Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2020 Feb 28;94(6):e01684-19. doi: 10.1128/JVI.01684-19

Severe Fever with Thrombocytopenia Syndrome Virus NSs Interacts with TRIM21 To Activate the p62-Keap1-Nrf2 Pathway

Younho Choi a, Zhongyi Jiang a, Woo-Jin Shin a, Jae U Jung a,✉
Editor: Adolfo García-Sastreb
PMCID: PMC7158713  PMID: 31852783

Tick-borne diseases have become a growing threat to public health. SFTSV, listed by the World Health Organization as a prioritized pathogen, is an emerging phlebovirus, and fatality rates among those infected with this virus are high. Infected Haemaphysalis longicornis ticks are the major source of human SFTSV infection. In particular, the recent spread of this tick to over 12 states in the United States has increased the potential for outbreaks of this disease beyond Far East Asia. Due to the lack of therapies and vaccines against SFTSV infection, there is a pressing need to understand SFTSV pathogenesis. As the Nrf2-mediated antioxidant response affects viral life cycles, a number of viruses deregulate Nrf2 pathways. Here we demonstrate that the SFTSV NSs inhibits the TRIM21 function to upregulate the p62-Keap1-Nrf2 antioxidant pathway for efficient viral pathogenesis. This study not only demonstrates the critical role of SFTSV NSs in viral pathogenesis but also suggests potential future therapeutic approaches to treat SFTSV-infected patients.

KEYWORDS: nonstructural protein, Nrf2 pathway, SFTSV, TRIM21

ABSTRACT

Nuclear factor erythroid 2-related factor 2 (Nrf2) dissociates from its inhibitor, Keap1, upon stress signals and subsequently induces an antioxidant response that critically controls the viral life cycle and pathogenesis. Besides intracellular Fc receptor function, tripartite motif 21 (TRIM21) E3 ligase plays an essential role in the p62-Keap1-Nrf2 axis pathway for redox homeostasis. Specifically, TRIM21-mediated p62 ubiquitination abrogates p62 oligomerization and sequestration activity and negatively regulates the Keap1-Nrf2-mediated antioxidant response. A number of viruses target the Nrf2-mediated antioxidant response to generate an optimal environment for their life cycle. Here we report that a nonstructural protein (NSs) of severe fever with thrombocytopenia syndrome virus (SFTSV) interacts with and inhibits TRIM21 to activate the Nrf2 antioxidant signal pathway. Mass spectrometry identified TRIM21 to be a binding protein for NSs. NSs bound to the carboxyl-terminal SPRY subdomain of TRIM21, enhancing p62 stability and oligomerization. This facilitated p62-mediated Keap1 sequestration and ultimately increased Nrf2-mediated transcriptional activation of antioxidant genes, including those for heme oxygenase 1, NAD(P)H quinone oxidoreductase 1, and CD36. Mutational analysis found that the NSs-A46 mutant, which no longer interacted with TRIM21, was unable to increase Nrf2-mediated transcriptional activation. Functionally, the NS wild type (WT), but not the NSs-A46 mutant, increased the surface expression of the CD36 scavenger receptor, resulting in an increase in phagocytosis and lipid uptake. A combination of reverse genetics and assays with Ifnar−/− mouse models revealed that while the SFTSV-A46 mutant replicated similarly to wild-type SFTSV (SFTSV-WT), it showed weaker pathogenic activity than SFTSV-WT. These data suggest that the activation of the p62-Keap1-Nrf2 antioxidant response induced by the NSs-TRIM21 interaction contributes to the development of an optimal environment for the SFTSV life cycle and efficient pathogenesis.

IMPORTANCE Tick-borne diseases have become a growing threat to public health. SFTSV, listed by the World Health Organization as a prioritized pathogen, is an emerging phlebovirus, and fatality rates among those infected with this virus are high. Infected Haemaphysalis longicornis ticks are the major source of human SFTSV infection. In particular, the recent spread of this tick to over 12 states in the United States has increased the potential for outbreaks of this disease beyond Far East Asia. Due to the lack of therapies and vaccines against SFTSV infection, there is a pressing need to understand SFTSV pathogenesis. As the Nrf2-mediated antioxidant response affects viral life cycles, a number of viruses deregulate Nrf2 pathways. Here we demonstrate that the SFTSV NSs inhibits the TRIM21 function to upregulate the p62-Keap1-Nrf2 antioxidant pathway for efficient viral pathogenesis. This study not only demonstrates the critical role of SFTSV NSs in viral pathogenesis but also suggests potential future therapeutic approaches to treat SFTSV-infected patients.

INTRODUCTION

Severe fever with thrombocytopenia syndrome virus (SFTSV) is an emerging and zoonotic pathogen, now renamed Huaiyangshan banyangvirus, within the genus Banyangvirus in the family Phenuiviridae of the order Bunyavirales (1). SFTSV is of concern because it causes hemorrhagic fever, thrombocytopenia, and multiorgan failure with a high fatality rate (12 to 30%) in humans (2, 3). Infected ticks, mostly those of the species Haemaphysalis longicornis (the Asian long-horned tick), are the major source of human SFTSV infection (4); however, human-to-human transmission by direct contact has been reported (5). Due to the lack of therapies and vaccines, there is a pressing need to understand SFTSV pathogenesis.

SFTSV encodes a multifunctional nonstructural protein (NSs) which plays important roles in host immune suppression by inhibitory interactions with antiviral alpha/beta interferon (IFN-α/β) signal molecules (6–9). Recently, we have discovered that SFTSV NSs targets the tumor progression locus 2 (TPL2)–A20-binding inhibitor of NF-κB activation 2 (ABIN2)–p105 complex to induce the expression of interleukin-10 (IL-10) for viral pathogenesis. Whereas SFTSV infection of wild-type (WT) mice led to rapid weight loss and death, Tpl2−/− mice or Il10−/− mice survived the infection. This indicates that SFTSV NSs targets the TPL2 signal pathway to induce immune-suppressive IL-10 cytokine production as a means to dampen the host defense and promote viral pathogenesis (10).

Nuclear factor erythroid 2-related factor 2 (Nrf2) is a major regulator responsible for the expression of a series of antioxidant proteins and detoxifying enzymes (11, 12). The intracellular Nrf2 level is regulated by interaction with Kelch-like ECH-associated protein 1 (Keap1) and the proteasome system (13). Under homeostatic conditions, Keap1 directs the ubiquitin-mediated degradation of Nrf2, resulting in the suppression of intracellular antioxidant responses. Disruption of the Keap1-Nrf2 interaction by oxidants allows Nrf2 translocation to the nucleus and leads to the increased expression of antioxidant response elements (AREs), which are involved in the detoxification reaction, cell survival, and immune modulation (14, 15). A noncanonical pathway includes p62/SQSTM1-mediated autophagic degradation to regulate Keap1-Nrf2. As an aggregated form, p62 competitively binds to Keap1, thereby dissociating Nrf2 from Keap1, which represents the p62-Keap1-Nrf2 axis (16–19).

Nrf2-mediated ARE responses affect the outcome of several viral infections (20, 21). The Nrf2 pathway inhibits influenza virus and respiratory syncytial virus replication, functioning as an antiviral response (22–24). On the other hand, Nrf2 activation supports the replication of hepatitis B virus, hepatitis C virus, and human cytomegalovirus by protecting host cells from oxidative stress (25–27). Recent studies also have shown that the Marburg virus (MARV) VP24 protein directly interacts with Keap1 to activate and hijack the Nrf2 pathway for the survival of MARV-infected cells (28, 29).

Tripartite motif 21 (TRIM21), which carries E3 ubiquitin ligase, plays an important role in recognizing an antibody-binding protein and its degradation via the ubiquitin proteasome system (30, 31). TRIM21 also interacts with key components of autophagosome assembly and targets activated IRF3 for degradation, thereby limiting immune signaling activity (32, 33). Moreover, a recent study has discovered that TRIM21 ubiquitinates lysine 7 of p62, which prevents p62 aggregation and subsequent Keap1 sequestration. TRIM21 thereby controls cellular redox homeostasis by negatively regulating the p62-Keap1-Nrf2 axis (34).

Here, we describe the mechanisms by which SFTSV NSs engages the p62-Keap1-Nrf2 axis through a direct interaction with TRIM21. We further define how SFTSV NSs activates Nrf2-mediated ARE responses, including expression of CD36 (scavenger receptor B2 or SR-B2). Ultimately, this study shows the critical role of SFTSV NSs in viral pathogenesis.

RESULTS

SFTSV NSs interacts with TRIM21.

Mass spectrometry analysis of NSs complexes purified from HEK293T cells identified TRIM21 E3 ubiquitin ligase to be a host NSs-binding protein (data not shown). A glutathione S-transferase (GST) pulldown (GST-PD) assay demonstrated that the GST-NSs fusion readily interacts with V5-tagged TRIM21 in HEK293T cells (Fig. 1A). A single molecular pulldown (SiMPull) assay also showed that NSs effectively binds to TRIM21 (Fig. 1B). Moreover, coimmunoprecipitation (co-IP) of SFTSV green fluorescent protein (GFP)-NSs-infected RAW 264.7 cells also showed an interaction between the virally produced GFP-NSs fusion protein and endogenous TRIM21 (Fig. 1C). TRIM21 has cytoplasmic fibril-like motile bodies in the cytosol and is diffused in the nucleus (35), whereas NSs forms cytosolic inclusion bodies (IBs) (10). Interestingly, when coexpressed with NSs, TRIM21 lost its cytoplasmic fibril-like motile bodies and became highly colocalized with the NSs-formed IBs (Fig. 1D). While other phleboviruses, heartland virus (HRTV) and Uukuniemi virus (UUKV), carry the NSs protein, the HRTV NSs and UUKV NSs did not interact with TRIM21 (Fig. 2A) or colocalize with TRIM21 (Fig. 2B). These results show that SFTSV NSs specifically interacts with TRIM21.

FIG 1.

FIG 1

NSs interacts with TRIM21. (A) HEK293T cells were transfected with NSs-GST and TRIM21-V5, and whole-cell extracts (WCEs) were pulled down by glutathione beads, followed by immunoblotting with the indicated antibody. (B) HEK293T cells were transfected with NSs-3×Flag and TRIM21-V5, and WCEs were applied to SiMPull analysis. (Left) Three representative images. (Right) Molecular numbers, in which the bar graphs indicate the average number of fluorophores per image. Error bars represent the SD of the mean across >20 images. The results of three independent experiments are represented. (C) RAW 264.7 cells were infected with SFTSV-NSs-GFP, a recombinant virus expressing GFP-tagged NSs, for 24 h and subjected to immunoprecipitation (IP) with anti-GFP antibody to pull down the GFP-NSs complex, followed by immunoblotting with anti-TRIM21 antibody to detect endogenous TRIM21. (D) HeLa cells were transfected with NSs-3×Flag-GFP and TRIM21-V5. The cells were fixed and stained with primary mouse anti-V5 antibody and with secondary Alexa Fluor 568-conjugated anti-mouse IgG antibody for confocal microscopy. Hoechst staining was used for the nucleus. The microscope images represent those from three independent experiments.

FIG 2.

FIG 2

SFTSV NSs specifically binds to and colocalizes with TRIM21. (A) HEK293T cells were transfected with TRIM21-V5 and NSs-3×Flag of three viruses (SFTSV, HRTV, and UUKV), and WCEs were immunoprecipitated by an anti-V5 antibody, followed by immunoblotting with the indicated antibody. (B) HeLa cells were transfected with TRIM21-V5 and NSs-3×Flag, as described in the legend to panel A. Cells were fixed and stained with primary antibodies (mouse anti-V5 and rabbit anti-Flag) and with secondary antibodies (Alexa Fluor 488-conjugated anti-mouse IgG and Alexa Fluor 568-conjugated anti-rabbit IgG) for confocal microscopy. Hoechst staining was used for the nucleus. The microscope images represent those from three independent experiments.

SFTSV NSs inhibits the TRIM21-p62 interaction.

TRIM21 has been shown to interact with and ubiquitinate p62, resulting in the inhibition of its homodimerization and aggregation, ultimately allowing TRIM21 to regulate the p62-Keap1-Nrf2 signal axis for intracellular redox homeostasis (34). A detailed mapping study found that the carboxyl (C)-terminal SPRY subdomain of TRIM21 is responsible for NSs binding (Fig. 3A and B). As TRIM21 also interacts with p62 through the C-terminal PRY/SPRY domain (34), we hypothesized that NSs competed with p62 for TRIM21 binding (Fig. 3C). A co-IP assay showed that NSs expression abolished the interaction between TRIM21 and p62 in a dose-dependent manner (Fig. 3D). Immunofluorescence microscopy showed that p62 highly colocalized with the cytoplasmic fibril-like bodies of TRIM21 (Fig. 3E, top row) but not with NSs-formed IBs (Fig. 3F, bottom row). However, upon NSs expression, p62 no longer colocalized with TRIM21 (Fig. 3E, bottom row). It should be noted that while MARV VP24 binds to Keap1 and activates Nrf2 activity (29), SFTSV NSs did not interact with Keap1 (Fig. 3G). Nevertheless, these data demonstrate that NSs binds to the SPRY subdomain of TRIM21, which leads to the inhibition of TRIM21 and interaction with p62.

FIG 3.

FIG 3

SFTSV NSs inhibits the TRIM21-p62 interaction. (A and B) Mapping of TRIM21 for NSs binding. (A) HEK293T cells were transfected with NSs-3×Flag and the individual domain (RBCC [R, ring; B, B box; CC, coiled-coil] and PRY/SPRY) of TRIM21-V5, and WCEs were immunoprecipitated with an anti-V5 antibody, followed by immunoblotting with the indicated antibody. (B) HEK293T cells were transfected with NSs-GST and the individual domain (PRY/SPRY, PRY, or SPRY) of TRIM21-V5, and WCEs were pulled down by glutathione beads, followed by immunoblotting with the indicated antibody. (C) A model of the molecular action of NSs in TRIM21 function. Ub, ubiquitin. (D) HEK293T cells were transfected with increasing amount of NSs-3×Flag, TRIM21-V5, and p62-Myc, and WCEs were immunoprecipitated by anti-V5 antibody, followed by immunoblotting with the indicated antibody. (E) HeLa cells were transfected with NSs-3×Flag-GFP, TRIM21-V5, and p62-Myc. The cells were fixed and stained with primary antibodies (rabbit anti-V5 or mouse anti-Myc) and with secondary antibodies (Alexa Fluor 568-conjugated anti-rabbit IgG or Alexa Fluor 350-conjugated mouse IgG) for confocal microscopy. No nucleus staining was performed. (F) HeLa cells were transfected with NSs-3×Flag-GFP and p62-Myc. The cells were fixed and stained with primary antibody (mouse anti-Myc) and with secondary antibody (Alexa Fluor 568-conjugated anti-mouse IgG) for confocal microscopy. Hoechst staining was used for the nucleus. The microscope images represent those from three independent experiments. (G) HEK293T cells were transfected with NSs-V5 and Keap1-Flag, and WCEs were immunoprecipitated with an anti-Flag antibody, followed by immunoblotting with the indicated antibody.

TRIM21-binding-deficient NSs mutant.

Based on NSs-TRIM21 colocalization as a readout, we performed alanine-scanning mutagenesis of NSs to identify the TRIM21-binding-deficient mutant. We constructed GFP-NSs-Flag mutants carrying five alanine substitutions (Fig. 4A) and coexpressed these mutants with V5-tagged TRIM21 in HeLa cells to assess colocalization. Among 59 alanine-scanning mutants, the NSs-A46 mutant carrying the replacement of K226KTDG230 with alanine still formed IBs but no longer colocalized with TRIM21 (Fig. 4A and B and Fig. 5A). A co-IP assay showed that the NSs-A46 mutant was not able to interact with TRIM21 (Fig. 5B and C). Consequently, the NSs-A46 mutant did not inhibit either the TRIM21 interaction with p62 (Fig. 5D) or its colocalization with p62 (Fig. 5E).

FIG 4.

FIG 4

Identification of the NSs-A46 mutant. (A) Amino acid sequence of NSs for alanine-scanning mutations. The NSs-A46 mutation is indicated with red. (B) HeLa cells were transfected with TRIM21-V5 and GFP-fused NSs-WT-3×Flag or individual alanine-scanning NSs mutant-3×Flag. The cells were fixed and stained with primary antibody (mouse anti-Myc) and with secondary antibody (Alexa Fluor 568-conjugated anti-mouse IgG) for confocal microscopy. Hoechst staining was used for the nucleus. The image at the top right represents an enlarged image of the area inside the red dashed-line box in the NSs-A46 panel.

FIG 5.

FIG 5

TRIM21-binding-deficient NSs mutant. (A) Schematic diagram of the NSs-A46 mutant carrying alanine substitutions at K226KTDG230. (B) HEK293T cells were transfected with NSs-WT-3×Flag, NSs-A46-3×Flag, and TRIM21-V5, and WCEs were immunoprecipitated with an anti-V5 antibody, followed by immunoblotting with the indicated antibody. (C) HEK293T cells were transfected with pEBG-GST, GST-NSs-WT, and GST-NSs-A46, and WCEs were pulled down by glutathione beads, followed by immunoblotting with an anti-TRIM21 antibody. (D) HEK293T cells were transfected with GST-NSs-WT, GST-NSs-A46, TRIM21-V5, and p62-Myc, and WCEs were immunoprecipitated with an anti-V5 antibody, followed by immunoblotting with the indicated antibody. (E) HeLa cells were transfected with NSs-A46-3×Flag-GFP, TRIM21-V5, and p62-Myc. The cells were fixed and stained with primary antibodies (rabbit anti-V5 or mouse anti-Myc) and with secondary antibodies (Alexa Fluor 568-conjugated anti-rabbit IgG or Alexa Fluor 350-conjugated mouse IgG) for confocal microscopy. No nucleus staining was performed. (F) HEK293T cells were transfected with NSs-WT-3×Flag, NSs-A46-3×Flag, p62-HA, p62-Myc, and TRIM21-V5, and WCEs were immunoprecipitated with an anti-Myc antibody, followed by immunoblotting with the indicated antibody.

TRIM21 interacts with the N-terminal PB1 domain of p62, and this interaction induces the ubiquitination of p62, ultimately inhibiting its oligomerization (34). When hemagglutinin (HA)- or Myc-tagged p62 was coexpressed to test its dimerization, TRIM21 was able to effectively block p62 dimerization (Fig. 5F). However, wild-type NSs (NSs-WT) interfered with TRIM21 activity, allowing p62 dimerization, whereas the NSs-A46 mutant did not (Fig. 5F). To genetically separate the NSs-binding activity of three different host factors (TBK1, ABIN2, and TRIM21), two additional NSs mutants, NSs-P102A and NSs-K211R, were included. The NSs-P102A mutant lost its TBK1-binding ability but still bound to TRIM21, the NSs-K211R mutant lost its ABIN2-binding ability but still bound to TRIM21, and the NSs-A46 mutant lost its TRIM21-binding ability but still bound to ABIN2 and TBK1 (Fig. 6). These indicate that NSs binds to three different host factors in a genetically independent manner.

FIG 6.

FIG 6

NSs mutants for interacting with three different host factors. (A to C) (Top) HEK293T cells were transfected with TRIM21-V5 and NSs-GST for four NSs (NSs-WT, NSs-A46, NSs-PA, and NSs-KR) (A), ABIN2-V5 and NSs-3×Flag for three NSs (NSs-WT, NSs-A46, and NSs-KR) (B), and TBK1-Flag with NSs-V5 for three NSs (NSs-WT, NSs-A46, and NSs-PA) (C). (Bottom) WCEs were pulled down by glutathione beads (A) or immunoprecipitated by anti-Flag antibody (B) or anti-V5 antibody (C), followed by immunoblotting with the indicated antibody.

NSs interaction with TRIM21 activates the Nrf2 pathway.

When Keap1 is bound to p62, Keap1 is sequestered into the ubiquitinated cargos, followed by autophagic degradation, resulting in Nrf2 nuclear localization and activation of ARE gene expression (16). In order to test whether NSs affected the p62-Keap1-Nrf2 axis pathway, the levels of these three proteins were examined in RAW 264.7 cells expressing the vector, NSs-WT, or NSs-A46. Interestingly, NSs-WT-expressing RAW 264.7 cells showed larger amounts of Nrf2 and p62 than vector- or NSs-A46-expressing RAW 264.7 cells, whereas the Keap1 amount was not changed (Fig. 7A). Subcellular fractionation showed that while a majority of the Nrf2 resided in the nucleus, a larger amount of Nrf2 was detected in the nuclear fractions of NSs-WT-expressing RAW 264.7 cells than in the nuclear fractions of vector- or NSs-A46-expressing RAW 264.7 cells (Fig. 7B). Quantitative reverse transcription-PCR (qRT-PCR) showed that NSs-WT expression induced higher levels of expression of the genes for endogenous AREs heme oxygenase 1 (Hmox1) and NAD(P)H quinone oxidoreductase 1 (Nqo1) than vector or NSs-A46 mutant expression did (Fig. 7C). On the other hand, the Nrf2 mRNA level was similar in all three groups of RAW 264.7 cells (Fig. 7D). Finally, treatment with ML385, a small-molecule inhibitor of Nrf2 (36), detectably abrogated NSs-induced Nqo1 expression (Fig. 7E). These results collectively indicate that SFTSV NSs specifically targets the p62-Keap1-Nrf2 axis pathway in a TRIM21-binding-dependent manner, resulting in an increase in the level of Nrf2 transcription factor activity.

FIG 7.

FIG 7

NSs activates the Nrf2 pathway and induces Nrf2-mediated gene expression. (A and B) (Left) RAW 264.7 cells stably expressing the vector, NSs-WT, or NSs-A46 were harvested, and WCEs (A) and the cytoplasmic/nuclear fractions (B) were analyzed by immunoblotting for the indicated proteins. (Right) The relative levels of Nrf2 in RAW 264.7 cells compared to the levels of β-actin for WCEs (A) and p84 for the nucleus (B) were calculated. (C and D) The mRNA levels of the Nrf2 target genes (Hmox1 and Nqo1) (C) and Nrf2 (D) in RAW 264.7 cells expressing the vector, NSs-WT, or NSs-A46 were measured by qRT-PCR. (E) The Nqo1 mRNA level in RAW 264.7 cells treated with dimethyl sulfoxide (DMSO) and an Nrf2 inhibitor (INH; 10 μM) for 24 h was measured by qRT-PCR.

NSs induces Cd36 expression via the Nrf2 signal pathway.

CD36 is a scavenger receptor for the uptake of oxidized low-density lipoproteins (oxLDLs) (37, 38), and its expression is regulated by Nrf2 (39, 40) or peroxisome proliferator-activated receptor γ (PPARγ) (41, 42). We have previously identified in a NanoString expression array that Cd36 is the gene that is the most highly induced by NSs expression in RAW 264.7 cells (10). Indeed, the Cd36 mRNA level was dramatically increased by NSs-WT expression but not by NSs-A46 expression (Fig. 8A). Flow cytometry showed that the surface expression of the CD36 protein was also induced by NSs-WT but not by NSs-A46 (Fig. 8B). Moreover, treatment with an Nrf2 inhibitor blocked the NSs-mediated induction of Cd36 mRNA in NSs-WT-expressing cells (Fig. 8C).

FIG 8.

FIG 8

NSs induces CD36 expression via the Nrf2 pathway and increases lipid uptake. (A) The level of Cd36 mRNA in RAW 264.7 cells expressing the vector, NSs-WT, or NSs-A46 was measured by qRT-PCR. (B) CD36 surface expression by RAW 264.7 cells expressing the vector, NSs-WT, or NSs-A46 was measured by flow cytometry. The surface expression of FITC fluorescence on cells was determined using FlowJo software (left), and the relative expression levels are provided (right). FACS, fluorescence-activated cell sorting. (C) The level of Cd36 mRNA in RAW 264.7 cells treated with DMSO or an Nrf2 inhibitor (INH, 10 μM) for 24 h was measured by qRT-PCR. (D) RAW 264.7 cells were treated with rabbit IgG-FITC complexed with latex beads at a final dilution of 1:500. (Right) The cells were washed/harvested, and flow cytometry was applied to measure the internalized rabbit IgG-FITC-complexed latex beads. (Left) The percentage of cells that phagocytosed the beads was determined using FlowJo software. (E) The organic phase of RAW 264.7 cells was extracted to measure the amount of free or total (free and esterified) cholesterol. A colorimetric assay was used to measure intracellular cholesterol levels at an absorbance of 570 nm, based on cholesterol standards. (F) RAW 264.7 cells were plated and treated with fluorescently tagged cholesterol at 20 μg/ml for 48 h. The cells were washed, fixed with paraformaldehyde, and applied to a microplate reader with filter sets designed for FITC and GFP. The amount of cholesterol taken up was described at a relative level.

As CD36 mediates lipid uptake, we assessed the phagocytic activity of NSs-expressing RAW 264.7 macrophage cells with latex beads coated with fluorescein isothiocyanate (FITC)-labeled rabbit IgG. Flow cytometry analysis showed the higher phagocytic activity in NSs-WT-expressing RAW 264.7 cells than in vector- or NSs-A46-expressing RAW 264.7 cells (Fig. 8D, left). Fluorescent microscopy also showed a higher number of phagocytosed latex beads in NSs-WT-expressing cells than in vector- or NSs-A46-expressing cells (Fig. 8D, right). When cholesterol amounts were measured, both free and esterified cholesterol levels were detectably higher in NSs-WT-expressing cells than in vector- or NSs-A46-expressing cells (Fig. 8E). Finally, when RAW 264.7 cells were plated and treated with fluorescence-tagged cholesterol (20 μg/ml) for 48 h, NSs-WT-expressing cells carried larger amounts of intracellular fluorescence-labeled cholesterol than vector- and NSs-A46-expressing cells (Fig. 8F). These data collectively indicate that the NSs-mediated activation of the Nrf2 pathway enhances Cd36 expression, thereby increasing CD36-mediated lipid uptake.

The NSs-TRIM21 interaction plays a role in viral pathogenesis.

To further investigate the role of the NSs-mediated activation of the Nrf2 signal pathway in viral pathogenesis, we generated a recombinant virus (SFTSV-A46) harboring the NSs-A46 mutation in the S genomic segment by reverse genetics (Fig. 9A). The plaque morphology of SFTSV-A46 was similar to that of wild-type SFTSV (SFTSV-WT) (Fig. 9B), and both viruses also had similar replication kinetics in Vero E6 cells (Fig. 9C). Ifnar−/− mice were infected with 102 PFU of SFTSV-WT or SFTSV-A46 and then monitored for body weight loss and survival. As previously shown (10), SFTSV-WT-infected Ifnar−/− mice died over the period from 4 to 5 days postinfection with a significant weight loss (Fig. 10A and B). Interestingly, SFTSV-A46-infected Ifnar−/− mice showed a delayed kinetics of weight loss and symptoms and mostly succumbed to infection over the period from 6 to 7 days postinfection (Fig. 10A and B).

FIG 9.

FIG 9

SFTSV-A46 mutant virus generation, plaque formation, and replication. (A) Sequence analysis of the NSs-A46 mutation of SFTSV-A46. (Top) The alanine substitution mutations of positive-strand viral mRNA are indicated in red. (Bottom) Sequencing results. (B) Plaque formation by SFTSV-WT and SFTSV-A46. The crystal violet-stained images are representative of those from three independent experiments. (C) The replication of SFTSV-WT and SFTSV-A46 in Vero E6 cells was examined by plaque assay (left) and by RT-PCR to measure the viral copy number (M segment) (right).

FIG 10.

FIG 10

SFTSV-A46 pathogenesis in mouse models. (A and B) Ifnar−/− mice were intramuscularly infected with 102 PFU of SFTSV-WT (n = 7) or SFTSV-A46 (n = 11) and were then monitored (A) and weighed (B) for 7 days. (C) Cd36 and Hmox1 mRNA levels in the spleens were measured by qRT-PCR at 4 days after infection with 102 PFU of SFTSV-WT or SFTSV-A46. (D) The viral copy number (M segment) in spleens from Ifnar−/− mice infected with SFTSV-WT or SFTSV-A46 was measured by qPCR.

The spleens were harvested from the infected mice to measure host gene expression and viral load. Cd36 and Hmox1 mRNA levels were defectively higher in SFTSV-WT-infected spleens than in mock-infected or SFTSV-A46-infected spleens (Fig. 10C). Measurement of the RNA copy number of the M segment showed only a marginal difference in the in vivo viral load between SFTSV-WT and SFTSV-A46. These data indicate that activation of the p62-Keap1-Nrf2 antioxidant response induced by the NSs-TRIM21 interaction contributes to efficient pathogenesis but that it is not essential for SFTSV-induced lethal infection.

DISCUSSION

Previous studies have shown that SFTSV NSs is a multifunctional protein involved in host immune modulation by inhibiting the interferon (IFN) signal and activating the anti-inflammatory response (6–8, 10). In this study, we also found that SFTSV NSs interacted with and inhibited the TRIM21 function to activate the Nrf2 signal pathway.

SFTSV NSs interacts with TRIM21.

TRIM21, which acts as an intracellular antibody receptor by binding to the Fc fragment of IgG, recognizes antibody-coated viruses, leading to the rapid proteasome-mediated destruction of viral capsids (43). The TRIM21-IgG-Fc interaction requires the carboxyl-terminal PRY/SPRY domain of TRIM21 (44). We also identified that the SPRY subdomain of TRIM21 is responsible for the NSs interaction, suggesting that the NSs interaction may also affect the function of TRIM21 as a cytosolic Fc receptor. Unlike nonenveloped viruses, which are targeted by TRIM21, however, enveloped viruses are able to evade TRIM21-mediated detection during membrane fusion (45). As an enveloped virus, SFTSV may utilize NSs to evade TRIM21-mediated neutralization. Besides being an intracellular antibody receptor, TRIM21 also has an antiviral function against RNA virus infection by promoting the activation of the IRF3 and NF-κB signal pathway through its Lys27-linked polyubiquitination of MAVS (33, 46, 47). We and other have shown that NSs suppresses the IFN and NF-κB signal pathways by sequestering and depositing IFN and NF-κB signaling molecules into the IBs. The NSs-A46 mutant, which did not interact with TRIM21, was still able to suppress the IFN signal pathway. This suggests that the NSs-mediated regulation of the IFN and Nrf2 pathways is genetically and functionally separable.

SFTSV NSs inhibits the TRIM21-p62 interaction.

A recent study has shown that TRIM21 ubiquitinates lysine 7 of p62, which prevents p62 oligomerization and subsequent Keap1 sequestration. TRIM21 thereby controls cellular redox homeostasis by negatively regulating the p62-Keap1-Nrf2 axis (34). As an autophagic receptor, p62 undergoes self-oligomerization, which is necessary for its autophagic activity, such as cargo sequestration, phagophore association, and, ultimately, cargo degradation (48–50). We showed that NSs competed with p62 by binding to the PRY/SPRY domain of TRIM21, which released p62 from TRIM21-mediated inhibition. While a previous study showed the colocalization between virally encoded NSs and endogenous p62 (51), we observed neither NSs-p62 colocalization nor an NSs-p62 interaction. Instead, p62 extensively colocalized with the cytoplasmic fibril-like bodies of TRIM21, but this colocalization was lost upon NSs expression, as TRIM21 translocated to the NSs-containing IBs (Fig. 3E). Collectively, these data demonstrate that NSs binds to the SPRY subdomain of TRIM21, which leads to inhibition of the TRIM21 and p62 interaction.

NSs interaction with TRIM21 activates the Nrf2 pathway.

The Keap1-interacting region (KIR) of p62 binds to Keap1 in a manner similar to that for Nrf2, which delivers Keap1 into the autophagosome for degradation. This ultimately releases Nrf2 from Keap1-mediated inhibition, resulting in Nrf2 stabilization and activation (17). Consistently, NSs-WT-expressing RAW 264.7 cells showed higher levels of p62 and Nrf2 than NSs-A46-expressing cells. However, the Keap1 level was surprisingly unaffected under the same conditions. We found that NSs expression also suppressed autophagosome formation by binding to the LC3 autophagy protein (data not shown). Thus, the inhibition of autophagosome formation by NSs might result not only in the accumulation of p62 but also in the inhibition of p62-mediated autophagic degradation. The nucleus-translocated Nrf2 activates its target gene expression in collaboration with the c-Maf transcription factor. Therefore, treatment with the small-molecule inhibitor ML385, which blocks the interaction between Nrf2 and c-Maf (36), detectably abrogated NSs-induced Nqo1 expression (Fig. 7E). Generally, viral infection induces oxidative stress, which plays a central role in the successful completion of the viral life cycle as well as the development of viral pathogenesis. To maintain an appropriate level of oxidative stress that aids in the host’s metabolism without inducing cell death, many viruses have evolved to manipulate the Nrf2 pathway for their favor. In the same context, SFTSV NSs targets TRIM21 to fine-tune the p62-Keap1-Nrf2 pathway for its life cycle.

NSs induces CD36 gene expression via the Nrf2 signal pathway.

Besides being a regulator of the cellular response to oxidative insults, Nrf2 promotes Cd36 expression in inflammatory macrophages, where the CD36 scavenger receptor contributes to phagocytosis (39, 40). Indeed, NSs increased CD36 surface expression through the Nrf2 pathway, increasing phagocytosis and lipid uptake. SFTSV NSs-formed cytosolic IBs are associated with lipid droplets, and the inhibition of fatty acid biosynthesis decreases IB formation and viral replication in SFTSV-infected cells (52, 53). A number of viruses induce and utilize IBs as a viral factory for viral replication and/or assembly. Therefore, we speculate that NSs increases CD36 expression and its lipid uptake, which facilitates IB formation and, thereby, SFTSV replication. Furthermore, two recent studies have shown that bone marrow aspirates of patients with severe fever with thrombocytopenia syndrome (SFTS) display hemophagocytic lymphohistiocytosis (54) and that macrophages potentially induce the phagocytosis of SFTSV-bound platelets (55). Thus, the SFTSV NSs induces CD36 surface expression on macrophages and phagocytosis by macrophages, which may contribute to the development of thrombocytopenia. Additional studies are necessary to provide evidence for or against this hypothesis.

The NSs-TRIM21 interaction plays a role in viral pathogenesis.

SFTSV infection produces severe clinical manifestations, and the fatality rate in human patients older than 50 years of age is increased compared with that in younger patients, indicating an age-dependent pathogenesis. While immunocompetent WT mice are completely resistant to SFTSV infection, immunocompromised Ifnar−/− mice are highly susceptible to SFTSV infection, exhibiting 100% lethality in an age-independent manner (56). Furthermore, SFTSV infected-immunocompromised Ifnar−/− mice do not show severe thrombocytopenia syndrome. On the other hand, we have reported on a ferret model in which the clinical manifestations of the syndrome are age dependent (57): young-adult ferrets (<2 years old) do not show any clinical symptoms and mortality; however, SFTSV-infected aged ferrets (>4 years old) demonstrate severe thrombocytopenia, a reduced white blood cell count, and a high temperature with an ∼90% mortality rate, fully reproducing the clinical manifestations seen in humans. Here, we found that the SFTSV-A46 mutant showed a detectable delay in pathogenesis compared to the SFTSV-WT, suggesting that the NSs-TRIM21 interaction is required for efficient pathogenesis but is not crucial for viral virulence in the mouse model. As the NSs-A46 mutant was able to inhibit the IFN signal and induce IL-10 expression, which are the critical immune evasion strategies of SFTSV, the NSs-TRIM21 interaction-mediated activation of Nrf2 may have a specific role in viral pathogenesis that cannot be assessed in immunocompromised mouse infection models. Thus, we plan to assess the SFTSV-A46 mutant for pathogenesis in the aged ferret model.

In summary, we report that the SFTSV NSs interacts with and inhibits TRIM21 to activate the Nrf2-mediated antioxidant response to generate the optimal environment for the viral life cycle. As a multifaceted protein, NSs deregulates the IFN, TPL2, and Nrf2 signal pathways, and the individual functions of these pathways may cooperate to induce a fast-progressing disease. Further study is therefore required to fully elucidate the impact of the NSs-TRIM21 interaction-mediated regulation of the Nrf2 antioxidant response in SFTSV infection.

MATERIALS AND METHODS

Bacterial strains, mammalian cell lines, and culturing conditions.

Escherichia coli TOP10 and DH10B cells were grown in LB (Lenox; Sigma) medium for genetic manipulations with appropriate antibiotics (ampicillin, 50 μg/ml; kanamycin, 50 μg/ml). HEK293T, HeLa, and mouse macrophage (RAW 264.7) cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS; Seradigm) and with 100 U/ml penicillin and 100 μg/ml streptomycin (1% Pen/Strep; Gibco). All cells were maintained at 37°C with 5% CO2. RAW 264.7 cells stably expressing SFTSV NSs-WT and NSs-A46 were generated by transfection with pIRES-NSs-3×Flag-puro, followed by selection with puromycin (puro; 0.5 μg/ml; Gibco).

Plasmids and reagents.

DNAs encoding NSs from SFTS, Heartland, and Uukuniemi viruses were synthesized from virally encoded cDNAs. cDNAs for human TRIM21, p62, Keap1, ABIN2, and TBK1 were obtained from Addgene and Origene. The constructs used for the transient and stable expression of the cDNAs in mammalian cells included the pEF-MCS-IRES-puro, pEBG-GST-MCS, and pCDH-CMV-MCS-EF1-puro (dual promoter; System Biosciences) vectors. All NSs expression plasmids contained a C-terminal 3×Flag tag, V5 tag, or 3×Flag and GFP tags and an N-terminal GST tag, the TRIM21 expression plasmid had a C-terminal V5 tag, the p62 expression plasmids had a C-terminal Myc or HA tag, the Keap1 expression plasmid contained a C-terminal Flag tag, the ABIN2 expression plasmid contained a C-terminal V5 tag, and the TBK1 expression plasmid contained a C-terminal Flag tag. Substitution and deletion mutants were constructed by a standard PCR cloning strategy. For the generation of recombinant viruses, five plasmids were transfected into BHK21-T7 cells. Plasmids pTVT7-ppL, pTVT7-ppM, and pTVT7-S carry three viral antigenomic segments under the control of the T7 promoter, and plasmids pTM1-ppL and pTM1-N produce RNA-dependent RNA polymerase (RdRp) and the N protein, respectively, to support viral replication. A small-molecule inhibitor of Nrf2, ML385 (Sigma), was added to the cell culture medium at 10 μM.

Mass spectrometry.

HEK293T cells were collected 48 h after transfection with pIRES-3×Flag and NSs-3×Flag and lysed with 1% NP-40 lysis buffer containing 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 1% Nonidet P-40 (Sigma) supplemented with cOmplete protease inhibitor EDTA-free cocktail (Roche). Postcentrifugation, supernatants were mixed with a 50% slurry of Flag M2 beads (catalog number M8823; Sigma), and the binding reaction mix was incubated for 4 h at 4°C. Precipitates were washed extensively with lysis buffer. Proteins bound to Flag M2 beads were eluted and separated in a 12% SDS-PAGE gel. After Coomassie brilliant blue staining, protein bands corresponding to the specific bands shown in NSs-3×Flag-expressing cells only were excised and separately analyzed by ion-trap mass spectrometry at the Harvard Taplin Biological Mass Spectrometry Facility in Boston, MA.

Mouse infection.

The University of Southern California (USC) Institutional Animal Care and Use Committee (IACUC) approved all animal studies. Ifnar−/− mice (A129 mice, which are of the C57BL/6 background) were purchased from The Jackson Laboratory. All mice were maintained in a pathogen-free barrier at the USC animal facilities and were transferred into a biosafety level 3 (BSL3) facility immediately prior to and for the duration of the infection study.

The mice were 8 to 12 weeks old during the course of the experiments and were age and sex matched in each experiment. Sample size was based on empirical data from pilot experiments and publications. No additional randomization or blinding was used to allocate the experimental groups. Immediately prior to infection, a frozen SFTSV stock was thawed and centrifuged. Mice were intramuscularly infected with 102 PFU of SFTSV per mouse in a 150-μl total volume of inoculum. For the survival experiment, mice were weighed daily after infection. Spleens were collected and used for quantitative PCR (qPCR).

Co-IP and GST-PD.

HEK293T cells were transfected with the DNA-expressing plasmids indicated above using the standard polyethylenimine (PEI) method. For SFTSV-NSs-GFP infection, the recombinant virus was kindly provided by a collaborator. RAW 264.7 cells were infected by SFTSV-NSs-GFP for 24 h. Cells were collected at 48 h posttransfection, followed by washing with phosphate-buffered saline (PBS), and the cell pellets were resuspended in 1% NP-40 lysis buffer. After sonication or freeze-thaw three times, whole-cell extracts (WCEs) were precleared with Sepharose beads rotating at 4°C for 2 h, followed by filtering through a 0.45-μm-pore-size polyether sulfone (PES) filter (Thermo Fisher). For coimmunoprecipitation (co-IP), precleared WCEs were incubated with the antibodies indicated below at 4°C for 3 to 12 h, followed by further incubation with protein A/G agarose beads (Thermo Fisher) at 4°C for 3 h. For GST pulldown (GST-PD), precleared WCEs were incubated with glutathione S-transferase (GSH)-conjugated Sepharose beads (GE) at 4°C for 2 h. Immobilized immune complexes or GST complexes containing beads were extensively washed five times using lysis buffer containing 1% NP-40 buffer with various concentrations of NaCl (150 to 500 mM). The beads were eluted in 2× Laemmli dye, heated for 5 min at 95°C, and then subjected to immunoblotting analysis.

Immunoblotting analysis.

Whole-cell lysates (WCLs) were lysed in 1% NP-40 buffer, and the protein concentration was measured by a Pierce bicinchoninic acid protein assay (Thermo Fisher) to equalize the protein loading. Proteins were resolved on SDS-PAGE gels and transferred to a polyvinylidene difluoride membrane by semidry transfer at 25 V for 30 min (Trans-Blot Turbo system; Bio-Rad). All membranes were blocked in 5% milk in Tris-buffered saline with Tween 20 (TBST; pH 8.0; Sigma) and probed with the antibodies indicated below in 5% milk or 5% bovine serum albumin (BSA) in TBST. The primary antibodies included TRIM21 (clone D1O1D; Cell Signaling), Nrf2 (clone D1Z9C; Cell Signaling), p62 (Cell Signaling), Keap1 (clone D6B12; Cell Signaling), GFP (clone B-2; Santa Cruz), GST (clone B-14; Santa Cruz), β-actin (clone C4; Santa Cruz), Flag (for rabbit Flag, clone F7425 [Sigma]; for mouse Flag, clone F1804 [Sigma]), HA (for rabbit HA, clone PRB-101P [Covance]; for mouse HA, clone 16B12 [BioLegend]), V5 (for rabbit V5, clone A190 [Bethyl]; for mouse V5, Invitrogen), and Myc (for rabbit Myc, clone Poly9063 [BioLegend]; for mouse Myc, clone 9E10 [BioLegend]). For detection of the viral protein Gn, mouse anti-SFTSV Gn antibody (58) was kindly provided by collaborators. Appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies were incubated on the membranes in 5% milk in TBST at room temperature for 1 h, and the bands were developed with an enhanced chemiluminescence (ECL) reagent (Thermo Fisher) and imaged on a ChemiDoc Touch imaging system (Bio-Rad).

Immunofluorescence microscopy.

HeLa cells were seeded onto glass coverslips. After 24 h, the cells were transfected using the Fugene HD reagent (Promega). The cells were washed at 12 to 16 h after transfection, fixed in 4% paraformaldehyde, permeabilized with 0.5% Triton X-100, and blocked with 5% BSA for 1 h. The cells were stained with the primary antibodies designated above, followed by labeling with anti-mouse Alexa Fluor 568 or Alex Fluor 488 and anti-rabbit Alexa Fluor 568 or Alexa Fluor 488 (Molecular Probes). After antibody labeling, the cells were counterstained with Hoechst 33342 (Molecular Probes) for nuclear staining. Cells were imaged with a confocal microscope (Nikon) and were processed with a NIS-Elements confocal microscope (Nikon).

qRT-PCR.

Total RNA was extracted using the TRI reagent (Sigma) and digested with DNase I (Sigma). One microgram of total RNA was reverse transcribed into cDNA using an iScript cDNA synthesis kit (Bio-Rad). Diluted cDNAs (1:5 or 1:10) were quantified using an iQ SYBR green Supermix kit (Bio-Rad) per the manufacturer’s instructions. DNase- and RNase-free water (catalog number W4502; Sigma) and filter tips were used. A CFX96 PCR machine (Bio-Rad) was used for quantitative reverse transcription-PCR (qRT-PCR) analysis with the following thermocycler conditions: 95°C for 3 min; 95°C for 10 s, 59°C for 20 s, and 72°C for 20 s for 40 cycles; and 95°C for 10 s. Melt curve analysis was done at temperatures ranging from 65°C to 95°C in increments of 0.5°C for 5 s. A plate read was added. The threshold cycle (CT) of each gene was normalized to that of the internal reference gene (β-actin) as follows: ΔCT = CT of the target gene – CT of the reference gene. Gene expression results are presented as the relative mRNA level or fold change. Relative mRNA levels were calculated using the 2−(ΔCT) method. Fold changes in expression were calculated using the 2−(ΔΔCT) method, where the level of the target gene relative to that of the control gene was determined by the equation ΔΔCT = ΔCT for the target sample – ΔCT for the control sample. Gene-specific probes (5′ to 3′) for qRT-PCR were mouse CD36 (GenBank accession number NM_001159558; forward primer, GGCCAAGCTATTGCGACATG; reverse primer, CCGAACACAGCGTAGATAGAC), mouse Hmox1 (GenBank accession number NM_010442; forward primer, GGTCAGGTGTCCAGAGAAGG; reverse primer, CTTCCAGGGCCGTGTAGATA), mouse Nqo1 (GenBank accession number NM_008706; forward primer, AGCGTTCGGTATTACGATCC; reverse primer, AGTACAATCAGGGCTCTTCTCG), mouse Nrf2 (GenBank accession number NM_010902; forward primer, AGCAGGACATGGAGCAAGTT; reverse primer, TTCTTTTTCCAGCGAGGAGA), and mouse β-actin (GenBank accession number NM_007393; forward primer, TGAGAGGGAAATCGTGCGTGAC; reverse primer, AAGAAGGAAGGCTGGAAAAGAG).

SiMPull assay.

The single-molecule pulldown (SiMPull) technique combines the principles of a conventional pulldown assay with single-molecule fluorescence microscopy and enables the direct visualization of individual protein-protein interactions (59). Briefly, HEK293T cells were transfected with the DNA-expressing plasmids indicated above (NSs-3×Flag, TRIM21-V5), and lysates were applied to slides coated with biotinylated anti-V5 antibody (catalog number GTX77436; GeneTex) for TRIM21-V5 pulldown. For binding, anti-Flag-Cy3 antibody (Sigma) was used for detecting NSs-3×Flag. Proteins immobilized on the slides were visualized by use of a total internal reflection fluorescence microscope equipped with an excitation laser (561 nm). Twenty different regions of the imaging surface were imaged, and molecular numbers were quantified by use of the IDL and MATLAB programs.

Phagocytosis assay.

For analyzing phagocytosis ability, we used a phagocytosis assay kit (IgG FITC; Cayman). In detail, vector-, NSs-WT-, or NSs-A46-expressing RAW 264.7 cells were plated in 12-well plates at a concentration of 2 × 105 cells/ml and were allowed to adhere. The cells were treated with a latex bead-rabbit IgG-FITC complex at a final dilution of 1:300. After 1 to 3 h of incubation, the cells were washed with PBS and incubated with trypan blue quenching solution for 5 min to distinguish the cells that had phagocytosed the beads from those that had simply bound the beads at the surface. Following a wash with assay buffer, the cells were applied to flow cytometry to measure the phagocytosis.

Cholesterol quantification assay.

To measure the amount of cholesterol in the cells, we used a cholesterol quantitation kit (catalog number MAK043; Sigma). Briefly, vector-, NSs-WT-, or NSs-A46-expressing RAW 264.7 cells were plated in 12-well plates at a concentration of 1 × 106 cells/ml and were allowed to adhere. Cells were harvested and extracted with 200 μl of a lysis solution consisting of chloroform-isopropanol-IGEPAL (7:11:0.1). The organic phase was collected by centrifugation at 13,000 × g for 10 min and air dried at 50°C to remove the chloroform. The dried lipids were dissolved in 200 μl of cholesterol assay buffer and mixed until they were homogeneous. Fifty microliters of lipids in cholesterol assay buffer was used for the reaction in 96-well plates. For the colorimetric assays, the absorbance at 570 nm was measured for each reaction sample. For every reaction, cholesterol standards were also measured and the results were plotted on a standard curve.

Cholesterol uptake assay.

For studying cellular cholesterol trafficking, we used a cholesterol uptake cell-based assay kit (Cayman). It employs fluorescently tagged cholesterol {22-[N(-7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-23,24- bisnor-5-cholen-3β-ol (NBD-cholesterol)} as a probe for the detection of the cholesterol taken up by cultured cells. Briefly, vector-, NSs-WT-, or NSs-A46-expressing RAW 264.7 cells were plated in 96-well plates at a concentration of 2 × 105 cells/ml and were allowed to adhere. Cells were treated with 100 μl of serum-free culture medium containing 20-μg/ml NBD-cholesterol and incubated for 48 h. For reading with a plate reader (Varioskan Lux multimode microplate reader; Thermo Fisher Scientific), the cells were washed with the assay buffer provided with the kit and analyzed immediately, with the filter sets designed for the detection of FITC.

Reverse genetics.

Recombinant viruses were generated as previously described (60). Briefly, BHK21-T7 cells (1.5 × 105 cells/ml) were transfected with 0.1 μg of pTM1-HB29ppL, 0.5 μg of pTM1-HB29N, and 1 μg of each pTVT7-based plasmid expressing copies of the cDNA of the viral antigenomic segments, using 3 μl of the TransIT-LT1 reagent (Mirus Bio LLC) per μg of DNA as the transfection reagent. After 7 days, the virus-containing supernatants were collected, clarified by low-speed centrifugation, and stored at −80°C. Stocks of recombinant viruses were grown in Vero E6 cells (1.5 × 105 cells/ml) at 37°C by infecting them at a multiplicity of infection of 0.01 and harvesting the culture medium at 7 days postinfection. The genome segments of recovered virus were amplified by reverse transcription-PCR (SuperScript IV reverse transcriptase; Invitrogen), and their nucleotide sequences were determined to confirm the lack of mutations. The pTVT7-S-NSs-A46 plasmid was constructed by using site-directed mutagenesis according to the manufacturer’s protocol and subsequently used to make SFTSV-A46 (GeneArt site-directed mutagenesis system; Invitrogen).

Virus titration by plaque assay.

Vero E6 cells were infected with serial dilutions of virus and incubated under an overlay consisting of DMEM supplemented with 2.5% FBS, 0.5% minimum essential amino acids, 0.5% sodium pyruvate, 0.5% GlutaMAX, 1% Pen/Strep, and 1.2% Avicel cellulose (FMC Biopolymer) at 37°C for 14 days. The cell monolayers were fixed with 10% formaldehyde in PBS. Following fixation, the cell monolayers were stained with 1% crystal violet in 20% ethanol to visualize the plaques.

Viral copy number.

The viral loads of SFTSV-infected cells or tissues of infected mice were determined by qPCR. For the M segment, the forward primer was SFTS-M-F (5′-AAGAAGTGGCTGTTCATCATTATTG-3′), the reverse primer was SFTS-M-R (5′-GCCTTAAGGACATTGGTGAGTA-3′), and the probe was SFTS-M-Probe (5′-6FAM-TCATCCTCCTTGGATATGCAGGCCTCA-TAM-3′ [where 6FAM is 6-carboxyfluorescein], which was synthesized by Sigma). qPCR cycling was performed using 10 ng of total RNA with an SsoAdvanced universal probes supermix (Bio-Rad) per the manufacturer’s instructions. The copy numbers were calculated as the ratio of the copy numbers to the copy number for the standard control.

Biosafety.

All work with infectious agents for SFTSV was done in the Wright Foundation and Hasting Foundation Laboratories Animal Biosafety Level 3 (BSL3/ABSL3) Facility at the Keck School of Medicine of USC.

Statistical analysis.

All results are presented as the mean ± standard deviation (SD). All experiments were repeated at least twice, with a representative gel or plot being shown where appropriate. Statistical analysis was performed using Prism (version 7.0) software (GraphPad Software). The numbers of independent experiments performed are indicated in the figure legends, and each experiment was conducted with two to three technical replicates. Where appropriate, column analyses were performed using an unpaired, two-tailed t test with Welch’s correction, or one-way analysis of variance (ANOVA) with Bonferroni’s or Dunnett’s test was used for multicomponent comparisons. For grouped analyses, two-way ANOVA with Bonferroni’s or Dunnett’s test was performed. P values of less than 0.05 (95% confidence interval) were considered significant. Comparison of mouse survival was estimated using the Kaplan-Meier method, and the results were analyzed by log-rank analysis.

Data availability.

The data that support the findings of this study are available from the corresponding author upon request.

ACKNOWLEDGMENTS

We thank Benjamin Brennan and Wenhui Li for reagents.

This work was partly supported by grants CA200422, AI073099, AI116585, AI129496, AI140718, AI140705, DE023926, DE027888, and DE028521 and by the Fletcher Jones Foundation (to J.U.J.).

Jae U. Jung is a scientific adviser to Vaccine Stabilization, a California corporation.

J.U.J. and Y.C. designed the research. Y.C., Z.J., and W.-J.S. performed the research. Y.C. and J.U.J. wrote the paper.

REFERENCES

  • 1.Abudurexiti A, Adkins S, Alioto D, Alkhovsky SV, Avšič-Županc T, Ballinger MJ, Bente DA, Beer M, Bergeron É, Blair CD, Briese T, Buchmeier MJ, Burt FJ, Calisher CH, Cháng C, Charrel RN, Choi IR, Clegg JCS, de la Torre JC, de Lamballerie X, Dèng F, Di Serio F, Digiaro M, Drebot MA, Duàn X, Ebihara H, Elbeaino T, Ergünay K, Fulhorst CF, Garrison AR, Gāo GF, Gonzalez J-PJ, Groschup MH, Günther S, Haenni A-L, Hall RA, Hepojoki J, Hewson R, Hú Z, Hughes HR, Jonson MG, Junglen S, Klempa B, Klingström J, Kòu C, Laenen L, Lambert AJ, Langevin SA, Liu D, Lukashevich IS, et al. 2019. Taxonomy of the order Bunyavirales: update 2019. Arch Virol 164:1949–1965. doi: 10.1007/s00705-019-04253-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Yu XJ, Liang MF, Zhang SY, Liu Y, Li JD, Sun YL, Zhang L, Zhang QF, Popov VL, Li C, Qu J, Li Q, Zhang YP, Hai R, Wu W, Wang Q, Zhan FX, Wang XJ, Kan B, Wang SW, Wan KL, Jing HQ, Lu JX, Yin WW, Zhou H, Guan XH, Liu JF, Bi ZQ, Liu GH, Ren J, Wang H, Zhao Z, Song JD, He JR, Wan T, Zhang JS, Fu XP, Sun LN, Dong XP, Feng ZJ, Yang WZ, Hong T, Zhang Y, Walker DH, Wang Y, Li DX. 2011. Fever with thrombocytopenia associated with a novel bunyavirus in China. N Engl J Med 364:1523–1532. doi: 10.1056/NEJMoa1010095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zhang YZ, He YW, Dai YA, Xiong Y, Zheng H, Zhou DJ, Li J, Sun Q, Luo XL, Cheng YL, Qin XC, Tian JH, Chen XP, Yu B, Jin D, Guo WP, Li W, Wang W, Peng JS, Zhang GB, Zhang S, Chen XM, Wang Y, Li MH, Li Z, Lu S, Ye C, de Jong MD, Xu J. 2012. Hemorrhagic fever caused by a novel bunyavirus in China: pathogenesis and correlates of fatal outcome. Clin Infect Dis 54:527–533. doi: 10.1093/cid/cir804. [DOI] [PubMed] [Google Scholar]
  • 4.Xing X, Guan X, Liu L, Xu J, Li G, Zhan J, Liu G, Jiang X, Shen X, Jiang Y, Wu Y, Zhang H, Huang J, Ding F, Sha S, Liu M, Zhan F. 2017. A case-control study of risk sources for severe fever with thrombocytopenia syndrome in Hubei Province, China. Int J Infect Dis 55:86–91. doi: 10.1016/j.ijid.2017.01.003. [DOI] [PubMed] [Google Scholar]
  • 5.Chen H, Hu K, Zou J, Xiao J. 2013. A cluster of cases of human-to-human transmission caused by severe fever with thrombocytopenia syndrome bunyavirus. Int J Infect Dis 17:e206–e208. doi: 10.1016/j.ijid.2012.11.006. [DOI] [PubMed] [Google Scholar]
  • 6.Moriyama M, Igarashi M, Koshiba T, Irie T, Takada A, Ichinohe T, Moriyama M, Igarashi M, Koshiba T, Irie T, Takada A, Ichinohe T. 2018. Two conserved amino acids within the NSs of severe fever with thrombocytopenia syndrome phlebovirus are essential for anti-interferon activity. J Virol 92:e00706-18. doi: 10.1128/JVI.00706-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ning YJ, Feng K, Min YQ, Cao WC, Wang M, Deng F, Hu Z, Wang H. 2015. Disruption of type I interferon signaling by the nonstructural protein of severe fever with thrombocytopenia syndrome virus via the hijacking of STAT2 and STAT1 into inclusion bodies. J Virol 89:4227–4236. doi: 10.1128/JVI.00154-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Santiago FW, Covaleda LM, Sanchez-Aparicio MT, Silvas JA, Diaz-Vizarreta AC, Patel JR, Popov V, Yu X-J, García-Sastre A, Aguilar PV. 2014. Hijacking of RIG-I signaling proteins into virus-induced cytoplasmic structures correlates with the inhibition of type I interferon responses. J Virol 88:4572–4585. doi: 10.1128/JVI.03021-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wu X, Qi X, Qu B, Zhang Z, Liang M, Li C, Cardona CJ, Li D, Xing Z. 2014. Evasion of antiviral immunity through sequestering of TBK1/IKKepsilon/IRF3 into viral inclusion bodies. J Virol 88:3067–3076. doi: 10.1128/JVI.03510-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Choi Y, Park SJ, Sun Y, Yoo JS, Pudupakam RS, Foo SS, Shin WJ, Chen SB, Tsichlis PN, Lee WJ, Lee JS, Li W, Brennan B, Choi YK, Jung JU. 2019. Severe fever with thrombocytopenia syndrome phlebovirus non-structural protein activates TPL2 signalling pathway for viral immunopathogenesis. Nat Microbiol 4:429–437. doi: 10.1038/s41564-018-0329-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Moi P, Chan K, Asunis I, Cao A, Kan YW. 1994. Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of the beta-globin locus control region. Proc Natl Acad Sci U S A 91:9926–9930. doi: 10.1073/pnas.91.21.9926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y, Oyake T, Hayashi N, Satoh K, Hatayama I, Yamamoto M, Nabeshima Y. 1997. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun 236:313–322. doi: 10.1006/bbrc.1997.6943. [DOI] [PubMed] [Google Scholar]
  • 13.Kobayashi A, Kang MI, Okawa H, Ohtsuji M, Zenke Y, Chiba T, Igarashi K, Yamamoto M. 2004. Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol Cell Biol 24:7130–7139. doi: 10.1128/MCB.24.16.7130-7139.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kobayashi A, Kang MI, Watai Y, Tong KI, Shibata T, Uchida K, Yamamoto M. 2006. Oxidative and electrophilic stresses activate Nrf2 through inhibition of ubiquitination activity of Keap1. Mol Cell Biol 26:221–229. doi: 10.1128/MCB.26.1.221-229.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Taguchi K, Motohashi H, Yamamoto M. 2011. Molecular mechanisms of the Keap1-Nrf2 pathway in stress response and cancer evolution. Genes Cells 16:123–140. doi: 10.1111/j.1365-2443.2010.01473.x. [DOI] [PubMed] [Google Scholar]
  • 16.Ichimura Y, Waguri S, Sou YS, Kageyama S, Hasegawa J, Ishimura R, Saito T, Yang Y, Kouno T, Fukutomi T, Hoshii T, Hirao A, Takagi K, Mizushima T, Motohashi H, Lee MS, Yoshimori T, Tanaka K, Yamamoto M, Komatsu M. 2013. Phosphorylation of p62 activates the Keap1-Nrf2 pathway during selective autophagy. Mol Cell 51:618–631. doi: 10.1016/j.molcel.2013.08.003. [DOI] [PubMed] [Google Scholar]
  • 17.Komatsu M, Kurokawa H, Waguri S, Taguchi K, Kobayashi A, Ichimura Y, Sou YS, Ueno I, Sakamoto A, Tong KI, Kim M, Nishito Y, Iemura S, Natsume T, Ueno T, Kominami E, Motohashi H, Tanaka K, Yamamoto M. 2010. The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. Nat Cell Biol 12:213–223. doi: 10.1038/ncb2021. [DOI] [PubMed] [Google Scholar]
  • 18.Lau A, Wang XJ, Zhao F, Villeneuve NF, Wu T, Jiang T, Sun Z, White E, Zhang DD. 2010. A noncanonical mechanism of Nrf2 activation by autophagy deficiency: direct interaction between Keap1 and p62. Mol Cell Biol 30:3275–3285. doi: 10.1128/MCB.00248-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Komatsu M, Waguri S, Koike M, Sou YS, Ueno T, Hara T, Mizushima N, Iwata J, Ezaki J, Murata S, Hamazaki J, Nishito Y, Iemura S, Natsume T, Yanagawa T, Uwayama J, Warabi E, Yoshida H, Ishii T, Kobayashi A, Yamamoto M, Yue Z, Uchiyama Y, Kominami E, Tanaka K. 2007. Homeostatic levels of p62 control cytoplasmic inclusion body formation in autophagy-deficient mice. Cell 131:1149–1163. doi: 10.1016/j.cell.2007.10.035. [DOI] [PubMed] [Google Scholar]
  • 20.Lee C. 2018. Therapeutic modulation of virus-induced oxidative stress via the Nrf2-dependent antioxidative pathway. Oxid Med Cell Longev 2018:6208067. doi: 10.1155/2018/6208067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ramezani A, Nahad MP, Faghihloo E. 2018. The role of Nrf2 transcription factor in viral infection. J Cell Biochem 119:6366–6382. doi: 10.1002/jcb.26897. [DOI] [PubMed] [Google Scholar]
  • 22.Cho HY, Imani F, Miller-DeGraff L, Walters D, Melendi GA, Yamamoto M, Polack FP, Kleeberger SR. 2009. Antiviral activity of Nrf2 in a murine model of respiratory syncytial virus disease. Am J Respir Crit Care Med 179:138–150. doi: 10.1164/rccm.200804-535OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kesic MJ, Simmons SO, Bauer R, Jaspers I. 2011. Nrf2 expression modifies influenza A entry and replication in nasal epithelial cells. Free Radic Biol Med 51:444–453. doi: 10.1016/j.freeradbiomed.2011.04.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yageta Y, Ishii Y, Morishima Y, Masuko H, Ano S, Yamadori T, Itoh K, Takeuchi K, Yamamoto M, Hizawa N. 2011. Role of Nrf2 in host defense against influenza virus in cigarette smoke-exposed mice. J Virol 85:4679–4690. doi: 10.1128/JVI.02456-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Schaedler S, Krause J, Himmelsbach K, Carvajal-Yepes M, Lieder F, Klingel K, Nassal M, Weiss TS, Werner S, Hildt E. 2010. Hepatitis B virus induces expression of antioxidant response element-regulated genes by activation of Nrf2. J Biol Chem 285:41074–41086. doi: 10.1074/jbc.M110.145862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lee J, Koh K, Kim YE, Ahn JH, Kim S. 2013. Upregulation of Nrf2 expression by human cytomegalovirus infection protects host cells from oxidative stress. J Gen Virol 94:1658–1668. doi: 10.1099/vir.0.052142-0. [DOI] [PubMed] [Google Scholar]
  • 27.Ivanov AV, Smirnova OA, Ivanova ON, Masalova OV, Kochetkov SN, Isaguliants MG. 2011. Hepatitis C virus proteins activate NRF2/ARE pathway by distinct ROS-dependent and independent mechanisms in HUH7 cells. PLoS One 6:e24957. doi: 10.1371/journal.pone.0024957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Edwards MR, Johnson B, Mire CE, Xu W, Shabman RS, Speller LN, Leung DW, Geisbert TW, Amarasinghe GK, Basler CF. 2014. The Marburg virus VP24 protein interacts with Keap1 to activate the cytoprotective antioxidant response pathway. Cell Rep 6:1017–1025. doi: 10.1016/j.celrep.2014.01.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Page A, Volchkova VA, Reid SP, Mateo M, Bagnaud-Baule A, Nemirov K, Shurtleff AC, Lawrence P, Reynard O, Ottmann M, Lotteau V, Biswal SS, Thimmulappa RK, Bavari S, Volchkov VE. 2014. Marburgvirus hijacks Nrf2-dependent pathway by targeting Nrf2-negative regulator Keap1. Cell Rep 6:1026–1036. doi: 10.1016/j.celrep.2014.02.027. [DOI] [PubMed] [Google Scholar]
  • 30.McEwan WA, Tam JC, Watkinson RE, Bidgood SR, Mallery DL, James LC. 2013. Intracellular antibody-bound pathogens stimulate immune signaling via the Fc receptor TRIM21. Nat Immunol 14:327–336. doi: 10.1038/ni.2548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Yang YS, Yang MC, Wang B, Weissler JC. 2000. Autoantigen Ro52 directly interacts with human IgG heavy chain in vivo in mammalian cells. Mol Immunol 37:591–602. doi: 10.1016/s0161-5890(00)00068-7. [DOI] [PubMed] [Google Scholar]
  • 32.Kimura T, Jain A, Choi SW, Mandell MA, Johansen T, Deretic V. 2017. TRIM-directed selective autophagy regulates immune activation. Autophagy 13:989–990. doi: 10.1080/15548627.2016.1154254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Yang K, Shi HX, Liu XY, Shan YF, Wei B, Chen S, Wang C. 2009. TRIM21 is essential to sustain IFN regulatory factor 3 activation during antiviral response. J Immunol 182:3782–3792. doi: 10.4049/jimmunol.0803126. [DOI] [PubMed] [Google Scholar]
  • 34.Pan JA, Sun Y, Jiang YP, Bott AJ, Jaber N, Dou Z, Yang B, Chen JS, Catanzaro JM, Du C, Ding WX, Diaz-Meco MT, Moscat J, Ozato K, Lin RZ, Zong WX. 2016. TRIM21 ubiquitylates SQSTM1/p62 and suppresses protein sequestration to regulate redox homeostasis. Mol Cell 62:149–151. doi: 10.1016/j.molcel.2016.03.015. [DOI] [PubMed] [Google Scholar]
  • 35.Tanaka M, Tanji K, Niida M, Kamitani T. 2010. Dynamic movements of Ro52 cytoplasmic bodies along microtubules. Histochem Cell Biol 133:273–284. doi: 10.1007/s00418-009-0669-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Singh A, Venkannagari S, Oh KH, Zhang YQ, Rohde JM, Liu L, Nimmagadda S, Sudini K, Brimacombe KR, Gajghate S, Ma J, Wang A, Xu X, Shahane SA, Xia M, Woo J, Mensah GA, Wang Z, Ferrer M, Gabrielson E, Li Z, Rastinejad F, Shen M, Boxer MB, Biswal S. 2016. Small molecule inhibitor of NRF2 selectively intervenes therapeutic resistance in KEAP1-deficient NSCLC tumors. ACS Chem Biol 11:3214–3225. doi: 10.1021/acschembio.6b00651. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Febbraio M, Hajjar DP, Silverstein RL. 2001. CD36: a class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism. J Clin Invest 108:785–791. doi: 10.1172/JCI14006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Puente Navazo MD, Daviet L, Ninio E, McGregor JL. 1996. Identification on human CD36 of a domain (155–183) implicated in binding oxidized low-density lipoproteins (Ox-LDL). Arterioscler Thromb Vasc Biol 16:1033–1039. doi: 10.1161/01.atv.16.8.1033. [DOI] [PubMed] [Google Scholar]
  • 39.Ishii T, Itoh K, Ruiz E, Leake DS, Unoki H, Yamamoto M, Mann GE. 2004. Role of Nrf2 in the regulation of CD36 and stress protein expression in murine macrophages: activation by oxidatively modified LDL and 4-hydroxynonenal. Circ Res 94:609–616. doi: 10.1161/01.RES.0000119171.44657.45. [DOI] [PubMed] [Google Scholar]
  • 40.Olagnier D, Lavergne RA, Meunier E, Lefevre L, Dardenne C, Aubouy A, Benoit-Vical F, Ryffel B, Coste A, Berry A, Pipy B. 2011. Nrf2, a PPARgamma alternative pathway to promote CD36 expression on inflammatory macrophages: implication for malaria. PLoS Pathog 7:e1002254. doi: 10.1371/journal.ppat.1002254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Nagy L, Tontonoz P, Alvarez JG, Chen H, Evans RM. 1998. Oxidized LDL regulates macrophage gene expression through ligand activation of PPARgamma. Cell 93:229–240. doi: 10.1016/s0092-8674(00)81574-3. [DOI] [PubMed] [Google Scholar]
  • 42.Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM. 1998. PPARgamma promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell 93:241–252. doi: 10.1016/s0092-8674(00)81575-5. [DOI] [PubMed] [Google Scholar]
  • 43.Rhodes DA, Trowsdale J. 2007. TRIM21 is a trimeric protein that binds IgG Fc via the B30.2 domain. Mol Immunol 44:2406–2414. doi: 10.1016/j.molimm.2006.10.013. [DOI] [PubMed] [Google Scholar]
  • 44.James LC, Keeble AH, Khan Z, Rhodes DA, Trowsdale J. 2007. Structural basis for PRYSPRY-mediated tripartite motif (TRIM) protein function. Proc Natl Acad Sci U S A 104:6200–6205. doi: 10.1073/pnas.0609174104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Vaysburd M, Watkinson RE, Cooper H, Reed M, O'Connell K, Smith J, Cruickshanks J, James LC. 2013. Intracellular antibody receptor TRIM21 prevents fatal viral infection. Proc Natl Acad Sci U S A 110:12397–12401. doi: 10.1073/pnas.1301918110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Manocha GD, Mishra R, Sharma N, Kumawat KL, Basu A, Singh SK. 2014. Regulatory role of TRIM21 in the type-I interferon pathway in Japanese encephalitis virus-infected human microglial cells. J Neuroinflammation 11:24. doi: 10.1186/1742-2094-11-24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Xue B, Li H, Guo M, Wang J, Xu Y, Zou X, Deng R, Li G, Zhu H, Xue B, Li H, Guo M, Wang J, Xu Y, Zou X, Deng R, Li G, Zhu H. 2018. TRIM21 promotes innate immune response to RNA viral infection through Lys27-linked polyubiquitination of MAVS. J Virol 92:e00321-18. doi: 10.1128/JVI.00321-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Pankiv S, Clausen TH, Lamark T, Brech A, Bruun JA, Outzen H, Overvatn A, Bjorkoy G, Johansen T. 2007. p62/SQSTM1 binds directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein aggregates by autophagy. J Biol Chem 282:24131–24145. doi: 10.1074/jbc.M702824200. [DOI] [PubMed] [Google Scholar]
  • 49.Bjorkoy G, Lamark T, Brech A, Outzen H, Perander M, Overvatn A, Stenmark H, Johansen T. 2005. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J Cell Biol 171:603–614. doi: 10.1083/jcb.200507002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Ciuffa R, Lamark T, Tarafder AK, Guesdon A, Rybina S, Hagen WJH, Johansen T, Sachse C. 2015. The selective autophagy receptor p62 forms a flexible filamentous helical scaffold. Cell Rep 11:748–758. doi: 10.1016/j.celrep.2015.03.062. [DOI] [PubMed] [Google Scholar]
  • 51.Sun Y, Liu MM, Lei XY, Yu XJ. 2018. SFTS phlebovirus promotes LC3-II accumulation and nonstructural protein of SFTS phlebovirus co-localizes with autophagy proteins. Sci Rep 8:5287. doi: 10.1038/s41598-018-23610-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Sun Q, Qi X, Zhang Y, Wu X, Liang M, Li C, Li D, Cardona CJ, Xing Z. 2016. Synaptogyrin-2 promotes replication of a novel tick-borne bunyavirus through interacting with viral nonstructural protein NSs. J Biol Chem 291:16138–16149. doi: 10.1074/jbc.M116.715599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Wu X, Qi X, Liang M, Li C, Cardona CJ, Li D, Xing Z. 2014. Roles of viroplasm-like structures formed by nonstructural protein NSs in infection with severe fever with thrombocytopenia syndrome virus. FASEB J 28:2504–2516. doi: 10.1096/fj.13-243857. [DOI] [PubMed] [Google Scholar]
  • 54.Mendoza CA, Ebihara H, Yamaoka S. 2019. Immune modulation and immune-mediated pathogenesis of emerging tickborne banyangviruses. Vaccines (Basel) 7:E25. doi: 10.3390/vaccines7040125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Jin C, Liang M, Ning J, Gu W, Jiang H, Wu W, Zhang F, Li C, Zhang Q, Zhu H, Chen T, Han Y, Zhang W, Zhang S, Wang Q, Sun L, Liu Q, Li J, Wang T, Wei Q, Wang S, Deng Y, Qin C, Li D. 2012. Pathogenesis of emerging severe fever with thrombocytopenia syndrome virus in C57/BL6 mouse model. Proc Natl Acad Sci U S A 109:10053–10058. doi: 10.1073/pnas.1120246109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Matsuno K, Orba Y, Maede-White K, Scott D, Feldmann F, Liang M, Ebihara H. 2017. Animal models of emerging tick-borne phleboviruses: determining target cells in a lethal model of SFTSV infection. Front Microbiol 8:104. doi: 10.3389/fmicb.2017.00104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Park SJ, Kim YI, Park A, Kwon HI, Kim EH, Si YJ, Song MS, Lee CH, Jung K, Shin WJ, Zeng J, Choi Y, Jung JU, Choi YK. 2019. Ferret animal model of severe fever with thrombocytopenia syndrome phlebovirus for human lethal infection and pathogenesis. Nat Microbiol 4:438–446. doi: 10.1038/s41564-018-0317-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Sun Y, Qi Y, Liu C, Gao W, Chen P, Fu L, Peng B, Wang H, Jing Z, Zhong G, Li W. 2014. Nonmuscle myosin heavy chain IIA is a critical factor contributing to the efficiency of early infection of severe fever with thrombocytopenia syndrome virus. J Virol 88:237–248. doi: 10.1128/JVI.02141-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Jain A, Liu RJ, Ramani B, Arauz E, Ishitsuka Y, Ragunathan K, Park J, Chen J, Xiang YK, Ha T. 2011. Probing cellular protein complexes using single-molecule pull-down. Nature 473:484–488. doi: 10.1038/nature10016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Brennan B, Li P, Zhang S, Li A, Liang M, Li D, Elliott RM. 2015. Reverse genetics system for severe fever with thrombocytopenia syndrome virus. J Virol 89:3026–3037. doi: 10.1128/JVI.03432-14. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon request.


Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES