of infectious or toxic nature or thought to be caused by food or water consumption” (1). Symptoms vary widely, depending on the etiological agents with diarrhea and vomiting as the most common symptoms (2). Among FBDs, food-borne infections are caused by many microbial pathogens that can contaminate foods. Food-borne poisoning is caused by poisonous chemicals, microbial toxin, or other harmful substances that are present in food (3). On the whole, FBDs are responsible for nearly 76 million illnesses, 325,000 hospitalizations, and 5,200 deaths each year in the world. They account for 14 million illnesses, 60,000 hospitalizations, and 1,800 deaths annually (4).
Staphylococcus strains produce toxins resulting in symptoms ranging from gastrointestinal disorders to paralysis and death (5). Although staphylococcal contamination can be readily eradicated by heat treatment of food, it remains a major cause of FBD (5). Staphylococcus aureus is able to grow in a wide range of temperatures, pH and NaCl concentrations (5, 6). Their resilience in being able to grow under a wide range of temperature, pH and osmolality justifies how S. aureus can be readily present in foodstuffs especially those often manipulated during processing, e.g. sausages, salads, cream-filled bakery items, sandwich equipment and dairy products (5).
Staphylococcal food poisoning (SFP), widely assigned to toxigenic Staphylococcus, takes place following ingestion of at least 1.0 μg of enterotoxin in food (7). The most remarkable virulence factors associated with staphylococci are the heat-stable enterotoxins (SEs) secreted by certain strains. The Staphylococcus Enterotoxins (SEs) are divided into five classical serological types: Staphylococcus Enterotoxin A (SEA), Staphylococcus Enterotoxin B (SEB), Staphylococcus Enterotoxin C (SEC), Staphylococcus Enterotoxin D (SED) and Staphylococcus Enterotoxin E (SEE). However, recently other enterotoxins were reported in the literature, including SEG, SHE, SEI, SER, SES, SET and the enterotoxin-like proteins such as SElK, SElN, SElO, SE1P, SE1Q and SElU (7, 8). Reliable detection of SE genes serves a twofold function. Firstly, it aids genotyping of the coagulase-positive staphylococci (CPS) for epidemiological studies. Secondly, it provides an assessment of the possible occurrence of SE genes in strains of Coagulase-Negative Staphylococci (CNS) often used as starters in food fermentation (8, 9).
The aim of the present study was to investigate the prevalence of Staphylococcus isolates and the toxin sea, seb, sed, see and tsst1 genes as well as their antimicrobial susceptibility patterns in isolates from a variety of food sources collected in Isfahan, Iran.
Materials and Methods
Sampling and identification
In a previous study (10), we had sampled 55 confectionaries for isolation and identification of Staphylococcus species. Forty isolates were recovered samples that belonged to different species (30% (12/40) S. aureus, 17/5% (7/40) S. succinus subsp. casei, 15 (6/40) S. warneri, 7.5% (3/40) S. carnosus, 5% (2/40) S. pasteuri, 5% (2/40) S. vitulinus, 5% (2/40) S. sciuri. 5% (2/40) S. epidermidis, 2.5% (1/40) S. succinus subsp. succinus, 2.5% (1/40) S. lugdonensis, 2.5% (1/40) S. saprophyticus and 2.5% (1/40) S. gallinarum). In the present study, from Sep 2015 to Oct 2016, 139 other foodstuff samples including dairy products (cheese, cottage and yogurt) and meat products (sausages, and hamburgers) belonging to 18 different brands were collected from 29 stores in various parts of Isfahan city (center of Iran). The samples were then processed within 12h of their collection in microbiology laboratory of Isfahan Infection Diseases and Tropical Medicine Research Center. Isolation of Staphylococcus species was performed as written in our prior study (10).
Antimicrobial susceptibility test
The Clinical and Laboratory Standard Institute (CLSI, 2017) reference method for disk diffusion was used for antimicrobial susceptibility test of all Staphylococcus isolates (11). The following antibiotics were tested using the standard antibiotic disks (Mast Group, UK) (concentrations are expressed in μg ml−1): penicillin (10 units), cefoxitin (30), gentamicin (10), tetracycline (30), ciprofloxacin (5), clindamycin (2), trimethoprimsulfamethoxazole (1.25/23.75), chloramphenicol (30), rifampin (5), linezolid (30), levofloxacin (5), and erythromycin (15).
DNA Extraction for Molecular Assays
DNA of all isolates was extracted using boiling method (12). In brief, a few colonies of each isolate were added to 100 μl of TE buffer (10 mM Tris, 1 mM EDTA, pH 7.8) and boiled for 15 min at 100 °C. After centrifugation at 9,000 × g for 5 min at 4 °C, supernatant fluid was transferred into a new sterile tube and stored at −20 °C.
Molecular Identification of Staphylococcus Species
The Staphylococcus spp. isolated from dairy and meat products and identified phenotypically according to conventional methods were further analyzed to the species level by sequence analysis of 16S rRNA gene (13). The sequence data were analysis by the Clustal W v2.0 software and Gen-Bank database (14).
Identification of mecA gene
A PCR reaction was carried out for the amplification of the 310 bp fragment of mecA gene using primers as was shown in Table 1. The PCR reaction mixture (25μL) contained: 4μL of DNA template, 2.5 μL of PCR buffer (×10), 0.75 μL MgCl2 (50 mM), 0.5 μL of dNTPs (10 mM), 1 μL of each primers (2 μL totally), 0.25 μL of Ex-Taq DNA polymerase (5u/μL) and 15 μL distilled water. The PCR conditions were as follows: Initial denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 30 sec, annealing at 55 °C for 30 sec and extention at 72 °C for 30 sec, and final extension at 72 °C for 7 min (15).
Table 1:
Primers for Amplification of toxin encoding and 16S rRNA genes of Staphylococcus isolates
| Gene | Primer | Oligonucleotida sequence (5–3) | Amplicon size(bp) |
|---|---|---|---|
| sea | SEA-1 SEA-2 |
TTGGAAACGGTTAAAACGAA GAACCTTCCCATCAAAAACA |
120 |
| seb | SEB-1 SEB-2 |
GGTACTCTATAAGTGCCTGC TTCGCATCAAACTGACAAACG |
475 |
| sec | SEC-1 SEC-2 |
AGAACTAGACATAAAAGCTAGG TCAAAATCGGATTAACATTATCC |
267 |
| sed | SED-1 SED-2 |
TTTGGTAATATCTCCTTTAAACG CTATATCTTATAGGGTAAACATC |
309 |
| see | SEE-1 SEE-2 |
CCTATAGATAAAGTTAAAACAAGC TAACTTACCGTGGACCCTTC |
173 |
| Tsst1 | TSST1-1 TSST1-2 |
ATGGCAGCATCAGCTTGATA TTTCCAATAACCACCCGTTT |
350 |
| mecA | MECA-1 MECA-2 |
GTAGAAATGACTGAACGTCCGATAA CCAATTCCACATTGTTTCGGTCTAA |
310 |
| 16S rRNA | 27F 515R |
AGAGTTTGATCMTGGCTCAG TTACCGCGGCKGCTGGCAC |
530 |
Identification of TSST1 and enterotoxins Genes
All Staphylococcus isolates were tested for toxin genes by two specific multiplex PCRs: (I) 120, 309 and 350 bp fragment of the sea, sed, and tsst1 genes; respectively (16), (II) 475, 267, 173 bp fragment of seb, sec, and see genes (17). Specific primers for amplifying the enterotoxin-encoding genes and tsst1 gene by PCR are shown in Table 1.
Results
Isolation and characterization of the isolates
Overall, 44 Gram-positive cocci with a positive catalase reaction were recovered from the 139 dairy and meat samples initially collected from diverse regions in Isfahan, Iran. 72.73% and 27.27% of Staphylococcus spp. were isolated from meat products and dairy products samples, respectively. Based on 16S rRNA gene sequence analysis, these Staphylococcus spp. isolates belonged to 11 validated species: S. vitulinus 25% (11/44), S. aureus 20% (9/44), S. warneri 9% (4/44), S. epidermidis 9% (4/44), S. equorum 9% (4/44), S. succinus subsp. casei 6.8% (3/44), S. saprophyticus 6.8% (3/44), S. pasteuri 4.5% (2/44), S. gallinarum 4.5% (2/44), S. xylosus 2.3% (1/44) and S. simulans 2.3% (1/44).
Antibiotic susceptibility pattern
The results of antibiotic susceptibility test revealed that, all Staphylococcus spp. isolates were susceptible to rifampicin, levofloxacin, ciprofloxacin and gentamicin.
Penicillin: The prevalent resistance towards penicillin was seen in S. pasteuri (100%), S. succinus sub succinus (100%), S. gallinarum (100%) and S. xylosus (100%). S. epidermidis (83.3%), S. warneri (80%), S. aureus (76.2%), S. equorum subsp. linens (75%), S. saprophyticus (75%), S. sciuri subsp. sciuri (50%), S. succinus subsp. casei (50%) and S. vitulinus (7.7%) were next in rank, respectively.
Tetracycline: The most prevalent tetracycline resistance was seen in S. saprophyticus (50%), S. warneri (50%), S. equorum subsp. linens (25%), S. pasteuri (25%), S. succinus subsp. casei (20%), S. epidermidis(16.7 %), S. vitulinus (14.4%), and S. aureus (14.3%) isolates, respectively.
Cefoxitin: S. sciuri subsp. sciuri (100%), S. succinus sub succinus (100%), S. epidermidis (50%), S. equorum subsp. linens (25%), S. succinus subsp. casei (20%), S. warneri (20%) and S. vitulinus (7.7%) had highest resistance for cefoxitin, respectively.
Erythromycin: S. epidermidis (50%), S. equorum subsp. linens (25%), S. saprophyticus (25%), S. warneri (20%), S. succinus subsp. casei (20%) and S. aureus (4.8%) had the most prevalence of resistance, respectively.
Chloramphenicol: Resistance for chloramphenicol was only seen in S. saprophyticus (50%).
Linezolid: S. pasteuri (25%) and S. aureus (4.8%) were non-susceptible to linezolid.
Clindamycin: 20% of S. warneri isolates and 7.7% of S. vitulinus isolates showed resistance for clindamycin.
Trimethoprim & Sulfamethoxazole: The most prevalent Trimethoprim & Sulfamethoxazole resistance was seen in S. epidermidis (33.3%), S. warneri (30%), S. equorum subsp. linens (25%), and S. succinus subsp. casei (10%), respectively.
Screening of mecA gene
Prevalence of mecA gene in all isolates was 38.5% in S. vitulinus, 33.3% in S. epidermidis, 30% in S. warneri, 25% in S. equorum, 10% in S. succinus subsp. casei and 9.5 % in S. aureus. Others Staphylococcus spp. isolates were negative.
Screening of TSST-1 and enterotoxins Genes
All isolates were screened for enterotoxin production and tsst-1 genses by specific PCR (Table 1). sea gene was found in 8 (9.5%) of the 84 isolates of Staphylococcus spp. The sec gene was found in 16 (19%) of the 84 isolates of Staphylococcus spp. Three (3.5%) of the 84 isolates of Staphylococcus spp. were positive for see gene. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. of Staphylococcus spp. Among all isolates, tsst-1 gene was only found in S. aureus (9.5%) and S. saprophyticus (25%). The seb and sed genes were not found in any of the Staphylococcus spp. isolates (Table 2).
Table 2:
Identification of enterotoxin-encoding genes and TSST-1 of Staphylococcus isolates in foodstuff product by molecular methods
| Specie | No. of Isolates | sea (%) | seb (%) | sec (%) | sed (%) | see (%) | tsst1 (%) |
|---|---|---|---|---|---|---|---|
| S. warneri | 10 | - | - | 30 | - | - | - |
| S. succinus sub succinus | 1 | - | - | - | - | - | - |
| S. succinus sub casei | 10 | 10 | - | - | - | - | - |
| S. vitulinus | 13 | - | - | 7.7 | - | 7.7 | - |
| S. pasteuri | 4 | - | - | 25 | - | - | - |
| S. aureus | 21 | 23.8 | - | 28.6 | - | 4.8 | 9.5 |
| S. lugdunensis | 1 | 100 | - | - | - | - | - |
| S. saprophyticus | 4 | - | - | 25 | - | - | 25 |
| S. epidermidis | 6 | - | - | 17.7 | - | - | - |
| S. gallinarum | 3 | - | - | 33.3 | - | - | - |
| S. carnosus | 3 | - | - | 33.3 | - | - | - |
| S. equorum | 4 | - | - | 25 | - | 25 | - |
| S. xylosus | 1 | - | - | - | - | - | - |
| S. simulans | 1 | - | - | - | - | - | - |
| S. sciuri subsp. sciuri | 2 | 50 | - | - | - | - | - |
Discussion
SFP is an intoxication that results from the consumption of foods containing sufficient amounts of one or several of the preformed SE (18, 19). Foods frequently contaminated with SE include meat and meat products, poultry and egg products, milk and dairy products, bakeries, and sandwich fillings (2, 20). The disease is usually self-limiting and typically resolves within 24–48 h after the onset. However, in some cases, the affliction can be severe enough to lead to hospitalization, particularly in cases involving the elderly, infants, and those with frail health (2, 21).
Identification of Staphylococcus species is quite significant for epidemiological investigations as well as to assess virulence factors such as enterotoxin production and the development of specific management practices to prevent SFPs caused by CNSs (22). V1 region is the best region to differentiate between S. aureus and CNSs (23). In this study, from 139 foodstuff samples collected, 44 (31.6%) isolates belonged to 11 different species and subspecies of Staphylococcus. Prevalence of S. aureus was 20/5%, which was lower than those reported by others (19% to 48.7% range) (24–28). Molecular analysis showed that 27.4% (23/84) of the isolates carried one or more SE genes. Four SE genotypes were detected. The most commonly detected SE genes were sec, sea, see and tsst1 with 19, 9.5, 3.5 and 3.5 percent occurrence, respectively. The frequent detection of SE genes among Staphylococcus spp. taken from different sources has already been demonstrated by various research groups (28–30). Our results are in agreement with these studies that demonstrated the enterotoxigenicity of more than 40% of the isolates of S. aureus collected from various food products. In contrary to our finding, in China, the most frequently seen SE genes was sea (86.5%, 45/52). Four SE gene profiles were observed, including sea (86.5%), sec-she (5.8%), seb (n=3.8%), and seg-sei (n=3.8%) (31). This discrepancy in frequency rate of SE genes suggests that probably some factors such as differences in food products, diagnostic methods and geographical distribution, may be effective in the variation of results.
Staphylococcus aureus has been known to be frequently resistant to antibiotic therapy due to their capacity to produce an exopolysaccharide barrier and a substantial quantity of antibiotic neutralizing enzyme that limits the antibiotic action (9, 32). Overall, 27% of the isolates were sensitive to all the tested antibiotics and 45% of the strains were shown to be intermediate (according to CLSI, 2017) and resistant to at least 4 antibiotics (data not shown). The isolates collected from dairy products were demonstrated to be most sensitive to the tested antibiotics (80%). No resistance to rifampicin, levofloxacin, ciprofloxacin, gentamicin and clindamycin was observed, while a relatively small percentage of the isolates demonstrated resistance to cefoxitin (14.3%), erythromycin (10.8%), and chloramphenicol (2.4%).
Similar to our finding, the most remarkable resistance was reported against penicillin (96.2%, 50/52) and followed by resistance to tetracycline (28.8%, 15/52) (31). Furthermore, a high level of penicillin-resistance (71.4%) was reported among S. aureus isolates from food samples (33).
In addition, in Brazil, where 227 CoNS isolates were recovered from 35 cheese samples, antibiotic susceptibility pattern of isolates showed a high level of resistance against penicillin (78.5%), and erythromycin (67.8%) which is inconsistent with our results (34).
Conclusion
Characterization of Staphylococcus species and enterotoxin-encoding genes is crucial for epidemiological investigations. Detection of enterotoxin-encoding genes and antibiotic resistance in staphylococcal spp. isolated from food indicated that food may represent a potential health risk.
Ethical considerations
Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.
Acknowledgements
No financial support was received for this study.
Footnotes
Conflicts of interest
The authors declare that there is no conflict of interest regarding the publication of this paper.
References
- 1.Griffith CJ. (2006). Food safety: where from and where to? Br Food J, 108 (1): 6–15. [Google Scholar]
- 2.Argudín MÁ, Mendoza MC, Rodicio MR. (2010). Food poisoning and Staphylococcus aureus enterotoxins. Toxins (Basel), 2 (7): 1751–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ross S. (2000). Functional foods: the Food and Drug Administration perspective. Am J Clin Nutr, 71 (6 Suppl): 1735S–38S. [DOI] [PubMed] [Google Scholar]
- 4.Ameme DK, Abdulai M, Adjei EY, et al. (2016). Foodborne disease outbreak in a resource-limited setting: a tale of missed opportunities and implications for response. Pan Afr Med J, 23:69. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Karimi M, Nasr Esfahani B, Halaji M, et al. (2017). Molecular characteristics and antibiotic resistance pattern of Staphylococcus aureus nasal carriage in tertiary care hospitals of Isfahan, Iran. Infez Med, 25: 234–240. [PubMed] [Google Scholar]
- 6.Schmitt M, Schuler-Schmid U, Schmidt-Lorenz W. (1990). Temperature limits of growth, TNase and enterotoxin production of Staphylococcus aureus strains isolated from foods. Int J Food Microbiol, 11 (1): 1–19. [DOI] [PubMed] [Google Scholar]
- 7.Sospedra I, Soriano JM, Mañes J. (2013). Enterotoxinomics: The omic sciences in the study of staphylococcal toxins analyzed in food matrices. Food Res Int, 54 (1): 1052–60. [Google Scholar]
- 8.Pinchuk IV, Beswick EJ, Reyes VE. (2010). Staphylococcal enterotoxins. Toxins (Basel), 2 (8): 2177–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ortega E, Abriouel H, Lucas R, Gálvez A. (2010). Multiple roles of Staphylococcus aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to antibiotic resistance. Toxins (Basel), 2 (8): 2117–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hoveida L, Ataei B, Amirmozafari N, Noormohammadi Z. (2018). Species diversity and molecular analysis of Staphylococcus in confectioneries of a developing country, Iran. Infez Med, 26 (2): 148–54. [PubMed] [Google Scholar]
- 11.Standard A. (2017). NCCLS document M38-A. National Committee for Clinical Laboratory Standards, Wayne, PA. [Google Scholar]
- 12.Rahdar HA, Azadi D, Shojaei H. (2017). Molecular analysis and species diversity of Nocardia in hospital environment of a developing country, a potential health hazard. J Med Microbiol, 66 (3): 334–341. [DOI] [PubMed] [Google Scholar]
- 13.Azadi D, Shojaei H, Pourchangiz M, et al. (2016). Species diversity and molecular characterization of nontuberculous mycobacteria in hospital water system of a developing country, Iran. Microb Pathog, 100: 62–69. [DOI] [PubMed] [Google Scholar]
- 14.Jeon Y-S, Chung H, Park S, et al. (2005). jPHYDIT: a JAVA-based integrated environment for molecular phylogeny of ribosomal RNA sequences. Bioinformatics, 21 (14): 3171–73. [DOI] [PubMed] [Google Scholar]
- 15.McClure J-A, Conly JM, Lau V, et al. (2006). Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from -resistant staphylococci. J Clin Microbiol, 44 (3): 1141–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Blaiotta G, Ercolini D, Pennacchia C, et al. (2004). PCR detection of staphylococcal enterotoxin genes in Staphylococcus spp. strains isolated from meat and dairy products. Evidence for new variants of seG and seI in S. aureus AB-8802. J Appl Microbiol, 97 (4): 719–30. [DOI] [PubMed] [Google Scholar]
- 17.Monday SR, Bohach GA. (1999). Use of multiplex PCR to detect classical and newly described pyrogenic toxin genes in staphylococcal isolates. J Clin Microbiol, 37 (10): 3411–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Dinges MM, Orwin PM, Schlievert PM. (2000). Exotoxins of Staphylococcus aureus. Clin Microbiol Rev, 13 (1): 16–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Hennekinne J-A, De Buyser M-L, Dragacci S. (2012). Staphylococcus aureus and its food poisoning toxins: characterization and outbreak investigation. FEMS Microbiol Rev, 36 (4): 815–36. [DOI] [PubMed] [Google Scholar]
- 20.Tamarapu S, McKILLIP JL, Drake M. (2001). Development of a multiplex polymerase chain reaction assay for detection and differentiation of Staphylococcus aureus in dairy products. J Food Prot, 64 (5): 664–68. [DOI] [PubMed] [Google Scholar]
- 21.Manders SM. (1998). Toxin-mediated streptococcal and staphylococcal disease. J Am Acad Dermatol, 39 (3): 383–98. [DOI] [PubMed] [Google Scholar]
- 22.Casaes Nunes RS, Pires de Souza C, Pereira KS, et al. (2016). Identification and molecular phylogeny of coagulase-negative staphylococci isolates from Minas Frescal cheese in southeastern Brazil: Superantigenic toxin production and antibiotic resistance. J Dairy Sci, 99 (4): 2641–53. [DOI] [PubMed] [Google Scholar]
- 23.Chakravorty S, Helb D, Burday M, et al. (2007). A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods, 69 (2): 330–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Sami M NA, Bagheri M, Sharifi H. (2013). Microbiological and chemical qualities of cream-filled pastries sold in Kerman city confectioneries, southeast of Iran. Eurasian J Vet Sci, 29 (3): 138–42. [Google Scholar]
- 25.Nikniaz Z MR, Jalilzadeh H, Vahed Jabbari M. (2011). Evaluation of Microbial Contamination in Cream Filled Pastries Distributed in Tabriz Confectionaries. J Food Technol Nutr, 8 (1): 66–71. [Google Scholar]
- 26.Sharifzadeh A, Hajsharifi-Shahreza M, Ghasemi-Dehkordi P. (2016). Evaluation of Microbial Contamination and Chemical Qualities of Cream-filled Pastries in Confectioneries of Chaharmahal Va Bakhtiari Province (Southwestern Iran). Osong Public Health Res Perspect, 7 (6): 346–350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Zafarzadeh A, Mahfoozi A. (2015). A Study on Staphylococcus aureus and Bacillus Cereus Contamination in Pastry Products in Gorgan. J Mazandaran Univ Med Sci, 25 (126): 143–47. [Google Scholar]
- 28.Omoe K, Ishikawa M, Shimoda Y, et al. (2002). Detection of seg, seh, and sei genes in Staphylococcus aureus isolates and determination of the enterotoxin productivities of S. aureus isolates harboring seg, seh, or sei genes. J Clin Microbiol, 40 (3): 857–62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kérouanton A, Hennekinne J, Letertre C, et al. (2007). Characterization of Staphylococcus aureus strains associated with food poisoning outbreaks in France. Int J Food Microbiol, 115 (3): 369–75. [DOI] [PubMed] [Google Scholar]
- 30.Aydin A, Sudagidan M, Muratoglu K. (2011). Prevalence of staphylococcal enterotoxins, toxin genes and genetic-relatedness of foodborne Staphylococcus aureus strains isolated in the Marmara Region of Turkey. Int J Food Microbiol, 148 (2): 99–106. [DOI] [PubMed] [Google Scholar]
- 31.Yan X, Wang B, Tao X, Hu Q, et al. (2012). Characterization of Staphylococcus aureus strains associated with food poisoning in Shenzhen, China. Appl Environ Microbiol, 78 (18): 6637–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Gould IM, David MZ, Esposito S, et al. (2012). New insights into meticillin-resistant Staphylococcus aureus (MRSA) pathogenesis, treatment and resistance. Int J Antimicrob Agents, 39 (2): 96–104. [DOI] [PubMed] [Google Scholar]
- 33.Aydin A, Muratoglu K, Sudagidan M, et al. (2011). Prevalence and antibiotic resistance of foodborne Staphylococcus aureus isolates in Turkey. Foodborne Pathog Dis, 8 (1): 63–9. [DOI] [PubMed] [Google Scholar]
- 34.Fontes CO, Silva VL, de Paiva MR, et al. (2013). Prevalence, antimicrobial resistance, and virulence characteristics of mecA-encoding coagulase-negative staphylococci isolated from soft cheese in Brazil. J Food Sci, 78 (4): M594–9. [DOI] [PubMed] [Google Scholar]
