Abstract
Fragile X syndrome (FXS), the most common form of inherited intellectual disability and autism, results from the loss of fragile X mental retardation protein (FMRP). We have recently identified a direct interaction of FMRP with voltage-gated Ca2+ channels that modulates neurotransmitter release. In the present study we used a combination of optophysiological tools to investigate the impact of FMRP on the targeting of voltage-gated Ca2+ channels to the active zones in neuronal presynaptic terminals. We monitored Ca2+ transients at synaptic boutons of dorsal root ganglion (DRG) neurons using the genetically-encoded Ca2+ indicator GCaMP6f tagged to synaptophysin. We show that knock-down of FMRP induces an increase of the amplitude of the Ca2+ transient in functionally-releasing presynaptic terminals, and that this effect is due to an increase of N-type Ca2+ channel contribution to the total Ca2+ transient. Dynamic regulation of CaV2.2 channel trafficking is key to the function of these channels in neurons. Using a CaV2.2 construct with an α-bungarotoxin binding site tag, we further investigate the impact of FMRP on the trafficking of CaV2.2 channels. We show that forward trafficking of CaV2.2 channels from the endoplasmic reticulum to the plasma membrane is reduced when co-expressed with FMRP. Altogether our data reveal a critical role of FMRP on localization of CaV channels to the presynaptic terminals and how its defect in a context of FXS can profoundly affect synaptic transmission.
Keywords: Calcium transients, Voltage-gated calcium channels, Trafficking, Synaptic transmission, Fragile X syndrome - FMRP
Graphical abstract
Highlights
-
•
Loss of FMRP increases presynaptic Ca2+ transients.
-
•
FMRP is a negative regulator of presynaptic Cav2.2 channel abundance.
-
•
FMRP reduces the forward trafficking of Cav2.2 channels from ER to plasma membrane.
-
•
Distal part of FMRP carboxy terminus is key for interaction with Cav2.2 channels.
1. Introduction
Fragile X syndrome (FXS) is the most common form of intellectual disability and the leading known genetic cause of autism (Hagerman et al., 2017; Santoro et al., 2012). FXS is typically associated with cognitive, behavioral and social impairments as well as neurological abnormalities. Neuronal hyperexcitability is one of the typical features of neurological deficits in FXS (Contractor et al., 2015). FXS results from the transcriptional silencing of FMR1 gene and as consequence the loss of expression of the protein it codes for: the fragile X mental retardation protein (FMRP). FMRP is an RNA binding protein that controls the localization, stability and translation of numerous mRNAs critical to neuronal development, dendritic spine architecture and synaptic plasticity (For reviews see: Banerjee et al., 2018; Braat and Kooy, 2015; Contractor et al., 2015; Huber et al., 2015; Richter et al., 2015).
Recent studies have pointed out translational-independent functions for FMRP. Indeed, FMRP was shown to directly interact with ion channels and modulate neuronal excitability and neurotransmitter release (Brown et al., 2010; Deng et al., 2013; Ferron, 2016; Ferron et al., 2014; Yang et al., 2018). FMRP interacts with the sodium-activated potassium (Slack) channel and modulates its gating properties which regulates the excitability of bag cell neurons in Aplysia (Brown et al., 2010; Zhang et al., 2012). In CA3 hippocampal neurons, FMRP binds to beta-4 auxiliary subunits of Ca2+-activated potassium (BK) channels regulating its Ca2+ sensitivity and affecting the short-term plasticity at the CA3-CA1 synapse in mice (Deng et al., 2013; Deng et al., 2011). In cerebellar interneurons, FMRP interacts with KV1.2 channels to modulate GABA release (Yang et al., 2018). Finally, FMRP interacts with N-type voltage-gated Ca2+ channels modifying their cell surface expression and affecting their control of vesicular release in rat dorsal root ganglion (DRG) neurons (Ferron et al., 2014).
Ca2+ entry via voltage-gated calcium channels (VGCCs) triggers neurotransmitter release (For review see Neher and Sakaba, 2008). Multiple VGCC subtypes including P/Q- (CaV2.1), N- (CaV2.2) and R-type (CaV2.3) mediate neurotransmitter release (Dolphin, 2012; Zamponi et al., 2015). CaV2.1 channels play a major role in neurotransmission at mature synapses in the central nervous system whereas CaV2.2 channels are predominant at synapses in the peripheral nervous system. Specific targeting of CaV2 channels to subcellular compartments, including the active zone in presynaptic terminals, is critical for them to fulfil their function. In this study, we combined the use of two presynaptic functional markers (synaptophysin-GCaMP6f, sy-GCaMP6f, and vesicle-associated membrane protein - mOrange 2, VAMP-mOr2), one for Ca2+ transients and the second to indicate vesicular release, to investigate the impact of FMRP on the trafficking of CaV to the plasma membrane of active boutons. Here we show that the knock-down of FMRP increases the amplitude of the Ca2+ transient in functionally releasing presynaptic terminal of DRG neurons and that this effect is due to an increase of N-type Ca2+ channel contribution to the total Ca2+ transient. We also used live labelling techniques to show that FMRP controls cell surface expression of CaV2.2 channels by regulating its forward trafficking between the endoplasmic reticulum (ER) and the plasma membrane. Altogether, our data show that FMRP is an important regulator of CaV trafficking and targeting to functional synapses and the loss of this regulatory mechanism likely contributes to neuronal hyperactivity observed in FXS.
2. Results
2.1. FMRP controls Ca2+ transients' amplitude in neuronal presynaptic terminals
We have previously shown that FMRP controls synaptic transmission via N-type Ca2+ channels in dorsal root ganglion (DRG) neuron terminals (Ferron et al., 2014) and we now wish to determine whether this effect is driven by a local accumulation of functional voltage-gated calcium channels.
To test this hypothesis, we monitored the local Ca2+ transient using the functional presynaptic reporter synaptophysin tagged with the genetically encoded Ca2+ indicator GCaMP6f: sy-GCaMP6f (Kadurin et al., 2016) (Fig. 1A). Sy-GCaMP6f positive nerve terminals were identified with a stimulus of 10 action potentials (APs) at 60 Hz (Fig. 1A and B). Rat DRG neurons co-cultured with dorsal horn (DH) neurons from embryonic stage 18 (E18) form functional synapses (Albuquerque et al., 2009; Ferron et al., 2014). In order to identify functionally releasing presynaptic terminals, E18 DRG neurons were co-transfected with a reporter of presynaptic exocytosis: VAMP tagged at its luminal carboxy terminal with the pH-sensitive fluorescent protein mOrange 2 (VAMP-mOr2; Fig. 1A). Increase of VAMP-mOr2 fluorescence in response to a stimulus of 200 APs at 10 Hz was used to identify releasing terminals (Fig. 1C). The impact of FMRP on local Ca2+ transients was then determined by knocking down its expression only in the presynaptic DRG neurons, by co-transfecting a short hairpin RNA (shRNA) (Ferron et al., 2014).
We first focused on the Ca2+ transient generated by 1AP (Fig. 1D and E). In the control (Ctrl) shRNA condition, the amplitude of the Ca2+ transient in releasing boutons is ~20% larger (100.0 ± 7.2%, n = 31 vs 122.8 ± 7.9%, n = 31, P = .045) compared with non-releasing ones; interestingly this difference was increased to ~50% in the FMRP shRNA condition (100.0 ± 6.8%, n = 34 vs 149.6 ± 10.5%, n = 33, P = .00014). When we compared the amplitude of the Ca2+ transient from releasing boutons in the FMRP shRNA vs Ctrl shRNA condition (Fig. 2A), we found an increase of ~86% following knock-down of FMRP (from 100.0 ± 6.9% for Ctrl shRNA, n = 31, to 186.4 ± 17.9% for FMRP shRNA, n = 33, P < .0001).
In order to identify VGCC subtypes involved in the Ca2+ transient, we used specific blockers for the 3 main VGCC types involved in synaptic transmission in DRG neurons: N-type (ω-conotoxin GVIA, ConTx), P/Q-type (ω-agatoxin IVA, AgaTx) and L-type (nifedipine, Nif) (Fig. 2B). After ConTx application in the Ctrl shRNA condition, the remaining Ca2+ transient is 53% of the total amplitude indicating that N-type channels mediate 46.7% of Ca2+ entry (Fig. 2C). When AgaTx was added to the perfusion in addition to ConTx, the remaining Ca2+ transient represented 40.7% of the total transient which shows that P/Q type channels contribute 13.8% to the total Ca2+ entry (Fig. 2C). Finally, when Nif was added to the perfusion in addition to AgaTx (ConTx was omitted at this stage, however ConTx blockade is still effective as its effect on N-type current is irreversible (Boland et al., 1994; Takahashi and Momiyama, 1993; Wheeler et al., 1994)), the remaining Ca2+ transient was 21.7% of the total which shows that L-type contributes 15.7%, and other channels (R-type and T-type) contribute 21.7% of the total Ca2+ transient (Fig. 2C). The use of 10 μM of Nif is sufficient to produce a complete block of L-type channels (Fox et al., 1987a, Fox et al., 1987b; Regan et al., 1991); however, such a concentration of Nif may also produce a partial block of other calcium channels (Fox et al., 1987a; Perez-Reyes, 2003) which could slightly affect the relative contributions of L-type and other channels. In the FMRP shRNA condition (Fig. 2B and C), there was an increased contribution attributable to N-type channels of ~20% to ~66% (Fig. 2C), whereas the remaining Ca2+ transient after treatment with all the Ca2+ channel blockers was significantly reduced to ~11% (Fig. 2C). P/Q- and L-type contributions were not significantly reduced (Fig. 2C).
We then examined the effect of presynaptic FMRP knock-down on the Ca2+ transient generated by 10 APs (Fig. 2D). We found that the amplitude of total Ca2+ transients was also increased by ~50% in terminals lacking FMRP (Fig. 2D). However, the application of VGCC-specific blockers in the Ctrl shRNA condition indicated there was no differential effect of ConTx, and thus there was a reduced relative contribution of N-type channels compared with the 1AP response (Fig. 2E). Indeed, N-type channels only contributed to 28% of the total Ca2+ transient (~20% less than in the response to 1AP) (Fig. 2F). Conversely, the contribution of “other” channels was increased by 20%. In the FMRP shRNA condition, only the sensitivity to Nif was modified (Fig. 2E). The relative contribution of L-type channels was increased by 20%, whereas the contribution of “other” channels was reduced by 20% (Fig. 2F).
We have previously shown that FMRP controls vesicular release in presynaptic terminals from hippocampal neurons (Ferron et al., 2014). We therefore also examined the effect of knock-down of FMRP on Ca2+ transients in response to 1 AP in terminals of hippocampal neurons in culture (Fig. 3A - 3D). Our data showed an increase in Ca2+ transients recorded from releasing presynaptic boutons in the FMRP knock-down condition by 77%, compared with the Ctrl shRNA condition (Fig. 3D), a similar result to that obtained in DRG-DH co-cultures.
We then used ConTx and AgaTx to determine the contribution of CaV channels to the Ca2+ transient. In the Ctrl shRNA condition, the AgaTx sensitive Ca2+ transient represented ~48% of the total Ca2+ transient and the addition of ConTx to the perfusion induced a further ~37% reduction (Fig. 3E). Our results indicated that only 11% of the other CaV channel types (L, R and T-type) contribute to the total Ca2+ transient. In the FMRP knock-down condition, the AgaTx sensitive Ca2+ transient represented ~41% of the total Ca2+ transient and the addition of ConTx induced a further ~47% reduction (Fig. 3E). Our results indicated that ~12% of the other CaV channel types contribute to the total Ca2+ transient. Overall, our results do not show a significant modification of the relative contribution of CaV channels to the total Ca2+ transient when FMRP is knocked-down, which suggests that the trafficking of both N- and P/Q-type channels is affected by FMRP in hippocampal neurons.
2.2. Distal FMRP C-terminal interacts with CaV2.2 channels
We have previously identified a direct interaction between the C-terminus of FMRP and CaV2.2 channels. Here, we aimed to identify the domain within the FMRP C-terminus involved in the FMRP/CaV2.2 interaction. We generated glutathione S-transferase (GST) fusion proteins with serial deletions of the FMRP C-terminus (Fig. 4A). We applied whole-cell lysate from tsA-201 cells transfected with CaV2.2/β1b/α2δ-1 to each purified GST-fusion protein and assessed their ability to interact with CaV2.2 (Fig. 4B). We showed that the interaction between FMRP C-terminal and CaV2.2 was strongly weakened by the deletion of the distal part of the FMRP C-terminus and then lost with the deletion of the RGG domain (Fig. 4B and C). Our data thus show that the distal domain of the FMRP C-terminus is crucial to the interaction with CaV2.2.
2.3. FMRP reduces CaV2.2 forward trafficking
We have shown that in DRG neurons lacking FMRP, the N-type VGCC-dependent Ca2+ transient was increased at presynaptic terminals. We have previously shown that cell surface expression of CaV2.2 channels was reduced in tsA-201 cells over-expressing FMRP (Ferron et al., 2014). Cell surface expression of transmembrane proteins results from the balance between the trafficking of newly synthesized proteins from the endoplasmic reticulum to the plasma membrane (forward trafficking), internalization (endocytosis) from the plasma membrane to intracellular compartments and their recycling and/or degradation. In order to identify the mechanism of action of FMRP on CaV2.2 cell surface expression, we have used CaV2.2 channels with a tandem α-bungarotoxin binding site (BBS) tag in an extracellular loop (Ferron et al., 2014). We first checked that CaV2.2-BBS cell surface expression was reduced when FMRP was co-expressed in Neuro2A (N2a) cells. After 2 days expression, N2a cells were live-labelled with fluorescently tagged α-bungarotoxin and the cell surface fluorescence was quantified (Fig. 5A). We found that CaV2.2-BBS staining was reduced by 26% when FMRP was co-expressed (Fig. 5B). We then investigated the effect of FMRP on CaV2.2 endocytosis by comparing the rate of internalization of CaV2.2-BBS (Fig. 5C). CaV2.2, with or without FMRP, showed similar kinetics of endocytosis (Fig. 5D). We next investigated the impact of FMRP on the net forward trafficking of CaV2.2 by monitoring the insertion of new CaV2.2-BBS into the plasma membrane over time (Fig. 5E). We found that the presence of FMRP reduced the initial speed of net forward trafficking of CaV2.2 (extracted from the initial linear phase of the curve) from 3.0 ± 0.1 a.u. / min to 2.0 ± 0.20 a.u. / min (n = 3, P = .009) and led to a reduced steady-state maximum cell surface expression (Fig. 5F and G). Net forward trafficking results from the combination of newly synthesized proteins trafficked from the endoplasmic reticulum to the plasma membrane via the Golgi apparatus, and also from pre-existing proteins recycled from the plasma membrane and internal compartments. Brefeldin A (BFA) disrupts the structure of the Golgi apparatus and blocks the translocation of proteins from the endoplasmic reticulum to the plasma membrane. Forward trafficking experiments were repeated after treatment with BFA and we showed that the initial speed of forward trafficking of CaV2.2 was reduced to 1.14 a.u./min and the steady-state maximum surface expression for CaV2.2 was reduced to 50% in the Ctrl condition (Fig. 5H). Moreover, after BFA, CaV2.2 forward trafficking characteristics were no longer different between the conditions with or without FMRP (Fig. 5H). These results indicate that FMRP has no impact on recycling of CaV2.2 channels back to the plasma membrane, but instead acts on the forward trafficking of CaV2.2 channels from the endoplasmic reticulum to the plasma membrane.
3. Discussion
Presynaptic Ca2+ influx plays a critical role in mediating neurotransmitter release (Dittman and Ryan, 2019). In this study we show that the knock-down of FMRP increases Ca2+ transients into presynaptic terminals of DRG neurons. Using specific calcium channel blockers, we demonstrate that this increase in Ca2+ transients is largely mediated by N-type Ca2+ channels. We also investigated the dynamic trafficking of CaV2.2 channels and show that FMRP controls CaV2.2 plasma membrane expression by reducing its forward trafficking between the ER and the plasma membrane. Altogether our data indicates that FMRP exerts a tight control on the functional expression of N-type Ca2+ channels at the synaptic nerve terminals.
We have previously shown that FMRP regulates vesicular release by modulating N-type Ca2+ channel density (Ferron et al., 2014). This regulation of vesicular release by FMRP could result from a modification of total Ca2+ influx (resulting from changes in VGCC gating and/or surface abundance) and/or changing in VGCC proximity to release sites (Dittman and Ryan, 2019). Thus, we investigated the effect of FMRP on the amplitude of Ca2+ transients and the VGCC subtype contribution in response to a brief stimulus (1AP, 1 ms) in DRG synapses onto DH neurons. Analysis of the response to 1AP revealed that N-type channels are, by far, the main contributors (~45%) to the total Ca2+ transient, and when FMRP was knocked-down their relative contribution increased further to 65%. Since we have previously shown that FMRP does not affect the biophysical properties of CaV2.2 channels (Ferron et al., 2014), our data suggests that FMRP modulates vesicular release by controlling the abundance of CaV2.2 channels at presynaptic terminals of DRG neurons. However, we cannot exclude that FMRP affects the proximity of VGCCs to the release sites and further experiments will be needed to shed light on this aspect.
We then carried out similar experiments on hippocampal neurons and revealed an equal contribution of N-type and P/Q-type channels to the presynaptic Ca2+ transient as previously demonstrated by Brockhaus & co-workers (Brockhaus et al., 2019). We also show that FMRP can control the trafficking of both N-type and P/Q-type channels to hippocampal synaptic terminals which is in good agreement with our previous study showing a direct interaction between FMRP and both CaV2.1 and CaV2.2 and an increase of vesicular release in hippocampal neurons when FMRP was knocked-down (Ferron et al., 2014).
It is interesting to note that the synaptic CaV contribution is distinct from that in the soma (Doughty et al., 1998) and it has been proposed that there is an independent regulation of the trafficking of CaV2 channels to the active zone in presynaptic terminals (Cao et al., 2004; Cao and Tsien, 2010; Hoppa et al., 2012; Lubbert et al., 2019). The molecular mechanism controlling presynaptic CaV2 channel accumulation and retention is still unknown and may depend on the type of synapse. It is tempting to suggest that FMRP might contribute to such a mechanism by controlling the targeting of CaV2 channels to the active zone.
We also analyzed the impact of FMRP on Ca2+ transients generated by a sustained stimulus in DRG neuron terminals. Surprisingly, the response to 10 APs (60 Hz) revealed a very different pharmacological profile from the response to 1AP. Indeed, in control conditions, N-type channels only represented about 28% of the total Ca2+ transient, and the main source of Ca2+ (~40%) was triggered by R- and/or T-types Ca2+ channels (Bourinet et al., 2005; Wilson et al., 2000). This difference in contribution could be explained by several mechanisms that have been described to result from prolonged activity: 1) facilitation of R-type Ca2+ channels (David et al., 2010; Dietrich et al., 2003; Gomora et al., 2002; Leroy et al., 2003); and/or 2) secondary Ca2+ release from internal stores (de Juan-Sanz et al., 2017; Scott and Rusakov, 2006); and/or 3) deinactivation of T-type Ca2+ channels: at the resting membrane potential (between −55 and −65 mV for DRG neurons) (Du et al., 2014; Wang et al., 1994; Xu et al., 1997) most of the T-type Ca2+ channels are inactivated and only a small tail current can be generated by the remaining fraction of activatable channels during the repolarization phase of the AP. However, AP repolarization is followed by an after-hyperpolarization (AHP) lasting for several tens of milliseconds during which the membrane potential can reach values of −70 mV or below (Margas et al., 2016). During this hyperpolarization period, a larger fraction of T-type Ca2+ channels will become activatable and if a new AP is triggered during this AHP, which will occur for a 60 Hz stimulation (one AP every 17 ms), a much larger tail current will be generated by T-type Ca2+ channels. Altogether, these data suggest that facilitation of R-type Ca2+ channels, deinactivation of T-type Ca2+ channels and secondary Ca2+ release can contribute to the residual Ca2+ transient recorded in response to 10 APs. It is also worth mentioning that T-type Ca2+ channels are expressed in a small fraction of DRG neurons (Bernal Sierra et al., 2017; Watanabe et al., 2015) and that only a study using specific blockers will ascertain the involvement of these channels.
When FMRP was knocked down, the relative contribution of L-type channels to Ca2+ transients in response to 10 APs was increased by ~18% and the contribution of R-/T-type Ca2+ channels was proportionally reduced by ~21%. Interestingly, a study investigating the effect of the loss of FMRP on neuronal excitability in CA3 hippocampal neurons and in cortical pyramidal neurons has shown an excessive AP broadening and a reduction of the AHP amplitude during repetitive activity due to a reduced BK channel availability (Deng et al., 2013). Although such effects in DRG neurons lacking FMRP would still have to be demonstrated, we can speculate that during repetitive activity an extension of the repolarizing phase of the AP would allow a larger Ca2+ influx via L-type channels and a reduction of the AHP amplitude would limit the deinactivation of T-type channels and as a consequence reduce their contribution to the Ca2+ transient. Moreover, as mentioned above, the comparison of the pharmacological profile of the response to 1 and 10 APs indirectly showed that the increase of L-type channel contribution did not result from an increase in the number of channels at the plasma membrane but rather an increase in facilitation and/or secondary Ca2+ induced Ca2+ release. Interestingly, the mRNAs coding for CaMKII, which is involved in Ca2+-dependent facilitation for CaV1.2 and CaV2.1 channels (Hudmon et al., 2005; Jiang et al., 2008), and proteins involved in Ca2+ homeostasis (ryanodine receptor, IP3 receptor, sarcoendoplasmic reticulum Ca2+ ATPase) have all been identified as targets for FMRP (Darnell et al., 2011; Zalfa et al., 2003). Therefore, knock-down of FMRP could potentially change the expression of its target mRNAs in DRG neurons and account in part for the modification of Ca2+ elevation described here in presynaptic terminals. Supporting this idea, neuronal developmental defects have been linked to the dysregulation of intracellular Ca2+ dynamics (Ca2+ influx and release by the endoplasmic reticulum) in central nervous system neurons in a Drosophila model of FXS (Tessier and Broadie, 2011). Modulation of Ca2+ transients has often been reported in studies investigating the role of FMRP. However, the mechanism by which FMRP modulates Ca2+ transients appears distinct depending on the type of neuron and the developmental stage. Indeed, FMRP modulates Ca2+ transients by directly affecting VGCCs: upregulating L-type Ca2+ channels in dendritic spines of young (P14–23) mouse cortical neurons (Meredith et al., 2007) and downregulating them in the soma of neural progenitors derived from human induced pluripotent stem cells and mouse brain (Danesi et al., 2018); upregulating N-type Ca2+ channels and downregulating P/Q-type Ca2+ channels in the soma of mouse E14.5 primary cortical neurons in culture (Castagnola et al., 2018); and downregulating R-type Ca2+ channels in the soma of mouse E18 hippocampal neurons in culture (Gray et al., 2019). FMRP also modulates Ca2+ transients indirectly by affecting potassium channels: upregulating BK channels in the soma of CA3 hippocampal neurons in young mice (15–25 days), and in dendrites of somatosensory cortical pyramidal neurons in young mice (4–6 weeks) (Deng et al., 2013; Zhang et al., 2014), upregulating A-type KV4 channels in the dendrites of CA1 pyramidal neurons in adult mice (Routh et al., 2013); and upregulating KV1.2 channels in inhibitory interneurons in the cerebellum of young mice (26–32 days) (Yang et al., 2018).
FMRP interacts with CaV2.2 channels via its C-terminal domain (Ferron et al., 2014). In the present study, we showed that the RGG domain (amino-acid 526 to 551) can interact with CaV2.2 but we also showed that the critical domain involved in the interaction is the distal C-terminal part of FMRP (amino-acid 552 to 614). The C-terminal domain of FMRP harbors a Low Complexity Domain (LCD, residue 466–632 in human FMRP) including a short arginine-glycine-rich (RGG) region which is an important domain for the interaction with RNAs (for review see (D'Annessa et al., 2019)). LCDs are intrinsically disordered domains that can promote dynamic interactions with proteins and RNAs and have been implicated in the formation of ribonucleoprotein particles (Kato et al., 2012).
FMRP controls the expression and the activity of numerous ion channels either by regulating the translation of specific mRNAs (Darnell et al., 2011; Hagerman et al., 2017) or by interacting directly with the pore-forming subunit or one of their auxiliary subunits (Brown et al., 2010; Deng et al., 2013, 2019; Ferron et al., 2014; Yang et al., 2018). We have previously shown that FMRP affects the plasma membrane expression of CaV2.2 (Ferron et al., 2014). In this study, we examined the effect of FMRP on the dynamic trafficking of CaV2.2 channels to the plasma membrane. We have provided evidence that FMRP does not interfere with the endocytosis of CaV2.2. Moreover, by disrupting the function of the Golgi apparatus with BFA, we have demonstrated that, while the recycling of the channels is not affected by FMRP, the forward trafficking of CaV2.2 from the endoplasmic reticulum to plasma membrane is reduced by the co-expression of FMRP. Post-translational modifications of Ca2+ channels are important steps in controlling their trafficking to functional site (Dolphin, 2012; Huang and Zamponi, 2017; Lipscombe et al., 2013). We have previously shown that the reduction of CaV2.2 cell surface expression induced by FMRP can be prevented by blocking proteasomal function, suggesting the involvement of the ubiquitin-proteasome system in the degradation of CaV2.2 (Ferron et al., 2014). Ubiquitination is a common post-translational modification and it can influence synaptic efficiency by modifying the degradation, trafficking and the activity of ion channels (Abriel and Staub, 2005; Altier et al., 2011; Marangoudakis et al., 2012; Page et al., 2016; Waithe et al., 2011; Yi and Ehlers, 2007). The involvement of FMRP in modifying CaV2.2 ubiquitination state will be investigated in future studies.
In summary, our findings reveal a critical role of FMRP in the localization of CaV channels to the presynaptic terminals and its effect on synaptic transmission in developing neurons. Controlling functional expression of CaV is currently under intensive study as it represents a potential therapy for many neurological diseases (Dolphin, 2018; Zamponi, 2016) and our findings suggest that it could also be a potential new avenue to restore proper synaptic plasticity and neural networks during early neural development in a context of FXS.
4. Methods
4.1. cDNA constructs
The following cDNAs were used: calcium channel CaV2.2 (rabbit, GenBank: D14157), containing an extracellular HA tag or bungarotoxin binding site (Ferron et al., 2014), β1b (rat, GenBank: X61394), α2δ-1 (rat, GenBank: M86621). VAMP-mOrange2 was generated by replacing mCherry from pCAGGs-VAMP-mCherry by mOrange2 (gifts from Tim Ryan). Sy-GCaMP6f was made by replacing GCaMP3 in pCMV-SyGCaMP3 (a gift from Tim Ryan) by GCaMP6f (Chen et al., 2013). GFP-FMRP was provided by G. J. Bassell. Ctrl shRNA and FMRP shRNA were previously described (Ferron et al., 2008, 2014).
4.2. Cell culture and transfection
Mouse neuroblastoma N2A cells (ATCC, male sex) were cultured in Dulbecco's modified Eagle's medium (DMEM) and OPTI-MEM (1:1), supplemented with 5% fetal bovine serum (FBS), 1 unit/ml penicillin, 1 μg/ml streptomycin and 1% GlutaMAX (Thermo Fisher Scientific). tsA-201 cells (ECACC, female sex) were cultured in DMEM supplemented with 10% FBS, 1 unit/ml penicillin, 1 μg/ml streptomycin and 2% GlutaMAX (Thermo Fisher Scientific). Cell lines were cultured in a 5% CO2 incubator at 37 °C. tsA-201 cells were transfected using FuGENE 6 transfection reagent (Promega) according to the manufacturer's protocol. N2A cells were transfected using PolyJet (SignaGen) at a ratio of 3:1 to DNA mix according to manufacturer's instructions.
For primary neuron cultures, all experiments were performed in accordance with the Home Office Animals (Scientific procedures) Act 1986, UK, using a Schedule 1 method. DRG/DH co-cultures were prepared as previously described with minor modifications (Ferron et al., 2014). Decapitated embryonic Sprague Dawley rats (E18) were placed into ice-cold Leibovitz's L-15 medium. Spinal cords were removed and the dorsal thirds were placed in warm S-MEM containing trypsin (100 μl of 2.5% trypsin per ml of S-MEM) and incubated for 20–25 min at 37 °C. Digested tissues were then washed twice with warm growth medium (Neurobasal A, 2% B-27, 10% FBS, 1 unit/ml penicillin, 1 μg/ml streptomycin, 1% GlutaMAX and 100 ng/ml mouse nerve growth factor 7S (Thermo Fisher Scientific)) and gently triturated with fire-polished glass Pasteur pipette. The cell suspension was then plated onto poly-l-lysine/laminin treated glass coverslip and incubated at 37 °C in a 5% CO2 incubator. Dorsal root ganglia were also excised from E18 rats and placed in Hank's Basal Salt Solution (HBSS) containing 3.75 mg/ml dispase, 1000 U/ml DNase 1 (Thermo Fisher Scientific) and 0.8 mg/ml collagenase type 1A (Sigma) for 25–30 min at 37 °C in a shaking water bath (200 rpm). Digested tissues were washed with warm 10% FBS-HBSS and centrifuged at 500g for 5 min. The pellet was re-suspended in warm HBSS and triturated using fire-polished glass Pasteur pipette to produce a single cell suspension. The cell suspension was centrifuged at 500g for 5 min and resuspended in 100 μl of Nucleofector (Rat Neuron Nucleofector kit, Lonza) and electroporated with a cDNA mix (2 μg DNA containing: synaptophysin-GCaMP6f, VAMP-mOrange2 and either Ctrl shRNA or FMRP shRNA) according to the manufacturer's protocol. The electroporated cells were then incubated for 7 min in 10% FBS-RPMI containing 50 ng/ml NGF at 37 °C and finally re-suspended in growth medium to be added dropwise on top of the dorsal horn neurons. Two hours after plating, growth medium is added to the cells and 24 h later growth medium is replaced with 1.5 ml conditioned medium (50% growth medium and 50% conditioned rat cortical astrocyte medium). Forty-height 48 h after plating, uridine/5-fluoro-2′-deoxyuridine (5 μM) is added to the culture medium. Half of the culture medium is replaced every 4–5 days.
Hippocampal neurons were obtained from male P0 Sprague Dawley rat pups as previously described (Ferron et al., 2018; Meyer et al., 2019). Approximately 75 × 103 cells in 200 μl of plating medium (MEM (Thermo Fisher Scientific) supplemented with B27 (Thermo Fisher Scientific, 2%), glucose (Sigma, 5 mg/ml), transferrin (Millipore, 100 μg/ml), insulin (Sigma, 24 μg/ml), fetal bovine serum (Thermo Fisher Scientific, 10%), GlutaMAX (Thermo Fisher Scientific,1%)) were seeded onto sterile poly-L-ornithine-coated glass coverslips. After 24 h, the plating medium was replaced with feeding medium (MEM supplemented with B27 (2%), glucose (5 mg/ml), transferrin (100 μg/ml), insulin (24 μg/ml), fetal bovine serum (5%), GlutaMAX (1%) and cytosine arabinose (Sigma, 0.4 μM)) half of which was replaced every 7 days. At 7 days in vitro (DIV) and 2 h before transfection, half of the medium was removed, and kept as ‘conditioned’ medium, and fresh medium was added. The hippocampal cell cultures were then transfected with synaptophysin-GCaMP6f, VAMP-mOrange2 and either Ctrl shRNA or FMRP shRNA using Lipofectamine 2000 (Thermo Fisher scientific). After 2 h, the transfection mixes were replaced with feeding medium consisting of 50% ‘conditioned’ and 50% fresh medium.
4.3. GST pull down assay
For pull-down assays, glutathione S-transferase (GST) was subcloned into pYES2.1/V5-His TOPO® TA (Invitrogen) by inserting PCR product using pGEX-2T as a template (GE Healthcare). GST-tagged constructs were generated by inserting PCR products of the mouse FMRP C-terminal (nucleotides 1514–2104; primer F: ACTAGTGAATTCTATATCACCTGAACTATTTAAAGGAAGTAGACC; primer R: ACTAGTGAATTCTTAGGGTACTCCATTCACCAGCGG), Δend (nucleotides 1514–1915; primer R: ACTAGTGAATTCTTATCCTTTGAAGCCTCCTCCTCT), ΔRGG (nucleotides 1514–1837; primer R: ACTAGTGAATTCTTACAGGAAGCTCTCCCTCTCTTC) and CTshort (nucleotides 1514–1693; primer R: ACTAGTGAATTCTTAATTTCTGTAAGGTCTACTACC) into EcoRI site of a pYES2.1/V5-His-GST. Yeasts (Saccharomyces cerevisiae) were transformed with individual expression vectors encoding the GST-fusion proteins and produced by standard methods. The yeast was lysed by vigorous shaking in PBS containing protease inhibitors (cOmplete tablet, Roche) and glass beads (Sigma) at 4 °C for 20 min. The lysates were then clarified by centrifugation (14,000 ×g, 5 min, 4 °C). GST-fusion proteins were immobilized on glutathione sepharose 4B beads (GE Healthcare) and incubated at 4 °C with lysate from tsA-201 cells transfected with CaV2.2/α2δ-1/β1b. Beads were washed four times with ice-cold 1% Triton-PBS containing protease inhibitors (cOmplete tablet, Roche) and incubated for 15 min at 55 °C with 100 mM dithiothreitol and 2xLaemmli sample buffer. Eluted proteins were then resolved by SDS-PAGE. The following antibodies (Ab) were used: rabbit polyclonal anti- CaV2.2 (Raghib et al., 2001) and mouse monoclonal anti-GST (Santa Cruz Biotechnology).
4.4. Western blot analysis
Forty-height hours after transfection, cells were rinsed twice with PBS and then harvested in PBS containing protease inhibitors (cOmplete tablet, Roche). The cells were lysed in PBS containing 1% Igepal and protease inhibitors for 30 min on ice. The detergent lysates were then clarified by centrifugation (14,000 ×g, 30 min, 4 °C). Proteins were separated by SDS-PAGE on 3–8% Tris-Acetate or 4–12% Bis-Tris gels and then transferred to polyvinylidene fluoride membranes. After blocking in TBS buffer (10 mM Tris, pH 7.4, 500 mM NaCl. 0.5% Igepal, 10% goat serum and 3% BSA), the membranes were incubated with primary antibody overnight. The protein-Ab complexes were then labelled with a horseradish peroxidase-conjugated secondary Ab (Sigma-Aldrich) for 1 h at room temperature and detected using the enhanced ECL Plus reagent (GE Healthcare) visualized with a Typhoon 9410 scanner (GE Healthcare). Quantification of immunoblot bands was performed with ImageQuant software (GE Healthcare) or Image J.
4.5. Endocytosis and forward trafficking experiments
N2a cells were plated onto glass-bottomed dishes (MatTek Corp., Ashland, MA) precoated with poly-l-lysine and transfected with a CaV2.2 construct tagged with a double bungarotoxin binding site epitope (CaV2.2-BBS) (Cassidy et al., 2014; Dahimene et al., 2018), α2δ-1, β1b and either empty vector or HA-FMRP (Ferron et al., 2014). After 40 h expression, cells were washed twice with Krebs-Ringer solution with HEPES (KRH) (in mM; 125 NaCl, 5 KCl, 1.1 MgCl2, 1.2 KH2PO4, 2 CaCl2, 6 Glucose, 25 HEPES, 1 NaHCO3). For endocytosis experiments, cells were incubated with 10 μg/ml α-bungarotoxin Alexa Fluor® 488 conjugate (BTX488) (Thermo Fisher Scientific) at 17 °C for 30 min. The unbound BTX488 was removed by washing with KRH, and the labelled cells were returned to 37 °C for the kinetic assay. Endocytosis was terminated by fixing the cells with cold 4% PFA-sucrose in PBS at the specified time. The cells were then mounted with VectaShield mounting medium (Vector Laboratories). For forward trafficking assay, the cells were incubated with 10 μg/ml unlabeled α-bungarotoxin (BTX; Invitrogen) at 17 °C for 30 min. The unbound BTX was washed off with KRH, and the cells were then incubated with 10 μg/ml BTX488 in KRH at 37 °C. To stop the reaction, cells were washed twice with cold KRH and then fixed with 4% PFA in PBS at specified times for the kinetic assay. Brefeldin A [BFA; 200 ng/ml (0.71 μM); Sigma-Aldrich] in 0.4% DMSO was added to the cells in FBS-free N2a cell culture medium for 4 h before the experiment, and during the experiment in KRH buffer. N2A cell samples were viewed on an LSM 780 confocal microscope (Zeiss) using a 63×/1.4 numerical aperture oil-immersion objective in 16-bit mode. The tile function (3 × 3 tiles, each tile consisting of 1024 × 1024 pixels) was used and every transfected cell within the image was analyzed to remove collection bias. Acquisition settings, chosen to ensure that images were not saturated, were kept constant for each experiment.
4.6. Live cell imaging
Neurons were imaged 14–16 days in culture. Live cell images were acquired as previously described with minor modifications (Kadurin et al., 2016). Coverslips were mounted in a rapid-switching, laminar-flow perfusion and stimulation chamber (RC-21BRFS, Warner Instruments) on the stage of an epifluorescence microscope (Axiovert 200 M, Zeiss). Live cell images were acquired with an Andor iXon+ (model DU-897U-CS0-BV) back-illuminated EMCCD camera using OptoMorph software (Cairn Research, UK). White and 470 nm LEDs served as light sources (Cairn Research, UK). Fluorescence excitation and collection was done through a Zeiss 40 × 1.3 NA Fluar objective using 450/50 nm excitation and 510/50 nm emission and 480 nm dichroic filters (for sy-GCaMP6f) and a 545/25 nm excitation and 605/70 nm emission and 565 nm dichroic filters (for mOrange2). Action potentials were evoked by passing 1 ms current pulses via platinum electrodes. Cells were perfused (0.5 ml min−1) in a saline solution at 25 °C containing (in mM) 119 NaCl, 2.5 KCl, 2 CaCl2, 2 MgCl2, 25 HEPES (buffered to pH 7.4), 30 glucose, 10 μM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) and 50 μM D,L-2-amino-5-phosphonovaleric acid (AP5, Sigma). Images were acquired at 100 Hz over a 512 × 266 pixel area in frame transfer mode (exposure time 7 ms) and analyzed in ImageJ (http://rsb.info.nih.gov/ij) using a custom-written plugin (http://rsb.info.nih.gov/ij/plugins/time-series.html). Successfully transfected neurons were identified by visualizing sy-GCaMP6f fluorescence in response to a 33 Hz stimulation for 180 ms every 4 s. Subsequently, single stimulations of 1 ms (mimicking single AP) were repeated 5 times with 30–45 s intervals. Regions of interest (ROI, 2 μm diameter circles) were placed around synaptic boutons responding to an electrical stimulation of 10 AP at 60 Hz. Functional synaptic boutons were identified by the increase of fluorescence of VAMP-mOr2 in response to 200 APs at 10 Hz (in this case images were acquired at 2 Hz with 50 ms exposure time). ω-conotoxin GVIA (1 μM), ω-agatoxin IVA (300 nM) (Alomone Labs) and nifedipine (10 μM, Sigma, dissolved in DMSO) were perfused for at least 5 min either alone or in combination before imaging. In order to show that the expression of the Ctrl shRNA construct did not affect CaV activity, we have compared the amplitude of the response to 1 AP (ΔF/F0) recorded from hippocampal neurons expressing sy-GCaMP6f and VAMP-mOr2 vs hippocampal neurons expressing sy-GCaMP6f and VAMP-mOr2 with Ctrl shRNA: 0.030 ± 0.005 (n = 5) and 0.034 ± 0.004 (n = 5), respectively (P = .57, t-test).
4.7. Statistical analysis
Data are given as mean ± SEM. Statistical comparisons were performed using paired, unpaired Student's t-test or one-way ANOVA with Bonferroni post-hoc test, as appropriate, using OriginPro 2016.
Declaration of Competing Interest
None.
Acknowledgements
This work was supported by a Wellcome Trust Investigator award to ACD (206279/Z/17/Z) and a Medical Research Council grant to ACD and LF (MR/J013285/1). We thank K. Chaggar for technical support. We thank M. Nieto-Rostro for her constructive comments on the manuscript.
References
- de Juan-Sanz J., Holt G.T., Schreiter E.R., de Juan F., Kim D.S., Ryan T.A. Axonal endoplasmic reticulum Ca(2+) content controls release probability in CNS nerve terminals. Neuron. 2017;93 doi: 10.1016/j.neuron.2017.01.010. (867–881 e866) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Abriel H., Staub O. Ubiquitylation of ion channels. Physiology (Bethesda) 2005;20:398–407. doi: 10.1152/physiol.00033.2005. [DOI] [PubMed] [Google Scholar]
- Albuquerque C., Joseph D.J., Choudhury P., MacDermott A.B. Cold Spring Harb Protoc 2009, pdb prot5275. 2009. Dissection, plating, and maintenance of dorsal root ganglion neurons for monoculture and for coculture with dorsal horn neurons. [DOI] [PubMed] [Google Scholar]
- Altier C., Garcia-Caballero A., Simms B., You H., Chen L., Walcher J., Tedford H.W., Hermosilla T., Zamponi G.W. The Cavbeta subunit prevents RFP2-mediated ubiquitination and proteasomal degradation of L-type channels. Nat. Neurosci. 2011;14:173–180. doi: 10.1038/nn.2712. [DOI] [PubMed] [Google Scholar]
- Banerjee A., Ifrim M.F., Valdez A.N., Raj N., Bassell G.J. Aberrant RNA translation in fragile X syndrome: from FMRP mechanisms to emerging therapeutic strategies. Brain Res. 2018;1693:24–36. doi: 10.1016/j.brainres.2018.04.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bernal Sierra Y.A., Haseleu J., Kozlenkov A., Begay V., Lewin G.R. Genetic tracing of Cav3.2 T-type calcium channel expression in the peripheral nervous system. Front. Mol. Neurosci. 2017;10:70. doi: 10.3389/fnmol.2017.00070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Boland L.M., Morrill J.A., Bean B.P. Omega-Conotoxin block of N-type calcium channels in frog and rat sympathetic neurons. J. Neurosci. 1994;14:5011–5027. doi: 10.1523/JNEUROSCI.14-08-05011.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bourinet E., Alloui A., Monteil A., Barrere C., Couette B., Poirot O., Pages A., McRory J., Snutch T.P., Eschalier A. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 2005;24:315–324. doi: 10.1038/sj.emboj.7600515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Braat S., Kooy R.F. Insights into GABAAergic system deficits in fragile X syndrome lead to clinical trials. Neuropharmacology. 2015;88:48–54. doi: 10.1016/j.neuropharm.2014.06.028. [DOI] [PubMed] [Google Scholar]
- Brockhaus J., Bruggen B., Missler M. Imaging and analysis of presynaptic calcium influx in cultured neurons using synGCaMP6f. Front. Synaptic Neurosci. 2019;11:12. doi: 10.3389/fnsyn.2019.00012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brown M.R., Kronengold J., Gazula V.R., Chen Y., Strumbos J.G., Sigworth F.J., Navaratnam D., Kaczmarek L.K. Fragile X mental retardation protein controls gating of the sodium-activated potassium channel slack. Nat. Neurosci. 2010;13:819–821. doi: 10.1038/nn.2563. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cao Y.Q., Tsien R.W. Different relationship of N- and P/Q-type Ca2+ channels to channel-interacting slots in controlling neurotransmission at cultured hippocampal synapses. J. Neurosci. 2010;30:4536–4546. doi: 10.1523/JNEUROSCI.5161-09.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cao Y.Q., Piedras-Renteria E.S., Smith G.B., Chen G., Harata N.C., Tsien R.W. Presynaptic Ca2+ channels compete for channel type-preferring slots in altered neurotransmission arising from Ca2+ channelopathy. Neuron. 2004;43:387–400. doi: 10.1016/j.neuron.2004.07.014. [DOI] [PubMed] [Google Scholar]
- Cassidy J.S., Ferron L., Kadurin I., Pratt W.S., Dolphin A.C. Functional exofacially tagged N-type calcium channels elucidate the interaction with auxiliary alpha2delta-1 subunits. Proc. Natl. Acad. Sci. U. S. A. 2014;111:8979–8984. doi: 10.1073/pnas.1403731111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Castagnola S., Delhaye S., Folci A., Paquet A., Brau F., Duprat F., Jarjat M., Grossi M., Beal M., Martin S. New insights into the role of Cav2 protein family in calcium flux deregulation in Fmr1-KO neurons. Front. Mol. Neurosci. 2018;11:342. doi: 10.3389/fnmol.2018.00342. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen T.W., Wardill T.J., Sun Y., Pulver S.R., Renninger S.L., Baohan A., Schreiter E.R., Kerr R.A., Orger M.B., Jayaraman V. Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature. 2013;499:295–300. doi: 10.1038/nature12354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Contractor A., Klyachko V.A., Portera-Cailliau C. Altered neuronal and circuit excitability in fragile X syndrome. Neuron. 2015;87:699–715. doi: 10.1016/j.neuron.2015.06.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dahimene S., Page K.M., Kadurin I., Ferron L., Ho D.Y., Powell G.T., Pratt W.S., Wilson S.W., Dolphin A.C. The alpha2delta-like protein Cachd1 increases N-type calcium currents and cell surface expression and competes with alpha2delta-1. Cell Rep. 2018;25 doi: 10.1016/j.celrep.2018.10.033. (1610–1621 e1615) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Danesi C., Achuta V.S., Corcoran P., Peteri U.K., Turconi G., Matsui N., Albayrak I., Rezov V., Isaksson A., Castren M.L. Increased calcium influx through L-type calcium channels in human and mouse neural progenitors lacking fragile X mental retardation protein. Stem Cell Rep. 2018;11:1449–1461. doi: 10.1016/j.stemcr.2018.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- D’Annessa I., Cicconardi F., Di Marino D. Handling FMRP and its molecular partners: structural insights into Fragile X syndrome. Prog. Biophys. Mol. Biol. 2019;141:3–14. doi: 10.1016/j.pbiomolbio.2018.07.001. [DOI] [PubMed] [Google Scholar]
- Darnell J.C., Van Driesche S.J., Zhang C., Hung K.Y., Mele A., Fraser C.E., Stone E.F., Chen C., Fak J.J., Chi S.W. FMRP stalls ribosomal translocation on mRNAs linked to synaptic function and autism. Cell. 2011;146:247–261. doi: 10.1016/j.cell.2011.06.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- David L.S., Garcia E., Cain S.M., Thau E., Tyson J.R., Snutch T.P. Splice-variant changes of the Ca(V)3.2 T-type calcium channel mediate voltage-dependent facilitation and associate with cardiac hypertrophy and development. Channels (Austin) 2010;4:375–389. doi: 10.4161/chan.4.5.12874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Deng P.Y., Sojka D., Klyachko V.A. Abnormal presynaptic short-term plasticity and information processing in a mouse model of fragile X syndrome. J. Neurosci. 2011;31:10971–10982. doi: 10.1523/JNEUROSCI.2021-11.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Deng P.Y., Rotman Z., Blundon J.A., Cho Y., Cui J., Cavalli V., Zakharenko S.S., Klyachko V.A. FMRP regulates neurotransmitter release and synaptic information transmission by modulating action potential duration via BK channels. Neuron. 2013;77:696–711. doi: 10.1016/j.neuron.2012.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Deng P.Y., Carlin D., Oh Y.M., Myrick L.K., Warren S.T., Cavalli V., Klyachko V.A. Voltage-independent SK-channel dysfunction causes neuronal hyperexcitability in the hippocampus of Fmr1 knock-out mice. J. Neurosci. 2019;39:28–43. doi: 10.1523/JNEUROSCI.1593-18.2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dietrich D., Kirschstein T., Kukley M., Pereverzev A., von der Brelie C., Schneider T., Beck H. Functional specialization of presynaptic Cav2.3 Ca2+ channels. Neuron. 2003;39:483–496. doi: 10.1016/s0896-6273(03)00430-6. [DOI] [PubMed] [Google Scholar]
- Dittman J.S., Ryan T.A. The control of release probability at nerve terminals. Nat. Rev. Neurosci. 2019;20:177–186. doi: 10.1038/s41583-018-0111-3. [DOI] [PubMed] [Google Scholar]
- Dolphin A.C. Calcium channel auxiliary alpha2delta and beta subunits: trafficking and one step beyond. Nat. Rev. Neurosci. 2012;13:542–555. doi: 10.1038/nrn3311. [DOI] [PubMed] [Google Scholar]
- Dolphin A.C. Voltage-gated calcium channels: their discovery, function and importance as drug targets. Brain Neurosci. Adv. 2018;2 doi: 10.1177/2398212818794805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Doughty J.M., Barnes-Davies M., Rusznak Z., Harasztosi C., Forsythe I.D. Contrasting Ca2+ channel subtypes at cell bodies and synaptic terminals of rat anterioventral cochlear bushy neurones. J. Physiol. 1998;512(Pt 2):365–376. doi: 10.1111/j.1469-7793.1998.365be.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Du X., Hao H., Gigout S., Huang D., Yang Y., Li L., Wang C., Sundt D., Jaffe D.B., Zhang H. Control of somatic membrane potential in nociceptive neurons and its implications for peripheral nociceptive transmission. Pain. 2014;155:2306–2322. doi: 10.1016/j.pain.2014.08.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ferron L. Fragile X mental retardation protein controls ion channel expression and activity. J. Physiol. 2016;594:5861–5867. doi: 10.1113/JP270675. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ferron L., Davies A., Page K.M., Cox D.J., Leroy J., Waithe D., Butcher A.J., Sellaturay P., Bolsover S., Pratt W.S. The stargazin-related protein gamma 7 interacts with the mRNA-binding protein heterogeneous nuclear ribonucleoprotein A2 and regulates the stability of specific mRNAs, including CaV2.2. J. Neurosci. 2008;28:10604–10617. doi: 10.1523/JNEUROSCI.2709-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ferron L., Nieto-Rostro M., Cassidy J.S., Dolphin A.C. Fragile X mental retardation protein controls synaptic vesicle exocytosis by modulating N-type calcium channel density. Nat. Commun. 2014;5 doi: 10.1038/ncomms4628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ferron L., Kadurin I., Dolphin A.C. Proteolytic maturation of alpha2delta controls the probability of synaptic vesicular release. Elife. 2018;7 doi: 10.7554/eLife.37507. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fox A.P., Nowycky M.C., Tsien R.W. Kinetic and pharmacological properties distinguishing three types of calcium currents in chick sensory neurones. J. Physiol. 1987;394:149–172. doi: 10.1113/jphysiol.1987.sp016864. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fox A.P., Nowycky M.C., Tsien R.W. Single-channel recordings of three types of calcium channels in chick sensory neurones. J. Physiol. 1987;394:173–200. doi: 10.1113/jphysiol.1987.sp016865. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gomora J.C., Murbartian J., Arias J.M., Lee J.H., Perez-Reyes E. Cloning and expression of the human T-type channel Ca(v)3.3: insights into prepulse facilitation. Biophys. J. 2002;83:229–241. doi: 10.1016/s0006-3495(02)75164-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gray E.E., Murphy J.G., Liu Y., Trang I., Tabor G.T., Lin L., Hoffman D.A. Disruption of GpI mGluR-dependent Cav2.3 translation in a mouse model of fragile X syndrome. J. Neurosci. 2019;39:7453–7464. doi: 10.1523/JNEUROSCI.1443-17.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hagerman R.J., Berry-Kravis E., Hazlett H.C., Bailey D.B., Jr., Moine H., Kooy R.F., Tassone F., Gantois I., Sonenberg N., Mandel J.L. Fragile X syndrome. Nat. Rev. Dis. Primers. 2017;3 doi: 10.1038/nrdp.2017.65. [DOI] [PubMed] [Google Scholar]
- Hoppa M.B., Lana B., Margas W., Dolphin A.C., Ryan T.A. alpha2delta expression sets presynaptic calcium channel abundance and release probability. Nature. 2012;486:122–125. doi: 10.1038/nature11033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang J., Zamponi G.W. Regulation of voltage gated calcium channels by GPCRs and post-translational modification. Curr. Opin. Pharmacol. 2017;32:1–8. doi: 10.1016/j.coph.2016.10.001. [DOI] [PubMed] [Google Scholar]
- Huber K.M., Klann E., Costa-Mattioli M., Zukin R.S. Dysregulation of mammalian target of rapamycin signaling in mouse models of autism. J. Neurosci. 2015;35:13836–13842. doi: 10.1523/JNEUROSCI.2656-15.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hudmon A., Schulman H., Kim J., Maltez J.M., Tsien R.W., Pitt G.S. CaMKII tethers to L-type Ca2+ channels, establishing a local and dedicated integrator of Ca2+ signals for facilitation. J. Cell Biol. 2005;171:537–547. doi: 10.1083/jcb.200505155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jiang X., Lautermilch N.J., Watari H., Westenbroek R.E., Scheuer T., Catterall W.A. Modulation of CaV2.1 channels by Ca2+/calmodulin-dependent protein kinase II bound to the C-terminal domain. Proc. Natl. Acad. Sci. U. S. A. 2008;105:341–346. doi: 10.1073/pnas.0710213105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kadurin I., Ferron L., Rothwell S.W., Meyer J.O., Douglas L.R., Bauer C.S., Lana B., Margas W., Alexopoulos O., Nieto-Rostro M. Proteolytic maturation of alpha2delta represents a checkpoint for activation and neuronal trafficking of latent calcium channels. Elife. 2016;5 doi: 10.7554/eLife.21143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kato M., Han T.W., Xie S., Shi K., Du X., Wu L.C., Mirzaei H., Goldsmith E.J., Longgood J., Pei J. Cell-free formation of RNA granules: low complexity sequence domains form dynamic fibers within hydrogels. Cell. 2012;149:753–767. doi: 10.1016/j.cell.2012.04.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Leroy J., Pereverzev A., Vajna R., Qin N., Pfitzer G., Hescheler J., Malecot C.O., Schneider T., Klockner U. Ca2+−sensitive regulation of E-type Ca2+ channel activity depends on an arginine-rich region in the cytosolic II-III loop. Eur. J. Neurosci. 2003;18:841–855. doi: 10.1046/j.1460-9568.2003.02819.x. [DOI] [PubMed] [Google Scholar]
- Lipscombe D., Allen S.E., Toro C.P. Control of neuronal voltage-gated calcium ion channels from RNA to protein. Trends Neurosci. 2013;36:598–609. doi: 10.1016/j.tins.2013.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lubbert M., Goral R.O., Keine C., Thomas C., Guerrero-Given D., Putzke T., Satterfield R., Kamasawa N., Young S.M., Jr. CaV2.1 alpha1 subunit expression regulates presynaptic CaV2.1 abundance and synaptic strength at a central synapse. Neuron. 2019;101 doi: 10.1016/j.neuron.2018.11.028. (260–273 e266) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marangoudakis S., Andrade A., Helton T.D., Denome S., Castiglioni A.J., Lipscombe D. Differential ubiquitination and proteasome regulation of Ca(V)2.2 N-type channel splice isoforms. J. Neurosci. 2012;32:10365–10369. doi: 10.1523/JNEUROSCI.0851-11.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Margas W., Ferron L., Nieto-Rostro M., Schwartz A., Dolphin A.C. Effect of knockout of alpha2delta-1 on action potentials in mouse sensory neurons. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 2016;371 doi: 10.1098/rstb.2015.0430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Meredith R.M., Holmgren C.D., Weidum M., Burnashev N., Mansvelder H.D. Increased threshold for spike-timing-dependent plasticity is caused by unreliable calcium signaling in mice lacking fragile X gene FMR1. Neuron. 2007;54:627–638. doi: 10.1016/j.neuron.2007.04.028. [DOI] [PubMed] [Google Scholar]
- Meyer J.O., Dahimene S., Page K.M., Ferron L., Kadurin I., Ellaway J.I.J., Zhao P., Patel T., Rothwell S.W., Lin P. Disruption of the key Ca(2+) binding site in the selectivity filter of neuronal voltage-gated calcium channels inhibits channel trafficking. Cell Rep. 2019;29 doi: 10.1016/j.celrep.2019.08.079. (22–33 e25) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Neher E., Sakaba T. Multiple roles of calcium ions in the regulation of neurotransmitter release. Neuron. 2008;59:861–872. doi: 10.1016/j.neuron.2008.08.019. [DOI] [PubMed] [Google Scholar]
- Page K.M., Rothwell S.W., Dolphin A.C. The CaVbeta subunit protects the I-II loop of the voltage-gated calcium channel CaV2.2 from proteasomal degradation but not oligoubiquitination. J. Biol. Chem. 2016;291:20402–20416. doi: 10.1074/jbc.M116.737270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Perez-Reyes E. Molecular physiology of low-voltage-activated t-type calcium channels. Physiol. Rev. 2003;83:117–161. doi: 10.1152/physrev.00018.2002. [DOI] [PubMed] [Google Scholar]
- Raghib A., Bertaso F., Davies A., Page K.M., Meir A., Bogdanov Y., Dolphin A.C. Dominant-negative synthesis suppression of voltage-gated calcium channel Cav2.2 induced by truncated constructs. J. Neurosci. 2001;21:8495–8504. doi: 10.1523/JNEUROSCI.21-21-08495.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Regan L.J., Sah D.W., Bean B.P. Ca2+ channels in rat central and peripheral neurons: high-threshold current resistant to dihydropyridine blockers and omega-conotoxin. Neuron. 1991;6:269–280. doi: 10.1016/0896-6273(91)90362-4. [DOI] [PubMed] [Google Scholar]
- Richter J.D., Bassell G.J., Klann E. Dysregulation and restoration of translational homeostasis in fragile X syndrome. Nat. Rev. Neurosci. 2015;16:595–605. doi: 10.1038/nrn4001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Routh B.N., Johnston D., Brager D.H. Loss of functional A-type potassium channels in the dendrites of CA1 pyramidal neurons from a mouse model of fragile X syndrome. J. Neurosci. 2013;33:19442–19450. doi: 10.1523/JNEUROSCI.3256-13.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Santoro M.R., Bray S.M., Warren S.T. Molecular mechanisms of fragile X syndrome: a twenty-year perspective. Annu. Rev. Pathol. 2012;7:219–245. doi: 10.1146/annurev-pathol-011811-132457. [DOI] [PubMed] [Google Scholar]
- Scott R., Rusakov D.A. Main determinants of presynaptic Ca2+ dynamics at individual mossy fiber-CA3 pyramidal cell synapses. J. Neurosci. 2006;26:7071–7081. doi: 10.1523/JNEUROSCI.0946-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takahashi T., Momiyama A. Different types of calcium channels mediate central synaptic transmission. Nature. 1993;366:156–158. doi: 10.1038/366156a0. [DOI] [PubMed] [Google Scholar]
- Tessier C.R., Broadie K. The fragile X mental retardation protein developmentally regulates the strength and fidelity of calcium signaling in Drosophila mushroom body neurons. Neurobiol. Dis. 2011;41:147–159. doi: 10.1016/j.nbd.2010.09.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Waithe D., Ferron L., Page K.M., Chaggar K., Dolphin A.C. Beta-subunits promote the expression of Ca(V)2.2 channels by reducing their proteasomal degradation. J. Biol. Chem. 2011;286:9598–9611. doi: 10.1074/jbc.M110.195909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Z., Van den Berg R.J., Ypey D.L. Resting membrane potentials and excitability at different regions of rat dorsal root ganglion neurons in culture. Neuroscience. 1994;60:245–254. doi: 10.1016/0306-4522(94)90218-6. [DOI] [PubMed] [Google Scholar]
- Watanabe M., Ueda T., Shibata Y., Kumamoto N., Shimada S., Ugawa S. Expression and regulation of Cav3.2 T-type calcium channels during inflammatory hyperalgesia in mouse dorsal root ganglion neurons. PLoS One. 2015;10 doi: 10.1371/journal.pone.0127572. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wheeler D.B., Randall A., Tsien R.W. Roles of N-type and Q-type Ca2+ channels in supporting hippocampal synaptic transmission. Science. 1994;264:107–111. doi: 10.1126/science.7832825. [DOI] [PubMed] [Google Scholar]
- Wilson S.M., Toth P.T., Oh S.B., Gillard S.E., Volsen S., Ren D., Philipson L.H., Lee E.C., Fletcher C.F., Tessarollo L. The status of voltage-dependent calcium channels in alpha 1E knock-out mice. J. Neurosci. 2000;20:8566–8571. doi: 10.1523/JNEUROSCI.20-23-08566.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu Z.Q., Zhang X., Grillner S., Hokfelt T. Electrophysiological studies on rat dorsal root ganglion neurons after peripheral axotomy: changes in responses to neuropeptides. Proc. Natl. Acad. Sci. U. S. A. 1997;94:13262–13266. doi: 10.1073/pnas.94.24.13262. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang Y.M., Arsenault J., Bah A., Krzeminski M., Fekete A., Chao O.Y., Pacey L.K., Wang A., Forman-Kay J., Hampson D.R. Identification of a molecular locus for normalizing dysregulated GABA release from interneurons in the Fragile X brain. Mol. Psychiatry. 2018 doi: 10.1038/s41380-018-0240-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yi J.J., Ehlers M.D. Emerging roles for ubiquitin and protein degradation in neuronal function. Pharmacol. Rev. 2007;59:14–39. doi: 10.1124/pr.59.1.4. [DOI] [PubMed] [Google Scholar]
- Zalfa F., Giorgi M., Primerano B., Moro A., Di Penta A., Reis S., Oostra B., Bagni C. The fragile X syndrome protein FMRP associates with BC1 RNA and regulates the translation of specific mRNAs at synapses. Cell. 2003;112:317–327. doi: 10.1016/s0092-8674(03)00079-5. [DOI] [PubMed] [Google Scholar]
- Zamponi G.W. Targeting voltage-gated calcium channels in neurological and psychiatric diseases. Nat. Rev. Drug Discov. 2016;15:19–34. doi: 10.1038/nrd.2015.5. [DOI] [PubMed] [Google Scholar]
- Zamponi G.W., Striessnig J., Koschak A., Dolphin A.C. The physiology, pathology, and pharmacology of voltage-gated calcium channels and their future therapeutic potential. Pharmacol. Rev. 2015;67:821–870. doi: 10.1124/pr.114.009654. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Y., Brown M.R., Hyland C., Chen Y., Kronengold J., Fleming M.R., Kohn A.B., Moroz L.L., Kaczmarek L.K. Regulation of neuronal excitability by interaction of Fragile X mental retardation protein with slack potassium channels. J. Neurosci. 2012;32:15318–15327. doi: 10.1523/JNEUROSCI.2162-12.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Y., Bonnan A., Bony G., Ferezou I., Pietropaolo S., Ginger M., Sans N., Rossier J., Oostra B., LeMasson G. Dendritic channelopathies contribute to neocortical and sensory hyperexcitability in Fmr1(−/y) mice. Nat. Neurosci. 2014;17:1701–1709. doi: 10.1038/nn.3864. [DOI] [PubMed] [Google Scholar]