Skip to main content
Wiley - PMC COVID-19 Collection logoLink to Wiley - PMC COVID-19 Collection
. 2011 Nov 25;163(4):1217–1243. doi: 10.1111/j.1096-3642.2011.00747.x

Molecular systematics of the Philippine forest skinks (Squamata: Scincidae: Sphenomorphus): testing morphological hypotheses of interspecific relationships

CHARLES W LINKEM 1,, ARVIN C DIESMOS 2, RAFE M BROWN 1
PMCID: PMC7165859  PMID: 32336789

Abstract

Skinks of the genus Sphenomorphus are the most diverse clade of squamates in the Philippine Archipelago. Morphological examination of these species has defined six phenotypic groups that are commonly used in characterizations of taxonomic hypotheses. We used a molecular phylogeny based on four mitochondrial and two nuclear genes to assess the group's biogeographical history in the archipelago and examine the phylogenetic validity of the currently recognized Philippine species groups. We re‐examined traditional characters used to define species groups and used multivariate statistics to quantitatively evaluate group structure in morphometric space. Clustering analyses of phenotypic similarity indicate that some (but not all) members of previously defined species groups are phenotypically most similar to other members of the same group. However, when species group membership was mapped on our partitioned Bayesian phylogenetic hypothesis, only one species group corresponds to a clade; all other species group arrangements are strongly rejected by our phylogeny. Our results demonstrate that (1) previously recognized species group relationships were misled by phenotypic convergence; (2) Sphenomorphus is widely paraphyletic; and (3) multiple lineages have independently invaded the Philippines. Based on this new perspective on the phylogenetic relationships of Philippine Sphenomorphus, we revise the archipelago's diverse assemblage of species at the generic level, and resurrect and/or expand four previously recognized genera, and describe two new genera to accommodate the diversity of Philippine skinks of the Sphenomorphus group.

© 2011 The Linnean Society of London, Zoological Journal of the Linnean Society, 2011, 163, 1217–1243.

Keywords: Australia, Lipinia, new genera, Papuascincus, Parvoscincus, Scincella, Sphenomorphus group, South‐East Asia, taxonomy

INTRODUCTION

The majority of lizard species in the family Scincidae are found in the subfamily Lygosominae, which is divided into three groups (Greer, 1979). The Sphenomorphus group is one of the largest assemblages of squamates on earth, including approximately 30 genera and 500 species defined by the shared presence of several morphological synapomorphies (Greer, 1979). Of these, Sphenomorphus Fitzinger is the most species‐rich genus (145 species) but the definition of this taxon remains enigmatic because of the lack of clear synapomorphies. Greer & Shea (2003) stated that ‘Sphenomorphus is undiagnosable and is almost certainly not monophyletic’ and Myers & Donnelly (1991) referred to Sphenomorphus as ‘a plesiomorphic taxon not at present definable by derived characters’. Originally named by Fitzinger (1843), Sphenomorphus was not recognized by Boulenger (1887) in his catalogue of lizards, but was later designated as a section of Lygosoma by Smith (1937). Mittleman (1952) redefined Sphenomorphus as a genus based on the presence of large prefrontals, paired frontoparietals, enlarged precloacals, exposed auricular openings, and large limbs. Mittleman's definition of the taxon is only slightly improved from Boulenger's (1887) definition of Lygosoma, and only includes plesiomorphic characters. Since that time, the genus has been gradually partitioned, as new taxa defined by novel, apomorphic characters have been described (Ctenotus Storr, 1969; Eremiascincus Greer, 1979; Lankascincus Greer, 1991; Leptoseps Greer, 1997; Oligosoma Girard, 1857; Parvoscincus Ferner, Brown & Greer, 1997; Sigaloseps Sadlier, 1987). However, other genera (Otosaurus, Insulasaurus, Ictiscincus, Parotosaurus) have been combined with Sphenomorphus (Loveridge, 1948; Mittleman, 1952; Greer & Parker, 1967). Although the composition of the genus has changed through time, species diversity remains high because of the lack of diagnostic characters, which has resulted in many new species being artificially assigned to Sphenomorphus. Currently, Sphenomorphus occur in South‐East Asia, Asia, Indochina, and Central America.

Two series of taxonomic revisions of Philippine Sphenomorphus provided an initial insight into the diversity of this assemblage. 1922a, 1922b, 1922c, 1923, 1925) recognized 19 species of Philippine forest skinks in the genera Otosaurus, Insulasaurus, and Sphenomorphus. In their review of Philippine scincids, Brown & Alcala (1980) followed Greer & Parker (1967) in placing Otosaurus and Insulasaurus in synonymy with Sphenomorphus. In addition, they synonymized several species recognized by Taylor and described four new species (reviewed by Brown et al., 2010). Six additional species were described (Brown, 1995; 2010, 1999; Linkem, Diesmos & Brown, 2010a), and one species was moved to the genus Parvoscincus (Ferner et al., 1997). Twenty‐eight endemic species are recognized as a result of these revisions and descriptions, making Sphenomorphus the most diverse squamate genus in the Philippines (Brown et al., 2010).

Taxonomy and biogeography of Philippine Sphenomorphus

Species diversity in the Philippines is intrinsically linked to the geological history of the region (Heaney, 1985; Brown & Diesmos, 2001 (2002), 2009). The Philippine archipelago formed during the last 15 Myr as continental plate movement and volcanism caused the emergence of multiple large oceanic islands (Hall, 1998). During low sea‐level stands of the Pleistocene, islands separated by shallow channels were connected by land allowing for faunal and floral range expansion through dispersion and dispersal (Fig. 1: Brown & Guttman, 2002; Roberts, 2006a, 2006b). These connected islands are often referred to as Pleistocene aggregate island complexes (PAICs). Species are commonly endemic to a single PAIC, although some species span multiple PAICs. Sphenomorphus atrigularis, Sphenomorphus beyeri, Sphenomorphus boyingi, Sphenomorphus diwata, Sphenomorphus hadros, Sphenomorphus igorotorum, Sphenomorphus kitangladensis, Sphenomorphus laterimaculatus, Sphenomorphus lawtoni, Sphenomorphus leucospilos, Sphenomorphus luzonensis, Sphenomorphus tagapayo, Sphenomorphus traanorum, Sphenomorphus wrighti, and Sphenomorphus victoria only occur on one island. Sphenomorphus acutus, Sphenomorphus arborens, Sphenomorphus bipartalis, Sphenomorphus fasciatus, Sphenomorphus llanosi, Sphenomorphus mindanensis, and Sphenomorphus variegatus are endemic to a single PAIC and can be found on multiple islands within that PAIC. Sphenomorphus abdictus, Sphenomorphus coxi, Sphenomorphus cumingi, Sphenomorphus decipiens, Sphenomorphus jagori, and Sphenomorphus steerei have widespread distributions occurring on more than one PAIC.

Figure 1.

Figure 1

A map of the Philippine Islands with the major landmasses labelled. The light grey areas depict the 120 m bathymetric contour that joined some neighbouring islands into Pleistocene aggregate island complexes (PAICs).

In addition to the 28 endemic species, three species are partitioned into two subspecies: Sphenomorphus abdictus abdictus, Sphenomorphus abdictus aquilonius, Sphenomorphus coxi coxi, Sphenomorphus coxi divergens, Sphenomorphus jagori grandis and Sphenomorphus jagori jagori. These 31 taxonomic units are organized into six groups in the foundational work of Brown & Alcala (1980); although not created in a phylogenetic framework, these groups have served as convenient phenotypic categories for diagnoses of new species (e.g. Brown, Ferner & Greer, 1995; Ferner et al., 1997; 2010, 1999; Linkem, Diesmos & Brown, 2010a) and as the basis for hypotheses of evolutionary relationships (Linkem et al., 2010b). Each group is diagnosed by a combination of morphological features. Some Philippine groups are similar to Sphenomorphus species groups that occur outside of the Philippines (Greer & Parker, 1967). The species in each of the Brown & Alcala (1980) groups are summarized below.

Group 1 Sphenomorphus are distinguished by moderate body size, high numbers of paravertebral scales (> 88), and a preference for high elevation, montane habitats (Table 1). Brown & Alcala (1980) placed two species in Group 1, Sphenomorphus beyeri and Sphenomorphus diwata, but a recent taxonomic revision (Brown et al., 2010) identified three additional species in this group –Sphenomorphus boyingi, Sphenomorphus hadros, and Sphenomorphus igorotorum. Most species in Group 1 are Luzon endemics, the only exception being Sphenomorphus diwata, which is restricted to eastern Mindanao (Fig. 1).

Table 1.

Taxonomic groups based on Brown & Alcala (1980) and the characters used to diagnose them

Species group Species included Character support for group
Group 1 Sphenomorphus beyeri, Sphenomorphus boyingi, Sphenomorphus diwata, Sphenomorphus hadros, Sphenomorphus igorotorum Moderate size, > 88 paravertebral scales
Group 2 Sphenomorphus atrigularis, Sphenomorphus biparietalis, Sphenomorphus lawtoni, Sphenomorphus luzonensis, Sphenomorphus steerei, Sphenomorphus tagapayo, P. palawanensis, P. sisoni Small size, with small digits
Group 3 Sphenomorphus acutus, Sphenomorphus laterimaculatus, Sphenomorphus leucospilos, Sphenomorphus kitangladensis, Sphenomorphus mindanensis, Sphenomorphus victoria Midbody scales 30–40, toe IV lamellae 15–20
Group 4 Sphenomorphus arborens, Sphenomorphus cumingi, Sphenomorphus decipiens, Sphenomorphus traanorum, Sphenomorphus variegatus, Sphenomorphus wrighti Midbody scales 36–54, toe IV lamellae 20–28
Group 5 Sphenomorphus abdictus abdictus, Sphenomorphus abdictus aquilonius, Sphenomorphus coxi coxi, Sphenomorphus coxi divergens, Sphenomorphus jagori grandis, Sphenomorphus jagori jagori, Sphenomorphus llanosi Large size, midbody scales 32–44, toe IV lamellae > 20
Group 6 Sphenomorphus fasciatus Limbs do not overlap, midbody scales < 36

Group 2 comprises small species with small digits (Table 1). Brown & Alcala (1980) described Group 2 as ‘a somewhat artificial assemblage’, but specified that Sphenomorphus atrigularis, Sphenomorphus lawtoni, and Sphenomorphus steerei were closely related, and that Sphenomorphus biparietalis was most similar to Sphenomorphus hallieri from Borneo. The authors also included Sphenomorphus luzonensis and Sphenomorphus palawanensis in Group 2. The discovery of Parvoscincus sisoni led to the transfer of Sphenomorphus palawanensis to the genus Parvoscincus (Ferner et al., 1997). As the two species of Parvoscincus resemble Group 2 species morphologically, we conditionally consider them as members of this group for the purpose of this review of phenotypic variation. The most recent species added to Group 2 was Sphenomorphus tagapayo (Brown et al., 1999); giving a total of eight species in Group 2. Most species in this group have limited distributions, with Sphenomorphus lawtoni, Sphenomorphus luzonensis, and Sphenomorphus tagapayo occurring only in limited regions of Luzon Island; Sphenomorphus atrigularis in western Mindanao; Sphenomorphus biparietalis in the Sulu Archipelago; Parvoscincus palawanensis on Palawan Island; and Parvoscincus sisoni on Panay Island. Sphenomorphus steerei ranges throughout the archipelago.

Group 3 consists of small‐to‐intermediate‐sized, slender‐bodied species with midbody scale rows 30–40, and lamellae beneath toe IV 15–20 (Table 1). Group 3 was considered most similar to Bornean Sphenomorphus murudensis and Sphenomorphus kinabaluensis, which are part of the Greer & Parker (1967) Sphenomorphus variegatus group. Brown & Alcala (1980) partitioned Philippine species of Greer & Parker's (1967) Sphenomorphus variegatus group into Groups 3 and 4 (see below) based on the ratio of midbody scale rows to lamellae beneath toe IV, which were on average fewer in Group 3 species than Group 4 species. Brown & Alcala (1980) placed the following species in Group 3: Sphenomorphus leucospilos, Sphenomorphus mindanensis, Sphenomorphus victoria, Sphenomorphus laterimaculatus, and Sphenomorphus acutus. Sphenomorphus acutus does not fit into any of Brown & Alcala's (1980) groups, but resembles Groups 3 and 4, and was placed in Group 3 by Brown & Alcala (1980). The Group 3 species occur in disparate parts of the archipelago, with Sphenomorphus laterimaculatus and Sphenomorphus leucospilos occurring on Luzon Island, Sphenomorphus victoria on Palawan Island, and Sphenomorphus mindanensis and Sphenomorphus acutus broadly distributed on Mindanao, Samar, and Leyte. Since Brown & Alcala's (1980) review, Brown (1995) described another Group 3 species, Sphenomorphus kitangladensis, from eastern Mindanao (Brown, 1995).

Brown & Alcala's (1980) Group 4 contains most Philippine members of Greer & Parker's (1967) Sphenomorphus variegatus group, defined by midbody scale rows 36–54 and lamellae beneath toe IV 20–28 (Table 1). This group includes the following species: Sphenomorphus arborens, Sphenomorphus cumingi, Sphenomorphus decipiens, Sphenomorphus variegatus, and Sphenomorphus wrighti. A new species was recently described in Group 4 –Sphenomorphus traanorum (Linkem, Diesmos & Brown, 2010a). Two Group 4 species are widespread in the archipelago, Sphenomorphus cumingi and Sphenomorphus decipiens. The others have more limited distributions, with Sphenomorphus wrighti and Sphenomorphus traanorum occurring on Palawan Island, Sphenomorphus arborens on Negros, Panay, and Masbate, and Sphenomorphus variegatus on Mindanao, Samar, Leyte, and Bohol.

Brown & Alcala's (1980) Group 5 was the only group that the authors considered a natural assemblage. It includes large [snout–vent length (SVL) > 53 mm] species with midbody scale rows 32–44, and > 20 toe IV subdigital lamellae (Table 1). Brown & Alcala (1980) placed Sphenomorphus abdictus abdictus, Sphenomorphus abdictus aquilonius, Sphenomorphus jagori grandis, Sphenomorphus jagori jagori, Sphenomorphus coxi coxi, Sphenomorphus coxi divergens, and Sphenomorphus llanosi in this group. Linkem et al. (2010b) corroborated the monophyly of Group 5, but demonstrated that many of the species and subspecies within the group do not correspond to the clades identified in phylogenetic analysis of mitochondrial DNA sequence data, thereby suggesting the need for a comprehensive review.

Brown & Alcala's (1980) Group 6 was considered a member of Greer & Parker's (1967) Sphenomorphus fasciatus group and contains only one species, Sphenomorphus fasciatus, found on Mindanao, Bohol, Camiguin Sur, Dinagat, Samar, and Leyte Islands.

Here we test whether Brown & Alcala's cohesive and largely unchallenged phenotypic groupings represent natural assemblages (see also 1995, 2010). First, we assess whether there is statistically significant phylogenetic support for the morphological species classifications of Brown & Alcala (1980). We then determine whether these supraspecific assemblages are natural monophyletic groups or whether these apparently cohesive phenotypic clusters of taxa represent instances of morphological convergence. In the context of these broad goals, we address three specific questions. (1) Are the morphologically cohesive, phenotypically defined species groups of Brown & Alcala (1980) natural, monophyletic units or has convergent evolution obscured and confounded our understanding of evolutionary trends in Philippine Sphenomorphus? (2) Are Philippine Sphenomorphus species derived from a single common ancestor, or is this diversity the product of multiple invasions from Asian and/or Papuan sources? (3) Is our current understanding of Sphenomorphus species diversity accurate (28 species), or is species diversity as grossly underestimated as suggested by recent studies (Brown et al., 2010; Linkem et al., 2010b)?

MATERIAL AND METHODS

Taxon sampling

To adequately examine the relationships amongst Philippine Sphenomorphus, we included 131 samples of lygosomine skinks, representing 64 described species (Appendix). Sampling was predominantly from the Sphenomorphus group (53 species), with representatives from the Eugongylus (six species) and Mabuya groups (five species). We also incorporated representatives from the ‘Scincinae’ genus Plestiodon (Plestiodon anthracinus, Plestiodon fasciatus, and Plestiodon quadrilineatus), and from the families Xantusiidae (Xantusia vigilis) and Lacertidae (Tachydromus sexilineatus).

We included samples from the following Sphenomorphus group genera: Lipinia, Papuascincus, Parvoscincus, Scincella, Glaphyromorphus, Eulamprus, Eremiascincus, and Hemiergis. The latter four genera are part of the Australian clade of the Sphenomorphus group, which is an assemblage of 15 genera previously shown to be well supported (Reeder, 2003; Rabosky et al., 2007; Skinner, 2007). We did not include all of the previously published data for this Australian clade because previous studies have found it to have high support, although these analyses lacked adequate outgroup sampling. We ran preliminary analyses (not shown) of our sampling in combination with all the Australian clade genera and found that the Australian clade maintained high support. Thus, we excluded members of the Australian clade to reduce the computational burden associated with this large data set.

We collected 27 of the 28 currently recognized species of Philippine Sphenomorphus and included samples of the three subspecies for a total of 30 taxonomic units sampled from the archipelago. We could not sample the species Sphenomorphus biparietalis because it occurs in the Sulu Archipelago, a region inaccessible to researchers. Similarly, Parvoscincus palawanensis has not been observed by researchers since its original collection and no genetic samples are available. For two widespread species (Sphenomorphus decipiens and Sphenomorphus steerei), we incorporated samples from multiple populations to maximize geographical coverage across known biogeographical boundaries such as mountain ranges and marine channels (Brown & Diesmos, 2001 (2002), 2002), 2009). Sampling comprised each of the 11 clades of the Sphenomorphus abdictusSphenomorphus coxiSphenomorphus jagori complex of Linkem et al. (2010b). We included available non‐Philippine Sphenomorphus from Borneo, Sulawesi, Indochina, China, the Solomon Islands, Central America, and Palau (Appendix). Sampling for Sphenomorphus and the Sphenomorphus group was far from inclusive, but was sufficient to address the questions that were the focus of this study.

Morphological data and analyses

Brown & Alcala (1980) based their morphological groupings on a combination of (1) snout–vent length, (2) number of scales around the mid‐body, (3) paravertebral scales, and (4) subdigital lamellae of the fourth toe of the right foot (Table 1). As we sought to determine whether Brown & Alcala's classification reflects natural phenotypic variation in the characters that vary amongst Philippine Sphenomorphus, we measured and counted the same characters on adults for all species of Philippine Sphenomorphus (see Brown et al., 2010 for a list of specimens examined). Scale counts, except mid‐body scale rows, were taken on the right side of the body and the average value of each species was used for subsequent multivariate analyses (Table 2). Morphological data were analysed in the R statistical package and in JMP8 (SAS Institute Inc.). We used the unweighted pair group method with arithmetic mean (UPGMA: Sokal & Michner, 1958) to create a phenogram of the morphological characters. Principal components analysis (PCA) was conducted using a correlation matrix on the raw scale counts for midbody scale rows and subdigital lamellae and log‐transformed paravertebral scale rows and snout–vent length. Log‐transformation was needed for the last two variables to achieve a normal distribution. The use of a correlation matrix standardized the variables with a zero mean and unit standard deviation, which is important when variables are not all of the same scale.

Table 2.

Morphological data used for principal components analysis and morphological clustering. Values are averages for each species. See Brown et al. (2010) for list of specimens examined

Species SVL PV MBSR SDL
Parvoscincus palawanensis 31.2 51.0 23.0 11.0
Parvoscincus sisoni 30.1 65.0 25.0 11.5
Sphenomorphus abdictus 86.2 68.5 39.0 23.0
Sphenomorphus abdictus aquionius 87.1 67.5 36.0 22.5
Sphenomorphus acutus 69.6 57.0 28.0 32.0
Sphenomorphus arborens 55.5 69.5 37.5 20.0
Sphenomorphus atrigularis 32.0 56.5 29.0 9.5
Sphenomorphus beyeri 65.4 95.0 40.0 19.5
Sphenomorphus biparietalis 33.7 64.5 32.0 10.0
Sphenomorphus boyingi 56.4 92.0 39.5 20.0
Sphenomorphus coxi coxi 75.0 67.0 35.0 22.5
Sphenomorphus coxi divergens 76.5 69.5 39.0 23.5
Sphenomorphus cumingi 135.8 82.5 51.0 24.5
Sphenomorphus decipiens 38.1 61.5 35.0 16.0
Sphenomorphus diwata 55.0 91.5 40.0 15.0
Sphenomorphus fasciatus 69.9 84.0 30.0 22.0
Sphenomorphus hadros 80.1 109.5 46.0 20.0
Sphenomorphus igorotorum 54.7 102.0 44.5 20.0
Sphenomorphus jagori grandis 90.2 74.0 41.0 25.0
Sphenomorphus jagori jagori 89.9 68.0 38.0 27.0
Sphenomorphus kitangladensis 53.5 74.5 36.0 16.0
Sphenomorphus laterimaculatus 49.6 78.5 36.0 17.5
Sphenomorphus lawtoni 40.1 61.0 28.5 13.5
Sphenomorphus leucospilos 53.5 65.5 31.0 17.0
Sphenomorphus llanosi 80.5 68.5 40.0 22.0
Sphenomorphus luzonensis 43.9 69.0 28.0 10.5
Sphenomorphus mindanensis 49.0 72.0 31.0 18.5
Sphenomorphus steerei 31.2 58.0 30.0 11.5
Sphenomorphus tagapayo 27.6 57.5 29.0 10.0
Sphenomorphus traanorum 50.6 65.5 31.0 16.0
Sphenomorphus variegatus 56.3 71.0 41.0 22.0
Sphenomorphus victoria 46.1 65.0 31.0 19.0
Sphenomorphus wrighti 59.0 74.5 39.0 23.5

MBSR, Midbody scale rows; PV, Paravertebrals; SDL, Subdigital lamellae; SVL, snout–vent length.

Gene choice and data collection

Tissue samples were extracted using a guanidine thiocyanate protocol modified from the PureGene protocol (Esselstyn, Timm & Brown, 2009, based on a protocol developed by M. Fujita, pers. comm.). Each extraction was amplified for the genes of interest (Table 3) through standard PCR protocols (Palumbi, 1996). PCR products were purified with ExoSAPit (USB corp.) with a 20% dilution of stock ExoSAPit, incubated for 30 min at 37 °C and then 80 °C for 15 min. Cleaned PCR products were dye‐labelled using Big‐Dye terminator 3.1 (Applied Biosystems), purified using Sephadex (NC9406038, Amersham Biosciences, Piscataway, NJ), and sequenced on an ABI 3730 automated capillary sequencer. Raw sequence data were processed using SEQUENCING ANALYSIS software (Applied Biosystems). Individual sequence chromatograms were examined in SEQUENCHER v. 4.2 and individual single‐stranded fragments were assembled into contiguous consensus reads for subsequent analysis. Consensus sequences for each individual for each gene were aligned using MUSCLE v. 3.6 (Edgar, 2004) with default settings. By‐eye adjustment of alignments and verification of coding frame was carried out in Se‐Al v.2.0a11 (http://tree.bio.ed.ac.uk/software/seal). RNA alignments were adjusted to maintain correct secondary structure based on the structure profile of skinks in Brandley, Schmitz & Reeder (2005).

Table 3.

Primer sequences used in this study

Gene Primer name Sequence: 5′–3′ Citation
ND2 Metf6 AAGCTTTCGGGCCCATACC Macey et al., 1997
SphenoR TAGGYGGCAGGTTGTAGCCC Linkem et al., 2010b
ND2sphR CTCTTDTTTGTRGCTTTGAAGGC Linkem et al., 2010b
12S 12S.H1478 GAGGGTGACGGGCGGTGTGT Kocher et al., 1989
12S.L1091 AAACTGGGATTAGATACCCCACTAT Kocher et al., 1989
16S 16SF.SKINK TGTTTACCAAAAACATAGCCTTTAGC Whiting, Bauer & Sites, 2003
16SR.SKINK TAGATAGAAACCGACCTGGATT Whiting et al., 2003
ND4 ND4 CACCTATGACTACCAAAAGCTCATGTAGAAGC Arevalo, Davis & Sites, 1994
tHis ATCCTTTAAAAGTGARGRGTCT T. Reeder (pers. comm.)
NGFB NGFBF_F2 GATTATAGCGTTTCTGATYGGC Townsend et al., 2008
NGFBR_R2 CAAAGGTGTGTGTWGTGGTGC Townsend et al., 2008
R35 R35F GACTGTGGAYGAYCTGATCAGTGTGGTGCC Leaché, 2009
R35R GCCAAAATGAGSGAGAARCGCTTCTGAGC Leaché, 2009

We chose a variety of mitochondrial and nuclear genes to estimate the phylogeny of this group (Table 3). We sequenced the mitochondrial genes Nicotinamide Adenine Dinucleotide (NADH) dehydrogenase subunit 2 (ND2: 1095 bp) and subunit 4 (ND4: 705 bp), and ribosomal 12S (447 bp) and 16S (518 bp) genes as well as two nuclear genes, nerve growth factor beta polypeptide (NGFB: 567 bp) and RNA fingerprint protein 35 (R35: 689 bp). These genes were sequenced for the majority of our novel samples (Appendix), although some sample and gene combinations could not be amplified and were coded as missing data in the matrix. We did not have samples of the Australian group taxa and could therefore only include previously published data, which is limited to 12S, 16S, and ND4. Simulation and empirical studies have suggested that robust estimates of phylogeny can still be obtained despite the presence of missing data, especially when many characters are sampled (Wiens, 2003; Philippe et al., 2004; Wiens & Moen, 2008). As a result, we are not concerned about the missing data in our data set affecting our estimate of phylogeny.

All data are available on GenBank (JF497855–JF498576) and alignments can be downloaded from Dryad (http://datadryad.org/doi:10.5061/dryad.30064)

Gene concatenation, partitioning strategy, model choice, and phylogenetic analyses

Our mitochondrial gene sampling is very similar to other studies on skinks, allowing us to make some assumptions in regard to concatenation and partitioning. In addition to two mitochondrial genes (12S, 16S) used in Brandley et al. (2005), we sequenced ND2 and ND4, which have been informative in Sphenomorphus group skinks (Reeder, 2003; 2010a, 2010b). We assumed that these mitochondrial genes share a single evolutionary history as a result of matrilineal inheritance and the lack of recombination of the mitochondrion. Brandley et al. (2005) found that the best partitioning strategy for mitochondrial genes was to partition by gene, codon, and ribosomal secondary structure. We therefore concatenated our mitochondrial genes following the partitioning strategy of Brandley et al. (2005) for an 11 partition mitochondrial data set. The nuclear genes we sampled have not been used in skink phylogenetics, so we tested whether they should be partitioned by codon or analysed as a continuous gene. We analysed each gene in MrModelTest v2.2 (Nylander, 2004) to estimate the best‐fit nucleotide substitution model, using the Akaike information criterion (AIC) to select the appropriate model. When multiple models had similar scores, we chose the most parameter‐rich model within ten AIC units of the best AIC model (Table 4). We assumed that partitions within genes (codons and ribosomal secondary structure) have the same overall model as the entire gene because simulations have shown that choosing the correct model may be difficult with a few hundred characters (Posada & Crandall, 2001).

Table 4.

Summary of the model of evolution selected using MrModelTest for each partition. Partitions within genes are assumed to share the partition of the whole gene (see text for justification)

Gene partition Model of substitution based on AIC Informative characters Uninformative characters Constant characters Total
ND2 GTR + I + G 703 56 270 1029
12S GTR + I + G 216 29 200 445
16S GTR + I + G 195 51 266 512
ND4 + tRNA GTR + I + G 503 56 287 846
NGFB GTR + I + G 230 55 282 567
R35 GTR + I + G 307 60 322 689
Total 2154 307 1627 4088

AIC, Akaike information criterion; GTR, general time reversible; I, invariant sites; G, gamma.

In order to combine the nuclear and mitochondrial data we tested for statistically significant incongruent phylogenetic relationships amongst the gene trees to ensure that each gene tracks the same evolutionary history. We conducted partitioned Bayesian phylogenetic analyses using MrBayes v. 3.2 (Huelsenbeck & Ronquist, 2001) of each nuclear gene and the mitochondrial data set separately. Each data set was run with four independent analyses for 20 million generations sampling every 1000 generations. Partitioned Bayesian analyses were completed with rates across partitions unlinked and the prior on branch lengths adjusted to exponential base 100 (Marshall, Simon & Buckley, 2006; Marshall, 2010). Chain convergence on the same posterior distribution was assessed using TRACER v. 1.5 (Rambaut & Drummond, 2007) and Are We There Yet (AWTY: Wilgenbusch, Warren & Swofford, 2004; Nylander et al., 2007). The compare function in AWTY was used to ensure split frequencies were similar across separate runs, ensuring topological congruence. Majority rule consensus topologies of the posterior distributions from the multiple runs were summarized using the ‘sumt’ command in MrBayes v. 3.2. We found no statistically significant incongruent phylogenetic relationships amongst gene trees (Posterior Probability ≥ 0.95; Huelsenbeck & Rannala, 2004) so we combined the nuclear and mitochondrial genes into a single data set for subsequent phylogenetic analysis.

Our combined data set was analysed with two different partitioning schemes, varying the partitioning of the nuclear data: P14, nuclear genes partitioned by codon; P17 nuclear genes partitioned by gene and codon (Table 5). We compared these partitioning strategies using Bayes factors (Nylander et al., 2004; Brandley et al., 2005). Analyses of the combined data used the same protocol as the individual genes mentioned above. All four analyses of the combined data sets for each partitioning strategy converged on the same posterior distribution within two million generations.

Table 5.

Different partitioning strategies employed for concatenated Bayesian phylogenetic analyses. The last column shows the Bayes factor (BF) difference between the two partitioning strategies

Partitioning strategy Gene type Partitions BF difference to P14
P14 Mitochondrial + nuclear 12Sstems, 12Sloops, 16Sstems, 16Sloops, ND2pos1, ND2pos2, ND2pos3, ND4pos1, ND4pos2, ND4pos3, tRNA, nucDNApos1, nucDNApos2, nucDNApos3
P17 Mitochondrial + nuclear 12Sstems, 12Sloops, 16Sstems, 16Sloops, ND2pos1, ND2pos2, ND2pos3, ND4pos1, ND4pos2, ND4pos3, tRNA, NGFBpos1, NGFBpos2, NGFBpos3, R35pos1, R35pos2, R35pos3 53.72

Testing alternative phylogenetic hypotheses

We used a Bayesian approach to test alternative phylogenetic relationships not represented in our consensus tree. We calculated a 95% credibility set of unique trees in the posterior distribution using the sumt command in MrBayes. We rejected the alternative phylogenetic hypothesis if it was absent from any tree in the 95% credible set.

RESULTS

Morphological groups

Our statistical analyses of the four morphological variables used by Brown & Alcala (1980) corresponded to most of their phenotypic groupings (Fig. 2). Each of Groups 1, 2, and 5 form morphological clusters in the UPGMA tree, equivalent to the findings of Brown & Alcala (1980). Groups 3 and 4 did not form morphological clusters; however, this seems to reflect the morphological divergence of Sphenomorphus acutus and Sphenomorphus cumingi (Fig. 2). Morphological clustering places these two species as morphologically divergent from all other Philippine Sphenomorphus. The other species that do not fit within morphological clusterings of Group 3 and 4 are Sphenomorphus traanorum, which Linkem, Diesmos & Brown (2010a) placed in Group 4, and Sphenomorphus decipiens, which Brown & Alcala considered part of Group 4.

Figure 2.

Figure 2

Molecular phylogeny, morphological unweighted pair group method with arithmetic mean (UPGMA) clustering, and principal components analysis (PCA) plot for Philippine Sphenomorphus. The molecular phylogeny is the Bayesian maximum consensus tree from the combined 17‐partition analysis. Posterior probability values equal or greater than 0.95 are black circles, above 0.75 are white circles, and below 0.75 are not shown. Morphological UPGMA clustering was calculated in JMP using average distances. The PCA plot is for PC1 and PC2 in Table 7. Species groups from Brown & Alcala (1980) are colour‐coded. Morphological UPGMA clustering shows species groups are morphologically congruent, but the phylogeny demonstrates that the same morphological types are convergent.

Morphological variation of the four variables was summarized with PCA (Table 6). Most of the variation among species is explained by size (69%). Principal component 2 explains 22% of the morphological variation and is primarily a shape axis of variation in paravertebral scales and midbody scale rows in relation to size. Groups 1, 2, and 5 are separated by PC axis 1 and moderately separate on PC axis 2 (shape). Groups 3 and 4 have a region of broad overlap, with most of the variation for Group 4 being the result of size and that of Group 3 the result of shape. Group 6 falls within Group 4. The range of variation for Group 4 would be smaller if the outlying point at the far right of PC1 was not included. This point is represented by the very large species Sphenomorphus cumingi. Similarly, Group 3 would be more compact if the morphologically disparate species Sphenomorphus acutus was not included. Comparing the morphological species classifications mapped onto the PCA plot and our best estimate of phylogeny, it is clear that the morphologically cohesive phenotypic classifications of Brown & Alcala (1980) are predominated by evolutionary convergence, with the only exception being Group 5, which is monophyletic.

Table 6.

Results of principal components analysis (PCA)

Variable PC1 PC2 PC3 PC4
log(PV) 0.42098 0.70214 0.57273 −0.042
MBSR 0.53437 0.28797 −0.72137 0.33339
SDL 0.48329 −0.56911 0.38239 0.54435
log(SVL) 0.55105 −0.31652 −0.07338 −0.76862
Eigenvalue 2.7976 0.8726 0.2251 0.1047
Percent of variation 69.94 21.81 5.628 2.618

MBSR, Midbody scale rows; PV, Paravertebrals; SDL, Subdigital lamellae; SVL, snout–vent length.

Molecular phylogenetic results

We did not find any incongruent clades above 95% posterior probability between the nuclear and mitochondrial gene trees. Therefore, we concatenated the data into one matrix totalling 4096 nucleotides, in which 155 characters were ambiguous to align and excluded (from 12S and 16S). Each partition was fitted to its best‐fit model of evolution and summarized for number of parsimony informative characters, number of invariant characters, and number of uninformative characters (Table 4).

We performed two different partitioning strategy analyses on the full data set, one with the nuclear genes partitioned by gene and codon (P17) and the other with the nuclear genes partitioned by codon position (P14: Table 5). Bayes factor comparisons demonstrated that the more partitioned model is the best model of evolution. Our preferred phylogenetic tree is therefore based on the analysis of the full, 17‐partition model (Table 5).

The resulting consensus tree from the Bayesian phylogenetic analyses of the fully partitioned data set has high (≥ 0.95) posterior probability for almost all nodes (Fig. 2). This includes support for Lygosominae and the Sphenomorphus group. Other, non‐Sphenomorphus genera in the Sphenomorphus group included in this study render Sphenomorphus paraphyletic; these include Scincella, Lipinia, Papuascincus, Parvoscincus, and the genera from the diverse radiation of Australian skinks of the Sphenomorphus group (Eremiascincus, Eulamprus, Glaphyromorphus, Hemiergis).

Philippine Sphenomorphus are more diverse phylogenetically than originally expected, with multiple highly divergent and independent clades defined here. One large radiation is represented by 19 of the 28 species found in the Philippines (Fig. 3, clade I). This diverse assemblage is in a polytomy with the Australian Sphenomorphus group radiation and with Sphenomorphus cumingi. Outside of this large Philippine clade, other Philippine species of Sphenomorphus are dispersed throughout the tree, all representing separate invasions of the Philippines. Sphenomorphus atrigularis, for example, is nested within a clade of species from Borneo, Sulawesi, and peninsular Malaysia. Sphenomorphus variegatus is nested within a clade of Bornean species. Sphenomorphus arborens, Sphenomorphus wrighti, Sphenomorphus traanorum, and Sphenomorphus victoria are related to Lipinia, which is a widespread genus in South‐East Asia, and Papuascincus, a genus found on Papua New Guinea. Sphenomorphus fasciatus is nested within a clade of species from Papua New Guinea and the Solomon Islands. These separate clades represent six invasions of the Philippines, which occurred primarily via the western island arc of the Philippines.

Figure 3.

Figure 3

Molecular phylogeny from Figure 2 with sampling reduced to one sample per species. Support is the same as Figure 2. Biogeographical ranges for Sphenomorphus species are marked on the phylogeny. Clades discussed in the text are denoted with letters A–K.

DISCUSSION

Morphological variation

Sphenomorphus are often thought of as skinks without morphological novelty (Myers & Donnelly, 1991; Greer & Shea, 2003). When morphological novelties, or derived apomorphic character differences, were found within species assigned to Sphenomorphus, the taxa were recognized as different genera (e.g. Greer, 1979, 1991, 1997; Greer & Simon, 1982; Ferner et al., 1997). Our results suggest that these morphological novelties represent multiple evolutionary transitions from a generalized plesiomorphic ancestor, repeated independently throughout the range and evolutionary history of the Sphenomorphus group. One such example involves the transition from a scaly lower eyelid to a transparent ‘window’ in the lower eyelid. Within our sampling the transparent ‘window’ is found in Lipinia, Scincella, and Papuascincus (clades C and D). It is also found in Sphenomorphus assatus and northern populations of Sphenomorphus cherriei; however southern populations of Sp. cheerei have a scaly eyelid. Clade E is nested within this group of transparent ‘window’ taxa, but the taxa in clade E have the plesiomorphic state of a scaly eyelid. As Sphenomorphus cherriei and clade E both have the plesiomorphic state, there are two equally parsimonious reconstructions of this character within these taxa, one requiring two reversals to the plesiomorphic state and one requiring a convergence of the derived character with one reversal. These convergences and reversals of complex characters have contributed to the complexity of taxonomic and historical evaluations of the Sphenomorphus group.

In the case of Brown & Alcala's (1980) taxonomic groups, it seems that the characters employed for most of the groups have evolved convergently, having arisen in multiple clades; therefore, their groupings based on those characters do not reflect phylogenetic history (Fig. 2). The one exception is the Sphenomorphus abdictus–Sphenomorphus coxi–Sphenomorphus jagori complex, Group 5, which corresponds to a clade.

It is not surprising that the phenotypic assemblages of Brown & Alcala (1980) do not correspond to phylogenetic clades as Brown & Alcala (1980) emphasized the doubtful phylogenetic validity of the groups they defined. Nevertheless, their identification of diagnostic characters has proven effective for identifying and describing new species. We have shown that Brown & Alcala's (1980) species groups do form phenotypically defined statistical clusters, but that they are not necessarily the most closely related congeners. Our results therefore suggest that the characters used to define phenotypic assemblages in Philippine Sphenomorphus are convergent within the archipelago.

Similarly, our results indicate that changes in body size have occurred repeatedly in Philippine Sphenomorphus. Our results suggest that small body size evolved early within clade K (Sphenomorphus steerei, Sphenomorphus decipiens, Parvoscincus sisoni, Sphenomorphus lawtoni, Sphenomorphus leucospilos, Sphenomorphus luzonensis, Sphenomorphus tagapayo) of Philippine species, with a later reversal to increased body size, forming a group of ‘giant‐dwarfs’ (Sphenomorphus beyeri, Sphenomorphus hadros, Sphenomorphus igorotorum, Sphenomorphus boyingi, Sphenomorphus cf. decipiens sp. 4, and Sphenomorphus laterimaculatus). All of these ‘giant‐dwarf’ taxa have proportionally more scales than other Sphenomorphus in the Philippines – a fact that may be explained by scales being proportionally smaller in miniaturized Sphenomorphus (C. W. Linkem, pers. observ.) and an increase in scale number as body size increases (Greer & Parker, 1974). We speculate the increase in body size may have been necessary for the shift to high‐elevation, moist cloud forest inhabited by the group of ‘giant‐dwarfs’ on Luzon.

Geographical patterns of species relationships

Biogeographical relationships found in Philippine Sphenomorphus represent novel patterns never before inferred by phylogenetic analyses of other Philippine vertebrate taxa (Brown & Diesmos, 2009; Esselstyn et al., 2009). In particular, our results unequivocally demonstrate that the complex southern and western Philippine communities of forest skinks are assembled from multiple regions of South‐East Asia and the Papuan realm (Fig. 3). The finding that these separate invasions primarily have been restricted to clades occupying the south‐western portion of the archipelago is expected given the geographically proximate potential sources of dispersal (Inger, 1954; Brown & Alcala, 1970). Invasions seem to have originated from different directions, including two potential invasions from Borneo into Mindanao (Sphenomorphus atrigularis, and Sphenomorphus variegatus), one potential invasion from an unknown source into Palawan and Panay (Sphenomorphus arborens, Sphenomorphus traanorum, Sphenomorphus victoria, Sphenomorphus wrighti), and one potential invasion from the New Guinea faunal region into Mindanao (Sphenomorphus fasciatus). Sphenomorphus variegatus was conspecific with Sphenomorphus multisquamatus, Sphenomorphus sabanus, and Sphenomorphus simus (Inger, 1958), the first two species, sampled in this study, are from Borneo, the latter is not sampled and is from Papua New Guinea. We infer that Sphenomorphus variegatus is derived from Borneo, but future sampling of Sphenomorphus simus may show this to be incorrect. The largest clade (Clade I) of Philippine species forms a polytomy with the diverse Australian Sphenomorphus group radiation and with another Philippine species, Sphenomorphus cumingi. This finding is biogeographically unexpected and may be a result of our missing‐taxon sampling from Papua New Guinea and/or Indonesia, or of our phylogenetic misplacement because of our limited gene sampling of the Australian taxa. Outside of the Philippine taxa, clades tend to be geographically restricted, with the caveat that our sampling is taxonomically sparse in these regions (Fig. 3). Additional clades identified in our analysis include: Clade A of Malaysia, Borneo, Sulawesi, and Mindanao species; Clade B of Indochina, Borneo, and Mindanao species; Clade F of Papuan and Mindanao species; Clade G of Australian species; and Clade I of Philippine species.

It is clear that some Philippine Sphenomorphus have evolved from multiple independent origins. Only two clades (E, I) show signs of within‐archipelago speciation, with Clade I diversifying to a much greater extent than Clade E. The species in Clade E are located on the Visayan PAIC (Panay, Negros, Masbate, Guimaras) and on Palawan Island. The islands of the Visayan PAIC and Palawan are geographically distant, with more than 150 km of intervening open water.

In a recent paper Blackburn et al. (2010) presented the ‘Palawan Ark Hypothesis’ and the supposition that the portion of the island arc now consisting of Palawan, southern Mindoro, and northern Panay was potentially emergent for the last 30 million years as it drifted south‐east from continental Asia. Clade E Sphenomorphus on Panay and Palawan present a possible extension of this hypothesis, although lack of fossil calibrations prevents reliable divergence time estimation. Our current taxon sampling makes it difficult to infer if clade E is closely related to the species in Asia, Borneo, or elsewhere in South‐East Asia. Clade I shows some biogeographical patterns similar to those seen in other Philippine animals (Heaney, 1985; Kennedy et al., 2000; Brown & Diesmos, 2001 (2002), 2002), 2009), with speciation events occurring across PAIC boundaries, although there are many speciation events within PAICs. The biogeography of Clade H is discussed in detail by Linkem et al. (2010b). Generally, widespread species in Clade H do not conform to PAIC predictions and there are multiple instances of divergent clades within a species occurring sympatrically. On Luzon Island, there are multiple instances of speciation on the island within Clade K – cases of potential allopatry across mountain ranges. The most obvious example of this is the clade of Sphenomorphus beyeri, Sphenomorphus boyingi, Sphenomorphus cf. decipiens sp. 4, Sphenomorphus hadros, Sphenomorphus igorotorum, and Sphenomorphus laterimaculatus. All of these species are high‐elevation endemics found on different mountain ranges on Luzon (Brown et al., 2010). The Sphenomorphus decipiens complex may be another example, but the putative new species have not yet been described.

Species relationships

This study confirms a long‐held suspicion of researchers interested in the relationships of skinks of the Sphenomorphus group – viz., that the genus Sphenomorphus is widely paraphyletic with respect to a number of lygosomine taxa (Greer & Shea, 2003; Honda et al., 2003; Reeder, 2003). Nevertheless, the degree of paraphyly is surprising given that every genus of the Sphenomorphus group sampled is nested within Sphenomorphus sensu lato. One explanation for this problem is that Sphenomorphus was never properly defined with diagnostic characters (Myers & Donnelly, 1991; Greer & Shea, 2003). Thus, species were placed in the genus if they possessed generalized plesiomorphic character states or if their phylogenetic affinities were unclear (Grismer, Ahmad & Onn, 2009).

Clade A is a group of small skinks represented here by Sphenomorphus aesculeticola, Sphenomorphus parvus, Sphenomorphus hallieri, and Sphenomorphus atrigularis. These leaf‐litter specialists occur in Borneo, Sulawesi, Borneo, and Mindanao, respectively. When describing Sphenomorphus aesculeticola, Inger et al. (2001) hypothesized that it was most closely related to the Philippine species Sphenomorphus atrigularis, Sphenomorphus biparietalis, and Sphenomorphus luzonensis, the Bornean species Sphenomorphus buettikoferi and Sphenomorphus hallieri, and the Malaysian species Sphenomorphus malayanus and Sphenomorphus butleri. As we lack samples of Sphenomorphus buettikoferi, Sphenomorphus malayanus, and Sphenomorphus butleri, we cannot comment on the relationships of those species, but the others are closely related, except Sphenomorphus luzonensis. Recently, numerous small, diminutive species have been described from Malaysia (Grismer, 2006, 2007a, 2007b; Grismer, Ahmad & Onn, 2009; Grismer, Wood & Grismer, 2009). In the recent description of Sphenomorphus temengorensis, Grismer, Ahmad & Onn (2009) summarized the eight species of diminutive skinks in Peninsular Malaysia, all of which are morphologically and ecologically similar to the species in Clade A. We also expect that diminutive species in Indonesia: Sphenomorphus temmincki, Sphenomorphus schlegeli, Sphenomorphus sanana, Sphenomorphus textus, Sphenomorphus necopinatus, and Sphenomorphus vanheurni to be part of this clade based on morphological similarity. Expanded taxon sampling to include these other diminutive species will hopefully resolve their relationships to Clade A, or elucidate part of another convergent lineage.

The genera Lipinia, Scincella, and Papuascincus are all nested within a clade of Sphenomorphus species from Indochina, Borneo, and the Philippines (Clades B, C, D, E). The Central American Sphenomorphus species Sphenomorphus cherriei and Sphenomorphus assatus are nested within Scincella and closely related to Scincella lateralis. Lipinia is monophyletic and sister to Papuascincus. There is low support for the monophyly of Lipinia (posterior probability = 0.83), but we note that we only included Lipinia noctua and Lipinia pulchella. More sampling may increase support for this genus. Pustulated structures on the surface of the eggshells in three species of Lobulia skinks led Allison & Greer (1986) to describe Papuascincus. These structures are unique amongst skinks and may represent a reliable synapomorphy for this clade. Additionally, Greer (1974) hypothesized that Lipinia, Lobulia, and Prasinohaema were related. Given the hypothesis of Greer (1974) and that Papuascincus was previously included in Lobulia, we expect that Lobulia and Prasinohaema will be related to Clade D of Lipinia and Papuascincus.

Clade B consists of one Philippine species, Sphenomorphus variegatus, which is closely related to a clade of the Bornean species Sphenomorphus multisquamatus, Sphenomorphus sabanus, and Sphenomorphus cyanolaemus. Both Sphenomorphus multisquamatus and Sphenomorphus sabanus were considered Sphenomorphus variegatus until Inger (1958) distinguished them. The species in Clade B are part of Greer & Parker's (1967) Sphenomorphus variegatus group, which was defined based on external morphology. These skinks are considered surface dwellers and Greer & Parker (1967) included a diverse array of species in the group. The Sphenomorphus variegatus group is not monophyletic in our phylogeny, with representatives in Clade B, E, G, and K. We speculate that with increased sampling, we will find that most of the species in the Sphenomorphus variegatus group belong to Clade B. However, given the placement of some species in the Sphenomorphus variegatus group in other clades, it would be premature to assign unsampled species to clades identified here on the basis of overall morphological gestalt.

We do not have a sample of Sphenomorphus melanopogon, the type species of the genus Sphenomorphus. There are few samples of this species in museums and the type series contains multiple species, raising the question of the true identity of Sphenomorphus melanopogon (C. W. Linkem, pers. observ.). The type series for Sphenomorphus melanopogon contains species that are morphologically similar to species in Clades B and F. There is one sample of Sphenomorphus melanopogon sequenced and available through GenBank from the work of Schmitz (2003), which is related to species in Clade F (not shown). A revision of Sphenomorphus melanopogon is in progress (G. Shea, pers. comm.), which will resolve the placement of the type species of Sphenomorphus. Until then, it is unclear whether Sphenomorphus sensu stricto is our Clade B or Clade F.

Papua New Guinea and the islands of the West Pacific are the most diverse regions for Sphenomorphus. Our sampling from these regions is limited in this phylogeny, but all species sampled are closely related in Clade F. Thus, we suspect that most of the Papuan and West Pacific diversity of Sphenomorphus will be related to Clade F. Greer & Parker (1967) divided Papuan Sphenomorphus into the Sphenomorphus variegatus and the Sphenomorphus fasciatus groups. Part of the Sphenomorphus fasciatus group was later put in the Sphenomorphus maindroni group based on a synapomorphic scale character (Greer & Shea, 2003). We have shown that the Sphenomorphus variegatus group is nonmonophyletic, and the one species (Sphenomorphus concinnatus) from the Papuan region that we sampled appears in Clade F. However, other species in the Sphenomorphus variegatus group fall into different clades. Members of the Sphenomorphus maindroni group (Sphenomorphus cranei, Sphenomorphus fasciatus, Sphenomorphus solomonis, and Sphenomorphus scutatus) form a clade based on the four species sampled (of the 22 species in the group). Our results suggest that the Sphenomorphusmaindroni group may be a monophyletic assemblage, whereas the Sphenomorphus variegatus group should be revised.

The Sphenomorphus group is most diverse in Australia, where it is represented by 15 genera (Reeder, 2003; Skinner, 2007). In these studies of the Australian genera, outgroup sampling for the Sphenomorphus group included only limited sampling of Papuan Sphenomorphus species. We have found that the Australian group forms a polytomy with Philippine species in Clade I + Sphenomorphus cumingi, and is not closely related to Papuan species. The Australia + Philippines polytomy has a posterior probability of 1.0, rejecting all possibilities for alternative Australian clade relationships given our current sampling and analyses. We cannot reject the hypothesis that the Australia group is sister to clade I + Sphenomorphus cumingi, as these groups collapse to a polytomy (Table 7). Increased gene sampling from the Australian clade and inclusion of more taxa from Papua and Indonesia may help to resolve this set of relationships.

Table 7.

Tests of multiple phylogenetic hypotheses using the most partitioned (P17) analysis. The presence of any trees within the 95% confidence set of unique trees that are congruent with the hypothesized relationship specifies that the hypothesis cannot be rejected by the data

Phylogenetic hypothesis Number of congruent trees
Total no. of trees in 95% CI 14426
Sphenomorphus cumingi + Clade I – Clade G 4619
 Group 1 0
 Group 2 0
 Group 3 0
 Group 4 0
Monophyly of Philippine taxa 0

CI, confidence interval.

Most of the Philippine species are found in Clade I, which can be subdivided into Clades H and J. If Sphenomorphus mindanensis is removed from Clade H, the lineage is the same as Brown & Alcala's (1980) Group 5 and the same group examined in Linkem et al. (2010b). The relationships amongst the Sphenomorphus abdictus–Sphenomorphus coxi–Sphenomorphus jagori group are similar to those found in Linkem et al. (2010b), but one of the clades identified in that study (Sphenomorphus abdictus aquilonius 8) is not monophyletic with the increased gene sampling in this study. Sphenomorphus abdictus aquilonius 8 is a large clade with a disjunct geographical distribution in the south‐west of Luzon and the islands north of Luzon. Finding that the populations in these geographical regions differ with the analysis of more data is not surprising, showing that even the division of widespread taxa in Linkem et al. (2010b) may still be insufficient to explain the diversity in the Sphenomorphus abdictus–Sphenomorphus coxi–Sphenomorphus jagori group. Sphenomorphus mindanensis was not included in the Linkem et al. (2010b) analysis of Group 5. It is interesting that we uncovered Sphenomorphus mindanensis as sister to Group 5 because it has nearly identical coloration to Sphenomorphus coxi coxi, but is smaller. Sphenomorphus mindanensis is part of Brown & Alcala's (1980) Group 3, and based on our morphological analyses of scale counts does not resemble members of the morphologically cohesive Group 5.

The placement of Sphenomorphus acutus and Sphenomorphus diwata is tenuous. Clade J, supporting these species as sister to Clade K, has low support (posterior probability = 0.77). Morphologically, it is also difficult to ascertain where these species might fit best within the Philippine taxa. Sphenomorphus acutus is morphologically unique, with a body shape most similar to Emoia, a distantly related genus. It does not resemble Sphenomorphus diwata, or any of the other species in the Philippines. Based on its unique appearance, we expected that it would be related to species outside the Philippines, but clearly our assumptions were incorrect. Sphenomorphus diwata has been considered part of Group 1, and morphologically similar to the Luzon high‐elevation species Sphenomorphus beyeri, Sphenomorphus boyingi, Sphenomorphus hadros, and Sphenomorphus igorotorum; however, Sphenomorphus diwata clearly is not related to these taxa. Increased gene sampling will probably help to resolve the relationship of these two Mindanao species with respect to the rest of Clade I in the Philippines.

We sampled multiple populations for two widespread species that we suspected contained cryptic genetic lineages. Sphenomorphus steerei is abundant on all the major Philippine islands except Palawan, where it is absent, and our analyses infer two highly divergent clades on Luzon, four divergent clades on Mindanao, and four clades on the Visayan PAIC. In some cases, these divergent clades occur in sympatry (Sphenomorphus cf. steerei sp. 5 & 6 on Panay; Sphenomorphus cf. steerei sp. 4 & 5 on Negros; Sphenomorphus cf. steerei sp. 1 & 7 on Mt. Banahao on Luzon), thereby suggesting that these may be exclusive lineages in need of species recognition. As Sphenomorphus steerei is a diminutive skink it is difficult to find externally diagnosable characters for these separate lineages. Populations of Sphenomorphus decipiens also show significant levels of genetic divergence; unlike Sphenomorphus steerei, there are pronounced morphological differences amongst clades. The most divergent population (Sphenomorphus cf. decipiens sp. 4) occurs at high elevations on Mt. Banahao and Mt. Palali on Luzon Island. Genetically, this population is most similar to the other high‐elevation species –Sphenomorphus beyeri, Sphenomorphus boyingi, Sphenomorphus hadros, Sphenomorphus igorotorum, and Sphenomorphus laterimaculatus. Scale counts and the size of Sphenomorphus cf. decipiens sp. 4 diagnose it as Sphenomorphus decipiens; however, these resemblances clearly are convergences because these populations of skinks are genetically so distinct from other Sphenomorphus decipiens. Sphenomorphus decipiens and Sphenomorphus cf. decipiens species 1, 2, and 3 form a clade, but there are morphological differences amongst these subclades. Additionally, Sphenomorphus cf. decipiens sp. 1, 2, and 4 all occur on Mt. Banahao on Luzon, with Sphenomorphus cf. decipiens sp. 1 and 2 occurring in sympatry and Sphenomorphus cf. decipiens sp. 4 occurring at a higher elevation on the mountain.

We were surprised to find that the diminutive, high‐elevation Parvoscincus sisoni on Panay Island is sister to the small, high‐elevation Sphenomorphus tagapayo on Luzon Island. These miniaturized species seem to have limited ranges on the mountains on which they occur; thus, it is difficult to ascertain relationships between these distant populations, especially given the suspected low probability of detection in intervening forested regions.

Taxonomic revision

Our analyses reveal that Sphenomorphus is not monophyletic, and that a large portion of its diversity is more closely related to a variety of other skink genera. Paraphyly has been shown in other studies of lygosomine skinks (Honda et al., 2003), but far less severe than that characterizing our results. Although most of our sampling was from species in the genus Sphenomorphus, and primarily from the Philippines, every other genus of the Sphenomorphus group included in this study renders Sphenomorphus paraphyletic.

Given the apparent wholesale paraphyly characterizing the Sphenomorphus group, we will avoid some taxonomic changes until future analyses incorporate more taxon sampling (C. W. Linkem, unpubl. data). However we agree with Graybeal & Cannatella (1995) that phylogenetic definitions of taxon names are often best viewed as works in progress, allowing for some well‐substantiated changes to be made as evidence justifying such changes becomes available. To that end, we have implemented a few taxonomic changes that are clearly warranted on the basis of our current results. These changes are an initial step toward a generic revision for the Sphenomorphus group and primarily affect the species from the Philippines, where our sampling is robust (Fig. 4).

Figure 4.

Figure 4

Molecular phylogeny from Figure 3 with the species names changed to reflect our new generic taxonomy.

Our fully partitioned Bayesian tree presents six separate invasions of the Philippines, each of which is a monophyletic, historical unit. Future taxonomic work will benefit from the recognition of these units as independent from Sphenomorphus sensu stricto. Previously defined names are available for most of the lineages defined herein. Insulasaurus and Otosaurus are revalidated and Scincella and Parvoscincus are expanded to include clades defined here. We define two new genera based on phylogenetic results and apply stem‐based names to these groups.

New genera

Tytthoscincus gen. nov.

Type species: Tytthoscincus hallieri (Lidth de Jeude, 1905).

Definition: The clade comprising Tytthoscincus hallieri (Lidth de Juede, 1905) and all species that share a more recent common ancestor with Tytthoscincus hallieri than with Anomalopus verreauxii, Calyptotis scutirostrum, Coeranoscincus frontalis, Coggeria naufragus, Ctenotus taeniolatus, Eremiascincus richardsonii, Eulamprus quoyiii, Glaphyromorphus isolepis, Gnypetoscincus queenslandiae, Hemiergis decresiensis, Insulasaurus wrighti, Lerista lineata, Lipinia pulchella, Nangura spinosa, Notoscincus ornatus, Ophioscincus australis, Otosaurus cumingi, Papuascincus stanleyanus, Parvoscincus sisoni, Pinoyscincus jagori, Prasinohaema flavipes, Saiphos equalis, Scincella lateralis, and Sphenomorphus melanopogon.

Etymology: From the Greek tytthos, meaning ‘small’ and the Latin scincus for lizard; the combination refers to the small sizes of the species in this genus. Suggested common name: diminutive Asian skink.

Description: Tytthoscincus can be identified by the following characters: (1) body size diminutive, usually less than 45 mm SVL; (2) temporal scales small, same size and shape as lateral body scales (Fig. 5); and (3) digits small, toe IV slightly longer than, or equal to, toe III.

Figure 5.

Figure 5

Lateral view of the heads of Tytthoscincus hallieri (A, redrawn from Inger et al., 2001: fig. 4) and of Parvoscincus cf. decipiens 1 (B). The temporal scales (highlighted in grey) of the new genus Tytthoscincus are small and blend in with the body scales, which is different from the typical shield‐like temporal scales (B).

Included species: Tytthoscincus aesculeticolus (Inger et al., 2001), Tytthoscincusatrigularis (Stejneger, 1905), Tytthoscincus biparietalis (Taylor, 1918), Tytthoscincus hallieri (Lidth de Juede, 1905), and Tytthoscincus parvus (Boulenger, 1897).

Comment: This clade of diminutive species has unique features that diagnoses it from all other skinks of the Sphenomorphus group. Although we lack genetic data for Tytthoscincus biparentialis, we nonetheless include it in this genus because it shares the unique presence of divided parietal scales with Tytthoscincus hallieri. The diminutive skinks of Malaysia (Grismer, Ahmad & Onn, 2009, 2009) should probably also be placed in this new genus, although we prefer to leave that decision in abeyance until a morphological and genetic examination of those taxa are complete. Tytthoscincus parvus (Boulenger, 1897) is one of three species of diminutive skinks described from Sulawesi Island. It is likely that the other diminutive species on Sulawesi, Sphenomorphus temmincki and Sphenomorphus textus are also part of Tytthoscincus. Future examination of temporal scales on small skinks in South‐East Asia should reveal the species composition of Tytthoscincus.

Pinoyscincus gen. nov.

Type species: Pinoyscincus jagori (Peters, 1864).

Definition: The clade comprising Pinoyscincus jagori (Peters, 1864) and all species that share a more recent common ancestor with Pinoyscincus jagori than with Anomalopus verreauxii, Calyptotis scutirostrum, Coeranoscincus frontalis, Coggeria naufragus, Ctenotus taeniolatus, Eremiascincus richardsonii, Eulamprus quoyii, Glaphyromorphus isolepis, Gnypetoscincus queenslandiae, Hemiergis decresiencsis, Insulasaurus wrighti, Lerista lineata, Lipinia pulchella, Lobulia elegans, Nangura spinosa, Notoscincus ornatus, Ophioscincus australis, Otosaurus cumingi, Papuascincus stanleyanus, Parvoscincus sisoni, Prasinohaema flavipes, Saiphos equalis, Scincella lateralis, Sphenomorphus melanopogon, and Tytthoscincus hallieri.

Etymology: The word pinoy is a commonly used Tagalog term of endearment amongst Filipinos, referring to an individual Filipino or the nation as a whole. We use it here in conjunction with the Latin scincus, meaning lizard, to name a clade of skinks found on the Philippine Archipelago. Suggested common name: Filipino skinks.

Description: Pinoyscincus can be identified by the following combination of characters: (1) body size medium to large (> 42 mm SVL); (2) paravertebral scale rows 56–80; (3) midbody scale rows 30–44; and (4) subdigital lamellae 17–26. In addition to these scale characters, species in this genus share a unique morphology of the hemipenis. The main shaft of the hemipenis, before the bifurcation, is wide with a large bulbous lobe on each lateral side of the shaft (Fig. 6).

Figure 6.

Figure 6

Sulcate, lateral, and asulcate views of Pinoyscincus abdictus abdictus hemipenis showing (arrows) the unique bulbous lobe structures on the lateral region of the main shaft before the bifurcation. Scale bar = 5 mm.

Included species: Pinoyscincus abdictus (Brown & Alcala, 1980), Pinoyscincus coxi (Taylor, 1915), Pinoyscincus jagori (Peters, 1864), Pinoyscincus llanosi (Taylor, 1919), and Pinoyscincus mindanensis (Taylor, 1922).

Comment: This morphologically cohesive genus includes Brown & Alcala's (1980) Group 5 and Pinoyscincus mindanensis. All of these species are easily diagnosable among the Philippine skink fauna. The morphology of the hemipenis in this genus has been observed in Pinoyscincus mindanensis, Pinoyscincus abdictus, Pinoyscincus jagori, and Pinoyscincus llanosi and has not been observed in any other Philippine skink examined (Otosaurus cumingi, Insulasaurus arborens, Insulasaurus traanorum, Parvoscincus beyeri, Parvoscincus decipiens, Sphenomorphus fasciatus, Sphenomorphus variegatus). We have not examined the hemipenis of Sphenomorphus acutus or Sphenomorphus diwata yet to see if they share the Pinoyscincus character so we prefer to leave them incertae sedis until a more thorough examination can be performed.

Generic resurrection

Insulasaurus Taylor, 1922

Type species: Insulasaurus wrighti Taylor, 1922.

Definition: The clade comprising Insulasaurus wrighti Taylor, 1922 and all species that share a more recent common ancestor with Insulasaurus wrighti than with Anomalopus verreauxii, Calyptotis scutirostrum, Coeranoscincus frontalis, Coggeria naufragus, Ctenotus taeniolatus, Eremiascincus richardsonii, Eulamprus quoyii, Glaphyromorphus isolepis, Gnypetoscincus queenslandiae, Hemiergis decresiencsis, Lerista lineata, Lipinia pulchella, Lobulia elegans, Nangura spinosa, Notoscincus ornatus, Ophioscincus australis, Otosaurus cumingi, Papuascincus stanleyanus, Parvoscincus sisoni, Pinoyscincus jagori, Prasinohaema flavipes, Saiphos equalis, Scincella lateralis, Sphenomorphus melanopogon, and Tytthoscincus hallieri.

Description: Insulasaurus is diagnosed by the following combination of characters: (1) medium body size, 45–64 mm SVL; (2) paravertebral scale rows 62–78; (3) midbody scale rows 29–41; and (4) subdigital lamellae 15–25.

Included species: Insulasaurus arborens (Taylor, 1917), Insulasaurus traanorum (Linkem, Diesmos & Brown, 2010a), Insulasaurus wrighti Taylor, 1925, and Insulasaurus victoria (Brown & Alcala, 1980).

Comment: The monotypic genus Insulasaurus was described by Taylor (1925) based on the presence of a divided frontonasal scale. Greer & Parker (1967) found this character to be variable within Insulasaurus wrighti, and subsequently placed Insulasaurus wrighti in the Sphenomorphusvariegatus group and synonymized Insulasaurus with Sphenomorphus. We found that Insulasaurus wrighti, Insulasaurus victoria, Insulasaurus traanorum (all from Palawan Island), and Insulasaurus arborens (Panay Island) are monophyletic, and distinct from other Philippine skinks. Our phylogeny suggests that this small, unique, and biogeographically circumscribed clade is more closely related to the genera Lipinia and Papuascincus, but separate from both, and therefore worthy of designation as a unique genus.

At this time, we have no data suggesting that other Sphenomorphus species would be properly placed in the genus Insulasaurus, although species in Borneo (e.g. Sphenomorphus kinabaluensis and Sphenomorphus murudensis) are potential candidates should future phylogenetic studies determine that they are more closely related to Insulasaurus than they are to Sphenomorphus s.s.

Otosaurus Gray, 1845

Type species: Otosaurus cumingi Gray, 1845.

Definition: The clade comprising Otosaurus cumingi (Gray, 1845) and all species that share a more recent common ancestor with Otosaurus cumingi than with Anomalopus verreauxii, Calyptotis scutirostrum, Coeranoscincus frontalis, Coggeria naufragus, Ctenotus taeniolatus, Eremiascincus richardsonii, Eulamprus quoyii, Glaphyromorphus isolepis, Gnypetoscincus queenslandiae, Hemiergis decresiencsis, Insulasaurus wrighti, Lerista lineata, Lipinia pulchella, Lobulia elegans, Nangura spinosa, Notoscincus ornatus, Ophioscincus australis, Papuascincus stanleyanus, Parvoscincus sisoni, Pinoyscincus jagori, Prasinohaema flavipes, Saiphos equalis, Scincella lateralis, Sphenomorphus melanopogon, and Tytthoscincus hallieri.

Description: Otosaurus is diagnosed by the following combination of characters: (1) body large and robust, with adults being longer than 115 mm SVL; (2) large supranasal scales in contact medially, occluding frontonasal contact with the rostral; and (3) supraoculars seven or eight.

Included species: Otosaurus cumingi Gray, 1845.

Comments: The species Otosaurus cumingi Gray, 1845 has always been a morphological outlier to the other Philippine skinks. Being the only Sphenomorphus group skink in the region to have large supranasal scales and having an average body size double that of other species (Gray, 1845; Taylor, 1922a, 1922b, 1922c, Brown & Alcala, 1980), it has been recognized as phenotypically distinct and unique amongst Philippine skinks. Our genetic and morphological results confirm its uniqueness amongst other lineages. Historically, this species was placed in the genus Otosaurus Gray, 1845 because of its distinctive morphology. As Otosaurus cumingi is the type species for the genus Otosaurus and is found to be both morphologically and genetically distinct, and our phylogenetic analyses place it in a polytomy with the Australian genera of the Sphenomorphus group and with the clade of Parvoscincus and Pinoyscincus, we re‐establish Otosaurus as a monotypic genus, moving cumingi from Sphenomorphus to Otosaurus.

Generic revision

Parvoscincus Ferner, Brown & Greer, 1997

Type species: Parvoscincus sisoni Ferner, Brown & Greer, 1997.

Definition: The clade comprising Parvoscincus sisoni (Ferner, Brown & Greer, 1997) and all species that share a more recent common ancestor with Parvoscincus sisoni than with Anomalopus verreauxii, Calyptotis scutirostrum, Coeranoscincus frontalis, Coggeria naufragus, Ctenotus taeniolatus, Eremiascincus richardsonii, Eulamprus quoyii, Glaphyromorphus isolepis, Gnypetoscincus queenslandiae, Hemiergis decresiencsis, Insulasaurus wrigthi, Lerista lineata, Lipinia pulchella, Lobulia elegans, Nangura spinosa, Notoscincus ornatus, Ophioscincus australis, Otosaurus cumingii, Papuascincus stanleyanus, Pinoyscincus jagori, Prasinohaema flavipes, Saiphos equalis, Scincella lateralis, Sphenomorphus melanopogon, and Tytthoscincus hallieri.

Description: Parvoscincus is diagnosed by the following combination of characters: (1) body size usually small (< 55 mm SVL) but larger in high‐elevation species (46 mm < SVL < 86 mm); (2) four enlarged supraoculars; (3) paravertebral scales 51–110; (4) midbody scale rows 23–46; and (5) subdigital lamellae 10–20.

Included species: Parvoscincus beyeri (Taylor, 1922), Parvoscincus boyingi (Brown et al., 2010), Parvoscincus decipiens (Boulenger, 1894), Parvoscincus hadros (Brown et al., 2010), Parvoscincus igorotorum (Brown et al., 2010), Parvoscincus laterimaculatus (Brown & Alcala, 1980), Parvoscincus leucospilos (Peters, 1872), Parvoscincus lawtoni (Brown & Alcala, 1980), Parvoscincus luzonensis (Boulenger, 1894), Parvoscincus kitangladensis (Brown, 1995), Parvoscincus palawanensis (Brown & Alcala, 1961), Parvoscincus sisoni (Ferner, Brown & Greer, 1997), Parvoscincus steerei (Stejneger, 1908), and Parvoscincus tagapayo (Brown et al., 1999).

Comments: The recently described genus Parvoscincus (Ferner, Brown & Greer, 1997) is nested within a large clade of Philippine Sphenomorphus (Clade K). Represented in our phylogeny by the type species, Parvoscincus sisoni, it is clear that this genus is not phylogenetically distinct from other Philippine Sphenomorphus as originally proposed (Ferner, Brown & Greer, 1997). The other species in this genus, Parvoscincus palawanensis, was not sampled; therefore, it is uncertain if it would be related to Parvoscincus sisoni, but we assume that it is until contrary evidence is presented. Clade K is clearly a unique and supported group of mostly small species of Philippine Sphenomorphus. As Parvoscincus is placed within this clade, we recommend that the name Parvoscincus be expanded to include the other small‐bodied species in this Philippine clade (Parvoscincus leucospilos, Parvoscincus tagapayao, Parvoscincus luzonensis, Parvoscincus lawtoni, Parvoscincus kitangladensis, Parvoscincus laterimaculatus, Parvoscincus steerei, Parvoscincus decipiens) in addition to the secondarily enlarged, montane forest species (Parvoscincus beyeri, Parvoscincus boyingi, Parvoscincus igorotorum, and Parvoscincus hadros). Two species (Sphenomorphus acutus and Sphenomorphus diwata) in the Philippines are not diagnosable to either Parvoscincus or Pinoyscincus. These morphologically distinct species are genetically most similar to Parvoscincus, but this relationship has low phylogenetic support. We prefer to leave these species incertae sedis until a more thorough examination can be performed.

Scincella Mittleman, 1950

Type species: Scincella lateralis (Say, 1823).

Definition: The clade comprising Scincella lateralis (Say, 1823) and all species that share a more recent common ancestor with Scincella lateralis than with Anomalopus verreauxii, Calyptotis scutirostrum, Coeranoscincus frontalis, Coggeria naufragus, Ctenotus taeniolatus, Eremiascincus richardsonii, Eulamprus quoyii, Glaphyromorphus isolepis, Gnypetoscincus queenslandiae, Hemiergis decresiencsis, Insulasaurus wrighti, Lerista lineata, Lipinia pulchella, Lissonota maculata, Lobulia elegans, Nangura spinosa, Notoscincus ornatus, Ophioscincus australis, Otosaurus cumingii, Papuascincus stanleyanus, Parvoscincus sisoni, Pinoyscincus jagori, Prasinohaema flavipes, Saiphos equalis, Sphenomorphus melanopogon, Tytthoscincus hallieri.

Description: Scincella can be diagnosed by the following combination of characters: (1) body size medium (SVL usually < 65 mm); (2) alpha palate (Greer, 1974) with nine premaxillary teeth; (3) long, thin postorbital bone usually present; and (4) with a transparent window in a movable lower eyelid. Transparent window may be lacking in southern populations of Sp. cheerei.

Included species: Scincella apraefrontalis Nguyen, Nguyen, Bohme & Ziegler, 2010, Scincella assata (Cope, 1864), Scincella barbouri (Stejneger, 1925), Scincella boettgeri (Van Denburgh, 1912), Scincella capitanea Oubeter, 1986, Scincella caudaequinae (Smith, 1951), Scincella cherriei (Cope, 1893), Scincella doriae (Boulenger, 1887), Scincella forbesora (Taylor, 1937), Scincella formosensis (Van Denburgh, 1912), Scincella gemmingeri (Cope, 1864), Scincella inconspicua (Müller, 1894), Scincella incerta (Stuart, 1940), Scincella kikaapoa Garcia‐Vazquez, Canseco‐Marquez & Nieto‐Montes de Oca, 2010, Scincella lateralis (Say, 1823), Scincella macrotis (Steindachner, 1867), Scincella melanosticta (Boulenger, 1887), Scincella modesta (Günther, 1864), Scincella monticola (Schmidt, 1927), Scincella ochracea (Bourret, 1937), Scincella potanini (Günther, 1896), Scincella przewalskii (Bedriaga, 1912), Scincella punctatolineata (Boulenger, 1893), Scincella rarus (Myers & Donnelly), 1991, Scincella reevesi (Gray, 1838), Scincella rufocaudatus Darevsky & Nguyen, 1983, Scincella rupicola (Smith, 1927), Scincella schmidti (Barbour, 1927), Scincella silvicola (Taylor, 1937), Scincella tsinglingensis (Hu & Djao, 1966), Scincella vandenburghi (Schmidt, 1927), and Scincella victoriana (Shreve, 1940).

Comment: The New World species Scincella cherriei and Scincella assata are nested within the genus Scincella, sister to the North American species Scincella lateralis. We predict that Scincella rarus, and Scincella incertus also will be members of this clade. When Greer (1974: 33) revised the genus Leiolepisma, he provided detailed comments about the potential relationships of these Central American skinks. Morphologically, these species are a mix of Sphenomorphus and Scincella, with Scincella assatus and Scincella incertus lacking a postorbital bone but possessing a window in the lower eye (characters of Scincella) and Scincella cherriei possessing a postorbital bone but having population variation in the presence of the lower eyelid window. Greer (1974) inferred that Scincella cherriei was the primitive form of the Central American radiation owing to the possession of the postorbital bone and placed these species in Sphenomorphus. He noted that this did not make sense biogeographically because it inferred a separate migration across the Bering Bridge, but he argued it was more plausible than the re‐evolution of the postorbital bone in Scincella cherriei. Our molecular evidence shows that the Central American species are part of the same radiation as North American Scincella, following the biogeographical expectation. It is therefore reasonable to move these Central American skinks to the genus Scincella.

CONCLUSIONS

This study, along with several other recent works, demonstrates the need for thorough systematic revision of Scincidae, the largest monophyletic family of squamates. We have shown that the largest genus of skinks in Scincidae is highly paraphyletic. Based on our phylogeny, morphological convergence in scale characters and body size are common within Philippine Sphenomorphus; these phenomena clearly have confounded past supraspecific taxonomic treatments. Taxonomic revisions based on robust molecular phylogenies may avoid misdiagnosing phylogenetic relationships resulting from high levels of homoplasy in some morphological characters. However, it is clear that many of these same morphological characters are useful for identifying new species. We have shown that species composition varies on different islands, with Luzon and Palawan being composed of closely related species, and the Mindanao faunal region being composed of an assembled fauna, derived from multiple separate invasions of the archipelago. Widespread species in the Philippines continue to show divergent relationships both within and between islands, and divergent clades often occur in sympatry. It is likely that morphological examination of subclades of these widespread species may reveal greater species diversity than currently recognized. If so, a more comprehensive understanding of Philippine Sphenomorphus group skinks will require a deeper knowledge of the diversity of the skinks in this unique archipelago.

ACKNOWLEDGEMENTS

Fieldwork in the Philippines was facilitated by research and collecting permits issued by the Protected Areas and Wildlife Bureau of the Department of Environment and Natural Resources, wherein we are especially grateful for the years of support provided by M. Lim, A. Tagtag, J. de Leon, and C. Custodio. Fieldwork in the Solomon Islands was facilitated by J. Horokou and T. Masolo at the Solomon Islands Ministry of Natural Resources; research permits were granted by the Ministry of Education, Solomon Islands. We are particularly grateful for the introductions and logistical assistance provided by C. Filardi and P. Pikatcha and the hospitality of the staff of Zipolo Habu Resort. A. C. D. acknowledges support from the Cagayan Valley Program on Environment and Development, Conservation International Philippines, The Rufford Foundation, and the National Museum of the Philippines (in particular R. V. Sison and V. S. Palpal‐latoc). R. M. B.'s fieldwork was supported by NSF DEB 0073199, 0640737 and EF 0334952; C. W. L.'s fieldwork was supported by an American Philosophical Society Lewis and Clark Fellowship, a University of Kansas (KU) Biodiversity Institute Panorama Grant, and NSF DEB 0910341 to C. W. L.; molecular data collection was supported by funds from the University of Kansas, NSF DEB 0640737 to R. M. B. and NSF DEB 0910341 to C. W. L. A CAS Charles Stearns grant was awarded to C. W. L. to examine specimens at the California Academy of Sciences. We thank R. F. Inger, and A. Resetar (FMNH), R. N. Fisher (USGS), B. Stuart (NCSM), Cameron Siler (KU), and J. Vindum (CAS) for critical specimen and tissue loans. Additionally, we appreciate the efforts of L. Heaney, E. Rickart, L. Duya, A. Duya, J. Esselstyn, J. Veluz, and D. Balete, who had the foresight to preserve genetic samples from skinks captured in their mammal traps. This manuscript was improved by critical reviews from members of KU's Herpetology Division. Special thanks are due to R. I. Crombie, J. W. Ferner, A. C. Alcala and the late W. C. Brown for nearly 20 years of support and encouragement during which many of the tissue samples necessary for this project were amassed.

Taxonomic identification Voucher number GenBank numbers
ND2 12S 16S ND4 NGFB R35
Lacertidae
Tachydromus sexilineatus KU 311512 HQ907420 JF498098 JF498325 HQ907624
Xantusiidae
Xantusia vigilis KU 220088 JF498215 JF497976 JF498107 JF498334 JF498458
Xantusia vigilis KU 220090 JF498216 JF497977 JF498108 JF498335 JF498459
Scincidae
Scincinae
Plestiodon quadrilinectus KU 311490 HQ907422 JF497945 JF498073 JF498547 JF498301 HQ907628
Plestiodon fasciatus KU 289462 HQ907423 JF497944 JF498072 JF498546 JF498300 HQ907629
Plestiodon anthracinus KU 290718 HQ907424 JF497943 JF498071 JF498545 JF498299 HQ907630
Lygosominae
Dasia grisea KU 305573 HQ907425 JF497855 JF497978 JF498460 JF498217 HQ907631
Emoia caeruleocauda KU 307154 JF498109 JF497857 JF497980 JF498462 JF498219 JF498336
Emoia cyanogaster KU 307235 JF498111 JF497859 JF497982 JF498464 JF498221 JF498338
Emoia cyanura TNHC 58932 JF498110 JF497858 JF497981 JF498463 JF498220 JF498337
Emoia schmidti KU 307133 JF497860 JF497983 JF498465 JF498222 JF498339
Emoia atrocostata KU 304896 HQ907421 JF497856 JF497979 JF498461 JF498218 HQ907627
Eremiascincus richardsonii AY169582 AY169619 AY169657
Eulamprus murrayi AY169584 AY169621 AY169659
Eutropis multifasciata KU 302890 JF498112 JF497861 JF497984 JF498466 JF498223 JF498340
Glaphyromorphus darwiniensis DQ915286 DQ915310 DQ915334
Hemiergis peroni AY169590 AY169627 AY169665
Insulasaurus arborens KU 306712 JF498114 JF497863 JF497986 JF498468 JF498225 JF498342
Insulasaurus arborens KU 306805 JF498113 JF497862 JF497985 JF498467 JF498224 JF498341
Insulasaurus traanorum KU 311442 JF498115 JF497864 JF497987 JF498469 JF498343
Insulasaurus traanorum KU 311443 JF498116 JF497865 JF497988 JF498470 JF498226 JF498344
Insulasaurus victoria KU 309443 JF498117 JF497989 JF498345
Insulasaurus wrighti KU 311422 JF498118 JF497866 JF497990 JF498471 JF498227 JF498346
Insulasaurus wrighti KU 311438 JF498119 JF497867 JF497991 JF498472 JF498226 JF498347
Lipinia noctua CAS 236454 JF498120 JF497868 JF497992 JF498473 JF498348
Lipinia pulchella TNHC 56378 JF498121 JF497869 JF497993 JF498474 JF498228 JF498349
Lipinia pulchella TNHC 56379 JF498122 JF497870 JF497994 JF498475 JF498229 HQ907625
Mabuya mabouia KU 214970 JF498123 JF497871 JF497995 JF498230 JF498350
Mabuya unimarginata KU 291283 JF498124 JF497943 JF497996 JF498476 JF498231 JF498351
Otosaurus cumingi RMB 808 JF498125 JF497873 JF497997 JF498477 JF498232 JF498352
Otosaurus cumingi RMB 985 JF498126 JF497874 JF497998 JF498478 JF498353
Panaspis togoensis KU 290440 JF498127 JF497875 JF497999 JF498233 JF498354
Papuascincus stanleyanus RNF 0065 JF498128 JF497876 JF498479 JF498234 JF498355
Papuascincus stanleyanus RNF 0067 JF498129 JF497877 JF498000 JF498480 JF498235 JF498356
Parvoscincus beyeri FMNH 266118 JF498130 JF498001 JF498481 JF498236 JF498357
Parvoscincus beyeri TNHC 06267 JF498131 JF497878 JF498002 JF498482 JF498237 JF498358
Parvoscincus boyingi FMNH 267561 JF498133 JF497880 JF498004 JF498484 JF498239 JF498360
Parvoscincus boyingi FMNH 267664 JF498132 JF497879 JF498003 JF498483 JF498238 JF498359
Parvoscincus cf. beyeri KU 308666 JF498134 JF497881 JF498005 JF498485 JF498240 JF498361
Parvoscincus cf. decipiens sp. 1 KU 306558 JF498135 JF497882 JF498006 JF498486 JF498241 JF498362
Parvoscincus cf. decipiens sp. 1 TNHC 62889 JF498136 JF497883 JF498487
Parvoscincus cf. decipiens sp. 2 KU 306560 JF498137 JF497884 JF498007 JF498488 JF498242 JF498363
Parvoscincus cf. decipiens sp. 2 TNHC 62679 JF498138 JF497885 JF498008 JF498489 JF498364
Parvoscincus cf. decipiens sp. 3 TNHC 62883 JF498139 JF497886 JF498009 JF498490 JF498243 JF498365
Parvoscincus cf. decipiens sp. 3 TNHC 62897 JF498140 JF497887 JF498010 JF498491 JF498244 JF498366
Parvoscincus cf. decipiens sp. 4 TNHC 62893 JF498142 JF497888 JF498012 JF498493 JF498246 JF498368
Parvoscincus cf. decipiens sp. 4 ACD 1020 JF498141 JF498011 JF498492 JF498245 JF498367
Parvoscincus cf. lawtoni FMNH 266278 JF498143 JF497889 JF498013 JF498494 JF498247 JF498369
Parvoscincus decipiens ACD 2233 JF498144 JF498014 JF498495 JF498248 JF498370
Parvoscincus decipiens ACD 2423 JF498145 JF497890 JF498015 JF498496 JF498249 JF498371
Parvoscincus hadros PNM 9618 JF498016 JF498372
Parvoscincus hadros PNM 9620 JF498017 JF498373
Parvoscincus igorotorum FMNH 259448 JF498146 JF497891 JF498018 JF498497 JF498250 JF498374
Parvoscincus igorotorum PNM 9623 JF498147 JF497892 JF498019 JF498498 JF498375
Parvoscincus kitangladensis KU 326618 JF498148 JF497893 JF498020 JF498499 JF498251 JF498376
Parvoscincus kitangladensis KU 326619 JF498149 JF497894 JF498021 JF498500 JF498252 JF498377
Parvoscincus kitangladensis KU 326627 JF498150 JF497895 JF498022 JF498501 JF498253 JF498378
Parvoscincus laterimaculatus TNHC 62675 JF498151 JF497896 JF498023 JF498502 JF498254 JF498379
Parvoscincus laterimaculatus TNHC 62676 JF498152 JF497897 JF498024 JF498503 JF498255 JF498380
Parvoscincus lawtoni KU 308668 JF498153 JF497898 JF498025 JF498504 JF498256 JF498381
Parvoscincus leucospilos KU 320522 JF498154 JF497899 JF498026 JF498505 JF498257 JF498382
Parvoscincus leucospilos TNHC 62682 JF498155 JF497900 JF498027 JF498506 JF498258 JF498383
Parvoscincus luzonensis FMNH 258990 JF498156 JF497901 JF498028 JF498507 JF498259 JF498384
Parvoscincus luzonensis FMNH 263506 JF498157 JF498029 JF498508 JF498260 JF498385
Parvoscincus sisoni RMB 700 JF498158 JF497902 JF498030 JF498509 JF498261 JF498386
Parvoscincus steerei 1 RMB 3944 JF498160 JF497904 JF498032 JF498511 JF498388
Parvoscincus steerei 1 TNHC 63091 JF498159 JF497903 JF498031 JF498510 JF498387
Parvoscincus steerei 2 ACD 1203 JF498161 JF497905 JF498033 JF498512 JF498262 JF498389
Parvoscincus steerei 3 ACD 2696 JF498162 JF497906 JF498034 JF498263 JF498390
Parvoscincus steerei 3 ACD 2709 JF498163 JF498035 JF498264 JF498391
Parvoscincus steerei 4 EMD 429 JF498164 JF497908 JF498036 JF498265 JF498392
Parvoscincus steerei 5 KU 306736 JF498165 JF497909 JF498037 JF498266 JF498393
Parvoscincus steerei4 TNHC 56356 JF498166 JF497910 JF498038 JF498513 JF498267 JF498394
Parvoscincus steerei5 KU 302937 JF498167 JF497911 JF498039 JF498514 JF498268 JF498395
Parvoscincus steerei5 KU 302938 JF498168 JF497912 JF498040 JF498515 JF498269 JF498396
Parvoscincus steerei6 KU 306840 JF498169 JF497913 JF498041 JF498516 JF498270 JF498397
Parvoscincus steerei6 GVAG 273 JF498170 JF497914 JF498042 JF498517 JF498271 JF498398
Parvoscincus steerei7 TNHC 63086 JF498171 JF497915 JF498043 JF498518 JF498272 JF498399
Parvoscincus steerei7 TNHC 63093 JF498172 JF497916 JF498044 JF498519 JF498273 JF498400
Parvoscincus tagapayo KU 308926 JF498173 JF497917 JF498045 JF498520 JF498274 JF498401
Parvoscincus tagapayo KU 326400 JF498174 JF497918 JF498046 JF498521 JF498275 JF498402
Pinoyscincus abdictus abdictus ACD 2687 JF498175 JF497920 JF498048 JF498523 JF498277 JF498404
Pinoyscincus abdictus abdictus KU 306538 GU573559 JF497919 JF498047 JF498522 JF498276 JF498403
Pinoyscincus abdictus aquilonius10 FMNH 266115 JF498176 JF497921 JF498049 JF498524 JF498278 JF498405
Pinoyscincus abdictus aquilonius10 KU 302920 GU573666 JF497922 JF498050 JF498525 JF498279 JF498406
Pinoyscincus abdictus aquilonius10 TNHC 62758 GU573648 JF497923 JF498051 JF498526 JF498280 JF498407
Pinoyscincus abdictus aquilonius11 RMB 953 JF498177 JF497924 JF498052 JF498527 JF498281 JF498408
Pinoyscincus abdictus aquilonius8 KU 307018 JF498178 JF497925 JF498053 JF498528 JF498282 JF498409
Pinoyscincus abdictus aquilonius8 TNHC 63108 JF498179 JF497926 JF498054 JF498529 JF498283 JF498410
Pinoyscincus coxi coxi KU 309908 GU573562 JF497927 JF498055 JF498530 JF498284 JF498411
Pinoyscincus coxi coxi ACD 2685 GU573564 JF497928 JF498056 JF498531 JF498285 JF498412
Pinoyscincus coxi divergens KU 308380 GU573561 JF497929 JF498057 JF498532 JF498413
Pinoyscincus coxi divergens ACD 925 GU573640 JF497930 JF498058 JF498533 JF498286 JF498414
Pinoyscincus jagori grandis GVAG 266 GU573597 JF497931 JF498059 JF498534 JF498287 JF498415
Pinoyscincus jagori grandis TNHC 62860 JF498180 JF497932 JF498060 JF498535 JF498288 JF498416
Pinoyscincus jagori jagori 3 TNHC 63095 JF498181 JF497933 JF498061 JF498536 JF498289 JF498417
Pinoyscincus jagori jagori 3 TNHC 63102 GU573571 JF497934 JF498062 JF498537 JF498290 JF498418
Pinoyscincus jagori jagori 4 KU 306546 GU573587 JF497935 JF498063 JF498538 JF498291 JF498419
Pinoyscincus jagori jagori 4 TNHC 56380 JF498182 JF497936 JF498064 JF498539 JF498292 JF498420
Pinoyscincus jagori jagori 6 KU 302929 GU573610 JF497937 JF498065 JF498540 JF498293 JF498421
Pinoyscincus jagori jagori 6 KU 307684 JF498183 JF497938 JF498066 JF498294 JF498422
Pinoyscincus llanosi KU 306556 GU573557 JF497939 JF498067 JF498541 JF498295 JF498423
Pinoyscincus llanosi KU 306557 GU573558 JF497940 JF498068 JF498542 JF498296 JF498424
Pinoyscincus mindanensis KU 310135 JF498184 JF497941 JF498069 JF498543 JF498297 JF498425
Pinoyscincus mindanensis TNHC 56351 JF498185 JF497942 JF498070 JF498544 JF498298 JF498426
Scincella assatus KU 289795 JF497946 JF498074 JF498548 JF498302 JF498427
Scincella assatus KU 291286 JF498186 JF498075 JF498549 JF498303 JF498428
Scincella cherrei JF497947 JF498076 JF498550 JF498304 JF498429
Scincella lateralis KU 289460 JF498187 JF497948 JF498077 JF498305 JF498430
Scincella reevesii FMNH 255540 HQ907428 JF497949 JF498078 JF498551 HQ907634
Sphenomorphus acutus KU 319962 JF498188 JF497950 JF498079 JF498552 JF498306 JF498431
Sphenomorphus concinnatus KU 307213 JF498189 JF498080 JF498553 JF498307 JF498432
Sphenomorphus concinnatus KU 307348 JF498190 JF497951 JF498081 JF498554 JF498308 JF498433
Sphenomorphus cranei KU 307167 JF498191 JF497952 JF498082 JF498555 JF498309 JF498434
Sphenomorphus cranei KU 307168 JF498192 JF497953 JF498083 JF498556 JF498310 JF498435
Sphenomorphus cyanolaemus FMNH 239867 JF498193 JF497954 JF498084 JF498557 JF498311 JF498436
Sphenomorphus diwata EMD 368 JF498194 JF497955 JF498085 JF498558 JF498312 JF498437
Sphenomorphus diwata EMD 428 JF498195 JF497956 JF498086 JF498559 JF498313 JF498438
Sphenomorphus fasciatus KU 310807 JF498196 JF497957 JF498087 JF498560 JF498314 JF498439
Sphenomorphus fasciatus KU 315061 JF498197 JF497958 JF498088 JF498561 JF498315 JF498440
Sphenomorphus indicus CAS 214892 JF498198 JF497959 JF498089 JF498562 JF498316 JF498441
Sphenomorphus maculatus FMNH 261863 JF498199 JF497960 JF498090 JF498563 JF498317 JF498442
Sphenomorphus multisquamatus FMNH 243828 JF498200 JF497961 JF498091 JF498564 JF498318 JF498443
Sphenomorphus sabanus FMNH 239881 JF498201 JF497962 JF498092 JF498565 JF498319 JF498444
Sphenomorphus scutatus CAS 236398 JF498202 JF497963 JF498093 JF498566 JF498320 JF498445
Sphenomorphus solomonis KU 307173 JF498203 JF497964 JF498094 JF498567 JF498321 JF498446
Sphenomorphus solomonis KU 307349 JF498204 JF497965 JF498095 JF498568 JF498322 JF498447
Sphenomorphus variegatus KU 309900 JF498205 JF497966 JF498096 JF498323 JF498448
Sphenomorphus variegatus KU 315087 JF498206 JF497967 JF498097 JF498569 JF498324 JF498449
Trachylepis perroteti KU 291923 JF498207 JF497968 JF498099 JF498326 JF498450
Tytthoscincus aesculeticola SP 06913 JF498208 JF497969 JF498100 JF498570 JF498327 JF498451
Tytthoscincus aesculeticola FMNH 239839 JF498209 JF497970 JF498101 JF498571 JF498328 JF498452
Tytthoscincus atrigularis KU 315055 JF498210 JF497971 JF498102 JF498572 JF498329 JF498453
Tytthoscincus atrigularis KU 315060 JF498211 JF497972 JF498103 JF498573 JF498330 JF498454
Tytthoscincus hallieri FMNH 230184 JF498212 JF497973 JF498104 JF498574 JF498331 JF498455
Tytthoscincus parvus RMB 4707 JF498213 JF497974 JF498105 JF498575 JF498332 JF498456
Tytthoscincus parvus JAM6275 JF498214 JF497975 JF498106 JF498576 JF498333 JF498457

REFERENCES

  1. Allison A, Greer AE. 1986. Egg shells with pustulate surface structures: basis for a new genus of New Guinea skinks (Lacertilia: Scincidae). Journal of Herpetology 20: 116–119. [Google Scholar]
  2. Arevalo E, Davis SK, Sites JW, Jr . 1994. Mitochondrial DNA sequence divergence and phylogentic relationships among eight chromosome races of the Sceloporus gram‐micus complex (Phrynosomatidae) in Central Mexico. Systematic Biology 43: 387–418. [Google Scholar]
  3. Blackburn DC, Bickford DP, Diesmos AC, Iskandar DT, Brown RM. 2010. An ancient origin for the enigmatic Flat‐Headed Frogs (Bombinatoridae: Barbourula) from the islands of Southeast Asia. PLoS ONE 5: e12090. doi:10.1371/journal.pone.0012090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Boulenger GA. 1887. Catalogue of the Lizards of the British Museum (Natural History). III. Lacertidae, Gerrhosauridae, Scincidae, Anelytropisidae, Dibamidae, Chameleontidae. London, UK: Trustees of the British Museum. [Google Scholar]
  5. Boulenger GA. 1897. On the reptiles and batrachians of Celebes. Proceedings of the Zoological Society of London 13 : 193–237. [Google Scholar]
  6. Brandley MC, Schmitz A, Reeder TW. 2005. Partitioned Bayesian analyses, partition choice, and the phylogenetic relationships of scincid lizards. Systematic Biology 54: 373–390. [DOI] [PubMed] [Google Scholar]
  7. Brown RM, Diesmos AC. 2001 (2002). Application of lineage‐based species concepts to oceanic island frog populations: the effects of differing taxonomic philosophies on the estimation of Philippine biodiversity. The Silliman Journal 42: 133–162. [Google Scholar]
  8. Brown RM, Diesmos AC. 2009. Philippines, biology In: Gillespie R, Clague D, eds. Encyclopedia of islands. Berkeley, CA: University of California Press, 723–732. [Google Scholar]
  9. Brown RM, Ferner JW, Greer AE. 1995. A new species of lygosomine lizard (Reptilia: Lacertilia: Scincidae: Sphenomorphus) from Mt. Isarog, Luzon Island, Philippines. Proceedings of the Biological Society of Washington 108: 18–28. [Google Scholar]
  10. Brown RM, Guttman SI. 2002. Phylogenetic systematics of the Rana signata complex of Philippine and Bornean stream frogs: Reconsideration of Huxley's modification of Wallace's Line at the Oriental‐Australian faunal zone interface. Biological Journal of the Linnaean Society 76 : 393–461. [Google Scholar]
  11. Brown RM, Linkem CW, Diesmos AC, Balete DS, Duya MV, Ferner JW. 2010. Species boundaries in Philippine montane forest skinks (Genus Sphenomorphus): three new species from the mountains of Luzon and clarification of the status of the poorly known S. beyeri, S. knollmanae, and S. laterimaculatus . Scientific Papers, Natural History Museum, University of Kansas 42: 1–27. [Google Scholar]
  12. Brown RM, McGuire JA, Ferner JW, Alcala AC. 1999. New species of diminutive scincid lizard (Squamata; Lygosominae; Sphenomorphus) from Luzon Island, Republic of the Philippines. Copeia 1999: 362–370. [Google Scholar]
  13. Brown WC. 1995. A new lizard of the genus Sphenomorphus (Reptilia: Scincidae) from Mt. Kitanglad, Mindanao Island, Philippine Islands. Proceedings of the Biological Society of Washington 108: 388–391. [Google Scholar]
  14. Brown WC, Alcala AC. 1970. The zoogeography of the Philippine Islands, a fringing archipelago. Proceedings of the California Academy of Science 38: 105–130. [Google Scholar]
  15. Brown WC, Alcala AC. 1980. Philippine lizards of the family scincidae. Dumaguete City, Philippines: Silliman University Press. [Google Scholar]
  16. Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32: 1792–1797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Esselstyn JA, Timm RM, Brown RM. 2009. Do geological or climatic processes drive speciation in dynamic archipelagos? The evolution of shrew diversity on SE Asian Islands. Evolution 63: 2595–2610. [DOI] [PubMed] [Google Scholar]
  18. Ferner JW, Brown RM, Greer AE. 1997. A new genus and species of moist closed canopy forest skinks from the Philippines. Journal of Herpetology 31: 187–192. [Google Scholar]
  19. Fitzinger LJFJ. 1843. Systema reptilium. Fasciculus primus. Wien: Braumüller et Seidel. [Google Scholar]
  20. Gray JE. 1845. Catalogue of the Specimens of Lizards in the Collection of the British Museum . London, UK: Trustees of the British Museum. [Google Scholar]
  21. Graybeal A, Cannatella DC. 1995. A new taxon of Bufonidae from Peru, with descriptions of two new species and a review of the phylogenetic status of supraspecific bufonid taxa. Herpetologica 51: 105–131. [Google Scholar]
  22. Greer AE. 1974. The generic relationships of the scincid lizard genus Leiolepisma and its relatives. Australian Journal of Zoology Supplement 31: 1–67. [Google Scholar]
  23. Greer AE. 1979. A phylogenetic subdivision of Australian skinks. Records of the Australian Museum 32: 339–371. [Google Scholar]
  24. Greer AE. 1991. Lankascincus, a new genus of scincid lizards from Sri Lanka, with descriptions of three new species. Journal of Herpetology 25: 59–64. [Google Scholar]
  25. Greer AE. 1997. Leptoseps: a new genus of scincid lizards from Southeast Asia. Journal of Herpetology 31: 393–398. [Google Scholar]
  26. Greer AE, Parker F. 1967. A new scincid lizard from the northern Solomon Islands. Breviora 275: 1–20. [Google Scholar]
  27. Greer AE, Parker F. 1974. The fasciatus species group of Sphenomorphus (Lacertilia: Scincidae): notes on eight previously described species and descriptions of three new species. Papua New Guinea Scince Society Proceedings 25: 31–61. [Google Scholar]
  28. Greer AE, Shea G. 2003. A new character within the taxonomically difficult Sphenomorphus group of lygosomine skinks, with a description of a new species from New Guinea. Journal of Herpetology 38: 79–87. [Google Scholar]
  29. Greer AE, Simon M. 1982. An unusual new genus and species of scincid lizard from New Guinea. Journal of Herpetology 16: 131–139. [Google Scholar]
  30. Grismer LL. 2006. Two new species of skinks (Genus Sphenomorphus F, 1843) from the Seribuat Archipelago West Malaysia. Herpetological Natural History 9: 151–162. [Google Scholar]
  31. Grismer LL. 2007a. A new species of small montane forest floor skink (Genus Spenomorphus F, 1843) from southern peninsular Malaysia. Herpetologica 63: 544–551. [Google Scholar]
  32. Grismer LL. 2007b. A new species of insular skink (Genus Sphenomorphus F, 1843) from the Langkawi Archipelago, Kedah, West Malaysia with the first report of the herpetofauna of Pulau Singa Besar and an updated checklist of the herpetofauna of Pulau Langkawi. Zootaxa 1691: 53–56. [Google Scholar]
  33. Grismer LL, Ahmad N, Onn CK. 2009. A new, diminutive, upland Sphenomorphus Fitzinger 1843 (Squamata: Scincidae) from Belum‐Temengor Forest complex, Peninsular Malaysia. Zootaxa 2312: 27–38. [Google Scholar]
  34. Grismer LL, Wood JPL, Grismer JL. 2009. A new insular species of skink of the genus Sphenomorphus Strauch 1887 (Squamata: Scincidae) from Pulau Perhentian Besar, Terengganu, Peninsular Malaysia. Tropical Life Sciences Research 20: 51–69. [Google Scholar]
  35. Hall R. 1998. The plate tectonics of Cenozoic SE Asia and the distribution of land and sea In: Hall R, Holloway JD, eds. Biogeography and geological evolution of SE Asia. Leiden, The Netherlands: Backhuys Publishers, 99–131. [Google Scholar]
  36. Heaney LR. 1985. Zoogeographic evidence for middle and late Pleistocene land bridges to the Philippine Islands. Modern Quaternary Research in Southeast Asia 9: 127–144. [Google Scholar]
  37. Honda M, Ota H, Kohler G, Ineich I, Chirio L, Chen S‐L, Hikida T. 2003. Phylogeny of the lizard subfamily Lygosominae (Reptilia: Scincidae), with special reference to the origin of the New World taxa. Genes Genetics Systematics 78: 71–80. [DOI] [PubMed] [Google Scholar]
  38. Huelsenbeck JP, Rannala B. 2004. Frequentist properties of Bayesian posterior probabilities of phylogenetic trees under simple and complex substitution models. Systematic Biology 53 : 904–913. [DOI] [PubMed] [Google Scholar]
  39. Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755. [DOI] [PubMed] [Google Scholar]
  40. Inger RF. 1954. Systematics and zoogeography of Philippine Amphibia. Fieldiana 33: 181–531. [Google Scholar]
  41. Inger RF. 1958. Three new skinks related to Sphenomorphus variegatus (Peters). Fieldiana: Zoology 39: 257–268. [Google Scholar]
  42. Inger RF, Lian TF, Lakim M, Yambun P. 2001. New species of the lizard genus Sphenomorphus, (Lacertilia: Scincidae), with notes on ecological and geographic distribution of species in Sabah, Malaysia. The Raffles Bulletin of Zoology 49: 181–189. [Google Scholar]
  43. Kennedy RS, Gonzales PC, Dickinson EC, Miranda HC, Fisher TH. 2000. A guide to the birds of the Philippines. Oxford: Oxford University Press. [Google Scholar]
  44. Kocher TD, Thomas WK, Meyer A, Edwards SV, Paabo S, Villablanca FX, Wilson AC. 1989. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences, USA 86: 6196–6200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Leaché AD. 2009. Species tree discordance traces to phylogeographic clade boundaries in North American fence lizards (Sceloporus). Systematic Biology 58: 547–559. [DOI] [PubMed] [Google Scholar]
  46. Linkem CW, Diesmos AC, Brown RM. 2010a. A new species of scincid lizard (Genus: Sphenomorphus) from Palawan Island, Philippines. Herpetologica 66: 67–79. [Google Scholar]
  47. Linkem CW, Hesed KM, Diesmos AC, Brown RM. 2010b. Species boundaries and cryptic lineage diversity in a Philippine forest skink complex (Reptilia; Squamata; Scincidae: Lygosominae). Molecular Phylogenetics and Evolution 56: 572–585. [DOI] [PubMed] [Google Scholar]
  48. Loveridge A. 1948. New Guinean reptiles and amphibians in the Museum of Comparative Zoology and United States National Museum. Bulletin of the Museum of Comparative Zoology 101 : 305–430. [Google Scholar]
  49. Macey JR, Larson A, Ananjeva NB, Fang Z, Papenfuss TJ. 1997. Two novel gene orders and the role of light‐strand replication in rearrangement of the vertebrate mitochondrial genome. Molecular Biology and Evolution 14: 91–104. [DOI] [PubMed] [Google Scholar]
  50. Marshall DC. 2010. Cryptic failure of partitioned Bayesian phylogenetic analyses: lost in the land of long trees. Systematic Biology 59: 108–117. [DOI] [PubMed] [Google Scholar]
  51. Marshall DC, Simon C, Buckley TR. 2006. Accurate branch length estimation in partitioned Bayesian analyses requires accommodation of among‐partition rate variation and attention to branch length priors. Systematic Biology 55: 993–1003. [DOI] [PubMed] [Google Scholar]
  52. Mittleman MB. 1952. A generic synopsis of the lizards of the subfamily Lygosominae. Smithsonian Miscellaneous Collections 117: 1–35. [Google Scholar]
  53. Myers WC, Donnelly MA. 1991. The lizard genus Sphenomorphus (Scincidae) in Panama, with a description of a new species. American Museum Novitates 3027: 1–12. [Google Scholar]
  54. Nylander JAA. 2004. Mrmodeltest v2. Program distributed by the author. Uppsala, Sweden: Evolutionary Biology Centre, Uppsala University. [Google Scholar]
  55. Nylander JAA, Ronquist F, Huelsenbeck JP, Nieves‐Aldrey JL. 2004. Bayesian phylogenetic analysis of combined data. Systematic Biology 53 : 47–67. [DOI] [PubMed] [Google Scholar]
  56. Nylander JAA, Wilgenbusch JC, Warren DL, Swofford DL. 2007. AWTY (Are We There Yet?) a system for graphical exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics 24: 581–583. [DOI] [PubMed] [Google Scholar]
  57. Palumbi SR. 1996. The polymerase chain reaction In: Hillis DM, Moritz C, Mable BK, eds. 2nd edn. Molecular systematics. Sunderland, MA: Sinauer Associates, 205–247. [Google Scholar]
  58. Philippe H, Snell EA, Bapteste E, Lopez P, Holland PWH, Casane D. 2004. Phylogenomics of eukaryotes: impacts of missing data on large alignments. Molecular Biology and Evolution 21: 1740–1752. [DOI] [PubMed] [Google Scholar]
  59. Posada D & Crandall KA. 2001. Selecting models of nucleotide substitution: An application to the human immunode‐ficiency virus 1 (HIV‐1). Molecular Biology and Evolution 18 : 271–275. [DOI] [PubMed] [Google Scholar]
  60. Rabosky DL, Donnellan SC, Talaba AL & Lovette IJ. 2007. Exceptional among‐lineage variation in diversification rates during the radiation of Australia's largest vertebrate clade. Proceeding of the Royal Society of London Series B 274 : 2915–2923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Rambaut A, Drummond AJ. 2007. Tracer. Available at: http://beast.bio.ed.ac.uk/Tracer
  62. Reeder TW. 2003. A phylogeny of the Australian Sphenomorphus group (Scincidae: Squamata) and the phylogenetic placement of the crocodile skinks (Tribolonotus): Bayesian approaches to assessing congruence and obtaining confidence in maximum likelihood inferred relationships. Molecular Phylogenetics and Evolution 27: 384–397. [DOI] [PubMed] [Google Scholar]
  63. Roberts TE. 2006a. History, ocean channels, and distance determine phylogeographic patterns in three widespread Philippine fruit bats (Pteropodidae). Molecular Ecology 15 : 2183–2199. [DOI] [PubMed] [Google Scholar]
  64. Roberts TE. 2006b. Multiple levels of allopatric divergence in the endemic Philippine fruit bat Haplonycteris fischeri (Pteropodidae). Biological Journal of the Linnaean Society 88 : 329–349. [Google Scholar]
  65. Say T. 1823. In James, E. Account of an expedition from Pittsburgh to the Rocky Mountains, performed in the years 1819, ’20, by order of the Hon. J. C. Calhoun, Secretary of War, under the command of Major Stephen H. Long. Vol. 2. Philadelphia: H. C. Carey & I. Lea.
  66. Schmitz A. 2003. Taxonomic and phylogenetic studies on scincid lizards (Reptilia: Scincidae). Unpublished Thesis, University Bonn, Germany.
  67. Skinner A. 2007. Phylogenetic relationships and rate of early diversification of Australian Sphenomorphus group scincids (Scincoidea, Squamata). Biological Journal of the Linnean Society 92: 347–366. [Google Scholar]
  68. Smith MA. 1937. A review of the genus Lygosoma (Scincidae, Reptilia) and its allies. Records of the Indian Museum 39: 213–234. [Google Scholar]
  69. Sokal R, Michner C. 1958. A statistical method for evaluating systematic relationships. University of Kansas Science Bulletin 38: 1409–1438. [Google Scholar]
  70. Taylor EH. 1922a. The lizards of the Philippine Islands. Manilla, Philippines: Philippine Bureau of Science. [Google Scholar]
  71. Taylor EH. 1922b. Additions to the herpetological fauna of the Philippine Islands, I. Philippine Journal of Science 21: 161–206. [Google Scholar]
  72. Taylor EH. 1922c. Additions to the herpetological fauna of the Philippine Islands, II. Philippine Journal of Science 21: 161–206. [Google Scholar]
  73. Taylor EH. 1923. Additions to the herpetological fauna of the Philippine Islands, III. Philippine Journal of Science 22: 151–557. [Google Scholar]
  74. Taylor EH. 1925. Additions to the herpetological fauna of the Philippine Islands, IV. Philippine Journal of Science 26: 97–111. [Google Scholar]
  75. Townsend TM, Alegre RE, Kelley ST, Wiens JJ, Reeder TW. 2008. Rapid development of multiple nuclear loci for phylogenetic analysis using genomic resources: an example from squamate reptiles. Molecular Phylogenetics and Evolution 47: 129–142. [DOI] [PubMed] [Google Scholar]
  76. Whiting AS, Bauer AM, Sites JW Jr. 2003. Phylogenetic relationships and limb loss in sub‐Saharan African scincine lizards (Squamata: Scincidae). Molecular Phylogenetics and Evolution 29: 582–598. [DOI] [PubMed] [Google Scholar]
  77. Wiens JJ. 2003. Missing data, incomplete taxa, and phylogenetic accuracy. Systematic Biology 52: 528–538. [DOI] [PubMed] [Google Scholar]
  78. Wiens JJ, Moen DS. 2008. Missing data and the accuracy of Bayesian phylogenetics. Journal of Systematic Evolution 46: 307–314. [Google Scholar]
  79. Wilgenbusch JC, Warren DL, Swofford DL. 2004. AWTY: a system for graphical exploration of MCMC convergence in Bayesian phylogenetic inference. Available at: http://ceb.csit.fsu.edu/awty. [DOI] [PubMed]

Articles from Zoological Journal of the Linnean Society are provided here courtesy of Wiley

RESOURCES