Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2020 Apr 14;10:6365. doi: 10.1038/s41598-020-63222-1

Quantitative Analysis of Salivary Oral Bacteria Associated with Severe Early Childhood Caries and Construction of Caries Assessment Model

Lijuan Zhang 1,2,#, Tongzheng Sun 3,#, Pengfei Zhu 4, Zheng Sun 4, Shanshan Li 1, Fan Li 1,2, Ying Zhang 1, Kaixuan Tan 2, Jie Lu 2, Rongtao Yuan 2, Zhenggang Chen 2, Dawei Guo 2, Qingyuan Guo 2, Fei Teng 4,✉, Fang Yang 1,2,✉
PMCID: PMC7156402  PMID: 32286402

Abstract

To construct a saliva-based caries risk assessment model, saliva samples from 176 severe early childhood caries (S-ECC) children and 178 healthy (H) children were screened by real-time PCR-based quantification of the selected species, including Streptococcus mutans, Prevotella pallens, Prevotella denticola and Lactobacillus fermentum. Host factors including caries status, dmft indices, age, gender, and geographic origin were assessed in their influence on abundance of the targeted species, which revealed host caries status as the dominant factor, followed by dmft indices (both P < 0.01). Moreover, levels of S. mutans and P. denticola in the S-ECC group were significantly higher than those in the healthy group (P < 0.001 for S. mutans and P < 0.01 for P. denticola). Interestingly, the co-occurrence network of these targeted species in the S-ECC group differed from that from the healthy group. Finally, based on the combined change pattern of S. mutans and P. pallens, we constructed an S-ECC diagnosis model with an accuracy of 72%. This saliva-based caries diagnosis model is of potential value for circumstances where sampling dental plague is difficult.

Subject terms: Microbiology, Medical research

Introduction

Early childhood caries (ECC) is defined as the presence of one or more decayed, missing, or filled tooth surfaces in the primary dentition in children of 71 months or younger1. Severe early childhood caries (S-ECC), an extraordinary form of ECC, is defined as the presence of decayed, missing, or filled score surfaces of either ≥4 (age 3 years), ≥5 (age 4 years), or ≥6 (age 5 years)2. In USA, 23% of children between the ages of 2 and 5 are affected by ECC3. In China, fresh reports from the Fourth National Oral Health Survey showed that over 70% of 5-year-old children carry dental caries in primary teeth4. Unfortunately, childhood caries are wide-ranging, rapid-progressing and irreversible5. Besides, severe caries can cause pulpal infection, as well as varieties of adverse physical and psychological effects, thus it affects children’s development while posing a substantial economic burden on both families and society6–8. Therefore, preventive measures and early diagnosis of ECC or S-ECC are of vital clinical and social importance.

Many studies have shown that caries is a multifactorial disease9,10 and pathogenic bacteria are the main cause of disease occurrence and progression11. Streptococcus mutans (S. mutans) has been considered as a cariogenic bacterial agent in children12–15, due to its aciduric and acidogenic properties16. Apart from this, Lactobacillus spp. was also linked to caries development and progression16–18. Positive associations between certain Lactobacillus spp. (especially Lactobacillus fermentum) and the hard tissue changes were revealed in the process of caries progression19,20. In addition, our past pyrosequencing of oral and plaque microbiota unveiled Prevotella spp’s close relationship with caries, in both cross-sectional and longitudinal studies21,22. Specifically, we proposed a caries risk assessment model based on the relative abundance of seven Prevotella spp. (Prevotella pallens, P. denticola, P. verovalis, P. salivae, P. histicola, P. DO039 and P. maculosa), which features 74% accuracy in predicting new onsets of ECC22. A number of studies have also reported strong association between several Prevotella spp. (in particular P. denticola) and caries status as well23–25.

However, at present it is not clear whether the absolute amount of above caries-associated taxa showed differential features among S-ECC and healthy; and moreover, if we could construct a saliva based efficient and economic caries diagnosis model based on PCR quantification. Therefore here we designed a cross-sectional study of 354 children, including 176 caries-active children (dmft≥6) and 178 healthy children (dmft=0), and quantify caries-associated organisms including S. mutans, L. fermentum, P. pallens, and P. denticola from saliva via quantitative real-time PCR (qPCR).

Results

Quantifying absolute abundance of selected bacteria from saliva

In total, 354 children (3–5 years of age), including 176 severe early childhood caries (S-ECC) (dmft≥6) children and 178 healthy (H) (dmft=0) children, were screened saliva sample collection. Detection and quantification of the selected species in salivary samples were performed by qPCR. The absolute amounts of S. mutans, P. pallens, P. denticola and L. fermentum were assessed by specific qPCR primers. Two pairs of primers (for S. mutans and L. fermentum) were used based on the published primer protocols (Table 1). Another two pairs of new primers (for P. pallens and P. denticola) were designed using AlleleID 6.0 (Premier Biosoft, Palo Alto, CA, USA) for qPCR and then analyzed in BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGcE_TYPE=BlastSearch). Specificity of above newly designed primers were verified in Fig. 1. The result showed that both the P. denticola and P. pallens primer pairs displayed good specificity at the species level. The thermal conditions of qPCR reactions were listed in Table 2.

Table 1.

DNA primers used in the qPCR analysis.

Target species Primer name Primer sequence (5′ → 3′) Amplicon Size(bp) References
Prevotella denticola Pd-R-12 AGATGGATGCAGAGCTGAAGC 150 —
Pd-F-12 GTCACCGACCTGGATCTTACG
Prevotella pallens Pp-16SB-F AGCCTGAACCAGCCAAGTAG 150 —
Pp-16SB-R GCCGGTCCTTATTCATACGATAC
Streptococcus mutans Sm-F2 GCAGTCAAGGGGTGGAAATCG 188 38
Sm-R2 TGGACGGCTTGTTGCAGGAATAC
Lactobacillus fermentum LF-F TGGAAACAGRTGCTAATACCG 231–233 19
LF-R GTCCATTGTGGAAGATTCCC

Figure 1.

Figure 1

Verification of the specificity of those two Prevotella primers. (A) Specificity of the primer pair targeting P. denticola. Lane 1–9 showed the amplification result of P. denticola primer pair from the genomic DNA of various oral species. Amplification was positive only when using P. denticola DNA as template. (B) Specificity of the primer pair targeting P. pallens. Lane 1–9 showed the amplification result of P. pallens primer pair from the genomic DNA of various oral species. Amplification was positive only when using P. pallens DNA.

Table 2.

Thermal cycling conditions for qPCR analysis.

Species Thermal cycling conditions
Pre-heating denaturation annealing elongation cycles
Prevotella denticola 94 °C, 10 min 94 °C, 15 s 60 °C, 20 s 72 °C, 15 s 30
Prevotella pallens 94 °C, 10 min 94 °C, 15 s 60 °C, 20 s 72 °C, 15 s 30
Streptococcus mutans 94 °C, 10 min 95 °C, 10 s 62–72 °C, 30 s 70 °C, 30 s 30
Lactobacillus fermentum 95 °C, 10 min 95 °C, 15 s 62 °C, 1 min 50 °C, 2 min 30

Influence of hosts’ factors in defining species levels

To compare the effect sizes of the various host factors on the bacterial levels, permutational multivariate analysis of variance (PERMANOVA) was applied. As shown in Table 3, among the five hosts’ factors including age, gender, caries-status, dmft indices and geographical origin, caries status displayed the strongest effect in defining the bacterial level, followed by dmft indices (F = 43.757, F = 3.420, respectively, both P < 0.01). No significant effect was observed from hosts’ age, gender, and geographic origin on the level of these species (P > 0.05). Hosts’ geographic origin also contributed to the differential load of those species, in which the amounts of S. mutans and P. pallens from northern city were significantly higher than those from the southern city (all P < 0.001, Mann-Whitney’s U test). However, no significant difference was found within these species’ levels among genders (P > 0.05, Mann-Whitney’s U test).

Table 3.

Influence of host factors on the abundance of selected species.

F value P value
Caries status 43.757 1.06E-03**
The dmft indices 3.420 1.14E-03**
Age 1.818 1.65E-01
Gender 0.537 4.46E-01
Geographic origin 0.086 6.81E-01

P < 0.05 was considered statistically significant. The asterisks denoted statistical significance (**P < 0.01).

Comparisons of the levels of specific species between healthy and caries-active children

Levels of those four species were compared between the S-ECC and healthy groups (Table 4). P. denticola and S. mutans in the S-ECC group were significantly more abundant than those in the healthy group (P < 0.01 and P < 0.001, respectively, Mann-Whitney’s U test). In contrast, no significant difference was found between the healthy and S-ECC groups for P. pallens and L. fermentum (P > 0.05). In addition, no significant difference was found within those species’ level among genders (P > 0.05, Mann-Whitney’s U test) (Table 4).

Table 4.

The absolute abundance of target species in saliva as measured by qPCR.

Streptococcus mutans Prevotella pallens Prevotella denticola Lactobacillus fermentum
Healthy and S-ECC groups
Healthy mean 4.02E + 04 1.06E + 03 2.83E + 05 1.23E + 00
SD 2.40E + 02 3.74E + 01 8.43 E + 02 1.34E + 00
S-ECC mean 1.10E + 06 Inline graphic 1.45E + 03 3.82E + 05 Inline graphic 2.84E + 00
SD 1.12E + 03 4.06E + 01 1.01E + 03 2.00E + 00
P value (Wilcoxon.test) 1.88E-28*** 1.34E-01 9.66E-03** 5.51E-02
Southern and northern city groups
Southern city mean 9.25E + 04 3.55E + 02 1.85E + 05 1.41E + 00
SD 4.39E + 02 2.20E + 01 9.68E + 02 1.26E + 00
Northern city mean 4.69E + 05 Inline graphic 1.90E + 03 Inline graphic 3.95E + 05 2.65E + 00
SD 2.14E + 06 9.63E + 03 9.11E + 02 1.98E + 00
P value (Wilcoxon.test) 3.62E-04*** 4.60E-16*** 2.16E-01 4.77E-01
Male and female groups
Male mean 7.53E + 05 1.15E + 03 3.47E + 04 1.81E + 00
SD 1.39E + 03 3.72E + 01 2.80E + 02 1.63E + 00
Female mean 7.63E + 05 1.51E + 03 3.26E + 04 2.15E + 00
SD 1.43E + 03 4.45E + 01 2.92E + 02 1.76E + 00
P value (Wilcoxon.test) 6.77E-01 6.77E-01 9.47E-01 6.77E-01

The values shown were represented by scientific notation. The units of the means were copies/μL. The red arrows indicate elevated trend. S-ECC: severe early childhood caries; SD: standard deviation; Mann-Whitney’s U test was used for statistical analysis. P < 0.05 was considered statistically significant. Asterisks denoted statistical significance (**P < 0.01; ***P < 0.001).

Correlation between species level and dmft indices

To understand the correlation between the selected species and dmft indices, we collected the hosts’ caries status data including number of decayed, missing and filled tooth from each individual and calculated the dmft indices. A strong positive correlation between S. mutans level and dmft indices was found (Table 5; Spearman’s rank correlation coefficient r = 0.600, P < 0.001). No significant correlation between other species levels and dmft indices was observed.

Table 5.

Correlation between the levels of targeted species in saliva and the dmft index scores.

Spearman’s rank correlation coefficient P value
Streptococcus mutans 0.600 2.17E-08 ***
Prevotella denticola 0.142 1.42E-01
Lactobacillus fermentum 0.125 2.89E-01
Prevotella pallens 0.070 1.00E + 00

P < 0.05 was considered statistically significant. The asterisks denoted statistical significance (***P < 0.001).

The co-occurrence networks of the targeted species in caries and health

The co-occurrence network can reveal the ecological relationship between the bacterial species in the microbial community. In the healthy group, there was a very strong positive correlation among the levels of each strains, including S. mutans, L. fermentum, P. pallens, and P. denticola (Fig. 2A). However, the correlation pattern changed in the S-ECC group (Fig. 2B). Specifically, the correlation between S. mutans and L. fermentum was weakened (the coefficient value changed from 0.997 to 0.78), and correlation between S. mutans and P. pallens disappeared in the S-ECC group (the coefficient value changed from 0.999 to 0.103). This result suggested that the salivary community structures were differed in disease state, and the weaken or even disappeared connection among the tested members in caries samples indicated a diversely distributed community structure.

Figure 2.

Figure 2

The co-occurrence networks of the targeted species in each of the two hosts groups. The connection lines between two nodes indicate positive correlation between the levels of two species, with color representing the degree of correlation. There was a very strong positive correlation among every species in a pair-wise manner in the healthy group (A). In the S-ECC group, however, the correlation between S. mutans and L. fermentum was weakened, and the correlation between S. mutans and P. pallens was no longer present (B).

Building a diagnosis model of S-ECC using P. pallens and S. mutans

To probe which of the four species exerts the greatest effect on model performance, a series of models were built from every singular species. The AUC values of models derived from the sole species of P. denticola, L. fermentum, P. pallens or S. mutans were 0.47, 0.51, 0.57 and 0.61, respectively (Fig. 3A–D). According to “rfcv” function in the Random-Forest package, the two top-ranking significant taxa (P. pallens and S. mutans) from these selected species led to a reasonably good classification of S-ECC status. And the two-species model built from P. pallens and S. mutans showed a relatively higher predictive power to distinguish S-ECC from the healthy groups (AUC = 0.72; shown in Fig. 3E). Specifically, through testing absolute amount of P. pallens and S. mutans, we could differentiate those hosts with severe caries disease with the accuracy of 72%.

Figure 3.

Figure 3

ROC curves of the caries classification models. The AUC values of models derived from P. denticola alone (0.47; (A)), L. fermentum alone (0.51; (B)), P. pallens alone (0.57; (C)), or from S. mutans alone (0.61; (D)). (E) The model was built from combining P. pallens and S. mutans. It carries an AUC of 0.72, higher than the single-species models.

Discussion

In this study, we aimed to utilize qPCR technology, a more simpler, cost-effective and time-saving method for accurate, sensitive and rapid quantification of those selected species in the salivary microbiome26,27. We found that the level of S. mutans in S-ECC was significantly higher than those from the healthy group (P < 0.001), which was consistent with the previous studies18,28. The dysbiosis of the oral microbiome, such as S. mutans, from an overproduction of acid, can result in increasing proportions of acidogenic and aciduric species29. However, no significant difference was found on the level of L. fermentum among the healthy and S-ECC groups in our study, which was also a recognized acidogenic caries pathogen. In contrast, another article reported that the levels of Lactobacillus spp. in plaques were significantly elevated in children with severe ECC patients18,30. Above conflicting results might be attributed to different sampling methods. Specifically, our study was based on saliva samples, while previous studies have used carious dentin samples. It indicated that L. fermentum might contribute more in the frontier of dentin caries, however, saliva-based quantification of L. fermentum could not detect significant difference in patients.

Our previous study tracked the changes of microbiota over time from the healthy status to caries occurrence and caries progression, thus developed a model for caries prediction and suggested a panel of Prevotella species that may be closely related to caries disease21,22. Prevotella’s association with caries was also verified by many other studies24,25. These indicated that the overexpressed collagenases for proteolytic metabolism in Prevotella species may lead to the progression of dental caries23. Therefore, the design of this study involved P. denticola and P. pallens, two of the seven most discriminant Prevotella species in the prediction and diagnosis model for ECC22. Although above two Prevotella spp. both contribute to great extent in caries risk prediction, only P. denticola was detected with significantly elevated absolute amount in S-ECC group (P < 0.01) by real-time PCR-based quantification, the amounts of P. pallens were nearly the same between the groups. This result suggested that the amount of the species might not directly linked to its effect on disease prediction model construction.

Caries status and dmft indices were the top two factors in defining the absolute abundance of those selected species, yet factors like age, gender and geographic origin did not influence the bacteria levels significantly. This suggested that even the individuals were from different background, disease status could still discriminate the S-ECC community structures from H groups. Interestingly, in healthy children, there were very strong positive correlations between two of the four targeted strains. In contrast, in children with S-ECC, the very strong positive correlation between S. mutans and L. fermentum found in the healthy children was significantly weakened, and the very strong positive correlation between S. mutans and P. denticola found in the healthy children was even disappeared. This finding was consistent to our former result that healthy microbiomes were more conversed, while those caries microbiomes were more diversely distributed21,22. For the healthy group, as they were more resembled, so we were able to detect more consistence in the close relationship of those bacterial members among this group. However, for the caries group, a shifted balance of microbiota takes place in the oral environment21,22,31, where any bacterial members with the ability of acid-producing and acid-resisting could potentially initiate the occurrence of caries. This might be a potential explanation for that on the links between the levels of chose bacterial members especially between those acknowledged caries-leading bacteria like S. mutans and L. fermentum, S. mutans and P. pallens were weaken or disappeared in the S-ECC group.

In terms of caries diagnosis assessment model, neither single species could elicit a satisfied diagnostic power with AUC from 0.47–0.61, even the significantly differentially distributed P. denticola resulted in the lowest accuracy of 0.47. However, the combination of S. mutans and P. pallens results in a caries assessment model with an accuracy of 72%, which was nearly equal to our former ECC prediction model (74% accuracy) based on eight marker Prevotella species via pyrosequencing22. In this study, based on a cross-sectional experimental design, we aimed to monitor levels of specific potential caries-associated bacterial markers and evaluate their contribution to caries diagnosis model construction. What deserve our attention is, levels of P. denticola (not P. pallens) were significantly higher in S-ECC, but the model finally constructed was derived from P. pallens and S. mutans. This suggested that the abundance of species might not be the sole predictor for caries32 and links among species can be exploited to discriminate caries status in the models. In addition, our result indicated that S. mutans played a significant role in the caries diagnosis model, and a model that combined S. mutans and P. pallens reached accuracy of 72%. However, the caries prediction model we built before were composed of a panel of seven Prevotella species with accuracy of 74%22, and S. mutans didn’t contribute to this model. This indicated that there was difference in dominant pathogens during caries onset and caries progression.

In this study, utilizing the rapid, accurate and economic qPCR technique, we developed a saliva-based efficient and economic S-ECC risk assessment model. Traditional methods of diagnosing ECC include visual-tactile detection combining with bitewing radiography. In addition, radiography, transillumination, ECM device, and methods based on fluorescence are useful for caries detection33. However, all these methods necessitate a certain extent of children’s cooperation and on-site at the dental chair, and they can also be time-consuming and laborious33,34. Therefore, the caries diagnosis model built here can be beneficial to preschool age children, especially for those children who are anxious and thus unable to cooperate for oral exams, and can also be adopted for remote screening or home-based survey of caries risk for epidemiological studies.

Materials and methods

Selection of subjects for this study

The children employed in this study were from an oral health census (June 2017) in kindergartens at the southern city of Guangzhou (the Guangdong Province) and the northern city of Qingdao (the Shandong Province), which are physically separated by two thousand kilometers in mainland China. After an oral health survey, 354 children (3–5 years of age), including 190 boys and 164 girls, were chosen for saliva sample collection. All children were unrelated individuals of both genders21. According to the number of dental caries assessed with a decayed, missing, filled tooth (dmft) indices, 176 children were classified as S-ECC (dmft ≥ 6) and 178 children were classified as healthy (dmft = 0). All the guardians of the children were made aware of the nature of the experiment and granted written permission for participation. The written permission and study design had been approved by the Ethical Committee of Qingdao University (Qingdao, China). All experiments were performed following relevant guidelines and regulations. No child wore a removable appliance or took antibiotics in the preceding three months. Children with systematic or other oral diseases such as mucosal diseases and/or were excluded21.

Sample collection and DNA extraction

The clinical examinations and assessments of caries, as well as salivary sample collection, were carried out by dentists who were previously trained for the assessments of caries and sampling procedures. Unstimulated whole saliva (2 mL) was collected from each child into a tube containing an equal volume of lysis buffer (50 mM EDTA, 50 mM sucrose, 50 mM Tris, pH 8.0, 100 mM NaCl and 1% SDS)35. Salivary samples were stored at −80 °C before DNA extraction21. The extraction of DNA from bacterial cultures was performed using an optimized protocol based on the Qiagen DNeasy Blood & Tissue DNA kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. DNA concentrations were determined using a Qubit Fluorometer 2.0 (Life Technologies, Grand Island, NY, USA). The purity of the extracted DNA was measured by the Qubit dsDNA HS Assay Kit (Invitrogen, Carlsbad, California, USA) following the manufacturer’s instructions, with an inclusion criterion of above 1.8. Electrophoresis of DNA was performed to assess DNA integrity under ultraviolet light. The extracted DNA samples were stored at −80 °C before further processing.

Design of quantitative qPCR primers

Detection and quantification of the selected species in salivary samples were performed by qPCR. The presence of S. mutans, P. pallens, P. denticola and L. fermentum was detected by specific qPCR primers. Two pairs of primers (for S. mutans and L. fermentum) were used based on the published primer protocols (Table 1). Another two pairs of new primers (for P. pallens and P. denticola) were designed using AlleleID 6.0 (Premier Biosoft, Palo Alto, CA, USA) for qPCR and then analyzed in BLASTn (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGcE_TYPE=BlastSearch)1. Species specificity for the primers of P. denticola and P. pallens were tested by conventional (Fig. 1). The thermal conditions of qPCR reactions were listed in Table 2.

Quantitative real-time PCR

Each reaction mixture (20 μL) was composed of 10 μL of SYBR Green Master Mix, 0.5 μL of each forward/reverse primer (10 μM), 5 μL of sterilized DNase-RNase-free water, and 4 μL of DNA sample. The qPCR reaction was performed in Microamp fast optical 96-well reaction plates (Applied Biosystems, Foster City, CA, USA) using a LightCycler 480II (Roche, Basle, Switzerland). The qPCR reaction of samples was performed in triplicate and a negative control (ddH2O as a template) was included within each experiment36. Standard curves of primers were obtained by measuring five 10-fold series diluted DNA standards (Targeted DNA fragment cloned in plasmid pMD19T)37. Reaction specificities were confirmed via melting curve analysis with a progressive increase in temperature and continuous fluorescence acquisition. The standard DNA amplification curve and melting-point product curve for each primer combination were obtained to calculate the quantity of DNA.

Statistical analysis

Statistical analyses were performed using R software (@Manual {, title = {igraph: Easily Install and Load the ‘igraph’}, author ={Patrick R. Amestoy}, organization ={AMD library}, address ={California, American}, year = 2019, url ={https://CRAN.R-project.org/package=igraph}}). Mann-Whitney U test was applied to the quantitative data of salivary microbiome. P < 0.05 was considered as the threshold for statistical significance for all tests. Asterisks were used to denote statistical significance (*: P < 0.05; **: P < 0.01; ***: P < 0.001). Association of the selected species levels and dmft indices, as well as the co-occurrence networks of the targeted species, were estimated using the Spearman correlation coefficient.

Construction of risk assessment model for S-ECC

Firstly, the Random Forests method was employed to discriminate between diseased and healthy subjects from the southern city cohort. The receiver operating characteristic (ROC) curve was used to evaluate the diagnostic value of bacterial candidates in discrimination between diseased and healthy subjects. According to “rfcv” function in the Random-Forest package, the two top-ranking significant taxa from these selected species led to a reasonably good classification of ECC status. Model performance was then assessed using a 10-fold cross-validation approach22. Secondly, the southern city cohort was used as a training dataset and the northern city cohort was used as a testing dataset to evaluate the discriminatory power of the model, which was further evaluated using the area under the ROC curve (AUC).

Acknowledgements

This work was supported by grants 81670979 and 31600099 from National Natural Science Foundation of China and grant SKLOD2019OF04 from State Key Laboratory of Oral Diseases (SKLOD) Open Fund.

Author contributions

L.Z., T.S., F.T. and F.Y. conceived and designed the research. L.Z., T.S. and S.L. collected samples. S.L., F.L., Y.Z., K.T. and J.L. prepared samples. L.Z. and T.S. carried out the experiments with the supervision of R.Y., Z.C., D.G., Q.G. and F.T. P.Z. and Z.S. analyzed data and drew the figures. L.Z., T.S. and F.Y. wrote the paper. All authors have reviewed and approved the final version of the manuscript.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Lijuan Zhang and Tongzheng Sun.

Contributor Information

Fei Teng, Email: tengfei@qibebt.ac.cn.

Fang Yang, Email: yangf82@sina.com.

References

  • 1.Colombo NH, et al. Quantitative assessment of salivary oral bacteria according to the severity of dental caries in childhood. Archives of Oral Biology. 2017;83:282–288. doi: 10.1016/j.archoralbio.2017.08.006. [DOI] [PubMed] [Google Scholar]
  • 2.Dentistry AAOP, Pediatrics AAO. Policy on early childhood caries (ECC): classifications, consequences, and preventive strategies. Pediatric Dentistry. 2011;30:31–33. [PubMed] [Google Scholar]
  • 3.Dye BA, Hsu KL, Afful J. Prevalence and Measurement of Dental Caries in Young Children. Pediatric Dentistry. 2015;37:200–216. [PubMed] [Google Scholar]
  • 4.Du MQ, et al. Dental Caries Status and its Associated Factors among 3- to 5-year-old Children in China: A National Survey. Chinese Journal of Dental Research. 2018;21:167–179. doi: 10.3290/j.cjdr.a41076. [DOI] [PubMed] [Google Scholar]
  • 5.Zhu C, et al. The Predictive Potentiality of Salivary Microbiome for the Recurrence of Early Childhood Caries. Frontiers in cellular and infection microbiology. 2018;8:423. doi: 10.3389/fcimb.2018.00423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Mcauliffe U, Kinirons M, Woods N, Harding M. A retrospective investigation of the oral health records of a cohort of preschool children who received extractions under general anaesthesia including cost analysis of treatment. Journal of the Irish Dental Association. 2017;63:38–44. [PubMed] [Google Scholar]
  • 7.Cummins D. Dental caries: a disease which remains a public health concern in the 21st century–the exploration of a breakthrough technology for caries prevention. Journal of Clinical Dentistry. 2013;24 Spec no A:A1–A14. [PubMed] [Google Scholar]
  • 8.Casamassimo PS, Sarat T, Edelstein BL, Elyse M. Beyond the dmft: the human and economic cost of early childhood caries. Journal of the American Dental Association. 2009;140:650–657. doi: 10.14219/jada.archive.2009.0250. [DOI] [PubMed] [Google Scholar]
  • 9.Alazmah A. Early Childhood Caries: A Review. Journal of Contemporary Dental Practice. 2017;18:732–737. doi: 10.5005/jp-journals-10024-2116. [DOI] [PubMed] [Google Scholar]
  • 10.WK S. Early Childhood Caries. Pediatric clinics of North America. 2018;65:941–954. doi: 10.1016/j.pcl.2018.05.004. [DOI] [PubMed] [Google Scholar]
  • 11.Ling Z, et al. Analysis of Oral Microbiota in Children with Dental Caries by PCR-DGGE and Barcoded Pyrosequencing. Microbial Ecology. 2010;60:677–690. doi: 10.1007/s00248-010-9712-8. [DOI] [PubMed] [Google Scholar]
  • 12.Maryam G, et al. Frequency, biofilm formation and acid susceptibility of streptococcus mutans and streptococcus sobrinus in saliva of preschool children with different levels of caries activity. Dental Research Journal. 2013;10:440–445. [PMC free article] [PubMed] [Google Scholar]
  • 13.Fan C, Wang W, Xu T, Zheng S. Risk factors of early childhood caries among children in Beijing: a case-control study. BMC Oral Health. 2016;16:98. doi: 10.1186/s12903-016-0289-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Jiang S, Gao X, Jin L, Lo EC. Salivary Microbiome Diversity in Caries-Free and Caries-Affected Children. International journal of molecular sciences. 2016;17:1978. doi: 10.3390/ijms17121978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hemadi AS, Huang RJ, Zhou Y, Zou J. Salivary proteins and microbiota as biomarkers for early childhood caries risk assessment. International Journal of Oral Science. 2017;9:e1. doi: 10.1038/ijos.2017.35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tanzer JM, Livingston J, Thompson AM. The microbiology of primary dental caries in humans. Journal of Dental Education. 2001;65:1028–1037. [PubMed] [Google Scholar]
  • 17.Piwat S, Teanpaisan R, Thitasomakul S, Thearmontree A, Dahlén G. Lactobacillus species and genotypes associated with dental caries in Thai preschool children. Oral Microbiology & Immunology. 2010;25:157–164. doi: 10.1111/j.2041-1014.2009.00556.x. [DOI] [PubMed] [Google Scholar]
  • 18.Mitrakul K, Chanvitan S, Jeamset A, Vongsawan K. Quantitative analysis of S. mutans, Lactobacillus and Bifidobacterium found in initial and mature plaques in Thai children with early childhood caries. European Archives of Paediatric Dentistry. 2017;18:251–261. doi: 10.1007/s40368-017-0295-7. [DOI] [PubMed] [Google Scholar]
  • 19.Roy B, et al. Quantitative analysis of diverse Lactobacillus species present in advanced dental caries. Journal of Clinical Microbiology. 2004;42:3128–3136. doi: 10.1128/JCM.42.7.2944-2951.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mitrakul K, Vongsavan K, Suratanachaikul P. Prevalence of Streptococcus mutans and Lactobacillus fermentum and their association with caries and dietary habits in preschool Thai children. European Archives of Paediatric Dentistry Official Journal of the European Academy of Paediatric Dentistry. 2013;14:83–87. doi: 10.1007/s40368-013-0017-8. [DOI] [PubMed] [Google Scholar]
  • 21.Yang F, et al. Saliva microbiomes distinguish caries-active from healthy human populations. ISME Journal. 2012;6:1–10. doi: 10.1038/ismej.2011.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Teng F, et al. Prediction of Early Childhood Caries via Spatial-Temporal Variations of Oral Microbiota. Cell Host & Microbe. 2015;18:296–306. doi: 10.1016/j.chom.2015.08.005. [DOI] [PubMed] [Google Scholar]
  • 23.Simón-Soro A, Belda-Ferre P, Cabrera-Rubio R, Alcaraz LD, Mira A. A tissue-dependent hypothesis of dental caries. Caries Research. 2013;47:591–600. doi: 10.1159/000351663. [DOI] [PubMed] [Google Scholar]
  • 24.Kressirer CA, Chen T, Lake Harriman K, Frias-Lopez J. Functional profiles of coronal and dentin caries in children. Journal of Oral Microbiol. 2018;10:1495976. doi: 10.1080/20002297.2018.1495976. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hurley E, et al. Comparison of the salivary and dentinal microbiome of children with severe-early childhood caries to the salivary microbiome of caries-free children. BMC Oral Health. 2019;19:13. doi: 10.1186/s12903-018-0693-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Nao S, Akihiro Y, Yoshio N. Quantitative analysis of multi-species oral biofilms by TaqMan Real-Time PCR. Clinical Medicine & Research. 2005;3:176–185. doi: 10.3121/cmr.3.3.176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Acr T, Kressirer CA, Rothmiller S, Johansson I, Chalmers NI. The Caries Microbiome: Implications for Reversing Dysbiosis. Advances in Dental Research. 2018;29:78–85. doi: 10.1177/0022034517736496. [DOI] [PubMed] [Google Scholar]
  • 28.Oda Y, Hayashi F, Wakita A, Nagatani Y, Okada M. Five-year longitudinal study of dental caries risk associated with Streptococcus mutans and Streptococcus sobrinus in individuals with intellectual disabilities. Journal of Oral Science. 2016;59:39–46. doi: 10.2334/josnusd.16-0325. [DOI] [PubMed] [Google Scholar]
  • 29.Sanz M, et al. Role of microbial biofilms in the maintenance of oral health and in the development of dental caries and periodontal diseases. Consensus report of group 1 of the Joint EFP/ORCA workshop on the boundaries between caries and periodontal disease. Journal of Clinical Periodontology. 2017;44:S5. doi: 10.1111/jcpe.12682. [DOI] [PubMed] [Google Scholar]
  • 30.Obata J, et al. Identification of the microbiota in carious dentin lesions using 16S rRNA gene sequencing. PLoS One. 2014;9:e103712. doi: 10.1371/journal.pone.0103712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gross EL, et al. Beyond Streptococcus mutans: dental caries onset linked to multiple species by 16S rRNA community analysis. PLoS One. 2012;7:e47722. doi: 10.1371/journal.pone.0047722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Guo L, Shi W. Salivary Biomarkers for Caries Risk Assessment. Journal of the California Dental Association. 2013;41:107–118. [PMC free article] [PubMed] [Google Scholar]
  • 33.Gomez J. Detection and diagnosis of the early caries lesion. BMC Oral Health. 2015;15(Suppl 1):S3. doi: 10.1186/1472-6831-15-s1-s3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tellez M, Gomez J, Pretty I, Ellwood R, Ismail AI. Evidence on existing caries risk assessment systems: are they predictive of future caries? Community dentistry and oral epidemiology. 2013;41:67–78. doi: 10.1111/cdoe.12003. [DOI] [PubMed] [Google Scholar]
  • 35.Huang S, et al. Preliminary characterization of the oral microbiota of Chinese adults with and without gingivitis. BMC Oral Health. 2011;11:33. doi: 10.1186/1472-6831-11-33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Liang Q, et al. Fecal Bacteria Act as Novel Biomarkers for Noninvasive Diagnosis of Colorectal Cancer. Clinical Cancer Research. 2017;23:2061–2070. doi: 10.1158/1078-0432.ccr-16-1599. [DOI] [PubMed] [Google Scholar]
  • 37.Hao GJ, et al. RT-qPCR analysis of dexB and galE gene expression of Streptococcus alactolyticus in Astragalus membranaceus fermentation. Applied microbiology and biotechnology. 2013;97:6009–6018. doi: 10.1007/s00253-013-4873-2. [DOI] [PubMed] [Google Scholar]
  • 38.Park SN, Yun KL, Kook JK. Development of quantitative real-time PCR primers for detecting 42 oral bacterial species. Archives of Microbiology. 2013;195:473–482. doi: 10.1007/s00203-013-0896-4. [DOI] [PubMed] [Google Scholar]

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES