Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2020 Feb 12;177(9):2042–2057. doi: 10.1111/bph.14967

Eucalyptol alleviates inflammation and pain responses in a mouse model of gout arthritis

Chengyu Yin 1, Boyu Liu 1, Ping Wang 2, Xiaojie Li 1, Yuanyuan Li 1, Xiaoli Zheng 1, Yan Tai 3, Chuan Wang 4,✉, Boyi Liu 1,✉
PMCID: PMC7161556  PMID: 31883118

Abstract

Background and Purpose

Gout arthritis, which is provoked by monosodium urate (MSU) crystal accumulation in the joint and periarticular tissues, induces severe pain and affects quality of life of the patients. Eucalyptol (1,8‐cineol), the principal component in the essential oils of eucalyptus leaves, is known to possess anti‐inflammatory and analgesic properties. We aimed to examine the therapeutic effects of eucalyptol on gout arthritis and related mechanisms.

Experimental Approach

A mouse model of gout arthritis was established via MSU injection into the ankle joint. Ankle oedema, mechanical allodynia, neutrophil infiltration, oxidative stress, NLRP3 inflammasome, and TRPV1 expression were examined.

Key Results

Eucalyptol attenuated MSU‐induced mechanical allodynia and ankle oedema in dose‐dependently, with effectiveness similar to indomethacin. Eucalyptol reduced inflammatory cell infiltrations in ankle tissues. Eucalyptol inhibited NLRP3 inflammasome activation and pro‐inflammatory cytokine production induced by MSU in ankle tissues in vivo. Eucalyptol reduced oxidative stress induced by MSU in RAW264.7 cells in vitro as well as in ankle tissues in vivo, indicated by an increase in activities of antioxidant enzymes and reduction of ROS. Eucalyptol attenuated MSU‐induced up‐regulation of TRPV1 expression in ankle tissues and dorsal root ganglion neurons innervating the ankle. The in vivo effects of eucalyptol on ankle oedema, mechanical allodynia, NLRP3 inflammasome, IL‐1β, and TRPV1 expression were mimicked by treating MSU‐injected mice with antioxidants.

Conclusion and Implications

Eucalyptol alleviates MSU‐induced pain and inflammation via mechanisms possibly involving anti‐oxidative effect. Eucalyptol and other antioxidants may represent promising therapeutic options for gout arthritis.

Abbreviations

GSH‐Px

GSH peroxidase

MDA

malondialdehyde

MSU

monosodium urate

MTT

3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide

MPO

myeloperoxidase

NAC

N‐acetyl‐l‐cysteine

Tempol

2,2,6,6‐tetramethylpiperidine‐1‐oxyl

What is already known

  • Eucalyptol, the principal component in essential oil of eucalyptus leaves, possesses anti‐inflammatory and analgesic effects.

  • ROS, NLRP3 activation, and TRPV1 overexpression are involved in gout pain and inflammation mechanisms.

What this study adds

  • Eucalyptol inhibits gout inflammation and pain with effectiveness similar to that of indomethacin.

  • Eucalyptol reduces ROS production, inhibits NLRP3 activation and TRPV1 overexpression, and thereby relieves gout.

What is the clinical significance

  • Eucalyptol may represent a promising therapeutic option for gout arthritis management.

1. INTRODUCTION

Gout arthritis is the most common inflammatory arthritis in the world (Rees, Hui, & Doherty, 2014). Gouty patients usually suffer from agonizing pain and joint swelling, which severely affect quality of life and may even lead to disability (Terkeltaub, 2003). It is estimated that 1.4 women and 4.0 men per 1,000 persons suffer from gout (Abhishek, Roddy, & Doherty, 2017; Roddy & Doherty, 2010; Terkeltaub, 2003). The incidence of gout is rising due to the ageing population and lifestyle changes (Roddy & Doherty, 2010). Gout is provoked by the accumulation of monosodium urate (MSU) crystals in the joint and periarticular tissues (Abu Bakar et al., 2018; Rees et al., 2014). The deposition of MSU crystals triggers the activation of the innate immune system, which elicits strong inflammatory responses in local joint and periarticular tissues (Rees et al., 2014).

Many mechanisms are involved in MSU‐induced inflammatory responses and pain in the joint and periarticular tissues. These mechanisms may include increased local ROS production and oxidative stress, leukocyte infiltration, especially neutrophils, release of pro‐inflammatory cytokines, including IL‐6 and TNF‐α, and activation of peripheral https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=485 and https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=507 channels. (Busso & So, 2010; Hoffmeister et al., 2011; Popa‐Nita & Naccache, 2010; Trevisan et al., 2013). In particular, MSU‐triggered activation of the https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1770 inflammasome, which cleaves pro‐IL‐1β into active https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4974, plays a crucial role in mediating the inflammatory response and pain of gout arthritis (Amaral et al., 2012). At present, the most commonly used therapeutic methods for relieving gout inflammation and pain include https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=2367, nonsteroidal anti‐inflammatory drugs (NSAIDs), and corticosteroids. However, these drugs often cause many unwanted side effects among patients (Terkeltaub, 2010).

https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=2464 a https://www.sciencedirect.com/topics/medicine-and-dentistry/terpene oxide, is the principal component of Eucalyptus essential oils (Juergens, 2014). It is also present in many other plant extracts, such as camphor, rosemary, and sage oils. Eucalyptol is widely used as a treatment option for symptoms of the common cold, respiratory infections, pancreatitis, and colitis and for pain relief (Juergens, 2014; Seol & Kim, 2016). Studies have demonstrated that eucalyptol possess antioxidant activity, can suppress LPS‐induced IL‐1β and NO production, and reduce LPS‐induced NF‐κB activation (Kennedy‐Feitosa et al., 2016; Kim, Lee, & Seol, 2015; Li et al., 2016; Seol & Kim, 2016). Eucalyptol also inhibits TRPA1 channels and diminishes pain elicited by application of TRPA1 channel agonists to human skin (Takaishi et al., 2012). Our recent work contributed to these efforts by revealing that eucalyptol interacts with the TRPM8 channel to exert anti‐inflammatory and analgesic effects on animal models of acute pain, CFA‐induced chronic inflammatory pain, and LPS‐induced pulmonary inflammation by reducing pro‐inflammatory cytokines and inflammatory cell infiltrations (Caceres et al., 2017; Liu et al., 2013; Liu & Jordt, 2018).

So far, there is still no study investigating the therapeutic effect of eucalyptol on gout arthritis. Given the fact that eucalyptol possesses antioxidant and anti‐inflammatory activities in both human and animal inflammatory models, we hypothesized that eucalyptol would be effective in treating inflammation and pain in gout arthritis. Therefore, in the present study, we have examined the therapeutic effects of eucalyptol in the treatment of inflammation and pain responses in a mouse model of MSU‐induced gout arthritis and explored the underlying mechanisms of its therapeutic effects.

2. METHODS

2.1. Animals

All animal care and experimental studies were approved by the Laboratory Animal Management and Welfare Ethical Review Committee of Zhejiang Chinese Medical University (Permission Number: ZSLL‐2017‐183). Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny, Browne, Cuthill, Emerson, Altman, & Group, 2010; McGrath & Lilley, 2015) and with the recommendations made by the British Journal of Pharmacology.

Male BALB/c mice (8 weeks, 23 ± 2 g) were purchased from Shanghai Laboratory Animal Center, Chinese Academy of Sciences and housed in the Laboratory Animal Center of Zhejiang Chinese Medical University accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) under standard environmental conditions (12 hr light–dark cycles and 24 ± 2°C). Food and water were provided ad libitum. Mice were randomly allocated, and five mice were housed per cage. The mice were given a minimum of 1 week to adapt to new environment before experiment. All animals were randomly grouped resulting in equal number of sample sizes. The group size in our experiments was chosen based upon our previous experience or studies using similar experimental protocols. Every effort was made to minimize the number of animals used and their suffering.

2.2. Cell culture

RAW264.7 macrophage cell line was purchased from Shanghai Academy of Life Sciences (Shanghai, China) and cultured in DMEM (Gibco, USA) supplemented with 10% FBS (Hycolon, USA) at 37°C in a humidified atmosphere of 5% CO2 and 95% air.

2.3. Measurement of intracellular ROS generation

ROS generated in RAW264.7 cells was measured using 10‐μM fluorescent probes, 2′,7′‐dichloro‐fluorescein diacetate (Beyotime, China); 1 × 106 RAW264.7 cells were seeded onto each well and treated with DCFH‐DA for 30 min at 37°C and immediately washed three times with 1 ml of PBS. Fluorescence images were captured with a multifunctional fluorescence microscope (Axio Observer.A1, Zeiss, Germany) with 485‐nm excitation and 525‐nm emission wavelengths and analysed by Zeiss ZENS software (Zeiss, Germany). Fluorescence intensities of each well were examined by a microplate reader (SpectraMax M4, Molecular Devices, CA, USA) with 485‐nm excitation and 525‐nm emission wavelengths.

2.4. Cell viability assay

The colorimetric 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) assay was employed to determine cell viability; 1 × 106 RAW264.7 cells were seeded beforehand. Medium was removed and washed with PBS. MTT was added to a final concentration of 0.5 mg·ml−1 and incubated for 4 hr at 37°C. MTT was then removed, and the formed formazan crystals were then dissolved in 150‐μl DMSO. The absorbance was measured spectrophotometrically using a microplate reader (SpectraMax M4, Molecular Devices, CA, USA) at 570 nm.

2.5. MSU‐induced acute gouty arthritis model establishment

Acute gouty arthritis was induced by intra‐articular (i.a.) injection of MSU crystals (0.5 mg) suspended in 20‐μl endotoxin‐free PBS into the tibio‐tarsal joint (ankle) of mice under isoflurane anaesthesia as described by Torres et al. (2009). Control group mice received an intra‐articular injection of 20‐μl sterile PBS. The successful establishment of the gout arthritis model was judged by obvious swelling and mechanical hyperalgesia 2 hr after MSU injection (Trevisan et al., 2014).

2.6. Evaluation of ankle joint hypersensitivity and oedema

Mice were habituated to the testing environment daily,for at least 2 days before baseline testing. The room temperature and humidity remained stable throughout all experiments. Mice were individually placed in transparent Plexiglas chambers on an elevated mesh floor and were habituated for 45 min before test. The mechanical hyperalgesia was determined using a series of von Frey filaments (UGO Basile, Italy) applied perpendicularly to the midplantar surface of the hind paws, with sufficient force to bend the filament slightly for 3–5 s according to methods we previously used (Chai et al., 2018; Hu et al., 2019). An abrupt withdrawal of the paw and licking and vigorously shaking in response to stimulation were considered pain‐like responses. The threshold was determined using the up–down testing paradigm, and the 50% paw withdrawal threshold (PWT) was calculated by the nonparametric Dixon test (Chaplan, Bach, Pogrel, Chung, & Yaksh, 1994; Dixon, 1980). Ankle oedema was evaluated as an increase in ankle diameter, measured with a digital calliper and was calculated as the difference between the basal value and the test value observed at different time points after gout model establishment. All these tests are conducted by an experimenter blinded to experimental conditions.

2.7. Drug administration

For the studies of ankle swelling and analgesic effect, eucalyptol (30, 100, 300, or 600 mg·kg−1), https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=1909 (10 mg·kg−1), or corresponding vehicle (corn oil) was injected i.p. 1 hr before MSU injection and 5, 23, and 47 hr after MSU injection for a total of four times. For other studies, eucalyptol (300 mg·kg−1), indomethacin (10 mg·kg−1), NAC (200 mg·kg−1), Tempol (200 mg·kg−1), or corresponding vehicle was injected i.p. 1 hr before MSU injection and 5 and 23 hr after MSU injection for a total of three times. The dosages of the drugs were adopted from previous studies (Caceres et al., 2017; Insuela et al., 2019; Wrotek, Jedrzejewski, Piotrowski, & Kozak, 2016; Zhou et al., 2018). One hour after the last drug application, mice were killed, and tissues were collected for analysis (see Figure 1 for more details).

Figure 1.

Figure 1

Open in a new tab

The structure of eucalyptol and experimental protocols. (a) The molecular structure of eucalyptol. (b) in vitro experiment protocol: RAW264.7 cells were seeded in six‐well plates. Eucalyptol (0.1–10 μM) was applied 20 min before MSU stimulation (0.5 mg·ml−1). Cells were incubated for 4 hr, and then MTT or ROS assay was performed. (c) in vivo experiment protocol: MSU (0.5 mg/20 μl) or PBS (20 μl) was injected into the ankle joint to establish the gout arthritis model or control group. Mechanical hypersensitivity and ankle oedema were measured at 0, 2, 4, 6, 8, 24, and 48 hr after model establishment. Eucalyptol (30, 100, 300, or 600 mg·kg−1), indomethacin (10 mg·kg−1), or vehicle (corn oil) were injected i.p., 1 hr before MSU injection and 5, 23, and 47 hr after model establishment for a total of four times. For tissue analysis, mice were killed 24 hr after model establishment, and ankle joint pathological analysis, MPO assay, qPCR, western blot, and antioxidant activity were assayed

2.8. Histopathological assessment of ankle joint

Mice were killed 24 hr after MSU injection, fixed with 10% paraformaldehyde in PBS, and then decalcified for 20 days with EDTA and embedded in paraffin for histological analysis. The paraffin sections were stained with haematoxylin and eosin for conventional morphological evaluation under the light microscope on 10× and 40× objectives. The numbers of infiltrated inflammatory cells per observation field in different groups were counted in a blind manner using 40× objectives and normalized with the control group (PBS injected).

2.9. Myeloperoxidase (MPO) activity measurement

Neutrophil recruitment in the ankle joint was evaluated via the quantification of the enzyme MPO activity using a commercial MPO Detection Kit (NanJing JianCheng Bio Ins, China) as previously described (Yuan et al., 2005). Briefly, mice were terminally anaesthetized, and the ankle joint was homogenized and centrifuged at 9,400× g, at 4°C for 15 min; 10 μl of the supernatant was transferred into PBS (PH 6.0) containing 0.17 mg·ml−1 3,3′,5,5′‐tetramethylbenzidine and 0.0005% hydrogen peroxide. MPO can catalyse the redox reaction of hydrogen peroxide and 3,3′,5,5′‐tetramethylbenzidine and produce yellow‐coloured compounds, through whose absorbance at 460 nm was determined. MPO activity was calculated and expressed as U·mg−1 protein. One unit of MPO activity was defined as the quantity of enzyme that degraded 1‐μmol hydrogen peroxide at 37°C·g−1 wet tissue.

2.10. Real‐time quantitative PCR (qPCR)

At 24 hr after intra‐articular injection of MSU, the ankle joint samples were collected under deep anaesthesia with isoflurane. Total RNA from each group was extracted in 1‐ml Trizol® reagent (Invitrogen, CA, USA) and centrifuged at 13,500× g at 4°C for 10 min. The purity and concentration of the samples were measured with a spectrophotometer, and wavelength absorption ratio (260/280 nm) was between 1.8 and 2.0 for all preparations. The extracted total RNA from ankle was reverse‐transcribed into cDNA using random hexamer primers with Prime Script™ RT reagent Kit (TaKaRa Bio Inc., China) according to the manufacturer's instruction. Each reaction was performed in triplicate and normalized to β‐actin gene expression. qPCR was performed in CFX96 Instrument Sequence Detection System (Bio‐Rad, USA) using the Fast Start Universal SYBR Green Master Kit (TaKaRa Bio Inc., China) with a 25‐μl reaction system as described previously (Yin et al., 2019). The Ct value of each well was determined using the CFX96 Real‐Time System Software, and the average of the triplicates was calculated. The relative quantification was determined by the △△Ct method. The sequences of all primers used were shown in Table 1.

Table 1.

Sequences of the primers used for qPCR

Sequence name Primer sequence (5′ to 3′) Amplicon size (bp)
Actb F:5′‐ATGCCACAGGATTCCATACC‐3′ 174
R:5′‐GCATCTTTACTCGAAACGGATC‐3′
Il‐1β F:5′‐CAACTGTTCCTGAACTCAACTG‐3′ 281
R:5′‐GAAGGAAAAGAAGGTGCTCATG‐3′
Il‐6 F:5′‐CTCCCAACAGACCTGTCTATAC‐3′ 97
R:5′‐CCATTGCACAACTCTTTTCTCA‐3′
TNF‐α F:5′‐ATGTCTCAGCCTCTTCTCATTC‐3′ 179
R:5′‐GCTTGTCACTCGAATTTTGAGA‐3′
HO‐1 F:5′‐TCCTTGTACCATATCTACACGG‐3′ 198
R:5′‐GAGACGCTTTACATAGTGCTGT‐3′
Nrf2 F:5′‐CTTTAGTCAGCGACAGAAGGAC‐3′ 95
R:5′‐AGGCATCTTGTTTGGGAATGTG‐3′
Caspase‐1 F:5′‐AGAGGATTTCTTAACGGATGCA‐3′ 149
R:5′‐TCACAAGACCAGGCATATTCTT‐3′
Nlrp3 F:5′‐ATGTGAGAAGCAGGTTCTACTC‐3′ 191
R:5′‐CTCCAGCTTAAGGGAACTCATG‐3′
Cxcl2 F:5′‐GGTTGACTTCAAGAACATCCAG‐3′ 183
R:5′‐TTGAGAGTGGCTATGACTTCTG‐3′
Cxcl1 F:5′‐ACTGCACCCAAACCGAAGTC‐3′ 114
R:5′‐TGGGGACACCTTTTAGCATCTT‐3′
Open in a new tab

2.11. Tissue collection and western blotting

The immuno‐related procedures used comply with the recommendations made by the British Journal of Pharmacology (Alexander et al., 2018). Ankle joint samples and ipsilateral L3‐5 DRGs were collected at 24 hr after MSU injection, weighed and immediately frozen in liquid nitrogen. Tissues were homogenized with a Bullet Blender (BBX24, NextAdvance Inc. NY, USA) in 50‐mM Tris‐base (pH 7.4) and 150‐mM NaCl added with protease inhibitors (Roche, Switzerland) and 0.2% Triton X‐100 (Sigma, MO, USA) at 4°C for 20 min at full speed, as we described previously (Liu et al., 2019). The supernatant was centrifuged at 13,500× g for 12 min at 4°C. The protein concentrations were determined by BCA assay (Thermo Fisher, MA, USA). Protein was loaded and separated by SDS‐PAGE and electrophoretically transferred onto PVDF membranes. The membranes were blocked with 5% milk in TBST solution for 1 hr at room temperature, probed with primary antibodies overnight at 4°C, and incubated with HRP‐coupled secondary antibodies. The antibodies used are as follows and further diluted in TBST: IL‐1β (1:1,000, rabbit polyclonal, RRID:AB_308765, ab9722, Abcam), β‐actin (1:5,000, mouse monoclonal, RRID:AB_445482, ab20272, Abcam), NLRP3 (1:1,000, rabbit polyclonal, RRID:AB_2750946, NBP2‐12446, Novus), https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1617 (1:500, rabbit polyclonal, RRID:AB_302644, ab1872, Abcam), Nrf2 (1:1,000, rabbit polyclonal, R1312‐8, HuaBio Inc.), and TRPV1 (1:1,000, rabbit polyclonal, RRID:AB_2313819, ACC‐030, Alomone Labs). The results of protein expression are normalized to the density of β‐actin. Fold change in control group was expressed as 100% for quantification.

2.12. Determination of oxidant/antioxidant status

Ankle joint tissues from mice of each group were collected 24 hr after MSU injection. The samples were then homogenized, followed by centrifugation at 845× g for 15 min. Supernatant was collected for SOD, reduced GSH, and malondialdehyde (MDA) assay as below:

2.12.1. Detection of SOD activity

SOD activity was detected based on the inhibition of nitro blue tetrazolium reduction using the xanthine/xanthine oxidase system as a superoxide generator with a commercially available kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Absorbance was determined with a microplate reader at 560 nm. The results were averaged and expressed as U·mg−1 of sample protein.

2.12.2. Detection of MDA level

Lipid peroxidation product MDA level was determined based upon the concentration of thiobarbituric acid‐reactive substances using a commercially available kit (Beyotime, Shanghai, China). Absorbance was determined using a microplate reader at 532 nm. MDA concentration was calculated using the absorbance coefficient according to manufacturer's instruction and expressed as U·mg−1 of sample protein.

2.12.3. Detection of glutathione peroxidase levels

Activity of glutathione peroxidase (GSH‐Px) was measured using 5,5′‐dithiobis‐(2‐nitrobenzoic acid) recycling method with a commercially available kit (Nanjing Jiancheng Bioengineering Institute, Nanjing). Absorbance was monitored using a microplate reader at 412 nm. The results were analysed by comparison with that of the standard solution of GSH and expressed as μmol·mg−1 of sample protein.

2.13. Immunofluorescent staining

Mice were deeply anaesthetized with isoflurane and were perfused through the ascending aorta with 0.9% saline followed by 4% paraformaldehyde in 0.1‐M PBS. After perfusion, the L3‐5 DRGs were removed and post‐fixed in the same fixative for 4–6 hr (4°C) before transferring to 15% and 30% sucrose for 72 hr for dehydration. DRGs were serially cut into 8‐μm thickness section on a frozen microtome (CryoStar NX50, Thermo Fisher, CA, USA) and processed for immunofluorescence. The sections were first blocked with 5% donkey serum in PBS (with 0.3% Triton X‐100, blocking buffer) for 1 hr at 37°C and then incubated overnight at 4°C with the following primary antibodies diluted in blocking buffer: rabbit anti TRPV1 (1:1,000, rabbit polyclonal, RRID:AB_2313819, ACC‐030, Alomone Labs) and mouse anti NeuN (1:400, mouse monoclonal, RRID:AB_11036146, NPB1‐92693, Novus Biologicals). The sections were then incubated 1 hr at 37°C with mixture of corresponding secondary antibodies. Fluorescence images were captured by Nikon A1R laser scanning confocal microscope (Nikon, Japan). Immunofluorescent staining was conducted in the way conforming to BJP Guidelines (Alexander et al., 2018)

2.14. Data and statistical analysis

The data and statistical analysis comply with the recommendations of the British Journal of Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2018). All data were included in data analysis and presentation. Statistical analysis was undertaken only for studies where each group size was at least n = 5. The group size in this study represents the number of independent values, and the statistical analysis was done using independent values. For AUC analysis of anti‐inflammatory and analgesic effects of eucalyptol, immunofluorescence staining intensity, and western blotting density analysis, data were normalized to control groups for comparison and quantification (control group was taken as 100%). Statistical analyses were performed using Graphpad Prism 6.0 software (GraphPad Software Inc., CA, USA). Results are presented as mean ± SEM. Statistical analyses were made by one‐ or two‐way ANOVA (for comparison among three or more groups) followed by Tukey's post hoc test with a P value of <.05 considered statistically significant (with F achieving P < .05 and no significant variance inhomogeneity).

2.15. Materials

MSU, indomethacin, NAC, corn oil, and DMSO were purchased from Sigma (MO, USA). Eucalyptol was purchased from Acros Organics (PA, USA). Tempol was purchased from APExBIO Technology (TX, USA).

2.16. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018), and are permanently archived in the Concise Guide to PHARMACOLOGY 2019/20 (Alexander, Fabbro et al., 2019a, b; Alexander, Mathie et al., 2019).

3. RESULTS

3.1. Eucalyptol alleviated MSU‐induced mechanical allodynia and ankle oedema in vivo

We first investigated the effects of eucalyptol, a https://www.sciencedirect.com/topics/medicine-and-dentistry/terpene oxide (Figure 1a), on MSU‐induced gout pain and ankle inflammation in vivo. Mice were injected with MSU (0.5 mg per ankle in 20‐μl PBS, i.a.) into the ankles to establish the gout model. The control group of mice was injected with vehicle (20‐μl PBS, i.a.). Injection of MSU induced obvious ankle swelling, which appeared 2 hr after the injection and lasted until 48 hr. For eucalyptol treatment, the dosages (30, 100, 300, or 600 mg·kg−1, i.p.) were based upon previous studies tested in rodents (Caceres et al., 2017; Li et al., 2016). Eucalyptol was applied 1 hr before MSU injection and 5, 23, and 47 hr after MSU injection for a total of four times (Figure 1c). Indomethacin (10 mg·kg−1, i.p.), the NSAIDs commonly used for alleviating gout pain and inflammation, was used as a positive control to compare the effects of eucalyptol. As expected, indomethacin reduced the ankle swelling of MSU‐treated mice (Figure 2a,b). AUC of Figure 2b showed significant anti‐inflammatory effects of 100, 300, or 600 mg·kg−1 eucalyptol and indomethacin accumulated over the observation period (Figure 2c). Next, we evaluated the effect of eucalyptol on MSU‐induced gout pain. MSU injection resulted in significant mechanical allodynia, as manifested by a reduction of the 50% paw withdraw threshold (PWT, Figure 2d). As expected, indomethacin alleviated MSU‐induced mechanical allodynia (Figure 2d,e). AUC of Figure 2d showed significant anti‐allodynic effect of 300 or 600 mg·kg−1 eucalyptol and indomethacin accumulated over the observation period (Figure 2e). These results suggest that eucalyptol can reduce MSU‐induced mechanical allodynia and ankle oedema. Based upon the results we obtained, we chose eucalyptol at a dosage of 300 mg·kg−1, which significantly reduced ankle swelling and mechanical allodynia, in our subsequent studies in vivo.

Figure 2.

Figure 2

Open in a new tab

Effects of eucalyptol on inflammation and pain in MSU‐induced gout arthritis in mice. (a) Representative photographs of ankles 24 hr after MSU injection. Black arrow indicates the injected ankle. (b) Time course of the effects of indomethacin (Indo) and different dosages of eucalyptol (Euca) on ankle oedema. n = 6 mice per group. (c) Normalized AUC of (b). (d) Time course of the effects of indomethacin and different doses of eucalyptol on mechanical allodynia of the hind paw. n = 6 mice per group. (e) Normalized AUC of (d). *P < .05, significantly different from Control group; # P < .05, significantly different from MSU + Veh group; NS: not significantly different from MSU + Veh group; one‐way or two way ANOVA followed by Tukey's post hoc test

We then examined the effects of eucalyptol on inflammatory cell infiltration induced by MSU in the ankle joint. MSU‐injected mice were treated with vehicle (MSU + Veh), eucalyptol (300 mg·kg−1, i.p., MSU + Euca), or indomethacin (10 mg·kg−1, i.p., MSU + Indo) as described in Figure 1c. Control group mice received PBS + vehicle treatment (Control). MSU significantly increased the inflammatory cell infiltration in the ankle joint (Figure 3a,b). Eucalyptol (300 mg·kg−1) and indomethacin (10 mg·kg−1) both inhibited MSU‐induced inflammatory cell infiltrations in the ankle joint (Figure 3a,b). Recruited leukocytes, especially neutrophils, play an important role in generating pain in gout arthritis (Amaral et al., 2012). Therefore, we continued to examine the effects of eucalyptol on neutrophil infiltrations in ankle joint tissues. Myeloperoxidase (MPO) assay indicated that MSU induced a significant increase in neutrophil infiltration in ankle joint tissues, whereas eucalyptol and indomethacin both significantly inhibited MSU‐induced neutrophil infiltration in ankle joint tissues (Figure 3c).

Figure 3.

Figure 3

Open in a new tab

Effects of eucalyptol on inflammatory cell infiltration in ankle joint tissues of MSU‐induced gout arthritis mice. (a) Representative microscopic photos of mice ankle tissue sections from Control, MSU + Veh, MSU + Eucalyptol (MSU + Euca), and MSU + Indomethacin (MSU + Indo) groups. (b) Summarized data showing the number of infiltrated inflammatory cells per observation field. Control group was taken as 100%. (c) Summarized data showing the myeloperoxidase (MPO) activity determined in ankle tissue samples. n = 6 mice per group. *P < .05, significantly different from Control group; # P < .05, significantly different from MSU + Veh group; one‐way ANOVA followed by Tukey's post hoc test

3.2. Eucalyptol inhibited NLRP3 inflammasome activation and IL‐1β production induced by MSU in vivo

The NLRP3 inflammasome is a complex of proteins responsible for the cleavage of pro‐IL‐1β into active IL‐1β, which plays an important role in mediating pain and inflammation in gout arthritis (Martinon, Petrilli, Mayor, Tardivel, & Tschopp, 2006). Therefore, in our following experiments, we investigated whether eucalyptol could act by interfering with this important mechanism of gout arthritis. MSU‐injected mice were treated with vehicle (MSU + Veh), eucalyptol (300 mg·kg−1, i.p., MSU + Euca), or indomethacin (10 mg·kg−1, i.p., MSU + Indo) as described in Figure 1c. Control group mice received PBS + vehicle treatment (Control). We first performed qPCR to examine the effects of eucalyptol on NLRP3 inflammasome expression in ankle joint tissues. The qPCR results showed that MSU significantly increased Nlpr3, Caspase‐1, and Il‐1β mRNA expression in ankle joint tissues, increases which were significantly attenuated by indomethacin (Figure 4a–c). Similar to indomethacin, eucalyptol significantly attenuated the overexpression of Nlpr3, Caspase‐1, and Il‐1β mRNA in ankle joint tissues (Figure 4a–c). Next, we examined the effects of eucalyptol on NLRP3 inflammasome activation by western blot. Consistent with our qPCR results, western blot indicated that eucalyptol and indomethacin both significantly attenuated the overexpression of NLRP3, Caspase‐1, and IL‐1β protein in ankle joint tissues induced by MSU (Figure 4d–f). Taken together, the above results indicate that eucalyptol inhibits NLRP3 inflammasome activation induced by MSU in ankle joint tissues in vivo.

Figure 4.

Figure 4

Open in a new tab

Eucalyptol inhibited NLRP3 inflammasome activation in ankle joint tissues of MSU‐induced gout arthritis mice. (a–c) Summarized data showing the expression of Nlrp3 (a), Caspase‐1 (b), and Il‐1β (c) genes in Control, MSU + Veh, MSU + Euca, and MSU + Indo groups determined by qPCR in mice ankle tissues 24 hr after MSU injection. n = 6 mice per group. (d–f) NLRP3 (d), caspase‐1 (e), and IL‐1β (f) protein expressions determined by western blotting in mice ankle tissues 24 hr after MSU injection. n = 5 mice per group for NLRP3 group. n = 6 mice for caspase‐1 and IL‐1β groups. Upper panel shows representative images of NLRP3, caspase‐1, IL‐1β, and β‐actin protein expression from Control, MSU + Veh, MSU + Euca, and MSU + Indo groups. Lower panel shows summarized NLRP3, caspase‐1, and IL‐1β protein expression normalized to β‐actin. *P < .05, significantly different from Control group; # P < .05, significantly different from MSU + Veh group;. one‐way ANOVA followed by Tukey's post hoc test

3.3. Eucalyptol suppressed MSU‐induced ROS production and restored endogenous antioxidant capacities

Given the fact that ROS play a critical role in activation of the NLRP3 inflammasome, we next examined whether eucalyptol could attenuate the oxidative stress during gout condition. We first tested the effect of eucalyptol in MSU‐treated murine macrophage cell line RAW264.7 in vitro, to screen the MSU concentrations that could elicit oxidative stress in RAW264.7 cells. We found that MSU induced obvious ROS generation, indicated by an increase in intracellular DCF fluorescence intensity, at a concentration above 0.5 mg·ml−1 (Figure 5a). Then, we evaluated the effects of eucalyptol on ROS generation induced by 0.5 mg·ml−1 MSU in RAW264.7 cells. We treated RAW264.7 cells with eucalyptol at concentrations of 0.1, 1, 5, or 10 μM 20 min before MSU (0.5 mg·ml−1) application and carried out the assays according to protocols indicated in Figure 1b. We found that eucalyptol concentration‐dependently reduced MSU‐induced ROS production in RAW264.7 cells, with an IC50 estimated at 1.09 ± 0.16 μM (Figure 5b,c). We then tested the cytotoxicity of eucalyptol on RAW264.7 cells by MTT assay and found that eucalyptol, at a concentration range of 0.1–10 μM, did not affect the overall cell viability (Figure 5d). These results indicate that eucalyptol can reduce ROS production induced by MSU in RAW264.7 cells in vitro.

Figure 5.

Figure 5

Open in a new tab

Eucalyptol suppresses MSU‐induced oxidative stress in RAW264.7 cells. (a) Upper panel: representative pictures showing cellular oxidative stress in RAW264.7 cells induced by 0.1, 0.5, and 1.0 mg·ml−1 MSU for 4 hr determined by DCF under fluorescence microscope. Lower panel: summarized results DCF fluorescence intensity measured by microplate reader. *P < .05 significantly different from Control group (no MSU added). NS: not significantly different from Control group. (b) Representative photographs showing the cellular oxidative stress induced by MSU in RAW264.7 cells treated with different dosages of eucalyptol (Euca; 0.1, 1, 5, and 10 μM) determined by DCF. (c) Summarized results of DCF fluorescence intensity changes in groups treated with different dosages of eucalyptol. DCF fluorescence intensity was normalized to that of the vehicle‐treated group (no MSU, no eucalyptol added) and shown as % of relative ROS. (d) RAW264.7 cells were treated with 0.1, 1, 5, or 10 μM eucalyptol for 4 hr, and cell viability was determined by MTT assay; n = 6 wells per group. Scale bar indicates 20 μm. *P < .05, significantly different from Control group (no MSU, no eucalyptol added); # P < .05, significantly different from MSU + Veh group; NS: not significantly different from MSU + Veh group; one‐way ANOVA followed by Tukey's post hoc test

To further investigate whether eucalyptol affects oxidative stress in vivo, we evaluated the effects of eucalyptol treatment on the activities of antioxidant enzymes SOD, GSH peroxidase (GSH‐Px), and lipid peroxidation product malondialdehyde (MDA) content in ankle joint tissues. MSU‐injected mice were treated with vehicle (MSU + Veh), eucalyptol (300 mg·kg−1, i.p., MSU + Euca), or indomethacin (10 mg·kg−1, i.p., MSU + Indo) as described in Figure 1c. Control group mice received PBS + vehicle treatment (Control). Eucalyptol (300 mg·kg−1, i.p.) restored the endogenous antioxidant capacities of ankle joint tissue by preventing the depletion of SOD and GSH‐Px levels (Figure 6a,b) in MSU‐injected mice. Consistent with this result, eucalyptol (300 mg·kg−1, i.p.) significantly reduced the production of MDA in ankle joint tissues of MSU‐induced gout mice (Figure 6c). Similarly, indomethacin treatment (10 mg·kg−1, i.p.) restored the activity of SOD and reduced MDA content (Figure 6a,c).

Figure 6.

Figure 6

Open in a new tab

Eucalyptol suppressed oxidative stress in ankle joint tissues of MSU‐induced gout arthritis mice. (a–c) Summarized data showing SOD activity (a), GSH‐Px activity (b), and MDA content (c) determined in mice ankle tissues 24 hr after MSU injection (d) Summarized data showing the expression of Nrf2 gene in Control, MSU + Veh, MSU + Euca, and MSU + Indo groups determined by qPCR in mice ankle tissues 24 hr after MSU injection. (e) Nrf2 protein expression determined by western blotting in mice ankle tissues 24 hr after MSU injection. Upper panel shows representative images of Nrf2 and β‐actin protein expression from Control, MSU + Veh, MSU + Euca, and MSU + Indo groups. Lower panel shows summarized Nrf2 protein expression normalized to β‐actin. n = 5 mice per group. *P < .0,5 significantly different from Control group; # P < .05, significantly different from MSU + Veh group; NS: not significantly different from MSU + Veh group; one‐way ANOVA followed by Tukey's post hoc test

Antioxidant transcription factor Nrf2‐mediated pathway constitutes an important endogenous anti‐oxidative mechanism (Loboda, Damulewicz, Pyza, Jozkowicz, & Dulak, 2016; Luo et al., 2018). Nrf2 binds with cis‐oxidation reaction elements in the nucleus to activate antioxidant gene expression, such as HO‐1, which possesses anti‐oxidative and anti‐inflammatory effects (Loboda et al., 2016). In order to explore whether eucalyptol exerts its anti‐oxidative and anti‐inflammatory effects via activating Nrf2 pathway, Nrf2 and its downstream target HO‐1 were examined. qPCR showed that MSU significantly down‐regulated Nrf2 gene expression level in ankle joint tissues, whereas eucalyptol restored its expression in ankle joint tissues (Figure 6d). Western blot further confirmed the results of qPCR, showing that eucalyptol (300 mg·kg−1, i.p.) significantly up‐regulated the decreased expression level of Nrf2 protein in ankle joint tissues (Figure 6e). qPCR further showed that eucalyptol significantly promoted the expression of HO‐1 gene in ankle tissue of MSU‐treated mice (Figure 6f). These results suggest that eucalyptol inhibits MSU‐induced oxidative stress and depletion of endogenous antioxidants, and enhances endogenous anti‐oxidative responses in ankle joint tissues in vivo.

3.4. Eucalyptol reduced MSU‐induced up‐regulation of pro‐inflammatory cytokines in ankle joint tissues

MSU can trigger the release of some key pro‐inflammatory cytokines and chemokines, including https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=4998 https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=5074, https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=819, and https://www.guidetopharmacology.org/GRAC/LigandDisplayForward?ligandId=827 (Rossaneis et al., 2019; Ryckman et al., 2003; Staurengo‐Ferrari et al., 2018). We proceeded to examine the effects of eucalyptol on expression of these cytokines and chemokines in ankle joint tissues, compared with theeffects of indomethacin. MSU‐injected mice were treated with vehicle (MSU + Veh), eucalyptol (300 mg·kg−1, i.p., MSU + Euca), or indomethacin (10 mg·kg−1, i.p., MSU + Indo) as described in Figure 1c. Control group mice received PBS + vehicle treatment (Control). qPCR results showed that MSU significantly up‐regulated the mRNA expression level of Il‐6, Tnf‐α, Cxcl1, and Cxcl2 in ankle joint tissues, whereas indomethacin significantly reduced the up‐regulation of Il‐6, Tnf‐α, and Cxcl2, but not Cxcl1 (Figure 7a–d). Similar to indomethacin, eucalyptol significantly reduced the up‐regulation of Il‐6, Tnf‐α, and Cxcl2 but not Cxcl1 induced by MSU in ankle joint tissues (Figure 7a–d).

Figure 7.

Figure 7

Open in a new tab

Effects of eucalyptol on pro‐inflammatory cytokine and chemokine expression in ankle joint tissues of MSU‐induced gout arthritis mice. (a–d) Summarized data showing the expression of Tnf‐α (a), Il‐6 (b), Cxcl1 (c), and Cxcl2 (d) genes in Control, MSU + Veh, MSU + Euca, and MSU + Indo groups determined by qPCR in mice ankle joint tissues 24 hr after MSU injection; n = 6 mice per group. *P < .05, significantly different from Control group; # P < .05 , significantly different from MSU + Veh group; NS: not significantly different from MSU + Veh group; one‐way ANOVA followed by Tukey's post hoc test

3.5. Eucalyptol reduced MSU‐induced up‐regulation of TRPV1 channel in ankle joint tissues and dorsal root ganglion (DRG) neurons that innervate the ankle

IL‐1β, IL‐6, and TNF‐α are well‐established pro‐inflammatory cytokines that up‐regulate TRPV1 channel expression to promote and maintain pain signals (Ebbinghaus et al., 2012; Fang et al., 2015; Schaible et al., 2010). Expression of TRPV1 channels is increased in local inflamed tissues during gout arthritis and involved in pain and inflammation of gout arthritis (Hoffmeister et al., 2011, 2014). Given the fact that eucalyptol reduced the overexpression of Il‐1β, Il‐6, and Tnf‐α in ankle joint tissues, we investigated whether eucalyptol affected TRPV1 overexpression in ankle joint tissues. MSU‐injected mice were treated with vehicle (MSU + Veh) or eucalyptol (300 mg·kg−1, i.p., MSU + Euca) as described in Figure 1c. Control group mice received PBS + vehicle treatment (Control). Consistent with previous studies, we found that expression of TRPV1 channels was significantly up‐regulated in the inflamed ankle joint tissues of MSU‐treated mice detected by western blot (Figure 8a). Eucalyptol significantly reduced the overexpression of TRPV1 channels induced by MSU in inflamed ankle joint tissues (Figure 8a).

Figure 8.

Figure 8

Open in a new tab

Effects of eucalyptol on expression of TRPV1 channels in ankle joint tissues and DRG neurons of MSU‐induced gout arthritis mice. (a, b) Western blot determination of TRPV1 protein expression in ankle joint tissues (a) and DRGs (b) of Control, MSU + Veh, and MSU + Euca groups of mice. Upper panel shows representative images of TRPV1 and β‐actin protein expression from Control, MSU + Veh, and MSU + Euca groups. Lower panel shows summarized TRPV1 protein expression normalized to β‐actin. (c) Representative immunofluorescence images indicating TRPV1 staining in DRG neurons from Control, MSU + Veh, and MSU + Euca groups of mice. Areas staining positive for TRPV1 protein are shown in green. DRGs were co‐stained with the pan‐neuronal marker NeuN (red) to identify DRG neurons. Scale bar indicates 100 μm. (d) Summary of the normalized % increase in fluorescence intensity of TRPV1 staining in the observation field as in panel (c). (e) Summary of the % of TRPV1 positively stained neurons (TRPV1+) from each observation field among all NeuN+ neurons. The total number of DRG neurons per field was calculated by positive NeuN staining. n = 5 mice per group. *P < .05, significantly different from Control group; # P < .05, significantly different from MSU + Veh group; one‐way ANOVA followed by Tukey's post hoc test

We further examined the expression of TRPV1 channels in L3‐5 DRGs that innervate the ankle and the hind paw. Western blot revealed that expression of TRPV1 channels was significantly increased in L3‐5 DRGs of MSU‐treated mice as well (Figure 8b). Eucalyptol significantly reduced the TRPV1 overexpression in L3‐5 DRGs (Figure 8b). Furthermore, immunofluorescence showed that the percentage of TRPV1 positive DRG neurons among all DRG neurons (stained with NeuN) and TRPV1 immunofluorescent staining intensity were both significantly increased in MSU‐treated group, whereas eucalyptol reduced the increase (Figure 8c–e). Thus, eucalyptol treatment reduced the overexpression of TRPV1 channels in our model of gout, in both inflamed ankle joint tissues and DRG neurons that innervate the ankle.

3.6. Antioxidants mimic the therapeutic effects of eucalyptol by inhibiting NLRP3 inflammasome activation, IL‐1β production, and TRPV1 channel overexpression in ankle joint tissues

We further explored the mechanisms of how eucalyptol inhibited NLRP3 inflammasome activation and IL‐1β production in gout arthritis. ROS and oxidative stress play an important role in mediating NLRP3 inflammasome activation (Sharma et al., 2018). We then examined whether reducing ROS may produce similar effects as eucalyptol under gout condition. We chose two well‐established antioxidants, namely, N‐acetyl‐l‐cysteine (NAC) and 2,2,6,6‐tetramethylpiperidine 1‐oxyl (Tempol) to reduce ROS generation and oxidative stress. NAC (200 mg·kg−1, i.p.) or Tempol (200 mg·kg−1, i.p.) was applied 1 hr before MSU injection and 5 and 23 hr after MSU injection for a total of three times, in the same way as eucalyptol (MSU + NAC and MSU + Tempol groups, Figure S1A). NAC and Tempol both significantly reduced the ankle swelling and mechanical allodynia of MSU‐injected mice (Figure S1B,D). AUC of Figure S1B,D showed significant accumulated anti‐inflammatory and anti‐allodynic effects of NAC and Tempol over the observation time frame (Figure S1C,E). As expected, NAC and Tempol treatments significantly reduced the production of MDA, a lipid peroxidation product, via anti‐oxidative mechanisms (Figure 9a). Meanwhile, NAC and Tempol treatments both restored SOD and GSH‐Px levels in ankle tissues of MSU‐treated mice as eucalyptol (Figure 9b,c). More importantly, NAC and Tempol treatments both significantly reduced the overexpression of NLRP3, https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=1617, IL‐1β, and TRPV1 proteins in ankle joint tissues of MSU‐injected mice (Figure 9d–g). These results suggest that the antioxidants attenuate NLRP3 inflammasome activation, IL‐1β production, and TRPV1 overexpression in ankle joint tissues of MSU‐injected mice, mimicking the actions of eucalyptol.

Figure 9.

Figure 9

Open in a new tab

Effects of the antioxidants NAC and Tempol on NLRP3 inflammasome activation, IL‐1β production, and TRPV1 overexpression in ankle joint tissues of MSU‐treated mice. (a–c) Summarized data showing the MDA content (a), SOD activity (b), and GSH‐Px activity (c) determined in mice ankle tissues 24 hr after MSU injection. (d–g) The protein expression of NLRP3 (d), caspase‐1 (e), IL‐1β (f), and TRPV1 (g) determined by western blotting in mice ankle tissues 24 hr after MSU injection. n = 6 mice per group. Upper panel displays the representative images of NLRP3, caspase‐1, IL‐1β, TRPV1, and β‐actin protein expression from Control, MSU + Veh, MSU + NAC, and MSU + Tempol groups. Lower panel illustrates the corresponding summarized data normalized to β‐actin. *P < .05, significantly different from Control group; # P < .05, significantly different from MSU + Veh group; one‐way ANOVA followed by Tukey's post hoc test

4. DISCUSSION

In the present study, we examined the anti‐inflammatory and analgesic effects of eucalyptol in a mouse model of MSU‐induced gout arthritis and compared its effects with indomethacin, the commonly used NSAIDs for gout treatment. We found that eucalyptol effectively reduced MSU‐induced mechanical allodynia, ankle oedema, and neutrophil infiltration in ankle joint tissues, with effectiveness similar to that of indomethacin. In vivo studies indicated that eucalyptol inhibited NLRP3 inflammasome activation as well as production of pro‐inflammatory cytokines, induced by MSU in ankle joint tissues. Furthermore, eucalyptol reduced oxidative stress induced by MSU in both RAW264.7 cells in vitro and in ankle joint tissues in vivo. MSU triggered the up‐regulation of TRPV1 in local ankle joint tissues and DRG neurons, which was significantly reduced by eucalyptol treatment. We further found that the in vivo effects of eucalyptol on ankle oedema, mechanical allodynia, NLRP3 inflammasome, IL‐1β, and TRPV1 expression were mimicked by treating MSU‐injected mice with antioxidants.

Eucalyptol has been shown to exert obvious anti‐inflammatory effects in several inflammatory conditions, including asthma, colitis, cigarette smoke‐induced acute lung inflammation, and influenza virus‐induced infection (Juergens, Stober, Schmidt‐Schilling, Kleuver, & Vetter, 1998; Kennedy‐Feitosa et al., 2016; Li et al., 2017; Santos et al., 2004). Eucalyptol also possesses analgesic effects in several pain conditions, including neuropathic orofacial pain and pain elicited by application of TRPA1 channel IL‐6, agonists to human skin (Melo Junior et al., 2017; Takaishi et al., 2012). Our recent work contributed to these efforts by identifying that eucalyptol produces anti‐inflammatory effects on LPS‐induced pulmonary inflammation and exerts analgesic effects on CFA‐induced mouse model of inflammatory pain as well as acetic acid‐induced visceral pain via interactions with the https://www.guidetopharmacology.org/GRAC/ObjectDisplayForward?objectId=500 (Caceres et al., 2017; Liu et al., 2013). Here, we found that eucalyptol effectively alleviates inflammation and pain in MSU‐induced mouse model of gout arthritis. So far there are no published reports of eucalyptol in the treatment of gout arthritis. Therefore, our work provides the first evidence showing the therapeutic effects of eucalyptol on gout arthritis.

MSU crystals trigger the activation of NLRP3 inflammasomes (Martinon et al., 2006). The NLRP3 inflammasome consists of a complex of proteins, including NLRP3/ASC/caspase‐1, which are responsible for the cleavage of pro‐IL‐1β into active IL‐1β. On one hand, IL‐1β promotes the recruitment of neutrophils at the sites of inflammation and induces gouty inflammation. On the other hand, IL‐1β sensitizes or directly activates nociceptors in peripheral sensory nerve system and cause intense pain (Binshtok et al., 2008; Safieh‐Garabedian, Poole, Allchorne, Winter, & Woolf, 1995). Blocking IL‐1β using neutralizing antibodies results in significant gout alleviation (Torres et al., 2009). Therefore, NLRP3 inflammasome activation plays a key role in the pathogenesis of MSU‐induced gout pain and inflammation. Our data demonstrate that eucalyptol significantly reduced the NLRP3, caspase‐1, and IL‐1β expression in ankle joint tissues of MSU‐induced gout arthritis mice. These results suggest that eucalyptol may alleviate MSU‐induced gout arthritis via inhibiting NLRP3 inflammasome activation.

We further investigated the mechanisms underlying NLRP3 inflammasome inhibition by eucalyptol. Evidence suggests that ROS generation activates NLRP3 inflammasome, whereas ROS scavengers block NLRP3 inflammasome activation (Sho & Xu, 2019; Zhou, Yazdi, Menu, & Tschopp, 2011). MSU induces NLRP3 activation via ROS‐dependent manner (Zhou, Tardivel, Thorens, Choi, & Tschopp, 2010). Here, we found that MSU induced a significant increase in ROS production in both macrophage cell line RAW264.7 cells in vitro and in ankle tissues in vivo. Eucalyptol has been reported to exert anti‐oxidative effects in several studies (Kennedy‐Feitosa et al., 2016; Lima et al., 2013). We found that eucalyptol reduced MSU‐induced ROS generation in RAW264.7 cells in vitro and exerted anti‐oxidative effects by reducing MDA generation, restoring SOD and GSH activities and up‐regulating Nrf2 expression in the inflamed ankle joint tissues in vivo. In order to understand whether reducing ROS could result in inhibition of NLRP3 inflammasome activation in gout condition, we studied the effects of two well‐established antioxidants, NAC and Tempol, in MSU‐injected mice. Recently, it is reported that antioxidants can attenuate NLRP3 inflammasome activation and IL‐1β production in the THP‐1 cell line challenged with MSU in vitro (Zhang et al., 2019). We found that both NAC and Tempol reduced the overproduction of MDA and restored the endogenous antioxidants in ankle joint tissues of MSU‐treated mice in vivo, to similar extents as eucalyptol. More importantly, NAC and Tempol reduced NLRP3 inflammasome activation, IL‐1β production, and TRPV1 channel overexpression in MSU‐injected mice, resembling the effects of eucalyptol. Thus, our data provide evidence supporting eucalyptol's anti‐oxidative effects on MSU‐induced gout arthritis and provide further in vivo evidence showing that eucalyptol may inhibit NLRP3 inflammasome activation via mechanisms involving anti‐oxidative effects.

We found that expression of TRPV1 channels was significantly up‐regulated in the joint tissue of MSU‐induced gout arthritis, which is consistent with previous report (Hoffmeister et al., 2014). TRPV1 channel antagonists reduce pain responses as well as joint swelling, plasma extravasation, leucocyte infiltration, and IL‐1β production in articular fluids of MSU‐induced gout arthritis (Hoffmeister et al., 2011, 2014). Desensitization of TRPV1‐positive sensory neurons significantly reduced MSU‐induced pain and joint oedema in gout arthritis, suggesting a crucial role of neuronal TRPV1 channels in mediating pain and inflammation in gout arthritis (Hoffmeister et al., 2011). It is well established that expression of TRPV1 channels can be up‐regulated by an array of pro‐inflammatory cytokines, including IL‐1β, IL‐6, and TNF‐α, which result in pain maintenance and exacerbation (Ebbinghaus et al., 2012; Fang et al., 2015; Moran & Szallasi, 2018; Schaible et al., 2010). Here, we found that IL‐1β, IL‐6, and TNF‐α expression are all increased in the ankle joint tissues of MSU‐treated mice, which may lead to TRPV1 up‐regulation observed in our study and others. Furthermore, we found that eucalyptol treatment significantly reduced the overexpression of IL‐1β, IL‐6, and TNF‐α in ankle joint tissues. Eliminating ROS by anti‐oxidative activity reduced NLRP3 inflammasome activation, resulting in less IL‐1β release. Therefore, these effects may result in attenuation of the expression of TRPV1 channels by eucalyptol in gouty conditions.

In conclusion, we have provided evidence showing that eucalyptol reduces MSU‐induced oxidative stress, NLRP3 inflammasome activation, pro‐inflammatory cytokine production, and TRPV1 overexpression. We further demonstrated that eucalyptol alleviates MSU‐induced pain and inflammation via mechanisms possibly involving its anti‐oxidative effect. Eucalyptol and other antioxidants may represent promising therapeutic options for gout arthritis management.

AUTHOR CONTRIBUTIONS

C.Y., Boyu L., P.W., X.L., Y.L., X.Z., and Y.T. completed the experiments and analysed the data. C.W. and Boyi L. designed and supervised the experiments and evaluated the results. C.Y. and Boyi L. wrote the manuscript.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14207, https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14206, and https://bpspubs.onlinelibrary.wiley.com/doi/full/10.1111/bph.14206, and as recommended by funding agencies, publishers and other organisations engaged with supporting research.

Supporting information

Supporting Info Item

Click here for additional data file. (1.2MB, tif)

Figure S1 Effects of anti‐oxidants NAC and Tempol on MSU‐induced inflammation and nocifensive response in mice. (A) Protocol showing the time schedule of NAC or Tempol application. (B) Time course of the effects of NAC and Tempol on ankle edema. n = 6 mice/group. (C) Normalized area under the curve (AUC) of panel (B). (D) Time course of the effects of NAC and Tempol on mechanical allodynia of the hind paw. n = 6 mice/group. (E) Normalized area under the curve (AUC) of panel (D). **p < 0.01 vs. Control group. # p < 0.05, ##p < 0.01 vs. MSU + Veh group. One‐way ANOVA followed by Tukeys post hoc test was used for statistical analysis

Click here for additional data file. (14.3KB, docx)

ACKNOWLEDGEMENTS

This project is supported by Zhejiang Provincial Natural Science Funds for Distinguished Young Scholars (LR17H270001), National Natural Science Foundation of China (81873365 and 81603676), and research funds from Zhejiang Chinese Medical University (Q2019J01, 2018ZY37, and 2018ZY19).

Yin C, Liu B, Wang P, et al. Eucalyptol alleviates inflammation and pain responses in a mouse model of gout arthritis. Br J Pharmacol. 2020;177:2042–2057. 10.1111/bph.14967

Chengyu Yin, Boyu Liu, and Ping Wang contributed equally to this work.

Contributor Information

Chuan Wang, Email: wangchuan@hebmu.edu.cn.

Boyi Liu, Email: boyi.liu@foxmail.com.

REFERENCES

  1. Abhishek, A. , Roddy, E. , & Doherty, M. (2017). Gout—A guide for the general and acute physicians. Clinical Medicine (London, England), 17, 54–59. 10.7861/clinmedicine.17-1-54 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Abu Bakar, F. I. , Abu Bakar, M. F. , Rahmat, A. , Abdullah, N. , Sabran, S. F. , & Endrini, S. (2018). Anti‐gout potential of Malaysian medicinal plants. Frontiers in Pharmacology, 9, 261 10.3389/fphar.2018.00261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Alexander, S. P. H. , Fabbro, D. , Kelly, E. , Mathie, A. , Peters, J. A. , Veale, E. L. , … Sharman, J. L. (2019a). The concise guide to pharmacology 2019/20: Catalytic receptors. British Journal of Pharmacology, 176(Suppl 1), S247–S296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Alexander, S. P. H. , Fabbro, D. , Kelly, E. , Mathie, A. , Peters, J. A. , Veale, E. L. , … Sharman, J. L. (2019b). The concise guide to pharmacology 2019/20: Enzymes. British Journal of Pharmacology, 176(Suppl 1), S297–S396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Alexander, S. P. H. , Mathie, A. , Peters, J. A. , Veale, E. L. , Striessnig, J. , Kelly, E. , … Sharman, J. L. (2019). The concise guide to pharmacology 2019/20: Ion channels. British Journal of Pharmacology, 176(Suppl 1), S142–S228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Alexander, S. P. H. , Roberts, R. E. , Broughton, B. R. S. , Sobey, C. G. , George, C. H. , Stanford, S. C. , … Ahluwalia, A. (2018). Goals and practicalities of immunoblotting and immunohistochemistry: A guide for submission to the British Journal of Pharmacology . British Journal of Pharmacology, 175, 407–411. 10.1111/bph.14112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Amaral, F. A. , Costa, V. V. , Tavares, L. D. , Sachs, D. , Coelho, F. M. , Fagundes, C. T. , … Teixeira, M. M. (2012). NLRP3 inflammasome‐mediated neutrophil recruitment and hypernociception depend on leukotriene B(4) in a murine model of gout. Arthritis and Rheumatism, 64, 474–484. 10.1002/art.33355 [DOI] [PubMed] [Google Scholar]
  8. Binshtok, A. M. , Wang, H. , Zimmermann, K. , Amaya, F. , Vardeh, D. , Shi, L. , … Samad, T. A. (2008). Nociceptors are interleukin‐1β sensors. The Journal of Neuroscience, 28, 14062–14073. 10.1523/JNEUROSCI.3795-08.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Busso, N. , & So, A. (2010). Mechanisms of inflammation in gout. Arthritis Research & Therapy, 12, 206 10.1186/ar2952 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Caceres, A. I. , Liu, B. , Jabba, S. V. , Achanta, S. , Morris, J. B. , & Jordt, S. E. (2017). Transient receptor potential cation channel subfamily M member 8 channels mediate the anti‐inflammatory effects of eucalyptol. British Journal of Pharmacology, 174, 867–879. 10.1111/bph.13760 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chai, W. , Tai, Y. , Shao, X. , Liang, Y. , Zheng, G. Q. , Wang, P. , … Liu, B. (2018). Electroacupuncture alleviates pain responses and inflammation in a rat model of acute gout arthritis. Evidence‐based Complementary and Alternative Medicine, 2018, 2598975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chaplan, S. R. , Bach, F. W. , Pogrel, J. W. , Chung, J. M. , & Yaksh, T. L. (1994). Quantitative assessment of tactile allodynia in the rat paw. Journal of Neuroscience Methods, 53, 55–63. 10.1016/0165-0270(94)90144-9 [DOI] [PubMed] [Google Scholar]
  13. Curtis, M. J. , Alexander, S. , Cirino, G. , Docherty, J. R. , George, C. H. , Giembycz, M. A. , … Ahluwalia, A. (2018). Experimental design and analysis and their reporting II: Updated and simplified guidance for authors and peer reviewers. British Journal of Pharmacology, 175, 987–993. 10.1111/bph.14153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dixon, W. J. (1980). Efficient analysis of experimental observations. Annual Review of Pharmacology and Toxicology, 20, 441–462. 10.1146/annurev.pa.20.040180.002301 [DOI] [PubMed] [Google Scholar]
  15. Ebbinghaus, M. , Uhlig, B. , Richter, F. , von Banchet, G. S. , Gajda, M. , Brauer, R. , & Schaible, H. G. (2012). The role of interleukin‐1β in arthritic pain: main involvement in thermal, but not mechanical, hyperalgesia in rat antigen‐induced arthritis. Arthritis and Rheumatism, 64, 3897–3907. 10.1002/art.34675 [DOI] [PubMed] [Google Scholar]
  16. Fang, D. , Kong, L. Y. , Cai, J. , Li, S. , Liu, X. D. , Han, J. S. , & Xing, G. G. (2015). Interleukin‐6‐mediated functional upregulation of TRPV1 receptors in dorsal root ganglion neurons through the activation of JAK/PI3K signaling pathway: Roles in the development of bone cancer pain in a rat model. Pain, 156, 1124–1144. 10.1097/j.pain.0000000000000158 [DOI] [PubMed] [Google Scholar]
  17. Harding, S. D. , Sharman, J. L. , Faccenda, E. , Southan, C. , Pawson, A. J. , Ireland, S. , … NC‐IUPHAR (2018). The IUPHAR/BPS guide to pharmacology in 2018: Updates and expansion to encompass the new guide to immunopharmacology. Nucleic Acids Research, 46, D1091–D1106. 10.1093/nar/gkx1121 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hoffmeister, C. , Silva, M. A. , Rossato, M. F. , Trevisan, G. , Oliveira, S. M. , Guerra, G. P. , … Ferreira, J. (2014). Participation of the TRPV1 receptor in the development of acute gout attacks. Rheumatology (Oxford), 53, 240–249. 10.1093/rheumatology/ket352 [DOI] [PubMed] [Google Scholar]
  19. Hoffmeister, C. , Trevisan, G. , Rossato, M. F. , de Oliveira, S. M. , Gomez, M. V. , & Ferreira, J. (2011). Role of TRPV1 in nociception and edema induced by monosodium urate crystals in rats. Pain, 152, 1777–1788. 10.1016/j.pain.2011.03.025 [DOI] [PubMed] [Google Scholar]
  20. Hu, Q. , Wang, Q. , Wang, C. , Tai, Y. , Liu, B. , Shao, X. , … Liu, B. (2019). TRPV1 channel contributes to the behavioral hypersensitivity in a rat model of complex regional pain syndrome type 1. Frontiers in Pharmacology, 10, 453 10.3389/fphar.2019.00453 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Insuela, D. B. R. , Azevedo, C. T. , Coutinho, D. S. , Magalhaes, N. S. , Ferrero, M. R. , Ferreira, T. P. T. , … Silva, P. M. (2019). Glucagon reduces airway hyperreactivity, inflammation, and remodeling induced by ovalbumin. Scientific Reports, 9, 6478 10.1038/s41598-019-42981-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Juergens, U. R. (2014). Anti‐inflammatory properties of the monoterpene 1.8‐cineole: Current evidence for co‐medication in inflammatory airway diseases. Drug Research (Stuttg), 64, 638–646. 10.1055/s-0034-1372609 [DOI] [PubMed] [Google Scholar]
  23. Juergens, U. R. , Stober, M. , Schmidt‐Schilling, L. , Kleuver, T. , & Vetter, H. (1998). Antiinflammatory effects of euclyptol (1.8‐cineole) in bronchial asthma: Inhibition of arachidonic acid metabolism in human blood monocytes ex vivo. European Journal of Medical Research, 3, 407–412. [PubMed] [Google Scholar]
  24. Kennedy‐Feitosa, E. , Okuro, R. T. , Pinho Ribeiro, V. , Lanzetti, M. , Barroso, M. V. , Zin, W. A. , … Valenca, S. S. (2016). Eucalyptol attenuates cigarette smoke‐induced acute lung inflammation and oxidative stress in the mouse. Pulmonary Pharmacology & Therapeutics, 41, 11–18. 10.1016/j.pupt.2016.09.004 [DOI] [PubMed] [Google Scholar]
  25. Kilkenny, C. , Browne, W. , Cuthill, I. C. , Emerson, M. , Altman, D. G. , & Group NCRRGW (2010). Animal research: Reporting in vivo experiments: The ARRIVE guidelines. British Journal of Pharmacology, 160, 1577–1579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kim, K. Y. , Lee, H. S. , & Seol, G. H. (2015). Eucalyptol suppresses matrix metalloproteinase‐9 expression through an extracellular signal‐regulated kinase‐dependent nuclear factor‐κB pathway to exert anti‐inflammatory effects in an acute lung inflammation model. The Journal of Pharmacy and Pharmacology, 67, 1066–1074. 10.1111/jphp.12407 [DOI] [PubMed] [Google Scholar]
  27. Li, Y. , Lai, Y. , Wang, Y. , Liu, N. , Zhang, F. , & Xu, P. (2016). 1,8‐Cineol protect against influenza‐virus‐induced pneumonia in mice. Inflammation, 39, 1582–1593. 10.1007/s10753-016-0394-3 [DOI] [PubMed] [Google Scholar]
  28. Li, Y. , Xu, Y. L. , Lai, Y. N. , Liao, S. H. , Liu, N. , & Xu, P. P. (2017). Intranasal co‐administration of 1,8‐cineole with influenza vaccine provide cross‐protection against influenza virus infection. Phytomedicine, 34, 127–135. 10.1016/j.phymed.2017.08.014 [DOI] [PubMed] [Google Scholar]
  29. Lima, P. R. , de Melo, T. S. , Carvalho, K. M. , de Oliveira, I. B. , Arruda, B. R. , de Castro Brito, G. A. , … Santos, F. A. (2013). 1,8‐cineole (eucalyptol) ameliorates cerulein‐induced acute pancreatitis via modulation of cytokines, oxidative stress and NF‐κB activity in mice. Life Sciences, 92, 1195–1201. 10.1016/j.lfs.2013.05.009 [DOI] [PubMed] [Google Scholar]
  30. Liu, B. , Fan, L. , Balakrishna, S. , Sui, A. , Morris, J. B. , & Jordt, S. E. (2013). TRPM8 is the principal mediator of menthol‐induced analgesia of acute and inflammatory pain. Pain, 154, 2169–2177. 10.1016/j.pain.2013.06.043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Liu, B. , & Jordt, S. E. (2018). Cooling the itch via TRPM8. The Journal of Investigative Dermatology, 138, 1254–1256. 10.1016/j.jid.2018.01.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Liu, B. , Tai, Y. , Liu, B. , Caceres, A. I. , Yin, C. , & Jordt, S. E. (2019). Transcriptome profiling reveals Th2 bias and identifies endogenous itch mediators in poison ivy contact dermatitis. JCI Insight, 4, e124497 10.1172/jci.insight.124497 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Loboda, A. , Damulewicz, M. , Pyza, E. , Jozkowicz, A. , & Dulak, J. (2016). Role of Nrf2/HO‐1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cellular and Molecular Life Sciences, 73, 3221–3247. 10.1007/s00018-016-2223-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Luo, J. F. , Shen, X. Y. , Lio, C. K. , Dai, Y. , Cheng, C. S. , Liu, J. X. , … Zhou, H. (2018). Activation of Nrf2/HO‐1 pathway by nardochinoid C inhibits inflammation and oxidative stress in lipopolysaccharide‐stimulated macrophages. Frontiers in Pharmacology, 9, 911 10.3389/fphar.2018.00911 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Martinon, F. , Petrilli, V. , Mayor, A. , Tardivel, A. , & Tschopp, J. (2006). Gout‐associated uric acid crystals activate the NALP3 inflammasome. Nature, 440, 237–241. 10.1038/nature04516 [DOI] [PubMed] [Google Scholar]
  36. McGrath, J. C. , & Lilley, E. (2015). Implementing guidelines on reporting research using animals (ARRIVE etc.): New requirements for publication in BJP. British Journal of Pharmacology, 172, 3189–3193. 10.1111/bph.12955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Melo Junior, J. M. , Damasceno, M. B. , Santos, S. A. , Barbosa, T. M. , Araujo, J. R. , Vieira‐Neto, A. E. , … Campos, A. R. (2017). Acute and neuropathic orofacial antinociceptive effect of eucalyptol. Inflammopharmacology, 25, 247–254. 10.1007/s10787-017-0324-5 [DOI] [PubMed] [Google Scholar]
  38. Moran, M. M. , & Szallasi, A. (2018). Targeting nociceptive transient receptor potential channels to treat chronic pain: Current state of the field. British Journal of Pharmacology, 175, 2185–2203. 10.1111/bph.14044 [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Popa‐Nita, O. , & Naccache, P. H. (2010). Crystal‐induced neutrophil activation. Immunology and Cell Biology, 88, 32–40. 10.1038/icb.2009.98 [DOI] [PubMed] [Google Scholar]
  40. Rees, F. , Hui, M. , & Doherty, M. (2014). Optimizing current treatment of gout. Nature Reviews Rheumatology, 10, 271–283. 10.1038/nrrheum.2014.32 [DOI] [PubMed] [Google Scholar]
  41. Roddy, E. , & Doherty, M. (2010). Epidemiology of gout. Arthritis Research & Therapy, 12, 223 10.1186/ar3199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Rossaneis, A. C. , Longhi‐Balbinot, D. T. , Bertozzi, M. M. , Fattori, V. , Segato‐Vendrameto, C. Z. , Badaro‐Garcia, S. , … Verri, W. A. Jr. (2019). [Ru (bpy)2(NO)SO3](PF6), a nitric oxide donating ruthenium complex, reduces gout arthritis in mice. Frontiers in Pharmacology, 10, 229 10.3389/fphar.2019.00229 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Ryckman, C. , McColl, S. R. , Vandal, K. , de Medicis, R. , Lussier, A. , Poubelle, P. E. , & Tessier, P. A. (2003). Role of S100A8 and S100A9 in neutrophil recruitment in response to monosodium urate monohydrate crystals in the air‐pouch model of acute gouty arthritis. Arthritis and Rheumatism, 48, 2310–2320. 10.1002/art.11079 [DOI] [PubMed] [Google Scholar]
  44. Safieh‐Garabedian, B. , Poole, S. , Allchorne, A. , Winter, J. , & Woolf, C. J. (1995). Contribution of interleukin‐1β to the inflammation‐induced increase in nerve growth factor levels and inflammatory hyperalgesia. British Journal of Pharmacology, 115, 1265–1275. 10.1111/j.1476-5381.1995.tb15035.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Santos, F. A. , Silva, R. M. , Campos, A. R. , De Araujo, R. P. , Lima Junior, R. C. , & Rao, V. S. (2004). 1,8‐cineole (eucalyptol), a monoterpene oxide attenuates the colonic damage in rats on acute TNBS‐colitis. Food and Chemical Toxicology, 42, 579–584. 10.1016/j.fct.2003.11.001 [DOI] [PubMed] [Google Scholar]
  46. Schaible, H. G. , von Banchet, G. S. , Boettger, M. K. , Brauer, R. , Gajda, M. , Richter, F. , … Natura, G. (2010). The role of proinflammatory cytokines in the generation and maintenance of joint pain. Annals of the New York Academy of Sciences, 1193, 60–69. 10.1111/j.1749-6632.2009.05301.x [DOI] [PubMed] [Google Scholar]
  47. Seol, G. H. , & Kim, K. Y. (2016). Eucalyptol and its role in chronic diseases. Advances in Experimental Medicine and Biology, 929, 389–398. 10.1007/978-3-319-41342-6_18 [DOI] [PubMed] [Google Scholar]
  48. Sharma, A. , Tate, M. , Mathew, G. , Vince, J. E. , Ritchie, R. H. , & de Haan, J. B. (2018). Oxidative stress and NLRP3‐inflammasome activity as significant drivers of diabetic cardiovascular complications: Therapeutic implications. Frontiers in Physiology, 9, 114 10.3389/fphys.2018.00114 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Sho, T. , & Xu, J. (2019). Role and mechanism of ROS scavengers in alleviating NLRP3‐mediated inflammation. Biotechnology and Applied Biochemistry, 66, 4–13. 10.1002/bab.1700 [DOI] [PubMed] [Google Scholar]
  50. Staurengo‐Ferrari, L. , Ruiz‐Miyazawa, K. W. , Pinho‐Ribeiro, F. A. , Fattori, V. , Zaninelli, T. H. , Badaro‐Garcia, S. , … Verri, W. A. Jr. (2018). Trans‐chalcone attenuates pain and inflammation in experimental acute gout arthritis in mice. Frontiers in Pharmacology, 9, 1123 10.3389/fphar.2018.01123 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Takaishi, M. , Fujita, F. , Uchida, K. , Yamamoto, S. , Sawada, S. M. , Hatai, U. C. , … Tominaga, M. (2012). 1,8‐cineole, a TRPM8 agonist, is a novel natural antagonist of human TRPA1. Molecular Pain, 8, 86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Terkeltaub, R. (2010). Update on gout: New therapeutic strategies and options. Nature Reviews Rheumatology, 6, 30–38. 10.1038/nrrheum.2009.236 [DOI] [PubMed] [Google Scholar]
  53. Terkeltaub, R. A. (2003). Clinical practice. Gout. The New England Journal of Medicine, 349, 1647–1655. 10.1056/NEJMcp030733 [DOI] [PubMed] [Google Scholar]
  54. Torres, R. , Macdonald, L. , Croll, S. D. , Reinhardt, J. , Dore, A. , Stevens, S. , … Murphy, A. J. (2009). Hyperalgesia, synovitis and multiple biomarkers of inflammation are suppressed by interleukin 1 inhibition in a novel animal model of gouty arthritis. Annals of the Rheumatic Diseases, 68, 1602–1608. 10.1136/ard.2009.109355 [DOI] [PubMed] [Google Scholar]
  55. Trevisan, G. , Hoffmeister, C. , Rossato, M. F. , Oliveira, S. M. , Silva, M. A. , Ineu, R. P. , … Ferreira, J. (2013). Transient receptor potential ankyrin 1 receptor stimulation by hydrogen peroxide is critical to trigger pain during monosodium urate‐induced inflammation in rodents. Arthritis and Rheumatism, 65, 2984–2995. 10.1002/art.38112 [DOI] [PubMed] [Google Scholar]
  56. Trevisan, G. , Hoffmeister, C. , Rossato, M. F. , Oliveira, S. M. , Silva, M. A. , Silva, C. R. , … Ferreira, J. (2014). TRPA1 receptor stimulation by hydrogen peroxide is critical to trigger hyperalgesia and inflammation in a model of acute gout. Free Radical Biology & Medicine, 72, 200–209. 10.1016/j.freeradbiomed.2014.04.021 [DOI] [PubMed] [Google Scholar]
  57. Wrotek, S. , Jedrzejewski, T. , Piotrowski, J. , & Kozak, W. (2016). N‐Acetyl‐l‐cysteine exacerbates generation of IL‐10 in cells stimulated with endotoxin in vitro and produces antipyresis via IL‐10 dependent pathway in vivo. Immunology Letters, 177, 1–5. 10.1016/j.imlet.2016.06.005 [DOI] [PubMed] [Google Scholar]
  58. Yin, C. , Hu, Q. , Liu, B. , Tai, Y. , Zheng, X. , Li, Y. , … Liu, B. (2019). Transcriptome profiling of dorsal root ganglia in a rat model of complex regional pain syndrome type‐I reveals potential mechanisms involved in pain. Journal of Pain Research, 12, 1201–1216. 10.2147/JPR.S188758 [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Yuan, G. J. , Ma, J. C. , Gong, Z. J. , Sun, X. M. , Zheng, S. H. , & Li, X. (2005). Modulation of liver oxidant‐antioxidant system by ischemic preconditioning during ischemia/reperfusion injury in rats. World Journal of Gastroenterology, 11, 1825–1828. 10.3748/wjg.v11.i12.1825 [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zhang, Y. , Liu, L. , Sun, D. , He, Y. , Jiang, Y. , Cheng, K. W. , & Chen, F. (2019). DHA protects against monosodium urate‐induced inflammation through modulation of oxidative stress. Food & Function, 10, 4010–4021. 10.1039/c9fo00573k [DOI] [PubMed] [Google Scholar]
  61. Zhou, R. , Tardivel, A. , Thorens, B. , Choi, I. , & Tschopp, J. (2010). Thioredoxin‐interacting protein links oxidative stress to inflammasome activation. Nature Immunology, 11, 136–140. 10.1038/ni.1831 [DOI] [PubMed] [Google Scholar]
  62. Zhou, R. , Yazdi, A. S. , Menu, P. , & Tschopp, J. (2011). A role for mitochondria in NLRP3 inflammasome activation. Nature, 469, 221–225. 10.1038/nature09663 [DOI] [PubMed] [Google Scholar]
  63. Zhou, Y. Q. , Liu, D. Q. , Chen, S. P. , Sun, J. , Zhou, X. R. , Rittner, H. , … Ye, D. W. (2018). Reactive oxygen species scavengers ameliorate mechanical allodynia in a rat model of cancer‐induced bone pain. Redox Biology, 14, 391–397. 10.1016/j.redox.2017.10.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Info Item

Click here for additional data file. (1.2MB, tif)

Figure S1 Effects of anti‐oxidants NAC and Tempol on MSU‐induced inflammation and nocifensive response in mice. (A) Protocol showing the time schedule of NAC or Tempol application. (B) Time course of the effects of NAC and Tempol on ankle edema. n = 6 mice/group. (C) Normalized area under the curve (AUC) of panel (B). (D) Time course of the effects of NAC and Tempol on mechanical allodynia of the hind paw. n = 6 mice/group. (E) Normalized area under the curve (AUC) of panel (D). **p < 0.01 vs. Control group. # p < 0.05, ##p < 0.01 vs. MSU + Veh group. One‐way ANOVA followed by Tukeys post hoc test was used for statistical analysis

Click here for additional data file. (14.3KB, docx)

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES