Abstract
Human rhinoviruses (RVs) belong to the genus Enterovirus of the family Picornaviridae, and are classified into RV‐A, ‐B, and ‐C species. Two assays were developed to detect RVs by a real‐time fluorescent reverse transcription loop‐mediated isothermal amplification method: one was designed based on the 5′‐untranslated regions (UTRs) of RV‐A and ‐B, and the other was designed based on the 5′‐UTR of RV‐C. The competence of both assays for the diagnosis of RV infection was tested using isolated viruses and compared with real‐time reverse transcription polymerase chain reaction assays on clinical specimens. Neither assay demonstrated cross‐reactivity with other tested enteroviruses, and they detected 19 out of 21 tested RV‐As and seven out of eight tested RV‐Cs. The specificity of the assays was 100% for the detection of RVs and their sensitivity for RV‐A and RV‐C was 86.3% and 77.3%, respectively, on clinical specimens by the combined use of both assays. Considering that both developed assays were highly specific and detected the majority of recently circulating RVs, they are helpful for the diagnosis of RV infection. Consequently, the results generated by these assays will enhance the surveillance of respiratory illness and the study of the roles of RVs associated with clinical features and disease severity.
Keywords: fluorescence, quenching primer, reverse transcription loop‐mediated isothermal amplification, rhinovirus
1. INTRODUCTION
Human rhinoviruses (RVs) are single‐stranded, positive‐RNA viruses belonging to the genus Enterovirus of the family Picornaviridae. The first RV was discovered in the 1950s, and approximately 100 RV serotypes were classified as RV‐A or ‐B species by the early 1990s.1, 2, 3, 4 With the development of molecular diagnostic techniques, the RV‐C group was identified in 2006.5, 6 The RV genome consists of structural (VP4, VP2, VP3, and VP1) and nonstructural (2A, 2B, 2C, 3A, 3B, 3C, and 3D) regions flanked by 5′‐ and 3′‐untranslated regions (UTRs). Recently, a genotypic classification of RVs was proposed according to the sequence of VP1 or VP4/VP2, and more than 160 RVs have now been classified as RV‐A, ‐B, or ‐C species (http://www.picornaviridae.com/).7
RVs cause respiratory illness throughout the world and throughout the year.8 The studies using molecular methods and viral culture demonstrated that RVs are the most common cause of upper respiratory tract infections.9 While they were once thought to cause relatively mild upper respiratory tract illness, RVs are suggested to be linked to exacerbations of the chronic pulmonary disease, including asthma,10 and chronic obstructive pulmonary disease.11 RVs are reportedly detected in infants and children with severe bronchiolitis12 as well as elderly patients with fatal pneumonia.13
Recently, nucleic acid amplification techniques have become major tools for the diagnosis of viral infections. Many real‐time reverse transcription polymerase chain reaction (RT‐PCR) assays for detecting RVs have been described to generate sensitive and quantitative results as laboratory diagnostic methods14, 15; however, real‐time RT‐PCR methods require multiple steps, highly specialized technical skills, and take time to generate results (>1 hour). Loop‐mediated isothermal amplification (LAMP), first reported in the early 2000s, is an isothermal nucleic acid amplification method, and a real‐time LAMP (RT‐LAMP) assay can be performed simply without the need for high‐precision instruments and can detect viral genomes within 30 minutes.16, 17, 18 A LAMP assay can be performed using fluorescent dyes for real‐time monitoring or for judgment by the naked eye,19, 20 while fluorescent dyes have a major limitation in that they can bind nonspecifically to double‐stranded DNA, such as primer‐dimers, leading to erroneous results.21 Previously, real‐time fluorescent RT‐LAMP was established to detect viral RNA using a quenching primer (QPrimer) or a quenching probe (QProbe). By using a QPrimer or QProbe, nonspecific reactions can be decreased and the target can be detected in a real‐time manner.22, 23 In this study, two assays were developed to detect RVs by a real‐time fluorescent RT‐LAMP method, and the competence of both assays was compared with real‐time RT‐PCR assays for the detection of RV infection using clinical specimens.
2. MATERIALS AND METHODS
2.1. Clinical specimens and virus isolates
The viruses shown in Tables 2 and 3 were isolated from clinical specimens. RV‐B14 (VR‐284), human coxsackievirus B4 (VR‐184) and B5 (VR‐185), human enterovirus A71 (VR‐1432), and enterovirus D68 (VR‐1826) were obtained from the American Type Culture Collection (Manassas, VA). Nasopharyngeal swabs and nasal aspirates of patients enrolled in clinical studies approved by the ethics committees of the National Institute of Infectious Diseases, Showa General Hospital, Ishimemorial Aizen‐en, and Nakano Children's Hospital and screened positive for RV and/or other respiratory viruses by real‐time RT‐PCR24, 25, 26 used for this study. This study was performed in compliance with the Declaration of Helsinki. Informed consent was obtained from all patients. A total of 132 nasopharyngeal swabs and nasal aspirates, consisting of 102, 2, 2, 2, 2, 2, 2, 1, 1, and 1 samples positive for RV, influenza A subtype H1pdm09 virus, influenza A subtype H3 virus, influenza B virus, respiratory syncytial virus A, respiratory syncytial virus B, human metapneumovirus, human parainfluenza virus type 3, human parainfluenza virus type 4, and human coronavirus OC43, respectively, and 15 samples negative for any virus tested were used.
Table 2.
The sensitivity of the RT‐LAMP assays was tested using serial dilutions of viral RNA from several RV‐A species.
| Types | Virus isolate names | Numbers of positive replicates/number of tests for each assay, viral RNA concentration (copies/reactions)a | ||||||
|---|---|---|---|---|---|---|---|---|
| Set 1 | Set 2 | |||||||
| 104 | 103 | 102 | 101 | 104 | 103 | 102 | ||
| A10 | 0441‐OsakaC‐JPN‐2015 | NT | 3/3 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 |
| A12 | 25‐SGH‐JPN‐2016 | 0/3 | 0/3 | 0/3 | 0/3 | 3/3 | 1/3 | 0/3 |
| A16 | 0035‐OsakaC‐JPN‐2015 | NT | 3/3 | 3/3 | 0/3 | 3/3 | 0/3 | 0/3 |
| A18 | 4‐SGH‐JPN‐2016 | NT | 3/3 | 2/3 | 0/3 | 0/3 | 0/3 | 0/3 |
| A19 | 54‐SGH‐JPN‐2015 | 3/3 | 1/3 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 |
| A21 | 0063‐OsakaC‐JPN‐2016 | NT | 3/3 | 2/3 | 0/3 | 0/3 | 0/3 | 0/3 |
| A24 | 09‐SGH‐JPN‐2015 | NT | 3/3 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 |
| A28 | 0088‐OsakaC‐JPN‐2016 | NT | 3/3 | 3/3 | 1/3 | 0/3 | 0/3 | 0/3 |
| A34 | 0049‐OsakaC‐JPN‐2015 | NT | 3/3 | 3/3 | 0/3 | 0/3 | 0/3 | 0/3 |
| A40 | 0071‐OsakaC‐JPN‐2016 | NT | 3/3 | 3/3 | 0/3 | 2/3 | 0/3 | 0/3 |
| A45 | 0157‐OsakaC‐JPN‐2016 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 |
| A46 | 29‐SGH‐JPN‐2015 | NT | 3/3 | 1/3 | 1/3 | 0/3 | 0/3 | 0/3 |
| A49 | 0044‐OsakaC‐JPN‐2015 | NT | NT | 3/3 | 0/3 | NT | 0/3 | 0/3 |
| A54 | 0058‐OsakaC‐JPN‐2015 | NT | 0/3 | 0/3 | 0/3 | 3/3 | 0/3 | 0/3 |
| A58 | 0008‐OsakaC‐JPN‐2015 | NT | 3/3 | 1/3 | 0/3 | 3/3 | 0/3 | 0/3 |
| A59 | 0087‐OsakaC‐JPN‐2016 | NT | 3/3 | 3/3 | 3/3 | 0/3 | 0/3 | 0/3 |
| A75 | 0123‐OsakaC‐JPN‐2016 | NT | 3/3 | 3/3 | 1/3 | 3/3 | 0/3 | 0/3 |
| A81 | 0073‐OsakaC‐JPN‐2016 | NT | 3/3 | 3/3 | 1/3 | 0/3 | 0/3 | 0/3 |
| A82 | 54‐SGH‐JPN‐2014 | NT | 3/3 | 1/3 | 0/3 | 0/3 | 0/3 | 0/3 |
| A88 | 12‐SGH‐JPN‐2015 | NT | 3/3 | 1/3 | 0/3 | NT | 0/3 | 0/3 |
| A101 | 41‐SGH‐JPN‐2015 | 0/3 | 0/3 | 0/3 | 0/3 | 1/3 | 0/3 | 0/3 |
| B14 | ATCC VR‐284 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 |
Abbreviations: NT, not tested; RT‐LAMP, reverse transcription loop‐mediated isothermal amplification; RV, rhinovirus.
Viral RNA copy number was calculated based on the 5′‐untranslated regions of each viral gene as described in the text.
This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.
Table 3.
The sensitivity of the RT‐LAMP assays was tested using serial dilutions of viral RNA from several RV‐C species
| Types | Virus isolate names | Number of positive replicates/number of tests for each assayviral RNA concentration (copies/reactions)a | ||||||
|---|---|---|---|---|---|---|---|---|
| Set 1 | Set 2 | |||||||
| 105 | 104 | 103 | 105 | 104 | 103 | 102 | ||
| C02 | 0095‐OsakaC‐JPN‐2016 | 1/3 | 0/3 | 0/3 | NT | 3/3 | 0/3 | 0/3 |
| C06 | 0060‐OsakaC‐JPN‐2016 | 0/3 | 0/3 | 0/3 | NT | 3/3 | 3/3 | 0/3 |
| C09 | 47‐SGH‐JPN‐2015 | 0/3 | 0/3 | 0/3 | NT | 3/3 | 3/3 | 1/3 |
| C12 | 0153‐OsakaC‐JPN‐2016 | 1/3 | 0/3 | 0/3 | NT | 3/3 | 3/3 | 0/3 |
| C18 | 57‐SGH‐JPN‐2014 | 0/3 | 0/3 | 0/3 | NT | 3/3 | 1/3 | 0/3 |
| C23 | 0105‐OsakaC‐JPN‐2016 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 | NT | NT |
| C40 | 63‐SGH‐JPN‐2016 | NT | 0/3 | 0/3 | 3/3 | 1/3 | 0/3 | NT |
| C53 | 04‐SGH‐JPN‐2015 | 0/3 | 0/3 | 0/3 | NT | 3/3 | 3/3 | 2/3 |
Abbreviations: NT, not tested; RT‐LAMP, reverse transcription loop‐mediated isothermal amplification; RV, rhinovirus.
Viral RNA copy number was calculated based on the 5′‐untranslated regions of each viral gene as described in the text.
This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.
2.2. RNA preparation
Total RNA was prepared from the clinical specimens and isolated viruses using a MagMAX 96 Viral Isolation Kit (Thermo Fisher Scientific, Waltham, MA) (using 50 μL of the clinical specimens and isolated viruses and eluted in 50 μL) with KingFisher Flex (Thermo Fisher Scientific) according to the manufacturer's instructions.
2.3. Sequencing of 5′‐UTR region
Purified viral RNA from clinical specimens was reverse‐transcribed using random hexamer primers (Promega, Madison, WI) and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) according to the manufacturer's instructions. The complementary DNA (3 µL) was amplified in three separate PCRs using RV species A‐, B‐, and C‐specific primer sets (0.5 μM of each, Table 1) with Phusion High‐Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA). The following PCR cycling conditions were used: 98°C for 30 seconds, followed by 40 cycles of 98°C for 10 seconds, 65°C for 30 seconds, and 72°C for 1 minute, with a final extension of 72°C for 10 minutes. Approximately 600 bp amplified products were gel purified with a MinElute Gel Extraction Kit (Qiagen, Hilden, Germany), and sequencing was performed in both directions using the amplification primers and an ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit, version 3.1 (Thermo Fisher Scientific).
Table 1.
Primer set
| Names | Sequences (5′‐3′) | Concentrations in RT‐LAMP reactions, µM |
|---|---|---|
| Primers for RT‐LAMP Set 1 | ||
| HRVA F3v1 | CYAGCCTGCGTGGCTGCC | 0.2 |
| RhinoB3 1_1 | GAAACACGGACACCCAAA | 0.2 |
| HRVA FIPv3 | CATTCAGGGGCCGGAGGA‐GACAAGGTGTGAAGAGYC | 1.6 |
| HRVA BIPv3 | GGCTAACCTTAAMCCYGCAGC‐GTAGTYGGTCCCATCCC | 1.6 |
| HRVA LFv1‐1 | CAAAACAAGCACACGG | 0.38 + 0.02 a |
| HRVA LFv2 | CAAGATGAGCACACGC | 0.38 + 0.02 a |
| HRVA LBv4 | ACAATCCAGTGTGTAGCTGGTCGTAA | 0.8 |
| Primers for RT‐LAMP Set 2 | ||
| HRVC F3_1 | AGCCTGCGTGGCTGCC | 0.07 |
| HRVC F3_2 | TGCCTGCGTGGCTGCC | 0.07 |
| HRVC F3_3 | AGCCCGCGTGGTGCCC | 0.07 |
| HRVC B3_2 | GAAACACGGACACCCAAA | 0.2 |
| HRVC FIPv1_2 | CATTCAGGGGCCGGAGGA‐GACAGGGTGTGAAGGTTC | 0.53 |
| HRVC FIPv1_4 | CATTCAGGGGCCGGAGGA‐GACAGGGTGTGAAGATTC | 0.53 |
| HRVC FIPv1_7 | CATTCAGGGGCCGGAGGA‐GACAAGGTGTGAAGAGCC | 0.53 |
| HRVC BIPv1_5 | GGCTAACCTTAACCCCGTAGC‐GTAGTCGGTCCCATCCC | 0.53 |
| HRVC BIPv1_6 | GGCTAATCCTAACCCCGTAGC‐GTAGTTGGTTCCATCCC | 0.53 |
| HRVC BIPv1_7 | GGCTAATCCAACCCYRCAGC‐GTAGTCGGTTCCGTCCC | 0.53 |
| HRVC LFv3_1 | CTCACWHGTAGCACAC | 0.4 |
| HRVC LFv3_2 | CTCATADBDAGCACAC | 0.4 |
| HRVC LBv4_1 | CCACCATGTAGGTAGTCGTAATGGGCAA | 0.152 + 0.008 b |
| HRVC LBv4_2 | CCAGTGTGTATATAGTCGTAATGAGCAA | 0.152 + 0.008 b |
| HRVC LBv4_3 | CCAGCATAAACACAGTCGTAATGGGCAA | 0.152 + 0.008 b |
| HRVC LBv4_4 | CCAGTACAAACATGGTCGTAATGGGCAA | 0.152 + 0.008 b |
| HRVC LBv4_5 | CCACCATGTAGATGGTCGTAATGAGCAA | 0.152 + 0.008 b |
| Primers for sequencing 5′‐UTR | ||
| HRVA seqF | GTATWCTRTTATTMCGGTAAAYTTGTACGCCA | |
| HRVA seqR | ACATTYTGTCTRGATACYTGWGCGCCCATG | |
| HRVB seqF | GTACACTGGTAYTWTGTACCTTTGTACGCCT | |
| HRVB seqR | GTGTWGAMACYTGWGCRCCCATGATYACA | |
| HRVC seqF | GTGCTCTTGTATYHCGGTACAYTTSCAYRCCA | |
| HRVC seqR | GYYTRSTWNACYTGDGCGCCCATGGTRACAA | |
Abbreviations: RT‐LAMP, reverse transcription loop‐mediated isothermal amplification; UTR, untranslated region.
Five percent of the LF primers were substituted for LF and LB. with QPrimer‐5G for RT‐LAMP Set 1 as described in Section 2.6.
Five percent of the LB primers were substituted with QPrimer‐5G for RT‐LAMP Set 2 as described in Section 2.6.
This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.
2.4. Preparation of RNA transcript control
To construct an RNA control to quantify RNA copy number by real‐time RT‐PCR, the 5′‐UTR region of RV‐A16 was amplified by RT‐PCR, and the resulting PCR product containing the T7 promoter was transcribed in vitro. The detailed procedure is described below. The 5′‐UTR region was amplified by PCR using Phusion High‐Fidelity DNA Polymerase (New England Biolabs) with paired primers (TAATACGACTCACTATAGGGGTACWCTRKTAYTMYGGTAMYYTTGTACGCC and AGWGCATCKGGYAAYTTCCA; underlined sequence is T7 promoter region). RNA was transcribed using the T7 RiboMAX Express Large Scale RNA Production System (Promega) and treated with TURBO DNase (Thermo Fisher Scientific) to degrade template DNA. The dNTPs and NTPs were removed using MicroSpin G‐25 Columns (GE Healthcare, Piscataway, NJ) by following the manufacturer's instructions. The transcribed RNAs were quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific), and RNA concentration was used to calculate the copy number of the transcribed RNA based on molecular weight and Avogadro's constant. The integrity of the transcribed RNAs was assessed with a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA).
2.5. Real‐time RT‐PCR assay
Real‐time RT‐PCR for quantifying virus genomes was carried out with a LightCycler 480 (Roche, Basel, Switzerland) as described previously for RVs24 and other enteroviruses14 with a slight modification using RNA transcript controls. Briefly, the 25‐μL assay contained 12.5 μL of 2× RT‐PCR buffer, 1 μL of 25× RT‐PCR Enzyme Mix, 3.5 μL Primers/Probe Mix, 3 μL water, and 5 μL template RNA using AgPath‐ID One‐Step RT‐PCR Reagents (Thermo Fisher Scientific). The primers/probe mix was prepared to contain 0.6 µM of each primer and 0.1 µM probe.
2.6. Real‐time fluorescent RT‐LAMP assay
RT‐LAMP was carried out as described previously with a slight modification,22 as the 25‐μL assay contained enzyme, buffer, primers, and template RNA. The primers were prepared to contain 0.2 µM each of the F3 and B3 primers, 1.6 µM each of the FIP and BIP primers, and 0.8 µM each of the LF and LB primers, as the final concentration in each reaction. Five percent of one of the LB or LF primers of each assay was substituted with QPrimer‐5G (Nippon Steel and Sumikin Eco‐Tech, Tokyo, Japan). The real‐time RT‐LAMP reaction was performed at 63°C for 30 minutes using a LightCycler 480 (Roche).
3. RESULTS
3.1. Development of the RT‐LAMP assays
To design primer sets for RT‐LAMP, the 5′‐UTR regions of RVs were sequenced using 102 clinical specimens that were positive for RV by real‐time RT‐PCR. The 5′‐UTR sequences of 76 RV‐A, 4 RV‐B, and 26 RV‐C specimens were obtained and deposited at the National Center for Biotechnology Information (accession numbers, LC420517‐LC420622). Two 5′‐UTR sequences in the same specimen were obtained from four samples; the one for RV‐A and the other for RV‐C were obtained from three samples, while the one for RV‐B and the other for RV‐C were obtained from one specimen. Primers for the RT‐LAMP Set 1 assay were designed based on 76 RV‐A and four RV‐B sequences, while those for the RT‐LAMP Set 2 assay were designed according to 26 RV‐C sequences (Table 1). The specificity of each RT‐LAMP assay was evaluated using other enteroviruses (human coxsackievirus B4 and B5, human enterovirus A71, and enterovirus D68), and no cross‐reactivity was detected (data not shown).
The sensitivity of each RT‐LAMP assay was evaluated using serially diluted RNAs that were purified from several clinical isolates of RV‐A, ‐B, and ‐C (Tables 2 and 3). The assays were carried out independently three times. The majority of tested RVs were detected by either or both of the RT‐LAMP assays, but their respective sensitivity for each RV was different (Tables 2 and 3). Both RT‐LAMP assays barely reacted with RV‐A45, A101, B14, and C23 (Tables 2 and 3). The RT‐LAMP Set 1 assay detected at least 1.0 × 102, 103, and 104 copies/reaction of RV‐A16, A28, A34, A40, A49, A59, A75, and A81, RV‐A10, A18, A21, A24, A46, A58, A82, and A88, and RV‐A19 in all three tests, respectively (Tables 2 and 3). The RT‐LAMP Set 2 assay detected at least 1.0 × 103, 104, and 105 copies of RV‐C06, C09, C12, and C53, RV‐A12, A16, A54, A58, A75, C02, and C18, and RV‐C40 in all three tests, respectively (Tables 2 and 3). Representative examples of the quenching signals of RT‐LAMP Set 1 on RV‐As and those of RT‐LAMP Set 2 on RV‐Cs were shown in Figure S1. The RT‐LAMP Set 1 assay reacted with some RV‐Cs and with the majority of RV‐As, while the RT‐LAMP Set 2 assay reacted with some RV‐As and with the majority of RV‐Cs.
3.2. Evaluation of the RT‐LAMP assays using clinical specimens
The RT‐LAMP assays were evaluated using RNA purified from 128 clinical specimens. Of them, 98 clinical specimens were positive for RV by real‐time PCR and considered to be a single infection case with either RV‐A, ‐B, or ‐C depending on the sequence of the 5′‐UTR region, as described in Section 3.1. When either or both RT‐LAMP assays detected the target, the results were taken as “positive.” Neither RT‐LAMP assay cross‐reacted with 15 clinical specimens that were positive for influenza A subtype H1pdm09 virus, influenza A subtype H3 virus, influenza B virus, respiratory syncytial virus A or B, human metapneumovirus, human parainfluenza virus type 3 or 4, or human coronavirus OC43 or with 15 clinical specimens that were negative for all tested viruses. Consequently, it was shown that the specificity of the assays was 100% for detecting RVs (Tables 4 and 5). The assay results for 73 clinical specimens that were positive for RV‐A by real‐time RT‐PCR and sequencing showed that the sensitivity of the RT‐LAMP assays for RV‐A was 86.3% (Table 4). Similarly, the results for 22 clinical specimens that were positive for RV‐C by real‐time RT‐PCR and sequencing showed that the sensitivity of the RT‐LAMP assays for RV‐C was 77.3% (Table 5). Neither assay reacted with three clinical specimens that were positive for RV‐B by real‐time RT‐PCR and sequencing (data not shown).
Table 4.
The performance of the RT‐LAMP assays compared with a real‐time RT‐PCR assay on RV‐A‐positive specimens
| Real‐time | RT‐LAMP | Specificity; | Sensitivity; | |
|---|---|---|---|---|
| RT‐PCR | Positive | Negative | 95% CI | 95% CI |
| Positive | 63 | 10 | 100.0%;88.4%‐100.0% | 86.3%;76.3%‐93.2% |
| Negative | 0 | 30 | ||
Abbreviations: CI, confidence interval; RT‐LAMP, reverse transcription loop‐mediated isothermal amplification; RT‐PCR, reverse transcription polymerase chain reaction; RV, rhinovirus.
This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.
Table 5.
The performance of the RT‐LAMP assays compared with real‐time RT‐PCR assay on RV‐C‐positive specimens
| Real‐time | RT‐LAMP | Specificity; | Sensitivity; | |
|---|---|---|---|---|
| RT‐PCR | Positive | Negative | 95% CI | 95% CI |
| Positive | 17 | 5 | 100.0%;88.4%‐100.0% | 77.3%;55.6%‐92.2% |
| Negative | 0 | 30 | ||
Abbreviations: CI, confidence interval; RT‐LAMP, reverse transcription loop‐mediated isothermal amplification; RT‐PCR, reverse transcription polymerase chain reaction; RV, rhinovirus.
This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.
4. DISCUSSION
In this study, two assays were developed to detect RVs using an RT‐LAMP method with primers that were designed based on recently circulating RVs in Japan. Among nucleic acid amplification techniques, real‐time fluorescent RT‐LAMP can be performed simply by incubating the reaction tube at 63°C and completed within 30 minutes.22 Other than real‐time RT‐PCR and RT‐LAMP methods, nucleic acid sequence‐based amplification (NASBA) to detect RVs, has been reported.27, 28, 29, 30 Similar to RT‐LAMP, NASBA is an isothermal nucleic acid amplification method that can be performed without the need for expensive equipment. However, NASBA takes 2 hours to generate a result, and requires an annealing step at 65°C before an isothermal amplification step at a lower temperature.31 It has been more than a decade since NASBA assays for RV detection were reported, and it is still not certain whether these assays can detect recently circulating RVs, especially the recently identified RV‐Cs. More recently, reverse transcription strand invasion‐based amplification (RT‐SIBA), which can be performed isothermally to detect RVs, has been reported32; however, this assay takes more than 1 hour to generate results and has only been evaluated with RV‐A and ‐B, but not with RV‐C. Similar to NASBA assays, it is uncertain whether RT‐SIBA can detect RV‐Cs.
RV genomes are highly diverse between different species, as well as within the same species; therefore, molecular assays typically target the 5′‐UTR of the viral genome, which contains relatively conserved sequences.7, 33 Our developed RT‐LAMP assays also target the 5′‐UTR and had no cross‐reactivity with other tested enteroviruses and detected 19 out of 21 tested RV‐A species and seven out of eight tested RV‐C species (Table 2and 3). In contrast, the assays failed to detect two RV‐A, 1 RV‐B, and 1 RV‐C species (Tables 2 and 3), which may have been caused by the presence of mismatches between the target RNA and the primers. Focusing on the QPrimer region, the four undetectable viruses have three nucleotide mismatches at the 3′‐end of the Set 1 QPrimer and one nucleotide mismatch at the 3′‐region of the Set 2 QPrimer. Meanwhile, from the assay results showing a detection rate of 90% for the tested RVs with high sensitivity and specificity (Tables 2 and 3), the assays were considered to be useful as molecular detection tools for RV infections.
Our developed RT‐LAMP assays have a sensitivity of 86.3% and 77.3% for detecting RV‐A and ‐C, respectively, in clinical specimens when compared with real‐time RT‐PCR (Tables 4 and 5). Unfortunately, only three RV‐B‐positive clinical specimens were available and the assays failed to detect all of them. The Cp values of the real‐time PCR assays for these three clinical specimens were greater than 30 (data not shown), so it was speculated that the low concentrations of the viral genomes resulted in their nondetection. Considering that the inability of the assays to detect RV‐Bs is a limitation of this approach, further evaluation using additional RV‐B‐positive clinical specimens and improvement of the assays are required. Recently, several molecular epidemiological studies have been conducted to type RVs, and it was shown that the majority of circulating RV species were RV‐A and ‐C, and even the prevalence of each RV species differed in each report.34, 35, 36 Considering these epidemiological studies and the sensitivity of the developed assays in the present study, it is suggested that the assays can detect 70% to 80% of recently circulating RVs.
In conclusion, both of the developed RT‐LAMP assays can be performed easily and quickly, are highly specific, and can detect the majority of recently circulating RVs. The assays are considered helpful for the diagnosis of RV infections; consequently, the results will help to enhance the surveillance of respiratory illness and to study the roles of RVs associated with clinical features and disease severity.
CONFLICT OF INTERESTS
The authors declared that there is no conflict of interests.
Supporting information
Supporting information
Supporting information
ACKNOWLEDGMENTS
We thank Drs Eri Nobusawa, Kazuya Nakamura, and Itsuki Hamamoto, Influenza Virus Research Center, National Institute of Infectious Diseases, for kindly providing RV‐B14, human coxsackievirus B4 and B5, human enterovirus A71, and enterovirus D68. This study was supported by AMED (grant number JP18fk0108030).
Nakauchi M, Takayama I, Takahashi H, et al. Development of real‐time fluorescent reverse transcription loop‐mediated isothermal amplification assays for rhinovirus detection. J Med Virol. 2019;91:1232‐1238. 10.1002/jmv.25427
References
REFERENCES
- 1. Hamparian VV, Colonno RJ, Cooney MK, et al. A collaborative report: rhinoviruses—extension of the numbering system from 89 to 100. Virology. 1987;159(1):191‐192. [DOI] [PubMed] [Google Scholar]
- 2. Andries K, Dewindt B, Snoeks J, et al. Two groups of rhinoviruses revealed by a panel of antiviral compounds present sequence divergence and differential pathogenicity. J Virol. 1990;64(3):1117‐1123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Uncapher CR, DeWitt CM, Colonno RJ. The major and minor group receptor families contain all but one human rhinovirus serotype. Virology. 1991;180(2):814‐817. [DOI] [PubMed] [Google Scholar]
- 4. Kennedy JL, Turner RB, Braciale T, Heymann PW, Borish L. Pathogenesis of rhinovirus infection. Curr Opin Virol. 2012;2(3):287‐293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Arden KE, McErlean P, Nissen MD, Sloots TP, Mackay IM. Frequent detection of human rhinoviruses, paramyxoviruses, coronaviruses, and bocavirus during acute respiratory tract infections. J Med Virol. 2006;78(9):1232‐1240. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Lamson D, Renwick N, Kapoor V, et al. MassTag polymerase‐chain‐reaction detection of respiratory pathogens, including a new rhinovirus genotype, that caused influenza‐like illness in New York state during 2004‐2005. J Infect Dis. 2006;194(10):1398‐1402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. McIntyre CL, Knowles NJ, Simmonds P. Proposals for the classification of human rhinovirus species A, B, and C into genotypically assigned types. J Gen Virol. 2013;94(Pt 8):1791‐1806. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Jacobs SE, Lamson DM, St. george K, Walsh TJ. Human rhinoviruses. Clin Microbiol Rev. 2013;26(1):135‐162. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Mäkelä MJ, Puhakka T, Ruuskanen O, et al. Viruses and bacteria in the etiology of the common cold. J Clin Microbiol. 1998;36(2):539‐542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Jartti T, Gern JE. Role of viral infections in the development and exacerbation of asthma in children. J Allergy Clin Immunol. 2017;140(4):895‐906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Mallia P, Message SD, Gielen V, et al. Experimental rhinovirus infection as a human model of chronic obstructive pulmonary disease exacerbation. Am J Respir Crit Care Med. 2011;183(6):734‐742. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Louie JK, Roy‐Burman A, Guardia‐Labar L, et al. Rhinovirus associated with severe lower respiratory tract infections in children. Pediatr Infect Dis J. 2009;28(4):337‐339. [DOI] [PubMed] [Google Scholar]
- 13. Louie JK, Yagi S, Nelson FA, et al. Rhinovirus outbreak in a long term care facility for elderly persons associated with unusually high mortality. Clin Infect Dis. 2005;41(2):262‐265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Tapparel C, Cordey S, Van Belle Belle S, et al. New molecular detection tools adapted to emerging rhinoviruses and enteroviruses. J Clin Microbiol. 2009;47(6):1742‐1749. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Faux CE, Arden KE, Lambert SB, et al. Usefulness of published PCR primers in detecting human rhinovirus infection. Emerg Infect Dis. 2011;17(2):296‐298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Notomi T, Okayama H, Masubuchi H, et al. Loop‐mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28(12):E63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Nagamine K, Hase T, Notomi T. Accelerated reaction by loop‐mediated isothermal amplification using loop primers. Mol Cell Probes. 2002;16(3):223‐229. [DOI] [PubMed] [Google Scholar]
- 18. Nakauchi M, Yoshikawa T, Nakai H, et al. Evaluation of reverse transcription loop‐mediated isothermal amplification assays for rapid diagnosis of pandemic influenza A/H1N1 2009 virus. J Med Virol. 2011;83(1):10‐15. [DOI] [PubMed] [Google Scholar]
- 19. Tomita N, Mori Y, Kanda H, Notomi T. Loop‐mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat Protoc. 2008;3(5):877‐882. [DOI] [PubMed] [Google Scholar]
- 20. Notomi T, Mori Y, Tomita N, Kanda H. Loop‐mediated isothermal amplification (LAMP): principle, features, and future prospects. J Microbiol. 2015;53(1):1‐5. [DOI] [PubMed] [Google Scholar]
- 21. Njiru ZK. Loop‐mediated isothermal amplification technology: towards point of care diagnostics. PLOS Negl Trop Dis. 2012;6(6):e1572. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Takayama I, Nakauchi M, Takahashi H, et al. Development of Real‐time Fluorescent Reverse Transcription Loop‐Mediated Isothermal Amplification Assay with Quenching Primer for Influenza Virus and Respiratory Syncytial Virus In:undersubmitting. [DOI] [PMC free article] [PubMed]
- 23. Shirato K, Semba S, El‐Kafrawy SA, et al. Development of fluorescent reverse transcription loop‐mediated isothermal amplification (RT‐LAMP) using quenching probes for the detection of the Middle East respiratory syndrome coronavirus. J Virol Methods. 2018;258:41‐48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Do DH, Laus S, Leber A, et al. A one‐step, real‐time PCR assay for rapid detection of rhinovirus. J Mol Diagn. 2010;12(1):102‐108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Nakauchi M, Yasui Y, Miyoshi T, et al. One‐step real‐time reverse transcription‐PCR assays for detecting and subtyping pandemic influenza A/H1N1 2009, seasonal influenza A/H1N1, and seasonal influenza A/H3N2 viruses. J Virol Methods. 2011;171(1):156‐162. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Kaida A, Kubo H, Takakura K, et al. Associations between codetected respiratory viruses in children with acute respiratory infections. Jpn J Infect Dis. 2014;67(6):469‐475. [DOI] [PubMed] [Google Scholar]
- 27. Sidoti F, Bergallo M, Terlizzi ME, et al. Development of a quantitative real‐time nucleic acid sequence‐based amplification assay with an internal control using molecular beacon probes for selective and sensitive detection of human rhinovirus serotypes. Mol Biotechnol. 2012;50(3):221‐228. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Samuelson A, Westmoreland D, Eccles R, Fox JD. Development and application of a new method for amplification and detection of human rhinovirus RNA. J Virol Methods. 1998;71(2):197‐209. [DOI] [PubMed] [Google Scholar]
- 29. Loens K, Ieven M, Ursi D, et al. Improved detection of rhinoviruses by nucleic acid sequence‐based amplification after nucleotide sequence determination of the 5′ noncoding regions of additional rhinovirus strains. J Clin Microbiol. 2003;41(5):1971‐1976. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Loens K, Goossens H, De Laat Laat C, et al. Detection of rhinoviruses by tissue culture and two independent amplification techniques, nucleic acid sequence‐based amplification and reverse transcription‐PCR, in children with acute respiratory infections during a winter season. J Clin Microbiol. 2006;44(1):166‐171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Compton J. Nucleic acid sequence‐based amplification. Nature. 1991;350(6313):91‐92. [DOI] [PubMed] [Google Scholar]
- 32. Kainulainen V, Elf S, Susi P, et al. Detection of human rhinoviruses by reverse transcription strand invasion based amplification method (RT‐SIBA). J Virol Methods. 2019;263:75‐80. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Palmenberg AC, Spiro D, Kuzmickas R, et al. Sequencing and analyses of all known human rhinovirus genomes reveal structure and evolution. Science. 2009;324(5923):55‐59. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Martin ET, Kuypers J, Chu HY, et al. Heterotypic infection and spread of Rhinovirus A, B, and C among child care attendees. J Infect Dis. 2018;218(6):848‐855. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Howard LM, Johnson M, Gil AI, et al. Molecular epidemiology of rhinovirus detections in young children. Open Forum Infect Dis. 2016;3(1):ofw001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Chen WJ, Arnold JC, Fairchok MP, et al. Epidemiologic, clinical, and virologic characteristics of human rhinovirus infection among otherwise healthy children and adults: rhinovirus among adults and children. J Clin Virol. 2015;64:74‐82. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supporting information
Supporting information