Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2020 Apr 17;14(4):e0008154. doi: 10.1371/journal.pntd.0008154

Evidence for both sequential mutations and recombination in the evolution of kdr alleles in Aedes aegypti

Yinjun Fan 1, Patrick O'Grady 1, Melissa Yoshimizu 2, Alongkot Ponlawat 3, Phillip E Kaufman 4, Jeffrey G Scott 1,*
Editor: Sujatha Sunil5
PMCID: PMC7164583  PMID: 32302303

Abstract

Background

Aedes aegypti is a globally distributed vector of human diseases including dengue, yellow fever, chikungunya, and Zika. Pyrethroid insecticides are the primary means of controlling adult A. aegypti populations to suppress arbovirus outbreaks, but resistance to pyrethroid insecticides has become a global problem. Mutations in the voltage-sensitive sodium channel (Vssc) gene are a major mechanism of pyrethroid resistance in A. aegypti. Vssc resistance alleles in A. aegypti commonly have more than one mutation. However, our understanding of the evolutionary dynamics of how alleles with multiple mutations arose is poorly understood.

Methodology/Principal findings

We examined the geographic distribution and association between the common Vssc mutations (V410L, S989P, V1016G/I and F1534C) in A. aegypti by analyzing the relevant Vssc fragments in 25 collections, mainly from Asia and the Americas. Our results showed all 11 Asian populations had two types of resistance alleles: 1534C and 989P+1016G. The 1534C allele was more common with frequencies ranging from 0.31 to 0.88, while the 989P+1016G frequency ranged from 0.13 to 0.50. Four distinct alleles (410L, 1534C, 410L+1534C and 410L+1016I+1534C) were detected in populations from the Americas. The most common was 410L+1016I+1534C with frequencies ranging from 0.50 to 1.00, followed by 1534C with frequencies ranging from 0.13 to 0.50. Our phylogenetic analysis of Vssc supported multiple independent origins of the F1534C mutation. Our results indicated the 410L+1534C allele may have arisen by addition of the V410L mutation to the 1534C allele, or by a crossover event. The 410L+1016I+1534C allele was the result of one or two mutational steps from a 1534C background.

Conclusions/Significance

Our data corroborated previous geographic distributions of resistance mutations and provided evidence for both recombination and sequential accumulation of mutations contributing to the molecular evolution of resistance alleles in A. aegypti.

Author summary

Mutations in the voltage-sensitive sodium channel (Vssc) gene in Aedes aegypti can confer resistance to insecticides and threaten vector control programs. To date, twelve Vssc mutations have been identified in pyrethroid resistant A. aegypti populations, and F1534C, V1016G/I, S989P and V410L commonly are found alone or in combination. However, the evolutionary dynamics of how alleles came to have multiple mutations is less known. In this study, we found 1534C and 989P+1016G alleles were widely distributed in Asian populations. In contrast, the distinct 410L, 410L+1534C, 410L+1016I+1534C and 1534C alleles were distributed in populations from the Americas. The 410L+1534C allele appears to have arisen by accumulation of the 410L mutation in an individual already having the 1534C allele or by a crossover event. The 410L+1016I+1534C arose by additional mutations from 1534C background. Our data corroborates previous geographic distributions of resistance mutations and provides evidence for both recombination and sequential accumulation of mutations contributing to the molecular evolution of resistance mutations in A. aegypti.

Introduction

Aedes aegypti is a vector of four important human disease viruses: dengue, yellow fever, chikungunya, and Zika [1]. Pyrethroids are the most common class of insecticides used to control adult A. aegypti. The decades-long intensive use of pyrethroid insecticides has resulted in the evolution of resistance in A. aegypti across the globe [2]. The voltage-sensitive sodium channel (VSSC) is the target site of pyrethroid insecticides, and mutations in Vssc are a major mechanism of pyrethroid resistance [3,4]. These resistance conferring mutations are collectively known as knockdown resistance (kdr).

To date, twelve Vssc mutations have been identified in pyrethroid resistant A. aegypti populations (Table 1). The G923V+I1011M, L982W, I1011M and V1016G mutations were first identified in 2003 [5]. I1011V and V1016I were identified in 2007 [6]. V1016G+D1763Y was identified in 2009 [7]. S989P+V1016G and F1534C were identified in 2010 [8,9]. V1016G+F1534C and S989P+V1016G+F1534C were identified in 2014 [10]. T1520I+F1534C was identified in 2015 [11]. V410L+F1534C was identified in 2017 [12]. V410L, V410L+F1534C, V410L+V1016I and V410L+V1016I+F1534C were identified in 2018 [13,14]. V1011M+V1016G was identified in 2019 [15]. Amino acid positions of these mutations are numbered based on the house fly VSSC (Genbank accession number: AAB47604). Of the known kdr mutations, F1534C, V1016G/I, S989P and V410L are common (Table 1). The F1534C mutation has been found in 58 out of 89 studies of pyrethroid resistant A. aegypti populations globally, while S989P (13 of 49 detections), V1016G (29 of 58 detections) and V1016I (33 of 89 detections) vary geographically [2,16,17]. To date, S989P has been found only in Asia [2,18,19]. V1016G mutations have been found in Asia [2,18,19] and the Americas [15]. In contrast, the V1016I mutation has been detected only in the Americas, Europe and Africa [2,16,17,20]. In 2017, the V410L mutation was first found in A. aegypti from Brazil [12]. Subsequently, the V410L mutation was detected in Colombian and Mexican populations [13,14]. Given the history of the discovery of the different mutations, several studies have only reported on a subset of the mutations that are now known, giving an incomplete picture of the distribution of each mutation and of the alleles present (Table 1). For example, several studies have focused on the V1016I mutation, without considering the V410L and F1534C mutations [6,2123], even though the V410L+V1016I+F1534C allele can be common [13,14]. Such an incomplete listing of mutations makes understanding the evolution of resistance alleles particularly challenging [4].

Table 1. Vssc mutations detected in pyrethroid resistant A. aegypti populations.

Allele Mutation* Continents Country Reference
V410L G923V L982W S989P I1011M I1011V V1016I V1016G T1520I F1534C D1763Y
V410L + - - America Colombia [13]
+ - - Mexico [14]
L982W - + - - - - - Asia Vietnam [5]
I1011V - + - - America Multiple Latin American [6]
- + - - Asia Thailand [59]
I1011M - - + - - - America Brazil [55]
V1016I
- - + - America Multiple Latin American [6]
+ Colombia [21]
+ - Colombia [45]
+ Mexico [22]
+ - Mexico [58,60]
- + - Mexico [14]
+ - Grand Cayman [61]
+ - Brazil [6264]
+ - Venezuela [65]
- - - - + - USA [23]
+ - USA [44]
+ - Colombian Caribbean [66]
V1016G - - - - - - + Asia Thailand [5]
- - - - - - + Indonesia [5]
- + - Indonesia [67]
+ - Indonesia [19]
- - - + - Vietnam [68]
- - - - + - Malaysia [69]
- + Malaysia [70]
- - - + - - Singapore [71]
- - - - + - - Taiwan, China [17,56]
- - - - + - India [72]
F1534C - - - - + Asia Vietnam [68]
- - - - - - - - - + Thailand [9]
- - - - - + - Singapore [36]
- - - - - - - Singapore [71]
- - - - - + Myanmar [10]
- - + Indonesia [67]
- + Indonesia [19]
- - - - - + Indonesia [73]
- - - - - + Malaysia [69]
- - + Malaysia [38]
+ India [74]
- - - - - + India [72]
- - + China [75]
- - - - - + - Taiwan, China [17,56]
- + America Venezuela [65]
- - - - - - - - - + - Brazil [12]
- + Brazil [6264]
- + Mexico [58,60,76]
- - + Mexico [14]
- + Jamaica [77]
- - + Colombia [13]
- + Colombia [45]
- + Puerto Rico [46]
- + USA [44]
- - + - USA [78]
- + Colombian Caribbean [66]
- - - - - + Africa Ghana [17]
- + Burkina Faso [20]
- - - + Burkina Faso [79]
- + Europe Madeira Island [16]
V410L+V1016I + + - America Colombia [13]
+ + - Mexico [14]
V410L+F1534C + - - - - - - - - + - America Brazil [12]
+ - + Colombia [13]
+ - + Mexico [14]
V410L+V1016I+F1534C + + + America Colombia [13]
+ + + Mexico [14]
G923V+I1011M + - - + - - - America French Guyana [5]
+ - - + - - - Brazil [5,55]
+ - - + - - - Martinique [5]
S989P+V1016G - - + - - - + Asia Thailand [8,80]
- - - + - - - + - - - Singapore [36]
+ - - - + - Myanmar [10]
+ + - China [75]
+ - - - + - - Taiwan, China [17,56]
+ + - Indonesia [67]
+ - - - + - Saudi Arabia [18]
+ + - Sri Lanka [81]
+ + Malaysia [70]
+ + - Malaysia [38]
S989P+V1016G+F1534C + - - - + + Asia Myanmar [10]
+ - - - + + Saudi Arabia [18]
+ + + Malaysia [38]
V1011M+V1016G - + - - + - America Panama [15]
V1016I+F1534C + + America Grand Cayman [61]
- - + - + Brazil [82]
+ + Brazil [6264]
+ + Venezuela [65]
+ + Mexico [58,60,76]
- + + Mexico [14]
+ + Mexico [58]
+ + Jamaica [77]
- + + Colombia [13]
+ + Colombia [45]
+ + Puerto Rico [46]
+ + USA [44]
+ + Colombian Caribbean [66]
- - - + - + Africa Ghana [17]
+ + Burkina Faso [20]
- + - + Burkina Faso [79]
+ + Europe Madeira Island [16]
V1016G+F1534C - - - + + - Asia Singapore [71]
- - - - + + Myanmar [10]
- - - - + + India [72]
V1016G+D1763Y - - - - - - - + - - + Asia Taiwan, China [7]
- - - - + - + Taiwan, China [17,56]
T1520I+F1534C + + Asia India [11]
Total^ 9/18 3/12 1/14 13/49 5/44 2/43 33/89 29/58 1/6 58/89 2/13

*A1007G mutation [47] was not included owing to the unclear role of this allele.

+ indicates the mutation was found.

- indicates the mutation was investigated, but it did not exist.

A black box indicates the mutation was not investigated.

^ The number of studies that found the mutation/the number of studies that examined the mutation.

Different studies have attempted to reconstruct the evolution of kdr alleles in A. aegypti. Saavedra-Rodriguez et al [14] examined three mutations (V410L, V1016I and F1534C) in populations of A. aegypti collected in Mexico from 2002 to 2012 and proposed that each arose independently and the 410L+1016I+1534C allele arose by two subsequent recombination events. A recent paper [4] proposed sequential evolution of the 989P+1016G+1534C allele, in which the 1016G allele was selected first, followed by 989P +1016G, and finally 989P+1016G+1534C. The 989P+1016G+1534C allele may have arisen from a crossing-over event [24], although sequential accumulation of mutations may also have played a role. The goal of the current study is to improve the understanding of how multiple mutations in Vssc have arisen and evolved. We examined nine Vssc mutations (V410L, L982W, S989P, A1007G, I1011V/M, V1016G/I and F1534C) and pattern types (see Materials and methods) of individuals from various geographical areas to investigate whether or not Vssc alleles with multiple mutations occur by (a) sequential accumulation of individual mutations, (b) by recombination between individual alleles or (c) some combination of the two mechanisms. Our results indicate the 410L+1534C allele could have evolved by both recombination and by addition of a second mutation to an existing resistance allele. This information will help to inform the evolution of kdr resistance in this important vector of human diseases.

Materials and methods

Rationale

Vssc in A. aegypti is >450 kb in length and contains >30 exons [25]. To investigate the evolution of kdr mutations in Vssc, we needed to explore the three regions containing mutations (V410L, S989P ± V1016G/I and F1534C) that are common in A. aegypti (Table 1). In addition, we wanted to capture sequence information near the 5′ and 3′ ends of Vssc to maximize the chances of detecting recombination events. We selected exons 6–8 and 31–32 for this purpose because their introns/exons were of a size appropriate for reliable PCR amplification and sequencing. Preliminary PCR and sequencing in the V410L or F1534C regions showed very limited sequence diversity (based on sequencing PCR products of about 1000 bp), beyond the presence or absence of the resistance mutations. Thus, for these regions we simply identified the presence or absence of the resistance mutation by allele-specific PCR (ASPCR) (see below). The L982W, S989P, A1007G, I1011M/V and V1016G/I mutations were investigated by sequencing a PCR product spanning exons 20–21. Thus, for each individual mosquito we sequenced three regions of Vssc (exon 6–8, exon 20–21 and exon 31–32) and genotyped for V410L and F1534C by ASPCR, giving us data across Vssc and providing details about which of the known resistance mutations were present (Fig 1).

Fig 1. Diagram of A. aegypti Vssc.

Fig 1

Regions that were sequenced are shown as boxes. Two mutations determined by ASPCR are shown as black stars. Stars indicate positions of five kdr mutations that may confer resistance. Diagram is not to scale. The L982W, A1007G and I1011M/V mutations (in the E20-21 region) are not shown as they were not found in any mosquitoes we tested.

A. aegypti collections

We evaluated the Vssc sequences of 25 populations of A. aegypti. Eleven of these were from Asia, thirteen were from the Americas and one was from Africa. Our goal was to identify the most common Vssc alleles in each population. At least eight individuals from each population were used, except for California populations (LA, SD, TE and MD) in which four individuals were used. The Costa Rica and Puerto Rico strains were provided by BEI Resources (https://www.beiresources.org/Home.aspx). Details about populations were shown in Table 2. Mosquitoes were reared at 27°C (± 1°C) with 70–80% relative humidity, and a photoperiod of 14 L:10 D. Females were blood fed using membrane-covered water-jacketed glass feeders with cow blood (Owasco Meat Co., Moravia, NY).

Table 2. Locations where A. aegypti were collected.

Name Location Field/lab Collection Date Reference
LVP Africa: Sierra Leone Lab Between 1935 and 1938 [83]
SP and SP0 Asia: Singapore Field 2009 [24]
NSK Asia: Nakhon Ratchasima, Samutprakarn, Thailand Lab/Field Between 2006 and 2017 This paper
BKK Asia: Bangkok, Thailandd Field 2018 This paper
UBN Asia: Ubon Ratchathani, Thailandd Field 2018 This paper
SNI Asia: Suratthani, Thailandd Field 2018 This paper
CMI Asia: Chiang Mai, Thailandd Field 2018 This paper
KPP Asia: Kamphaeng Phet, Thailandd Field 2018 This paper
HN Asia: Hainan, Chinaf Field 2017 This paper
DZ Asia: Danzhou, Chinaf Field 2017 This paper
RL Asia: Ruili, Chinaf Field 2017 This paper
XSBN Asia: Xishuangbanna, Chinaf Field 2017 This paper
SMK North America: USA Lab before 1993 [24]
OL North America: Orlando, Florida, USA Lab 1952 This paper
AT North America: Augustine, Florida, USAc Field 2016 This paper
LA North America: Los Angeles, California, USAa Field 2017 This paper
SD North America: San Diego, California, USAb Field 2017 This paper
TE North America: Tulare, California, USAa Field 2017 This paper
MD North America: Merced, California, USAa Field 2017 This paper
NO North America: New Orleans, USA Lab ~1990 [84]
RK South America: Cuba Lab unknown [83]
MN South America: Acacias, Meta, Colombiae Field 2017 This paper
LM South America: La Mesa, Colombia Lab 2016 This paper
PR South America: San Juan, Puerto Rico Lab 2012 This paper
CR South America: Puntarenas, Costa Rica Lab 2001 [85]

aAdult females were collected and tested.

bAdult males were collected and tested.

cRandom sample from collection of ~1500 eggs.

dLarvae and pupae (~300–500 total per site) were collected from water storage containers inside and around houses. Emerging A. aegypti adults were placed in cages (30 x 30 x 30 cm) and raised under laboratory conditions. The 1st generation offspring were used in this study.

eThe second generation from a collection of >300 eggs.

fLarvae (15–32 per site) were collected. Emerging A. aegypti adults were placed in cages and raised under laboratory conditions. The 1st generation offspring were used in this study.

DNA extraction

Genomic DNA was isolated from three legs of individual mosquitoes from each population using an alkali extraction method as follows. The legs were placed in individual wells of a 96-well PCR plate (BioRad, Hercules, CA, USA) containing three 2.3-mm diameter zirconia/silica beads (BioSpec Products, Bartlesville, OK, USA) and 10 μL 0.2 M NaOH. The samples were homogenized on a vortex mixer for 2 min and then incubated at 70°C for 10 min. Then 10 μL of neutralization buffer (360 mM Tris-HCl, pH 7.5 and 10 mM EDTA) and 80 μl of ddH2O were added to each well.

Genotyping

PCR was carried out using 1 μL gDNA, 12.5 μL GoTaq Green Master Mix 2x (Promega, Madison, WI, USA), 9.5 μL ddH2O, and 2 μL of 10 μM forward and reverse primer mix. The primers and thermocycler conditions are shown in Table 3. The genotypes for Vssc exons 6–8, 20–21 and 31–32 were obtained by Sanger sequencing. PCR products were treated with ExoSAP (5 μL PCR product/1 μL of 1 u/μL ExoSAP mix), and sequenced (6 μL ExoSAP treated PCR product, 1 μL primer, 11 μL ddH2O) at the Cornell University Biotechnology Resource Center. PCR products with ambiguous sequences were cloned using the pGEM-T Vector System (Promega). Positive colonies were confirmed to have the expected size insert by PCR with primers T7 and SP6 designed from the plasmid sequence, and the PCR products were directly sequenced using the primer T7. Sequences were confirmed by analyzing two or more clones.

Table 3. Vssc primers used for genotyping individual A. aegypti.

Region/Mutation Primer Sequence Purpose
E6-8a
522 bp
E6-F GGGTAATCTCGCTGCATTGAG PCR amplification and sequencing
E8-R ACCCGACGAGTTCCCACAAAGAG PCR amplification
E20-21a
614 bp
E20-F GACAATGTGGATCGCTTCCC PCR amplification
E21-R GCAATCTGGCTTGTTAACTTG PCR amplification and sequencing
E31-32b
1128 bp
E31-F CTCGTTCTTAGCGATCTCATCG PCR amplification
E32-R CAGACATCCGCCGATCGTGAAG PCR amplification
E31-F1 CAAGAGCGGGCTGGACGATGTG sequencing
V410La AaSCF9 TATCTGCCTTTCGTCTAATGACCC PCR amplification
AaSCR10 TTCCTCGGCGGCCTCTTC PCR amplification
410com-F TATCTGCCTTTCGTCTAATGACCC Allele-specific common primer
V410-R GACAATGGCCAAGATCAAATTGAC Allele-specific susceptible genotype
410L-R GACAATGGCCAAGATCAAATTAAA Allele-specific resistance genotype
F1534C*c 1534com-F GGAGAACTACACGTGGGAGAAC Allele-specific common primer and PCR amplification
1534com-R CGCCACTGAAATTGAGAATAGC Allele-nonspecific outer primer and PCR amplification and sequencing
F1534-R GCGTGAAGAACGACCCGA Allele-specific susceptible genotype
1534C-R GCGTGAAGAACGACCCGC Allele-specific resistance genotype

a Thermalcycler conditions: 94°C for 3 min, 35 × (94°C for 30 s, 55°C for 30 s, 72°C for 30 s) and 72°C for 10 min.

b Thermalcycler conditions: 94°C for 3 min, 35 × (94°C for 30 s, 55°C for 30 s, 72°C for 1min) and 72°C for 10 min.

c Thermalcycler conditions: 94°C for 3 min, 35 × (94°C for 30 s, 60°C for 30 s, 72°C for 30 s) and 72°C for 10 min.

* The methods were previously reported [75]

ASPCR was used to determine the V410L and F1534C genotypes. Each ASPCR was evaluated on a 1% agarose gel and was scored as homozygous susceptible (ASPCR band only with susceptible primers), homozygous resistant (ASPCR band only with kdr primers) or heterozygous (ASPCR band with both susceptible and kdr primers). Samples were always run alongside DNA from individuals with known genotypes determined by Sanger sequencing. At least one random sample from each population was also sequenced (see above) to validate the ASPCR results.

Sequence analysis

Electropherograms were inspected with Chromas Lite (Technelysium Pty. Ltd., Tewantin, Queensland). We used the term haplotype to refer to the unique allele from sequencing each of the three (E6-8, E20-21 and E31-32) regions. Unknown haplotypes were identified by aligning sequences with known haplotypes using the MegAlign and EditSeq applications of Lasergene 7 (DNAStar, Madison, WI). Haplotypes present in heterozygous samples were identified either by cloning and sequencing (a minimum of two clones) or were inferred by comparison the known haplotypes in same populations on the electropherograms. All inferred haplotypes were observed in more than one individual.

We used the term “pattern sequences” to refer to specific concatenated sequences that were assembled from the sequence of E6-8, the codon from V410L (GTA for V, TTA for L), the sequence of E20-21, the codon from F1534C (TTC for F, TGC for C) and the sequence of E31-32 in each individual mosquito (Fig 1). Pattern sequences from heterozygous individuals were identified by comparison of known pattern sequences from the homozygous samples in the same population. Unique pattern sequences were numbered in the order they were discovered.

Population structure analysis

STRUCTURE 2.3 [26] was used to infer the co-ancestry of individuals within the 24 populations from Asia and the Americas (Africa was not included because only a single population was available) using their pattern sequences. The STRUCTURE algorithm was run using a 100,000 burn-in period and 500,000 MCMC replications under the admixture model with correlated allele frequencies. This was repeated five times for each K, ranging from 1 to 5. The optimal number of K clusters was determined both following the guidelines of Pritchard et al [26] and the delta K method from Evanno et al [27] with the online version of STRUCTURE HARVESTER v.0.6.94 [28]. CLUMPP 1.12 [29] was used to aggregate results across the six independent STRUCTURE runs and provide the Q matrices based on which a population or an individual can be assigned to a specific cluster. The clustering results were visualized graphically using DISTRUCT v.1.1[30].

Phylogenetic analyses

We used Vssc pattern sequences to create a phylogenetic tree based on maximum likelihood (ML). The program PhyML2.2.0 [31] plugin for Geneious Pro 10.2.2 [32] was used to perform maximum likelihood analyses with the substitution model (GTR+I+G), selected based on AIC in jModelTest 2.1.10 [33]. We assessed support for relationships on each phylogeny by performing 500 bootstrap replicates. In addition, we constructed the parsimony network to identify genealogic relations among patterns across sampling sites based on a TCS network in PopART [34,35]. The probability of parsimony is calculated for the number of mutational steps between patterns until the probability exceeds 0.95 in TCS network.

Results

Frequency and distribution of kdr alleles

There was considerable variation in the Vssc resistance alleles found in populations from Asia vs. the Americas. All Asian populations had only two types of resistance alleles: 1534C and 989P+1016G (Fig 2). The 1534C alleles were more common in each population, except Danzhou (DZ, China) with frequencies ranging from 0.31 to 0.88. Frequency of the 989P+1016G alleles ranged from 0.13 to 0.50. No susceptible alleles were found in the populations from Singapore [36] or from Thailand, except NSK. However, all Chinese populations contained susceptible alleles, with frequencies ranging from 0.19 (DZ) to 0.31(XSBN). Given that the 989P+1016G allele is known to confer pyrethroid resistance [37], all of these populations are resistant to pyrethroids. In populations from the Americas, four resistance alleles (410L, 410L+1534C, 410L+1016I+1534C and 1534C) were detected (Fig 3). Overall, the most common resistance allele was 410L+1016I+1534C, which was found in seven out of 10 populations, with allele frequencies ranging from 0.50 to 1.00. The second most common resistance allele was 1534C which was found in four out of 10 populations, with frequencies ranging from 0.13 to 0.50. The 410L allele was only detected in the SD population with a frequency of 0.13. The 410L+1534C allele was found only in the NO population at a frequency of 0.06. The resistant alleles 1534C and 410L+1016I+1534C were found in all populations from the USA, except AT. In the Colombian populations, the 410L+1016I+1534C allele was fixed in LM, whereas the MN had only the 1534C kdr allele (frequency of 0.50). No Vssc resistance alleles were detected in the AT and CR populations. The L982W, A1007G and I1011M/V mutations were not found in any mosquitoes, nor was the S989P+V1016G+F1534C allele which has been found in Myanmar [10], Saudi Arabia [18] and Malaysia [38]. All of the sequences have been deposited at GenBank (accession nos. MK977825-MK977851, S1 Table).

Fig 2. Vssc allele frequencies in populations of A. aegypti from Asia.

Fig 2

Collections from Thailand included Ubon Ratchathani (UBN), Bangkok (BKK), Chiang Mai (CMI), Suratthani (SNI), Kamphaeng Phet (KPP), Nakhon Ratchasima (NSK). Strains from China included Xishuangbanna (XSBN), Hainan (HN), Ruili (RL) and Danzhi (DZ). * strain from Singapore (Kasai et al 2014).

Fig 3. Vssc allele frequencies in populations of A. aegypti from the Americas.

Fig 3

Collections from USA included Merced (MD), Tulare (TE), San Diego (SD), Los Angeles (LA), New Orleans (NO), St. Augustine (AT). Collections from Colombia included Acacias, Meta (MN), La Mesa (LM). Puerto Rico (PR) is from Puerto Rico. Costa Rica (CR) is from Costa Rica. RK (Cuba), SMK (USA) and OL (USA) are not included because they are susceptible strains with susceptible alleles and have been laboratory reared for many years.

Haplotype and population structure analysis

Out of 192 individual mosquitoes examined, seven E6-8 haplotypes, nine E20-21 haplotypes, and eleven E31-32 haplotypes were identified (S1S3 Figs). In E6-8 (~482 bp), exon 7 had one synonymous single nucleotide polymorphism (SNP), and there were 37 SNPs and 12 indels in introns 6 and 7. In E20-21 (~581 bp), exon 20 had 3 synonymous SNPs and 1 nonsynonymous SNP (S989P), exon 21 had 2 nonsynonymous substitutions (V1016I and V1016G), and intron 20 had 49 SNPs plus 20 indels. E20-21 haplotypes contained introns of 234 bp, except for v4, v8 and v9 which were 250 bp, and v1 which was 233 bp. Only one haplotype contained the 989P+1016G mutations (v8) and only one haplotype had the V1016I mutation (v9). The v4, v8 and v9 were identical in sequence except for the kdr mutations (S989P, V1016G/I). In the E31-32 region (1029 bp), exon 32 had 14 synonymous substitutions and 1 nonsynonymous substitutions (Q1835R), and intron 31 had 3 SNPs. The Vssc pattern sequences of 177 individuals from Asia and the Americas were used to analyze the population structure of these samples. It revealed admixture between the two groups despite the geographically distinct patterns for resistance mutations (Fig 4).

Fig 4. Population structure of A. aegypti populations from Asia and Americas used in this study.

Fig 4

STRUCTURE bar plots indicate relatedness among geographic locations in 177 individuals. K = 2, and each cluster is indicated by different colors. Each vertical bar represents an individual. The height of the bars represents the probability of assignment to clusters.

Phylogenetic analyses

Phylogenetic analyses of 33 determined pattern sequences revealed multiple clades (with bootstrap support ≥90%)) (Fig 5). There are at least two independent clades containing 1534C alleles, suggesting multiple evolutionary origins of the F1534C mutation. Other resistance alleles were found in only a single pattern type (410L and 410L+1534C) or were found in two lineages (989P+1016G and 410L+1016I+1534C), making predictions of single or multiple evolutionary origins uncertain.

Fig 5. Maximum likelihood tree of the 33 pattern sequences found in A. aegypti.

Fig 5

The pattern sequences are concatenated E6-8, V410L codon (GTA for V, TTA for L), E20-21, F1534C codon (TTC for F, TGC for C) and E31-32 in Vssc, and their types are represented by P number. ML bootstrap percentages are noted for clades ≥50%. The different kdr alleles are indicated by different symbols.

The pattern sequences genealogy network illustrates frequency, relationships and number of mutations between the different pattern types (Fig 6). These results indicate pattern sequence P27 (1534C) and P28 (410L) were the result of one and two mutational steps, respectively, from their common susceptible ancestor P26. Similarly, P24 (1534C) and P25 (410L+1534C) are the results of one and two mutational step from P23, respectively. Also, the 410L pattern sequence (P28) and 410L+1534C pattern sequence (P25) were distributed in different lineages (Fig 5). These results suggest the 410L+1534C allele arose from in individual already having 1534C. The most common pattern sequences (P29 and P30) with 410L+1016I+1534C arose from P27 (1534C). However, neither the 410L+1534C nor 1016I+1534C were found in the lineage. The 410L+1016I+1534C pattern sequences and 410L+1534C pattern sequence were located in different lineages (Fig 5). This suggested the 410L+1016I+1534C allele more likely originated from a 1534C background by two additional mutations, but was not the result of additional one mutation (1016I) from a 410L+1534C background.

Fig 6. Vssc pattern sequences genealogy network constructed by TCS.

Fig 6

The Vssc pattern sequences are concatenated E6-8, V410L codon (GTA for V, TTA for L), E20-21, F1534C codon (TTC for F, TGC for C) and E31-32) found in A. aegypti. The pattern sequences are connected to one another based on their similarity. Circles and numbers represent individual pattern sequences (S1 Table). The size of the circle represents the number of individuals having that pattern. Short hash-marks perpendicular to pattern branches indicate the number of base pair differences between pattern sequences. Black balls indicate intermediate missing (i.e. unsampled) steps. Geographic regions are coded by colors (Asia is yellow, America is blue and Africa is green). The different kdr alleles are indicated by different symbols.

In order to determine if recombination may contribute to the evolution of multiple mutations in Vssc alleles, we analyzed the observed pattern sequences associated with kdr mutations. We found sequences consistent with recombination events giving rise to the 410L+1534C allele (P25) from alleles having a 410L (P28) and a 1534C allele (P20) (Fig 7).

Fig 7. Recombination among the kdr pattern sequences in A. aegypti.

Fig 7

The pattern sequences are concatenated E6-8, V410L codon (GTA for V, TTA for L), E20-21, F1534C codon (TTC for F, TGC for C) and E31-32 in Vssc.

Discussion

There are multiple kdr alleles in A. aegypti; some with global distribution and others that are found in more limited areas of the world (Fig 2 and Fig 3). The alleles containing only the F1534C mutation were widely distributed in the populations from Asia and the Americas. Alleles containing the S989P+V1016G mutations were found only in Asia and alleles with the V1016I mutation were only found in the Americas. These results are consistent with previous reports [2]. In 2017, the V410L mutation was detected in populations from Brazil [12]. It was subsequently found in A. aegypti from Colombia [13] and Mexico [14]. We also detected alleles with this mutation in mosquitoes from USA, Colombia and Puerto Rico (Fig 3). This suggests that Vssc alleles with the V410L mutation are widely distributed in A. aegypti from the Americas. We found a novel Q1835R mutation in the PR strain, but its association with the resistance requires further study.

The frequencies of the 989P+1016G and the 1534C alleles found in the Asian populations are intriguing. The S989P+V1016G allele confers pyrethroid resistance [36,37] and the F1534C allele has been shown to strongly correlate with pyrethroid resistance in A. aegypti. A field collected strain having both the 989P+1016G and 1534C alleles was selected with permethrin and the resulting strain had only the S989P+V1016G allele, suggesting that this allele gives greater protection to permethrin than the F1534C allele [4,36]. In all 11 of our Asian populations both the 1534C and 989P+1016G alleles were detected, and the 1534C allele was generally more common with frequencies ranging from 0.31 to 0.88 compared to 989P+1016G allele frequency that ranged from 0.13 to 0.50 (Fig 2). This suggests that the mosquitoes with the F1534C allele may have a lower fitness cost relative to the mosquitoes with the 989P+1016G allele. This finding is supported by Plernsub et al who reported that a strain having the F1534C mutation had no fitness reductions [39]. These results appear to be similar to the findings of Vssc alleles in house flies where kdr-his is common in some populations, even though it provides less resistance than other alleles [4043].

Our results have both similarities and differences to what has previously been reported on Vssc alleles in the Americas. The populations we sampled from the USA had high frequencies of the 410L+1016I+1534C allele, and this is similar with Cornel et al. 2016 who reported that two populations from California were homozygous for V1016I mutation, although the 410 and 1534 positions were not examined [23]. Our mosquitos from Florida (AT) had no kdr alleles, and this is not consistent with Estep et al 2018 who found most A. aegypti strains from 62 locations in Florida were fixed or nearly fixed for the F1534C and V1016I mutations with frequencies from 0.11 to 1 [44]. Additional studies in Florida, across sites, seasons and years would be helpful to understand this discrepancy. In our populations from Colombia, the kdr allele types and frequencies are variable, and this is consistent with previous reports [13,45]. Generally, we detected four putative kdr alleles (410L, 410L+1534C, 410L+1016I+1534C and 1534C) in populations from Americas. The most common kdr allele was 410L+1016I+1534C. The PR strain was originally reported to have the 1016I+1534C allele [46], but the V410L position was not examined. Our results indicate that the PR population has the V410L+V1016I+F1534C allele. Thus, it is likely that the 1016I+1534C allele previously reported in A. aegypti is most likely the 410L+1016I+1534C allele. This also suggested that the high frequencies of 1016I or 1016I+1534C in previous studies are most likely high frequencies of 410L+1016I+1534C. This point is supported by Granada et al 2018 [13] and Saavedra-Rodriguez et al 2018 [14] in which the 1016I and 1016I +1534C alleles were rare, and the 410L+1016I+1534C allele was more common. Our primer sets of E20-21 are also capable of detecting previously reported mutations L982W, A1007G and I1011M/V[5,47], and none of the mutations were detected in any of the mosquitoes we analyzed, indicating they are rare or are geographically constrained.

It is well established that A. aegypti originated in Africa, invaded the Americas and later Asia from the Americas, likely in the 1890s [4850]. Our population structure analysis showed that the populations from Asia and the Americas have similar background (Fig 4), although some kdr alleles have different geographic distributions (Fig 6). This supports the admixture of the populations from Asia and the Americas. For the population structure of mosquitoes from the Americas, it is important to consider that this species was eradicated from much of this area in the 1950s and 1960s, with re-colonization starting in the 1970s [49]. Therefore, it is possible that the mosquitoes with the V410L or V1016I mutations in populations from the Americas were from re-colonization by African populations. This idea is supported by previous reports [17,20] in which the V1016I (no S989P and V1016G) mutation was detected in African populations, unfortunately V410L was not examined in these two studies. Also, the 989P+1016G allele confers a >2000-fold resistance to DDT [37], so it is unlikely that the S989P+V1016G was ever present and then eradicated in American populations owing to the DTT use, and it is likely that the S989P and V1016G mutations occurred in Asian populations after the A. aegypti invaded Asia.

The intron between exons 20 and 21 is highly polymorphic in some species and being in close proximity to important kdr mutations has facilitated phylogenetic analyses of alleles in Myzus persicae [51], Bemisia tabaci [52], Musca domestica [53] and Leptinotarsa decemlineata [54]. While we did identify nine haplotypes from this region (E20-21) in A. aegypti (S2 Fig), this is far fewer than have been found for the species mentioned above. Thus, our ability to determine a single or multiple origin of the mutations (S989P, V1016G/I) in this region was unsuccessful. As additional E20-21 haplotype sequences become available, this analysis should be revisited.

A previous study on the E20-21 region of Vssc from A. aegypti identified two intron length polymorphisms: group A (250 bp) and B (234 bp) [55]. In our nine E20-21 haplotypes, introns of V4, V8 and V9 belong to intron group A, introns of V2, V3, V5, V6 and V7 belong to intron group B, and the intron of V1 differs from group B by the deletion of a single nucleotide (S2 Fig). The intron of group A was found to be strongly linked with S989P, V1016G/I and D1763Y mutations [6,56]. This agrees with our results in which the haplotypes containing S989P and V1016G/I mutations have the intron of group A (S2 Fig, V4, V8 and V9). Also, our results showed the F1534C mutation had no strong link to either the group A or group B. Specifically, the F1534C mutation was found with both intron A (V4-F1534C and V9-F1534C) and B (V2-F1534C and V1-F1534C), and they were found in populations from both Asia (V1-F1534C, V2-F1534C and V4-F1534C) and Americas (V2-F1534C, V4-F1534C and V9-F1534C) (i.e. showed no geographical distribution) (S1 Table). The findings are not consistent with previous reports in which the F1534C mutation was strongly linked with the intron of group A in Ghana [17] and intron of group B in Taiwan [17,56]. This is most likely that the two studies used A. aegypti populations from limited areas.

Previous studies on single vs. multiple evolutionary origins of kdr mutations have all suggested that multiple origins are more common [5153,57]. Similarly, our results for F1534C suggest that this mutation had multiple evolutionary origins. However, our data could not differentiate between single and multiple evolutionary origins for the 989P+1016G and 410L+1016I+1534C allele. Additional sequences from other strains/populations will be needed before more concrete conclusions can be drawn.

Vera-Maloof et al [58] and Saavedra-Rodriguez et al [14] detected the frequencies of mutations in A. aegypti collected in Mexico from 2000–2012, and proposed the V410L, V1016I, and F1534C mutations arose independently, and then by two recombination events, gave rise to the 410L+1016I+1534C allele. In order to examine if alleles with multiple mutations arose by sequential accumulation of mutations, recombination or a combination of both processes, we analyzed our 33 pattern sequences. Our data equally support the ideas that the 410L+1534C allele could have arisen by recombination (Fig 7) or by addition of the 410L mutation to an individual having the F1534 allele (Fig 6). Without accurate knowledge of mutation and recombination rates it is difficult to decide which model is most likely. Our data suggests that other kdr alleles having multiple mutations could have arisen by sequential accumulation of mutations, but we found no evidence to support that they arose via recombination. However, a larger dataset of alleles would be needed before solid conclusions can be made. Although no 1016I+1534C allele was found in our samples, it has been reported in mosquitoes from Colombia [13] and Mexico[14]. Therefore, based on the sequence polymorphisms associated with the mutations, we put forward possible evolutionary scenarios of how resistance alleles with multiple mutations may have evolved (Fig 8). It appears the 410L+1534C allele occured by addition of a V410L mutation to an individual already having the F1534C allele or by recombination (see above), ii) the 410L+1016I+1534C allele arose in an individual having the 1016I +1534C allele which originates from an individual with a1534C allele. It should be mentioned that we analyzed the relationship between the pattern sequences, not considering geographyical distribution of alleles (because our analysis focused on identification of the most common alleles in each population, not on a deep sampling). Although the 989P+1016G+1534C allele has been reported in A. aegypti populations [18,19,38], it was not detected in our samples. Therefore we cannot propose how this allele arose.

Fig 8. Proposed evolutionary scenarios of resistance alleles within the V410L, V1016I and 1534C mutations in A. aegypti populations.

Fig 8

i) 410L+1534C occurs by addition of the 410L mutation to the 1534C allele, ii) 410L+1534C arises by crossover between the 410L and 1534C alleles, iii) 410L+1016I+1534C occurs sequential addition of the 1016I mutation and then the 410L mutation starting from the 1534C allele. Resistance alleles are indicated by different colors and box shapes.

In summary, we examined nine Vssc mutations (V410L, L982W, S989P, A1007G, I1011V/M, V1016G/I and F1534C) and 33 pattern sequences of individual A. aegypti from 25 geographic collections. Our results show that 1534C and 989P+1016G alleles are widely distributed in Asian populations. The distinct 410L, 410L+1534C, 410L+1016I+1534C and 1534C alleles were found in populations from the Americas where the most common kdr allele was 410L+1016I+1534C, followed by 1534C. The phylogenetic analysis of Vssc suggest multiple independent origins of the 1534C allele. Our data suggest the 410L+1534C allele could have arisen by accumulation of the V410L mutation in an individual already having the 1534C allele or by the crossover of the 410L and 1534C alleles. More kdr pattern sequences (i.e. 1016I+1534C and 989P+1016G+1534C) would allow for understanding of how multiple mutations in Vssc have arisen and evolved. Overall, our data corroborate previous geographic distributions of kdr mutations and provides evidence for both recombination and sequential accumulation of mutations contributing to the molecular evolution of kdr mutations in A. aegypti.

Supporting information

S1 Table. Pattern sequences concatenated E6-8, V410L codon (GTA for V, TTA for L), E20-21, F1534C codon (TTC for F, TGC for C) and E31-32 in Vssc in A. aegypti.

(XLSX)

S1 Fig. The sequence alignment of haplotypes of E6-8 in Vssc of A. aegypti.

The sequences were determined by direct sequencing of PCR products using reverse primers. The introns are shaded and bases differing from the majority are red.

(DOCX)

S2 Fig. The sequence alignment of haplotypes in E20-21 in Vssc of A. aegypti.

The sequences were determined by direct sequencing of PCR products using reverse primer. The introns are shaded and bases differing from the majority are red. # S989P mutation (TCC for S989, CCC for 989P), * and & V1016I and V1016G mutations (GTA for V1016, ATA for V1016I, GGA for 1016G), respectively. The introns of V4, V8 and V9 belong to haplotype group A, others belong to haplotype group A according to Martins et al. 2009 [55].

(DOCX)

S3 Fig. The sequence alignment of haplotypes in E30-31 in Vssc of A. aegypti.

The sequences were determined by direct sequencing of PCR products using reverse and forward primers. The intron is shaded and bases differing from the majority are red.

(DOCX)

Acknowledgments

We thank Prof. L. Harrington for the NSK and MN strain, Prof. M. Roe for the NO strain, Prof. X. Gao for the RL, DZ, XSBN and HN strains, J. Silva for the LM strain, L. Smith for the SP strain, and BEI Resources for PR and CR strains. We thank the San Gabriel Valley Mosquito and Vector Control District, the Greater Los Angles Vector Control District, the San Diego County Vector Control Program, and the Tulare and Merced County Mosquito abatement district for collections of mosquitoes. We thank J. Freeman, J. Silva, R. Mertz, L. Smith and H. Sun for their helpful comments on the manuscript and for their support.

Data Availability

All relevant data are submitted to GenBank (accession numbers: MK977825-MK977851), and within the manuscript and its Supporting Information files.

Funding Statement

This study was funded in part by the China Scholarship Council (grant no.201706350254) (to YF) and the National Institutes of Health (to JGS). The funders had no role in the study design, data collection and analysis, decision to publish or preparation of the manuscript.

References

  • 1.Shepard DS, Undurraga EA, Halasa YA, Stanaway JD (2016) The global economic burden of dengue: a systematic analysis. Lancet Infect Dis 16: 935–941. 10.1016/S1473-3099(16)00146-8 [DOI] [PubMed] [Google Scholar]
  • 2.Smith LB, Kasai S, Scott JG (2016) Pyrethroid resistance in Aedes aegypti and Aedes albopictus: important mosquito vectors of human diseases. Pestic Biochem Physiol 133: 1–12. 10.1016/j.pestbp.2016.03.005 [DOI] [PubMed] [Google Scholar]
  • 3.Dong K, Du Y, Rinkevich F, Nomura Y, Xu P, et al. (2014) Molecular biology of insect sodium channels and pyrethroid resistance. Insect Biochem Mol Biol 50: 1–17. 10.1016/j.ibmb.2014.03.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Scott JG (2019) Life and death at the voltage-sensitive sodium channel: Evolution in response to insecticide use. Ann Rev Entomol 64: 243–257. [DOI] [PubMed] [Google Scholar]
  • 5.Brengues C, Hawkes NJ, Chandre F, McCarroll L, Duchon S, et al. (2003) Pyrethroid and DDT cross-resistance in Aedes aegypti is correlated with novel mutations in the voltage-gated sodium channel gene. Med Vet Entomol 17: 87–94. 10.1046/j.1365-2915.2003.00412.x [DOI] [PubMed] [Google Scholar]
  • 6.Saavedra-Rodriguez K, Urdaneta-Marquez L, Rajatileka S, Moulton M, Flores AE, et al. (2007) A mutation in the voltage-gated sodium channel gene associated with pyrethroid resistance in Latin American Aedes aegypti. Insect Mol Biol 16: 785–798. 10.1111/j.1365-2583.2007.00774.x [DOI] [PubMed] [Google Scholar]
  • 7.Chang C, Shen WK, Wang TT, Lin YH, Hsu EL, et al. (2009) A novel amino acid substitution in a voltage-gated sodium channel is associated with knockdown resistance to permethrin in Aedes aegypti. Insect Biochem Mol Bio 39: 272–278. [DOI] [PubMed] [Google Scholar]
  • 8.Srisawat R, Komalamisra N, Eshita Y, Zheng M, Ono K, et al. (2010) Point mutations in domain II of the voltage-gated sodium channel gene in deltamethrin-resistant Aedes aegypti (Diptera: Culicidae). Appl Entomol Zool 45: 275–282. [Google Scholar]
  • 9.Yanola J, Somboon P, Walton C, Nachaiwieng W, Prapanthadara L (2010) A novel F1552/C1552 point mutation in the Aedes aegypti voltage-gated sodium channel gene associated with permethrin resistance. Pestic Biochem Physiol 96: 127–131. [Google Scholar]
  • 10.Kawada H, Oo SZM, Thaung S, E. K, Maung YNM, et al. (2014) Co-occurrence of point mutations in the voltage-gated sodium channel of pyrethroid-resistant Aedes aegypti populations in Myanmar. PLOS Neglect Trop Dis 8: e3032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kushwah RBS, Dykes CL, Kapoor N, Adak T, Singh OP (2015) Pyrethroid-resistance and presence of two knockdown resistance (kdr) mutations, F1534C and a novel mutation T1520I, in Indian Aedes aegypti. PLoS Negl Trop Dis 9: e3332 10.1371/journal.pntd.0003332 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Haddi K, Tomé HVV, Du Y, Valbon WR, Nomura Y, et al. (2017) Detection of a new pyrethroid resistance mutation (V410L) in the sodium channel of Aedes aegypti: a potential challenge for mosquito control. Sci Rep 7: 46549 10.1038/srep46549 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Granada Y, Mejía-Jaramillo A, Strode C, Triana-Chavez O (2018) A point mutation V419L in the sodium channel gene from natural populations of Aedes aegypti is involved in resistance to λ-cyhalothrin in Colombia. Insects 9: 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Saavedra-Rodriguez K, Maloof FV, Campbell CL, Garcia-Rejon J, Lenhart A, et al. (2018) Parallel evolution of vgsc mutations at domains IS6, IIS6 and IIIS6 in pyrethroid resistant Aedes aegypti from Mexico. Sci Rep 8: 6747 10.1038/s41598-018-25222-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Murcia O, Henríquez B, Castro A, Koo S, Young J, et al. (2019) Presence of the point mutations Val1016Gly in the voltage-gated sodium channel detected in a single mosquito from Panama. Parasite Vector 12: 62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Seixas G, Grigoraki L, Weetman D, Vicente JL, Silva AC, et al. (2017) Insecticide resistance is mediated by multiple mechanisms in recently introduced Aedes aegypti from Madeira Island (Portugal). PLOS Neglect Trop D 11: e0005799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kawada H, Higa Y, Futami K, Muranami Y, Kawashima E, et al. (2016) Discovery of point mutations in the voltage-gated sodium channel from African Aedes aegypti populations: potential phylogenetic reasons for gene introgression. PLOS Negl Trop Dis 10: e0004780 10.1371/journal.pntd.0004780 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Al Nazawi AM, Aqili J, Alzahrani M, McCall PJ, Weetman D (2017) Combined target site (kdr) mutations play a primary role in highly pyrethroid resistant phenotypes of Aedes aegypti from Saudi Arabia. Parasite Vector 10: 161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hamid PH, Prastowo J, Widyasari A, Taubert A, Hermosilla C (2017) Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia. Parasite Vector 10: 283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Sombié A, Saiki E, Yaméogo F, Sakurai T, Shirozu T, et al. (2019) High frequencies of F1534C and V1016I kdr mutations and association with pyrethroid resistance in Aedes aegypti from Somgandé (Ouagadougou), Burkina Faso. Trop Med Health 47: 2–8. 10.1186/s41182-018-0134-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Aguirre-Obando OA, Dalla Bona AC, L. D, E. I, Navarro-Silva MA (2015) Insecticide resistance and genetic variability in natural populations of Aedes (Stegomyia) aegypti (Diptera: Culicidae) from Colombia. Zoologica 32: 14–22. [Google Scholar]
  • 22.García GP, Flores AE, Fernández-Salas I, Saavedra-Rodríguez K, Reyes-Solis G, et al. (2009) Recent rapid rise of a permethrin knock down resistance allele in Aedes aegypti in México. PLoS Neglect Trop Dis 3: e531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cornel AJ, Holeman J, Nieman CC, Yoosook Lee, Smith C, et al. (2016) Surveillance, insecticide resistance and control of an invasive Aedes aegypti (Diptera: Culicidae) population in California. F100 Res 10.12688/f1000research.8107.3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hirata K, Komagata O, Itokawa K, Yamamoto A, Tomita T, et al. (2014) A single crossing-over event in voltage-sensitive Na+ channel genes may cause critical failure of dengue mosquito control by insecticides. PLoS Negl Trop Dis 8: e3085 10.1371/journal.pntd.0003085 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Silva J, Scott JG (2019) Conservation of the voltage-sensitive sodium channel protein within the Insecta Insect Mol Bio 29: 9–18. 10.1111/imb.12605. [DOI] [PubMed] [Google Scholar]
  • 26.Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155: 945–959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol 14: 2611–2620. 10.1111/j.1365-294X.2005.02553.x [DOI] [PubMed] [Google Scholar]
  • 28.Earl DA, vonHoldt BM (2011) STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Resour 4: 359–361. [Google Scholar]
  • 29.Jakobsson M, Rosenberg NA (2007) CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics 23: 1801–1806. 10.1093/bioinformatics/btm233 [DOI] [PubMed] [Google Scholar]
  • 30.Rosenberg NA (2003) distruct: a program for the graphical display of population structure. Mol Ecol Notes 4: 137–138. [Google Scholar]
  • 31.Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52: 696–704. 10.1080/10635150390235520 [DOI] [PubMed] [Google Scholar]
  • 32.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, et al. (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. 10.1093/bioinformatics/bts199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Posada D (2008) jModelTest: Phylogenetic model averaging. Mol Biol Evol 25: 1253–1256. 10.1093/molbev/msn083 [DOI] [PubMed] [Google Scholar]
  • 34.Clement M, Posada D, Crandall KA (2000) TCS: a computer program to estimate gene genealogies. Mol Ecol 9: 1657–1659. 10.1046/j.1365-294x.2000.01020.x [DOI] [PubMed] [Google Scholar]
  • 35.Leigh JW, Bryant D, Nakagawa S (2015) Popart: full-feature software for haplotype network construction. Methods Ecol Evol 6: 1110–1116. [Google Scholar]
  • 36.Kasai S, Komagata O, Itokawa K, Shono T, Ng LC, et al. (2014) Mechanisms of pyrethroid resistance in the dengue mosquito vector, Aedes aegypti: target site insensitivity, penetration, and metabolism. PLoS Negl Trop Dis 8: e2948 10.1371/journal.pntd.0002948 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Smith LB, Kasai S, Scott JG (2017) Voltage-sensitive sodium channel mutations S989P+V1016G in Aedes aegypti confer variable resistance to pyrethroids, DDT and oxadiazines. Pest Manag Sci 74: 737–745. 10.1002/ps.4771 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Leong CS, Vythilingam I, Liew JW, Wong ML, Wan-Yusoff WS, et al. (2019) Enzymatic and molecular characterization of insecticide resistance mechanisms in field populations of Aedes aegypti from Selangor, Malaysia. Parasite Vector 12: 236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Plernsub S, Stenhouse SA, Tippawangkosol P, Lumjuan N, Yanola J, et al. (2013) Relative developmental and reproductive fitness associated with F1534C homozygous knockdown resistant gene in Aedes aegypti from Thailand. Trop Biomed 30: 621–630. [PubMed] [Google Scholar]
  • 40.Freeman JC, Ross DH, Scott JG (2019) Insecticide resistance monitoring of house fly populations from the United States. Pestic Biochem Physiol 158: 61–68. 10.1016/j.pestbp.2019.04.006 [DOI] [PubMed] [Google Scholar]
  • 41.Scott JG, Leichter CA, Rinkevich FD, Harris SA, Su C, et al. (2013) Insecticide resistance in house flies from the United States: Resistance levels and frequency of pyrethroid resistance alleles. Pestic Biochem Physiol 107: 377–384. 10.1016/j.pestbp.2013.10.006 [DOI] [PubMed] [Google Scholar]
  • 42.Rinkevich FD, Zhang L, Hamm RL, Brady SG, Lazzaro BP, et al. (2006) Frequencies of the pyrethroid resistance alleles of Vssc1 and CYP6D1 in house flies from the eastern United States. Insect Mol Biol 15: 157–167. 10.1111/j.1365-2583.2006.00620.x [DOI] [PubMed] [Google Scholar]
  • 43.Sun H, Kasai S, Scott JG (2017) Two novel house fly Vssc mutations, D600N and T929I, give rise to new insecticide resistance alleles. Pestic Biochem Physiol 143: 116–121. 10.1016/j.pestbp.2017.08.013 [DOI] [PubMed] [Google Scholar]
  • 44.Estep AS, Sanscrainte ND, Waits CM, Bernard SJ, Lloyd AM, et al. (2018) Quantification of permethrin resistance and kdr alleles in Florida strains of Aedes aegypti (L.) and Aedes albopictus (Skuse). PLoS Neglect Trop Dis 12: e0006544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Aponte A, Penilla RP, Rodriguez AD, Ocampo CB (2019) Mechanisms of pyrethroid resistance in Aedes (Stegomyia) aegypti from Colombia. Acta Trop 191: 146–154. 10.1016/j.actatropica.2018.12.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Estep AS, Sanscrainte ND, Waits CM, Louton JE, Becnel JJ (2017) Resistance status and resistance mechanisms in a strain of Aedes aegypti (Diptera: Culicidae) from Puerto Rico. J Med Entomol 54: 1643–1648. 10.1093/jme/tjx143 [DOI] [PubMed] [Google Scholar]
  • 47.Lien NTK, Ngoc NTH, Hien NT, Hoang NH, Binh NTH (2018) Two novel mutations in the voltage-gated sodium channel associated with knockdown resistance (kdr) in the dengue vector Aedes aegypti in Vietnam. J Vect Ecol 43: 184–189. [DOI] [PubMed] [Google Scholar]
  • 48.Brown JE, Evans BR, Zheng W, Obas V, Barrera-Martinez L, et al. (2014) Human impacts have shaped historical and recent evolution in Aedes aegypti, the dengue and yellow fever mosquito. Evolution 68: 514–525. 10.1111/evo.12281 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Gloria-Soria A, Ayala D, Bheecarry A, Calderon-Arguedas O, Chadee DD, et al. (2016) Global genetic diversity of Aedes aegypti. Molec Ecol 25: 5377–5395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Powell JR, Gloria-Soria A, Kotsakiozi P (2018) Recent history of Aedes aegypti: Vector genomics and epidemiology records. Biosci 68: 854–860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Anstead JA, Williamson MS, Denholm I (2005) Evidence for multiple origins of identical insecticide resistance mutations in the aphid Myzus persicae. Insect Biochem Mol Biol 35: 249–256. 10.1016/j.ibmb.2004.12.004 [DOI] [PubMed] [Google Scholar]
  • 52.Alon M, Benting J, Lueke B, Ponge T, Alon F, et al. (2006) Multiple origins of pyrethroid resistance in sympatric biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect Biochem Mol Biol 36: 71–79. 10.1016/j.ibmb.2005.10.007 [DOI] [PubMed] [Google Scholar]
  • 53.Rinkevich FD (2005) Population genetics of Vssc1 and CYP6D1 in pyrethroid resistant house flies (Musca domestica) from the Eastern United States: Cornell University. [Google Scholar]
  • 54.Rinkevich FD, Su C, Lazo TA, Hawthorne DJ, Tingey WM, et al. (2012) Multiple evolutionary origins of knockdown resistance (kdr) in pyrethroid-resistant Colorado potato beetle, Leptinotarsa decemlineata. Pestic Biochem Physiol 104: 192–200. [Google Scholar]
  • 55.Martins AJ, Lima JBP, Peixoto AA, Valle D (2009) Frequency of Val1016I1e mutation in the voltage-gated sodium channel gene of Aedes aegypti Brazilian populations. Trop Med Intern Health 14: 1351–1355. [DOI] [PubMed] [Google Scholar]
  • 56.Chung HH, Cheng IC, Chen YC, Lin C, Tomita T, et al. (2019) Voltage-gated sodium channel intron polymorphism and four mutations comprise six haplotypes in an Aedes aegypti population in Taiwan. PLoS Negl Trop Dis 13: e0007291 10.1371/journal.pntd.0007291 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Rinkevich FD, Hedtke SM, Leichter CA, Harris SA, Su C, et al. (2012) Multiple origins of kdr-type resistance in the house fly, Musca domestica. PLoS ONE 7: e52761 10.1371/journal.pone.0052761 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Vera-Maloof FZ, Saavedra-Rodriguez K, Elizondo-Quiroga AE, Lozano-Fuentes S, Black WCI (2016) Coevolution of the Ile1,016 and Cys1,534 mutations in the voltage gated sodium channel gene of Aedes aegypti in Mexico. PLoS Negl Trop Dis 9: e0004263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Rajatileka S, Black W, Saavedra-Rodriguez K, Trongtokit Y, Apiwathnasorn C, et al. (2008) Development and application of a simple colorimetric assay reveals widespread distribution of sodium channel mutations in Thai populations of Aedes aegypti. Acta Tropica 108: 54–57. 10.1016/j.actatropica.2008.08.004 [DOI] [PubMed] [Google Scholar]
  • 60.Aponte HA, Penilla RP, Dzul-Manzanilla F, Che-Mendoza A, López AD, et al. (2013) The pyrethroid resistance status and mechanisms in Aedes aegypti from the Guerrero state, Mexico. Pestic Biochem Physiol 170: 226–234. [Google Scholar]
  • 61.Harris AF, Rajatileka S, Ranson H (2010) Pyrethroid resistance in Aedes aegypti from Grand Cayman. Am J Trop Med Hyg 83: 277–284. 10.4269/ajtmh.2010.09-0623 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Viana-Medeiros PF, Bellinato DF, Valle D (2018) Laboratory selection of Aedes aegypti field populations with the organophosphate malathion: Negative impacts on resistance to deltamethrin and to the organophosphate temephos. PLoS Negl Trop Dis 12: e0006734 10.1371/journal.pntd.0006734 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Linss JGB, Brito LP, Garcia GA, Araki AS, Bruno RV, et al. (2014) Distribution and dissemination of the Val1016Ile and Phe1534Cys Kdr mutations in Aedes aegypti Brazilian natural populations. Parasite Vector 7: 25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Macoris ML, Martins AJ, Andrighetti MTM, Lima JBP, Valle D (2018) Pyrethroid resistance persists after ten years without usage against Aedes aegypti in governmental campaigns: Lessons from Sao Paulo State, Brazil. PLoS Negl Trop Dis 12: e0006390 10.1371/journal.pntd.0006390 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Alvarez LC, Ponce G, Saavedra-Rodriguez K, Lopez B, Flores AE (2015) Frequency of V1016I and F1534C mutations in the voltage-gated sodium channel gene in Aedes aegypti in Venezuela. Pest Man Sci 71: 863–869. [DOI] [PubMed] [Google Scholar]
  • 66.Maestre-Serrano R, Pareja-Loaiza P, Gomez Camargo D, Ponce-Garcia G, Flores AE (2019) Co-occurrence of V1016I and F1534C mutations in the voltage-gated sodium channel and resistance to pyrethroids in Aedes aegypti (L.) from the Colombian Caribbean region. Pest Manag Sci 75: 1681–1688. 10.1002/ps.5287 [DOI] [PubMed] [Google Scholar]
  • 67.Wuliandari JR, Lee SF, White VL, Tantowijoyo W, Hoffmann AA, et al. (2015) Association between three mutations, F1565C, V1023G and S996P, in the voltage-sensitive sodium channel gene and knockdown resistance in Aedes aegypti from Yogyakarta, Indonesia. Insects 6: 608–625. 10.3390/insects6030608 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Kawada H, Higa Y, Nguyen YT, Tran SH, Nguyen HT, et al. (2009) Nationwide investigation of the pyrethroid susceptibility of mosquito larvae collected from used tires in Vietnam. PLoS Negl Trop Dis 3: e391 10.1371/journal.pntd.0000391 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Ishak IH, Jaal Z, Ranson H, Wondji C (2015) Contrasting patterns of insecticide resistance and knockdown resistance (kdr) in the dengue vectors Aedes aegypti and Aedes albopictus from Malaysia. Parasite Vector 8: 181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Rasli R, Lee H, Wasi Ahmad N, Fikri S, Ali R, et al. (2018) Susceptibility status and resistance mechanisms in permethrin-selected, laboratory susceptible and field-collected Aedes aegypti from Malaysia. Insects 9: 43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Pang SC, Chiang LP, Tan CH, Vythilingam I, Lam-Phua SG, et al. (2015) Low efficacy of deltamethrin-treated net against Singapore Aedes aegypti is associated with kdr-type resistance. Trop Biomed 32: 140–150. [PubMed] [Google Scholar]
  • 72.Saha P, Chatterjee M, Ballav S, Chowdhury A, Basu N, et al. (2019) Prevalence of kdr mutations and insecticide susceptibility among natural population of Aedes aegypti in West Bengal. PLoS One 14: e0215541 10.1371/journal.pone.0215541 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Mulyaningsih B, Umniyati SR, Satoto TBT, Ernaningsih, Nugrahaningsih DAA(2018) Detection of polymorphism on voltage-gated sodium channel gene of Indonesian Aedes aegypti associated with resistance to pyrethroids. Indones Biomed J 10: 250–255. [Google Scholar]
  • 74.Muthusamy R, Shivakumar MS (2015) Involvement of metabolic resistance and F1534C kdr mutation in the pyrethroid resistance mechanisms of Aedes aegypti in India. Acta Tropica 148: 137–141. 10.1016/j.actatropica.2015.04.026 [DOI] [PubMed] [Google Scholar]
  • 75.Li C-X, Kaufman PE, Xue R-D, Zhao M-H, Wang G, et al. (2015) Relationship between insecticide resistance and kdr mutations in the dengue vector Aedes aegypti in Southern China. Parasite Vector 8: 325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Grossman MK, Rodriguez J, Barreiro AM, Lenhart A, Manrique-Saide P, et al. (2019) Fine-scale spatial and temporal dynamics of kdr haplotypes in Aedes aegypti from Mexico. Parasite Vector 12: 20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Francis S, Saavedra-Rodriguez K, Perera R, Paine M, Black IV WC, et al. (2017) Insecticide resistance to permethrin and malathion and associated mechanisms in Aedes aegypti mosquitoes from St. Andrew Jamaica. PloS ONE 12: e0179673 10.1371/journal.pone.0179673 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Kandel Y, Vulcan J, Rodriguez SD, Moore E, Chung HN, et al. (2019) Widespread insecticide resistance in Aedes aegypti L. from New Mexico, U.S.A. PLoS One 14: e0212693 10.1371/journal.pone.0212693 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Badolo A, Sombie A, Pignatelli PM, Sanon A, Yameogo F, et al. (2019) Insecticide resistance levels and mechanisms in Aedes aegypti populations in and around Ouagadougou, Burkina Faso. PLoS Negl Trop Dis 13: e0007439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Srisawat R, Komalamisra N, Apiwathnasorn C, Paeporn P, Sittiruk R, et al. (2012) Field-collected permethrin-resistant Aedes aegypti from central Thailand contain point mutations in the domain IIS6 of the sodium channel gene (kdr). SE Asian J Trop Med 43: 1380–1386. [PubMed] [Google Scholar]
  • 81.Fernando SD, Hapugoda M, Perera R, Saavedra-Rodriguez K, Black WC, et al. (2018) First report of V1016G and S989P knockdown resistant (kdr) mutations in pyrethroid-resistant Sri Lankan Aedes aegypti mosquitoes. Parasite Vector 11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Brito L, Linss J, Lima-Camara T, Belinato T, Peixoto A, et al. (2013) Assessing the effects of Aedes aegypti kdr mutations on pyrethroid resistance and its fitness cost. PLoS ONE 8: e60878 10.1371/journal.pone.0060878 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Kuno G (2010) Early history of laboratory breeding of Aedes aegypti (Diptera: Culicidae) focusing on the origins and use of selected strains. J Med Entomol 47: 957–971. 10.1603/me10152 [DOI] [PubMed] [Google Scholar]
  • 84.Stell FM, Roe RM, Arellano C, Kennedy L, Thornton H, et al. (2012) Proof of concept for a novel insecticide bioassay based on sugar feeding by adult Aedes aegypti (Stegomyia aegypti). Med Vet Entomol 27: 284–297. 10.1111/j.1365-2915.2012.01048.x [DOI] [PubMed] [Google Scholar]
  • 85.Perich MJ, Rocha O, Castro L, Alfaro W, Platt KB, et al. (2003) Evaluation of the efficacy of lambda-cyhalothrin applied by three spray application methods for emergency control of Aedes aegypti in Costa Rica. J Am Mosq Control Assoc 19: 58–62. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Pattern sequences concatenated E6-8, V410L codon (GTA for V, TTA for L), E20-21, F1534C codon (TTC for F, TGC for C) and E31-32 in Vssc in A. aegypti.

(XLSX)

S1 Fig. The sequence alignment of haplotypes of E6-8 in Vssc of A. aegypti.

The sequences were determined by direct sequencing of PCR products using reverse primers. The introns are shaded and bases differing from the majority are red.

(DOCX)

S2 Fig. The sequence alignment of haplotypes in E20-21 in Vssc of A. aegypti.

The sequences were determined by direct sequencing of PCR products using reverse primer. The introns are shaded and bases differing from the majority are red. # S989P mutation (TCC for S989, CCC for 989P), * and & V1016I and V1016G mutations (GTA for V1016, ATA for V1016I, GGA for 1016G), respectively. The introns of V4, V8 and V9 belong to haplotype group A, others belong to haplotype group A according to Martins et al. 2009 [55].

(DOCX)

S3 Fig. The sequence alignment of haplotypes in E30-31 in Vssc of A. aegypti.

The sequences were determined by direct sequencing of PCR products using reverse and forward primers. The intron is shaded and bases differing from the majority are red.

(DOCX)

Data Availability Statement

All relevant data are submitted to GenBank (accession numbers: MK977825-MK977851), and within the manuscript and its Supporting Information files.


Articles from PLoS Neglected Tropical Diseases are provided here courtesy of PLOS

RESOURCES