Skip to main content
NCBI home page
Wiley - PMC COVID-19 Collection logoLink to Wiley - PMC COVID-19 Collection
. 2019 May 30;103(5):1503–1511. doi: 10.1111/jpn.13129

Effect of chicken egg yolk immunoglobulins on serum biochemical profiles and intestinal bacterial populations in early‐weaned piglets

Xian Tan 1, Jia Li 1,2, Yali Li 1,✉, Jianzhong Li 1,✉, Qingping Wang 3, Lin Fang 3, Xueqin Ding 1, Pengfei Huang 1, Huansheng Yang 1,2,✉, Yulong Yin 1,2
PMCID: PMC7166376  PMID: 31144409

Abstract

This study was conducted to test the hypothesis that dietary supplementation with anti‐E. coli, chicken egg yolk immunoglobulins (IgY), may affect early weaned piglet (EWP) intestinal functions and enteric micro‐organisms. One hundred and forty‐eight ([Landrace × Yorkshire] × Duroc) piglets, weaned at age day 21, were randomly assigned to receive one of three diets for 14 days. Treatment group one (control group) was fed the base diet. Treatment group two (antibiotics group) was fed the base diet which was supplemented with 100 ppm colistin sulphate and 15 ppm enramycin; treatment group three (IgY group) was fed the base diet which was supplemented with 500 mg/kg anti‐E. coli IgY. The study evaluated the effects on EWPs of IgY on growth, serum biochemical, inflammatory profiles and also digestion content intestinal bacterial populations. Results showed no significant difference in diarrhoea rates between IgY‐fed EWPs and antibiotic‐treated EWPs. Serum biochemical analysis showed that EWPs fed an IgY‐containing diet had both lower (p < 0.05) cholesterol and low‐density lipoprotein compared to antibiotic‐treated EWPs. Escherichia coli populations measured in IgY‐fed EWP ileal contents, compared to the control group, were significantly reduced (p < 0.05). Enterococcus, Lactobacillus, Clostridium and Bifidobacterium populations were unaffected by the IgY treatment. Larger (p < 0.05) Enterococcus populations and lower (p < 0.05) expression levels of heat‐stable enterotoxin b (STb) were observed in IgY‐fed EWP caecal digesta compared to the control group. Enteric Lactobacillus significantly decreased (p < 0.05) in EWPs fed antibiotics while it was unaffected by IgY treatment. Dietary supplementation with anti‐E. coli IgY has the potential to suppress enteric E. coli growth, but not Lactobacillus, Clostridium and Bifidobacterium. This promotes and maintains a healthy EWP intestinal environment. These findings suggest that IgY may be used as an alternative to antibiotics in EWP diets.

Keywords: antibiotic, diarrhoea, early weaned piglets, egg yolk immunoglobulins, gut microflora

1. INTRODUCTION

Weaning triggers significant psychosocial, and physical, stress in piglets including maternal and littermate separation, and abrupt diet change (Campbell, Crenshaw, & Polo, 2013; Qiao, Li, Wang, & Wang, 2015; Xiong et al., 2015). Abrupt weaning can contribute to intestinal and immune system dysfunctions and lead to diarrhoea (Kuang et al., 2015; Pluske, Hampson, & Williams, 1997). In order to address problems caused by weaning, antibiotics have been widely used (Cromwell, 2002; Yin et al., 2009). Misuse of antibiotics in feed has resulted in serious complications due to drug residues in animal products and increased bacterial resistance (Yen, Lai, Lin, & Chiang, 2015). Dietary antibiotics change enteric microflora that are important maintaining intestinal health and function (Guarner & Malagelada, 2003).

IgY derived from egg yolks by immunizing hens. It is actively transported from hen serum into the embryo via the egg yolk and provides passive immunity to embryos and offspring (Muller, Schubert, Zajac, Dyck, & Oelkrug, 2015; Sui, Cao, & Lin, 2011). IgY is resistant against specific pathogens based on the antigen the hens are immunized against. It has been shown to be effective against a variety of intestinal pathogens particularly diarrhoea pathogens such as bovine and human rotaviruses, bovine coronavirus, enterotoxigenic Escherichia coli (ETEC) and Salmonella (Diraviyam et al., 2014; Muller et al., 2015; Sui et al., 2011; Thu et al., 2017; Xu et al., 2011). IgY has attracted considerable interest as an alternative to antibiotics for the control of infectious diseases in the alimentary tract (Li, Wang, Zhen, Li, & Xu, 2015). The present study was conducted to test the hypothesis that supplementing early weaned piglet (EWP) diets with anti‐E. coli IgY may affect their enteric Escherichia coli, without affecting other micro‐organisms, and also beneficially intestinal function.

2. MATERIALS AND METHODS

2.1. Animals, housing and experimental treatments

One hundred and forty‐eight (148) ([Landrace × Yorkshire] × Duroc) piglets were weaned day 21. Their initial body weight (BW) was 7.37 ± 0.26 kg. They were used in a 14‐day feeding trial. EWPs were assigned to one of three possible treatments (3 replicate/treatment; 13–17 piglets/replicate). They were the control group (base diet), the antibiotics group (base diet + 100 ppm colistin sulphate + 15 ppm enramycin) and the IgY group (base diet + 500 ppm specific IgY). The base diet formulation (Table 1) met nutrient requirements of weaned pigs as recommended by the National Research Council (NRC, 2012). Specific IgY with high titres of anti‐E. coli (50 000) was provided by Zyme Fast (Changsha) Biotechnology. Throughout the experimental period, feed and water were available ad libitum. At the end of the trial, seven EWPs from each group were randomly selected and sacrificed for sampling. The experimental design and procedures in this study were reviewed and approved by the Animal Care and Use Committee of Hunan Normal University, Changsha City, Hunan, China.

Table 1.

Diet composition as fed

Component Content (%)
Corn 37.66
Extruded corn 20.00
Soybean meal, 43% CP 8.00
Concentrated soy protein 7.00
Whey 10.00
Fish meal, 63% CP 5.00
Plasma protein powder 4.50
l‐lysine HCl, 98% 0.33
dl‐methionine 0.08
l‐threonine 0.03
l‐tryptophan 0.01
Glucose 2.00
Soybean oil 2.00
Limestone 1.04
Monocalcium phosphate 0.50
Choline chloride, 50% 0.10
Antioxidants 0.05
Zinc oxide 0.30
Citric acid 0.30
Vitamin–mineral premixa 1.00
IgY premix or carrierb 0.10
Total 100
Calculated composition
CP, % 18.0
ME, MJ/kg 14.2
Lysinec % 1.35
Methioninec % 0.39
Methionine + cystinec % 0.74
Threoninec % 0.79
Tryptophanc % 0.22
Open in a new tab

Abbreviations: CP, crude protein; ME, metabolizable energy.

a

Vitamin–mineral premix supplied per kilogram of feed: 10,000 IU of vitamin A, 1,000 IU of vitamin D3, 80 IU of vitamin E, 2.0 mg of vitamin K3, 0.03 mg of vitamin B12, 12 mg of riboflavin, 40 mg of niacin, 25 mg of d‐pantothenic acid, 0.25 mg of biotin, 1.6 mg of folic acid, 3.0 mg of thiamine, 2.25 mg of pyridoxine, 300 mg of choline chloride, 150 mg of Fe (FeSO4), 100 mg of Zn (ZnSO4), 30 mg of Mn (MnSO4), 25 mg of Cu (CuSO4), 0.5 mg of I (KIO3), 0.3 mg of Co (CoSO4), 0.3 mg of Se (Na2SeO3) and 4.0 mg of ethoxyquin.

b

IgY = chicken egg yolk immunoglobulins; dried, egg yolk powder spray was used as carrier.

c

Standardized ileal digestible.

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

2.2. Growth performance and diarrhoea rate

Initial and final body weight and feed consumption were recorded throughout the trial. Average daily gain (ADG), average daily feed intake (ADFI) and feed/gain (F:G) ratio were calculated. Each pig was clinically monitored throughout the experiment. Diarrhoea score was recorded as (0), normal; (1), soft; (2), mild diarrhoea; and (3), severe diarrhoea (watery stool) (Alustiza et al., 2016). Diarrhoea rate was calculated according to this formula. Diarrhoea rate (%) = number of EWPs with diarrhoea within a treatment/(number of EWPs × total experimental days) × 100%. “Number of EWPs with diarrhoea” was the total number of EWPs with diarrhoea observed on a particular day (Wan et al., 2016).

2.3. Collection of serum, digesta and jejunal mucosal samples

Blood was sampled via 10‐ml vacutainer tubes that contained EDTA as an anticoagulant. They were centrifuged at 3,000 × g for 10 min at 4°C (Yin et al., 2009) and stored at −80°C until the biochemical profile analysis was performed. Total protein (TP), alanine transaminase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), glucose (GLU), triglycerides (TG), cholesterol (CHOL), high‐density lipoprotein (HDL), low‐density lipoprotein (LDL), diamine oxidase (DAO), Complement C4, immunoglobulin M (IgM) and NH3 in serum were examined. Digesta samples from the ileum, caecum and colon were collected, quick‐frozen in liquid nitrogen and stored at −80°C (Kuang et al., 2015). Mid‐jejunum intestinal tissues (approximately 20 cm) were collected. Mucosa samples were scraped using sterilized glass slides, frozen in liquid nitrogen and stored at ‐80°C for further processing (Xiong et al., 2015).

2.4. RNA isolation and real‐time quantitative PCR analysis

Total RNA was isolated from jejunal mucosal samples using a TRIzol reagent (100 mg tissue per 1 ml TRIzol; Invitrogen Life Technologies) following manufacturer instructions. RNA integrity was checked using 1% agarose gel electrophoresis stained with 10 µg/ml ethidium bromide. The quantity and quality of RNA were determined using a NanoDrop ND‐2000 spectrophotometer system (Thermo Fisher Scientific). All RNA samples were reverse transcribed into cDNA using a Superscript First‐Strand Synthesis System (Invitrogen Life Technologies) with a PrimeScript RT‐PCR kit (TaKaRa) using OligodT Primer. cDNA samples were then tested for IL‐1β, IL‐6, IFN‐r, TNF‐α, ZO‐1, Claudin‐1 and Occludin‐1 expressions via real‐time RT‐PCR performed as described by Yang, Wang, Xiong, and Yin (2016). Results were normalized to β‐actin expression. Relative quantification was calculated using the 2−ΔΔCT method. The sequences for the sense and antisense primers used to quantify mRNA were designed using Oligo 6.0 (Molecular Biology Insights) and appear in Table 2.

Table 2.

Cytokines primers and tight junction proteins used

Target gene Orientation Sequence (5′–3′) T m (°C) Product size (bp)
β‐actin Forward AGTTGAAGGTGGTCTCGTGG 57.4 216
Reverse TGCGGGACATCAAGGAGAAG
IL‐1β Forward CCTGGACCTTGGTTCTCT 53 123
Reverse GGATTCTTCATCGGCTTCT
IL‐6 Forward GGCAAAAGGGAAAGAATCCAG 57 87
Reverse CGTTCTGTGACTGCAGCTTATCC
IFN‐r Forward CCATTCAAAGGAGCATGGAT 55 146
Reverse GAGTTCACTGATGGCTTTGC
TNF‐α Forward ACAGGCCAGCTCCCTCTTAT 53.9 102
Reverse CCTCGCCCTCCTGAATAAAT
ZO‐1 Forward TTGATAGTGGCGTTGACA 52 126
Reverse CCTCATCTTCATCATCTTCTAC
Claudin‐1 Forward CTAGTGATGAGGCAGATGAA 59 250
Reverse AGATAGGTCCGAAGCAGAT
Occludin Forward GAGTGATTCGGATTCTGTCT 54 181
Reverse TAGCCATAACCATAGCCATAG
Open in a new tab

Abbreviations: IL‐1β, interleukin 1β; IL‐6, interleukin 6; IFN‐r, interferon‐γ; Tm, melting temperature; TNF‐α, tumour necrosis factor alpha; ZO‐1, Zonula occludens‐1.

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

2.5. Bacterial quantification by real‐time PCR

Intestinal digesta samples were collected after sacrifice. Total bacteria DNA was extracted using a QIAamp DNA stool mini kit (Qiagen) following manufacturer's instructions. DNA concentration and quality were checked using NanoDrop ND‐2000 spectrophotometer system (Fisher Scientific) prior to the samples being adjusted to a concentration of 10 ng/µl. Enterococcus, E. coli, Lactobacillus, Clostridium, Bifidobacterium and enterotoxins quantifications were conducted using real‐time PCR, according to the methods described in Wang, Zijlstra, and Ganzle (2017). Results were normalized total bacteria expression and relative fold changes calculated by the 2−ΔΔCT method. PCR primers are listed in Table 3.

Table 3.

Primers used to amplify bacteria and enterotoxins in digesta samples

Target gene Orientation Sequence (5′–3′) T m (°C) Product size (bp)
Total bacteria Forward CGGTCCAGACTCCTACGGG 63 200
Reverse TTACCGCGGCTGCTGGCAC
Enterococcus Forward CCCTTATTGTTAGTTGCCATCATT 63 144
Reverse ACTCGTTGTACTTCCCATTGT
Escherichia coli Forward CCGATACGCTGCCAATCAGT 65 884
Reverse ACGCAGACCGTAGGCCAGAT
Lactobacillus Forward AGCAGTAGGGAATCTTCCA 59 341
Reverse CACCGCTACACATGGAG
Clostridium Forward AATGACGGTACCTGACTAA 63 439
Reverse CTTTGAGTTTCATTCTTGCGAA
Bifidobacterium Forward CGCGTCCGGTGTGAAAG 51 121
Reverse CTTCCCGATATCTACACATTCCA
Heat‐labile Forward CCGTGCTGACTCTAGACCCCCA 68 480
Enterotoxin Reverse CCTGCTAATCTGTAACCATCCTCTGC
Heat‐stable Forward TGCCTATGCATCTACACAAT 63 110
Enterotoxin b Reverse CTCCAGCAGTACCATCTCTA
Open in a new tab

Abbreviation: T m, melting temperature.

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

2.6. Statistical analysis

Results were expressed as mean ± SEM. Statistical differences were determined using one‐way ANOVA with spss 22.0 software (SPSS). Duncan differences were determined to compare differences among the groups. Values were considered significantly different at p < 0.05, while 0.05 < p < 0.10 was used to indicate a tendency towards significance.

3. RESULTS

3.1. Growth performance and diarrhoea rates

Early weaned piglet growth during the 14‐day experimental period appears in Table 4. ADG, ADFI and F:G were similar for all dietary treatments. EWPS fed antibiotic‐containing diets had lower (p < 0.05) diarrhoea rates than controls. There were no diarrhoea rate differences between antibiotic‐treated and IgY‐fed EWPs.

Table 4.

Effects of antibiotics or IgY on early weaned piglet growth

Item Control Antibiotics IgY p‐Values
Initial weight/kg 7.38 ± 0.73 7.36 ± 0.28 7.37 ± 0.44 0.999
Final weight/kg 8.35 ± 0.75 8.38 ± 0.25 8.58 ± 0.28 0.938
ADG (g/day) 69.34 ± 9.47 73.04 ± 6.94 86.66 ± 33.87 0.958
ADFI (g/day) 197.28 ± 36.52 210.39 ± 5.23 171.33 ± 18.25 0.252
F:G 2.82 ± 0.26 2.93 ± 0.3 2.43 ± 0.58 0.674
Diarrhoea ratio (%) 3.7 ± 0.53a 1.51 ± 0.57b 3.15 ± 0.84ab 0.020
Diarrhoea index 0.079 ± 0.01a 0.032 ± 0.014b 0.07 ± 0.02ab 0.049
Open in a new tab

Values are expressed as mean ± SEM, n = 3.

Abbreviations: ADG, average daily gain; ADFI, average daily feed intake; F:G, feed/gain.

Means within each row, values not labelled with the same superscript letters are significantly different at p < 0.05 or show a tendency towards differing at p < 0.10.

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

3.2. Serum biochemical indexes

Serum biochemical analysis showed that EWPs fed an IgY‐containing diet had lower (p < 0.05) CHOL and LDL than did antibiotic‐treated EWPs. There were no differences in serum TP, ALT, AST, BUN, GLU, TG, HDL, DAO, C4, IgM or NH3 among the three treatment groups (Table 5).

Table 5.

EWP serum biochemical profiles

Item Control Antibiotics IgY p‐Values
TP (g/L) 49.01 ± 1.25 50.17 ± 0.63 52.00 ± 1.27 0.187
ALT (U/L) 41.41 ± 4.91 36.31 ± 1.83 35.41 ± 3.47 0.467
AST (U/L) 52 ± 4.71 48.5 ± 4.42 50.2 ± 4.88 0.867
BUN (mmol/L) 3.99 ± 0.37 4.36 ± 0.19 4.11 ± 0.35 0.703
GLU (mmol/L) 6.71 ± 0.47 6.7 ± 0.40 5.41 ± 0.55 0.116
TG (mmol/L) 0.53 ± 0.04 0.56 ± 0.05 0.54 ± 0.04 0.858
CHOL (mmol/L) 1.93 ± 0.12ab 2.28 ± 0.16a 1.76 ± 0.12b 0.039
HDL (mmol/L) 0.85 ± 0.09 0.99 ± 0.07 0.73 ± 0.07 0.108
LDL (mmol/L) 1.02 ± 0.06ab 1.23 ± 0.10a 0.93 ± 0.07b 0.036
DAO (mmol/L) 1.43 ± 0.24 1.34 ± 0.16 1.1 ± 0.09 0.663
C4 (g/L) 0.03 ± 0.001 0.03 ± 0.004 0.03 ± 0.002 0.605
IgM (g/L) 0.56 ± 0.04 0.53 ± 0.06 0.57 ± 0.06 0.854
NH3 (µmol/L) 306 ± 22.82 301.83 ± 15.99 261.56 ± 10.37 0.156
Open in a new tab

Values are expressed as mean ± SEM, n = 7.

Abbreviations: ALT, alanine transaminase; AST, aspartate aminotransferase; BUN, blood urea nitrogen; C4, Complement C4; CHOL, cholesterol; DAO, diamine oxidase; GLU, glucose; HDL, high‐density lipoprotein; IgM, immunoglobulin M; LDL, low‐density lipoprotein; NH3, ammonia; TG, triglycerides; TP, total protein.

Means within each row, values not labelled with the same superscript letters are significantly different at p < 0.05 or show a tendency towards differing at p < 0.10.

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

3.3. Gene expression of pro‐inflammatory cytokine and tight junction protein in jejunal mucosa

IL‐1β gene expression decreased (p < 0.1) in the groups receiving antibiotics compared to the control group and the IgY group. There were no significant differences in the mRNA expression of pro‐inflammatory cytokines (IL‐6, IFN‐r and TNF‐α). Tight junction proteins (ZO‐1, Claudin‐1 and Occludin‐1) were observed in all treatment groups (Table 6).

Table 6.

Gene expression in jejunal mucosa of inflammatory profiles and tight junction proteins

Item Control Antibiotics IgY p‐Values
IL‐1β 1.04 ± 0.10 0.59 ± 0.15 0.81 ± 0.13 0.071
IL‐6 1.06 ± 0.13 0.69 ± 0.12 1.01 ± 0.26 0.340
IFN‐r 1.09 ± 0.21 1.44 ± 0.41 1.32 ± 0.28 0.803
TNF‐α 1.06 ± 0.10 0.98 ± 0.24 0.88 ± 0.17 0.624
Z0‐1 1.07 ± 0.15 1.01 ± 0.07 1.16 ± 0.09 0.595
Claudin‐1 1.20 ± 0.26 1.26 ± 0.14 1.38 ± 0.23 0.828
Occludin‐1 1.09 ± 0.18 1.04 ± 0.19 1.05 ± 0.15 0.984
Open in a new tab

Values are expressed as mean ± SEM, n = 7.

Abbreviations: IL‐1β, interleukin 1β; IL‐6, interleukin 6; INF‐r, interferon‐γ; TNF‐α, tumour necrosis factor alpha; ZO‐1, Zonula occludens‐1.

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

3.4. Intestinal bacterial population changes

In‐feed antibiotics significantly decreased (p < 0.05) E. coli and Lactobacillus populations as well as heat‐stable enterotoxin b (STb) expression in ileal contents compared to the control group (Table 7). E. coli population significantly (p < 0.05) reduced in IgY‐fed EWP ileal contents compared to the control group. Enterococcus, Lactobacillus, Clostridium, Bifidobacterium populations as well as enterotoxin expressions were unaffected by IgY treatment. Dietary antibiotics significantly decreased (p < 0.05) E. coli and Lactobacillus in caecal digesta as well as STb expression levels compared to the control group (p < 0.05). Greater (p < 0.05) Enterococcus populations and lower (p < 0.05) STb expression levels were observed in EWPs fed IgY compared to the control diet (p < 0.05). Lactobacillus expression levels in colonic digesta significantly decreased (p < 0.05) in EWPs fed diets containing antibiotics compared to the control group. No significant differences in bacterial populations in IgY group colonic contents were measured compared to the control group.

Table 7.

Changes in early weaned piglet intestinal bacterial populations

Item Control Antibiotics IgY p‐Values
Ileum
Enterococcus 1.17 ± 0.23 0.89 ± 0.34 1.78 ± 0.53 0.293
Escherichia coli 1.20 ± 0.30a 0.12 ± 0.05b 0.25 ± 0.12b 0.018
Lactobacillus 1.06 ± 0.15a 0.50 ± 0.28b 0.99 ± 0.15a 0.040
Clostridium 1.03 ± 0.08 0.92 ± 0.33 1.10 ± 0.31 0.904
Bifidobacterium 1.01 ± 0.13 1.05 ± 0.44 0.98 ± 0.17 0.948
Heat‐labile enterotoxin 1.27 ± 0.27 0.74 ± 0.40 1.75 ± 0.63 0.203
Heat‐stable enterotoxin b 1.17 ± 0.26a 0.25 ± 0.18b 0.73 ± 0.24ab 0.039
Caecum
Enterococcus 1.11 ± 0.20b 0.86 ± 0.20b 2.01 ± 0.44a 0.041
Escherichia coli 1.11 ± 0.22a 0.08 ± 0.03b 4.22 ± 1.57a 0.005
Lactobacillus 1.14 ± 0.22a 0.31 ± 0.14b 1.75 ± 0.38a 0.002
Clostridium 1.05 ± 0.13 0.84 ± 0.20 0.75 ± 0.11 0.340
Bifidobacterium 1.04 ± 0.01 0.86 ± 0.14 0.88 ± 0.15 0.569
Heat‐labile enterotoxin 1.42 ± 0.60 6.84 ± 2.38 6.34 ± 2.33 0.355
Heat‐stable enterotoxin b 1.32 ± 0.47a 0.39 ± 0.12b 0.43 ± 0.17b 0.063
Colon
Enterococcus 1.11 ± 0.0.13 1.27 ± 0.51 1.04 ± 0.11 0.581
Escherichia coli 1.22 ± 0.36 0.66 ± 0.35 1.95 ± 0.91 0.195
Lactobacillus 1.45 ± 0.48a 0.23 ± 0.11b 1.36 ± 0.42ab 0.028
Clostridium 1.11 ± 0.16 1.36 ± 0.25 1.06 ± 0.15 0.506
Bifidobacterium 1.13 ± 0.18 1.40 ± 0.22 1.01 ± 0.17 0.358
Heat‐labile enterotoxin 1.35 ± 0.46 3.80 ± 1.41 5.30 ± 1.77 0.344
Heat‐stable enterotoxin b 1.14 ± 0.30 1.53 ± 0.94 1.70 ± 0.70 0.926
Open in a new tab

Values are expressed as mean ± SEM, n = 7.

Means within each row, values not labelled with the same superscript letters are significantly different at p < 0.05 or show a tendency towards differing at p < 0.10.

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

4. DISCUSSION

Enterotoxigenic E. coli is a major cause of diarrhoea and death in neonatal and EWPs (Wu et al., 2012). E. coli can adhere to the intestinal epithelial cells and elaborate enterotoxins (LT, STa or STb). This induces diarrhoea and intestinal inflammation (Heo et al., 2013; Wang et al., 2017). In the experiments described here, dietary supplementation of antibiotics or E. coli K88‐specific IgY had no effect on ADG or ADFI compared to the control group. Heo et al. (2015) reported that egg antibodies did not significantly affect growth performance in 21‐day‐old EWPs in the first phase (14‐day period and unchallenged) of the investigation.

It has been reported that pro‐inflammatory cytokines, such as TNF‐α, IFN‐r, IL‐6 and IL‐1β, play a crucial role in the modulating inflammatory response (Al‐Sadi, Boivin, & Ma, 2009) and also participate in intestinal barrier integrity regulation (Hu, Xiao, Luan, & Song, 2013; Wang et al., 2016). The present study analysed gene expressions of pro‐inflammatory cytokines and tight junction proteins in the EWP intestines. No significant differences were observed. This demonstrates that adding antibiotics or IgY to diets results in no differences in intestinal inflammatory responses or intestinal barrier integrity.

Digestive system microflora play important roles in maintaining intestinal health and function (Dowarah, Verma, & Agarwal, 2017). A previous study on intestinal microbiota of weaned piglets has shown that after weaning, E. coli concentrations increased while the number of Lactobacillus decreased (Konstantinov et al., 2006). As we know, E. coli is one of the major sources of intestinal pathogens, and a few strains can induce serious illness, including diarrhoea (Hu et al., 2014). The improvement of the immunoglobulins is required to regulate and enhance immune function, which provides health benefits, diminished weaning stress and improved health status and performance of weaning pigs. This study detected significantly decreased E. coli in ileal digesta in IgY‐fed EWPs and antibiotic‐fed EWPs compared to controls. This suggests that IgY has the similar effect to antibiotic against E. coli. Antibiotic feed reduced E. coli populations in the caecum which is consistent with Wu et al. (2012), who reported that antibiotics reduced E. coli populations in the caecum compared to control EWPs. Dietary IgY supplements increased Lactobacillus population in the ileum and caecum compared with the antibiotic group and significantly decreased enterotoxin STb in caecum digesta compared to the control group. These results show that the inclusion of antibiotic in the diet reduced the proliferation of both harmful coliform bacteria and beneficial Lactobacillus in the pig's gut. Antibiotics seriously affect the activity and composition of the gut microflora. It is reported that most cases of antibiotic‐associated diarrhoea (AAD) may be due to direct toxics effects of antibiotics on the intestine, altered digestive function secondary to reduced concentrations of gut bacteria or overgrowth of pathogenic micro‐organisms (Beaugerie & Petit, 2004). Additionally, it has been reported that an increment of Lactobacillus results in competitively exclude potentially pathogenic species from colonizing the intestine (Collier et al., 2003). In our study, Clostridium and Bifidobacterium are not affected by IgY supplementation.

In healthy intestinal tracts, Lactobacillus dominates (Dowarah et al., 2017). Lactobacillus is considered to produce lactate from sugars as the only or major end product with some minor products such as acetate, formate or ethanol (Tsukahara & Ushida, 2002). Previous studies demonstrated Lactobacillus potential to increase beneficial bacteria and inhibit pathogenic bacteria (Hossain, Begum, & Kim, 2015; Qi et al., 2011). Lactobacillus produced lactic acid, hydrogen peroxide and lactoferrin which may exhibit antagonistic activity against E. coli (Li, Ni, et al., 2015). IgY supplementation significantly decreased cholesterol and low‐density lipoprotein concentrations and confirms this positive effect of IgY. Jeon, Kang, Kim, Hwangbo, and Park (2016) reported findings consistent with this report that IgY significantly decreases total cholesterol compared to the control group. The decreased cholesterol concentration could be attributed to assimilation (or uptake) by Lactobacillus (Buck & Gilliland, 1994) or to coprecipitate of cholesterol with deconjugated bile salts (Jin, Ho, Abdullah, & Jalaludin, 1998). Chen, Wang, Yan, and Huang (2013) reported probiotics reduced serum cholesterol and inhibit hydroxyl‐methyl‐glutaryl coenzyme‐A, which is involved in cholesterol synthesis. Thus, the decreased cholesterol concentration could be attributed to the reduced synthesis of cholesterol. Low‐density lipoprotein (LDL) is also referred to as “bad” cholesterol, because it constitutes a major risk factor for cardiovascular disease (Toth et al., 2013).

In order to prevent or treat enteric infections, IgY must resist degradation and reach the small intestine without activity loss (Hong et al., 2004). Several strategies to protect IgY from hydrolysis have been developed including liposomes (Chang, Lee, Chen, & Tu, 2002), polymeric microspheres (Torche et al., 2006) and multiple emulsifications (Cho et al., 2005). Further investigations are indispensable to determine how robust of IgY application can be. Optimizing IgY dose effectiveness via a suitable formulation to withstand the gastric environment is warranted, and we hope explore any synergistic effects of combining IgY with other therapeutic strategies, such as probiotics or plant extracts in order to improve performance.

5. CONCLUSION

In this work, dietary supplementation with IgY has the potential to suppress the growth of bacterial pathogens, thus promoting and maintaining a healthy EWP intestinal environments. These findings suggest that IgY may be used as an alternative to the use of antibiotics in diets for weaned EWPs.

ACKNOWLEDGEMENTS

This work was supported by Key Programs of Frontier Scientific Research of the Chinese Academy of Sciences (QYZDY‐SSW‐SMC008), Natural Science Foundation of Hunan Province (2017JJ1020) and Young Elite Scientists Sponsorship Program by CAST (YESS20160086).

Tan X, Li J, Li Y, et al. Effect of chicken egg yolk immunoglobulins on serum biochemical profiles and intestinal bacterial populations in early weaned piglets. J Anim Physiol Anim Nutr. 2019;103:1503–1511. 10.1111/jpn.13129

Xian Tan and Jia Li contributed equally to this work.

Contributor Information

Yali Li, Email: liyali06@163.com.

Jianzhong Li, Email: ljzhong@hunnu.edu.cn.

Huansheng Yang, Email: yhs@hunnu.edu.cn.

REFERENCES

  1. Al‐Sadi, R. , Boivin, M. , & Ma, T. (2009). Mechanism of cytokine modulation of epithelial tight junction barrier. Frontiers in Bioscience, 14, 2765–2778. 10.2741/3413 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alustiza, F. , Bellingeri, R. , Picco, N. , Motta, C. , Grosso, M. C. , Barbero, C. A. , … Vivas, A. (2016). IgY against enterotoxigenic Escherichia coli administered byhydrogel‐carbon nanotubes composites to prevent neonatal diarrhoea in experimentally challenged piglets. Vaccine, 34, 3291–3297. 10.1016/j.vaccine.2016.05.004 [DOI] [PubMed] [Google Scholar]
  3. Beaugerie, L. , & Petit, J. C. (2004). Antibiotic‐associated diarrhoea. Best Practice & Research Clinical Gastroenterology, 18, 337–352. 10.1016/j.bpg.2003.10.002 [DOI] [PubMed] [Google Scholar]
  4. Buck, L. M. , & Gilliland, S. E. (1994). Comparisons of freshly isolated strains of Lactobacillus acidophilus of human intestinal origin for ability to assimilate cholesterol during growth. Journal of Dairy Science, 77, 2925–2933. 10.3168/jds.S0022-0302(94)77233-7 [DOI] [PubMed] [Google Scholar]
  5. Campbell, J. M. , Crenshaw, J. D. , & Polo, J. (2013). The biological stress of early weaned piglets. Journal of Animal Science and Biotechnology, 4, 19 10.1186/2049-1891-4-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chang, H. M. , Lee, Y. C. , Chen, C. C. , & Tu, Y. Y. (2002). Microencapsulation protects immunoglobulin in yolk (IgY) specific against Helicobacter pylori urease. Journal of Food Science, 67, 15–20. 10.1111/j.1365-2621.2002.tb11351.x [DOI] [Google Scholar]
  7. Chen, W. , Wang, J. P. , Yan, L. , & Huang, Y. Q. (2013). Evaluation of probiotics in diets with different nutrient densities on growth performance, blood characteristics, relative organ weight and breast meat characteristics in broilers. British Poultry Science, 54, 635–641. 10.1080/00071668.2013.825369 [DOI] [PubMed] [Google Scholar]
  8. Cho, Y. H. , Lee, J. J. , Park, I. B. , Huh, C. S. , Baek, Y. J. , & Park, J. (2005). Protective effect of microencapsulation consisting of multiple emulsification and heat gelation processes on immunoglobulin in yolk. Journal of Food Science, 70, E148–E151. 10.1111/j.1365-2621.2005.tb07088.x [DOI] [Google Scholar]
  9. Collier, C. T. , Smiricky‐Tjardes, M. R. , Albin, D. M. , Wubben, J. E. , Gabert, V. M. , Deplancke, B. , … Gaskins, H. R. (2003). Molecular ecological analysis of porcine ileal microbiota responses to antimicrobial growth promoters. Journal of Animal Science, 81, 3035–3045. 10.2527/2003.81123035x [DOI] [PubMed] [Google Scholar]
  10. Cromwell, G. L. (2002). Why and how antibiotics are used in swine production. Animal Biotechnology, 13, 7–27. 10.1081/ABIO-120005767 [DOI] [PubMed] [Google Scholar]
  11. Diraviyam, T. , Zhao, B. , Wang, Y. , Schade, R. , Michael, A. , & Zhang, X. (2014). Effect of chicken egg yolk antibodies (IgY) against diarrhea in domesticated animals: A systematic review and meta‐analysis. PLoS ONE, 9, e97716 10.1371/journal.pone.0097716 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dowarah, R. , Verma, A. K. , & Agarwal, N. (2017). The use of Lactobacillus as an alternative of antibiotic growth promoters in pigs: A review. Animal Nutrition, 3, 1–6. 10.1016/j.aninu.2016.11.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Guarner, F. , & Malagelada, J. R. (2003). Gut flora in health and disease. Lancet, 361, 512–519. 10.1016/S0140-6736(03)12489-0 [DOI] [PubMed] [Google Scholar]
  14. Heo, J. M. , Opapeju, F. O. , Pluske, J. R. , Kim, J. C. , Hampson, D. J. , & Nyachoti, C. M. (2013). Gastrointestinal health and function in weaned pigs: A review of feeding strategies to control post‐weaning diarrhoea without using in‐feed antimicrobial compounds. Journal of Animal Physiology and Animal Nutrition, 97, 207–237. 10.1111/j.1439-0396.2012.01284.x [DOI] [PubMed] [Google Scholar]
  15. Heo, J. M. , Woyengo, T. A. , Kahindi, R. K. , Kiarie, E. , Maiti, P. K. , & Nyachoti, C. M. (2015). Ileal amino acid digestibility in egg from hyperimmunized‐hens fed to weaned pigs and piglet response to diets contain egg products. Animal Feed Science and Technology, 204, 52–61. 10.1016/j.anifeedsci.2015.03.006 [DOI] [PubMed] [Google Scholar]
  16. Hong, J. W. , Kwon, O. S. , Min, B. J. , Lee, W. B. , Shon, K. S. , Kim, I. H. , & Kim, J. W. (2004). Evaluation effects of spray‐dried egg protein containing specific egg yolk antibodies as a substitute for spray‐dried plasma protein or antibiotics in weaned pigs. Asian‐Australasian Journal of Animal Sciences, 17, 1139–1144. 10.5713/ajas.2004.1139 [DOI] [Google Scholar]
  17. Hossain, M. M. , Begum, M. , & Kim, I. H. (2015). Effect of Bacillus subtilis, Clostridium butyricum and Lactobacillus acidophilus endospores on growth performance, nutrient digestibility, meat quality, relative organ weight, microbial shedding and excreta noxious gas emission in broilers. Veterinární Medicína, 60, 77–86. 10.17221/7981-VETMED [DOI] [Google Scholar]
  18. Hu, C. H. , Xiao, K. , Luan, Z. S. , & Song, J. (2013). Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen‐activated protein kinases in pigs. Journal of Animal Science, 91, 1094–1101. 10.2527/jas.2012-5796 [DOI] [PubMed] [Google Scholar]
  19. Hu, Y. , Dun, Y. , Li, S. , Zhao, S. , Peng, N. , & Liang, Y. (2014). Effects of Bacillus subtilis KN‐42 on growth performance, diarrhea and faecal bacterial flora of weaned piglets. Asian Australasian Journal of Animal Sciences, 27, 1131–1140. 10.5713/ajas.2013.13737 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jeon, I. S. , Kang, H. K. , Kim, C. H. , Hwangbo, J. , & Park, S. B. (2016). Effects of egg yolk antibody powder (IgY) supplementation on growth performance, blood component profile, intestinal microflora, and immunoglobulin G in meat ducks. Korean Journal of Poultry Science, 43, 143–148. 10.5536/KJPS.2016.43.3.143 [DOI] [Google Scholar]
  21. Jin, L. Z. , Ho, Y. W. , Abdullah, N. , & Jalaludin, S. (1998). Growth performance, intestinal microbial populations, and serum cholesterol of broilers fed diets containing Lactobacillus cultures. Poultry Science, 77, 1259–1265. 10.1093/ps/77.9.1259 [DOI] [PubMed] [Google Scholar]
  22. Konstantinov, S. R. , Awati, A. A. , Williams, B. A. , Miller, B. G. , Jones, P. , Stokes, C. R. , … de Vos, W. M. (2006). Post‐natal development of the porcine microbiota composition and activities. Environmental Microbiology, 8, 1191–1199. 10.1111/j.1462-2920.2006.01009.x [DOI] [PubMed] [Google Scholar]
  23. Kuang, Y. , Wang, Y. , Zhang, Y. , Song, Y. , Zhang, X. , Lin, Y. , … Fang, Z. (2015). Effects of dietary combinations of organic acids and medium chain fatty acids as a replacement of zinc oxide on growth, digestibility and immunity of weaned pigs. Animal Feed Science and Technology, 208, 145–157. 10.1016/j.anifeedsci.2015.07.010 [DOI] [Google Scholar]
  24. Li, D. , Ni, K. , Pang, H. , Wang, Y. , Cai, Y. , & Jin, Q. (2015). Identification and antimicrobial activity detection of lactic acid bacteria isolated from corn stover silage. Asian‐Australasian Journal of Animal Sciences, 28, 620–631. 10.5713/ajas.14.0439 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li, X. , Wang, L. , Zhen, Y. , Li, S. , & Xu, Y. (2015). Chicken egg yolk antibodies (IgY) as non‐antibiotic production enhancers for use in swine production: A review. Journal of Animal Science and Biotechnology, 6, 40 10.1186/s40104-015-0038-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Muller, S. , Schubert, A. , Zajac, J. , Dyck, T. , & Oelkrug, C. (2015). IgY antibodies in human nutrition for disease prevention. Nutrition Journal, 14, 109 10.1186/s12937-015-0067-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. National Research Council (2012). Nutrient requirements of swine (11th ed.). Washington, DC: National Academies Press. [Google Scholar]
  28. Pluske, J. R. , Hampson, D. J. , & Williams, I. H. (1997). Factors influencing the structure and function of the small intestine in the weaned pig: A review. Livestock Production Science, 51, 215–236. 10.1016/S0301-6226(97)00057-2 [DOI] [Google Scholar]
  29. Qi, H. W. , Xiang, Z. T. , Han, G. Q. , Yu, B. , Huang, Z. Q. , & Chen, D. W. (2011). Effects of different dietary protein sources on cecal microflora in rats. African Journal of Biotechnology, 10, 3704–3708. 10.5897/AJB10.2677 [DOI] [Google Scholar]
  30. Qiao, J. , Li, H. , Wang, Z. , & Wang, W. (2015). Effects of Lactobacillus acidophilus dietary supplementation on the performance, intestinal barrier function, rectal microflora and serum immune function in weaned piglets challenged with Escherichia coli lipopolysaccharide. Antonie Van Leeuwenhoek, 107, 883–891. 10.1007/s10482-015-0380-z [DOI] [PubMed] [Google Scholar]
  31. Sui, J. , Cao, L. , & Lin, H. (2011). Antibacterial activity of egg yolk antibody (Ig Y)against Listeria monocytogenes and preliminary evaluation of its potential for food preservation. Journal of the Science of Food and Agriculture, 91, 1946–1950. 10.1002/jsfa.4381 [DOI] [PubMed] [Google Scholar]
  32. Thu, H. M. , Myat, T. W. , Win, M. M. , Thant, K. Z. , Rahman, S. , Umeda, K. , … Choi, H. J. (2017). Chicken egg yolk antibodies (IgY) for prophylaxis and treatment of rotavirus diarrhea in human and animal neonates: A concise review. Korean Journal for Food Science of Animal Resources, 37, 1–9. 10.5851/kosfa.2017.37.1.1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Torche, A. M. , Le Dimna, M. , Le Corre, P. , Mesplede, A. , Le Gal, S. , Cariolet, R. , & Le Potier, M. F. (2006). Immune responses after local administration of IgY loaded‐PLGA microspheres in gut‐associated lymphoid tissue in pigs. Veterinary Immunology and Immunopathology, 109, 209–217. 10.1016/j.vetimm.2005.08.016 [DOI] [PubMed] [Google Scholar]
  34. Toth, P. P. , Barter, P. J. , Rosenson, R. S. , Boden, W. E. , Chapman, M. J. , Cuchel, M. , … Rader, D. J. (2013). High‐density lipoproteins: A consensus statement from the National Lipid Association. Journal of Clinical Lipidology, 7, 484–525. 10.1016/j.jacl.2013.08.001 [DOI] [PubMed] [Google Scholar]
  35. Tsukahara, T. , & Ushida, K. (2002). Succinate accumulation in pig large intestine during antibiotic‐associated diarrhea and the constitution of succinate‐producing flora. Journal of General and Applied Microbiology, 48, 143–154. 10.2323/jgam.48.143 [DOI] [PubMed] [Google Scholar]
  36. Wan, J. , Li, Y. , Chen, D. , Yu, B. , Chen, G. , Zheng, P. , … He, J. (2016). Recombinant plectasin elicits similar improvements in the performance and intestinal mucosa growth and activity in weaned pigs as an antibiotic. Animal Feed Science and Technology, 211, 216–226. 10.1016/j.anifeedsci.2015.12.003 [DOI] [Google Scholar]
  37. Wang, W. , Zijlstra, R. T. , & Ganzle, M. G. (2017). Identification and quantification of virulence factors of enterotoxigenic Escherichia coli by high‐resolution melting curve quantitative PCR. BMC Microbiology, 17, 114 10.1186/s12866-017-1023-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Wang, Y. , Kuang, Y. , Zhang, Y. , Song, Y. , Zhang, X. , Lin, Y. , … Fang, Z. (2016). Rearing conditions affected responses of weaned pigs to organic acids showing a positive effect on digestibility, microflora and immunity. Animal Science Journal, 87, 1267–1280. 10.1111/asj.12544 [DOI] [PubMed] [Google Scholar]
  39. Wu, S. , Zhang, F. , Huang, Z. , Liu, H. , Xie, C. , Zhang, J. , … Qiao, S. (2012). Effects of the antimicrobial peptide cecropin AD on performance and intestinal health in weaned piglets challenged with Escherichia coli . Peptides, 35, 225–230. 10.1016/j.peptides.2012.03.030 [DOI] [PubMed] [Google Scholar]
  40. Xiong, X. , Yang, H. , Li, B. , Liu, G. , Huang, R. , Li, F. , … Deng, D. (2015). Dietary supplementation with yeast product improves intestinal function, and serum and ileal amino acid contents in weaned piglets. Livestock Science, 171, 20–27. 10.1016/j.livsci.2014.10.012 [DOI] [Google Scholar]
  41. Xu, Y. , Li, X. , Jin, L. , Zhen, Y. , Lu, Y. , Li, S. , … Wang, L. (2011). Application of chicken egg yolk immunoglobulins in the control of terrestrial and aquatic animal diseases: A review. Biotechnology Advances, 29, 860–868. 10.1016/j.biotechadv.2011.07.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Yang, H. , Wang, X. , Xiong, X. , & Yin, Y. (2016). Energy metabolism in intestinal epithelial cells during maturation along the crypt‐villus axis. Scientific Reports, 6, 31917 10.1038/s41598-018-31068-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Yen, H. C. , Lai, W. K. , Lin, C. S. , & Chiang, S. H. (2015). Medium‐chain triglyceride as an alternative of in‐feedcolistin sulfate to improve growth performance and intestinal microbial environment in newly weaned pigs. Animal Science Journal, 86, 99–104. 10.1111/asj.12248 [DOI] [PubMed] [Google Scholar]
  44. Yin, F. G. , Liu, Y. L. , Yin, Y. L. , Kong, X. F. , Huang, R. L. , Li, T. J. , … Hou, Y. (2009). Dietary supplementation with Astragalus polysaccharide enhances ileal digestibilities and serum concentrations of amino acids in early weaned piglets. Amino Acids, 37, 263–270. 10.1007/s00726-008-0142-6 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Animal Physiology and Animal Nutrition are provided here courtesy of Wiley

RESOURCES