Skip to main content
NCBI home page
Wiley - PMC COVID-19 Collection logoLink to Wiley - PMC COVID-19 Collection
. 2018 Sep 8;65(6):1421–1428. doi: 10.1111/tbed.13005

Biological and phylogenetic characterization of a novel hemagglutination‐negative avian avulavirus 6 isolated from wild waterfowl in China

Yanyu Chen 1,†, Zhuang Ding 1, Xinxin Liu 2,†, Jianjun Chen 3,†, Junjiao Li 1, Yidong Fei 1, Zhe Liu 1, Tobias Stoeger 4, Yuhai Bi 5, Renfu Yin 1,✉
PMCID: PMC7169737  PMID: 30146734

Abstract

Up to now only nine whole genome sequences of avian avulavirus 6 (AAvV‐6) had been documented in the world since the first discovery of AAvV‐6 (AAvV‐6/duck/HongKong/18/199/77) at a domestic duck in 1977 from Hong Kong of China. Very limited information is known about the regularities of transmission, genetic and biological characteristics of AAvV‐6 because of the lower isolation rate and mild losses for poultry industry. To better further explore the relationships among above factors, an AAvV‐6 epidemiological surveillance of domestic poultry and wild birds in six provinces of China suspected of sites of inter‐species transmission and being intercontinental flyways during the year 2013–2017 was conducted. Therefore, 9,872 faecal samples from wild birds and 1,642 cloacal and tracheal swab samples from clinically healthy poultry of live bird market (LBM) were collected respectively. However, only one novel hemagglutination‐negative AAvV‐6 isolate (AAvV‐6/mallard/Hubei/2015) was isolated from a fresh faecal sample obtained from mallard at a wetland of Hubei province. Sequencing and phylogenetic analyses of this AAvV‐6 isolate (AAvV‐6/mallard/Hubei/2015) indicated that this isolate grouping to genotype I were epidemiological intercontinentally linked with viruses from the wild birds in Europe and America. Meanwhile, at least two genotypes (I and II) are existed within serotype AAvV‐6. In additional, this novel hemagglutination‐negative AAvV‐6 isolate in chicken embryos restored its hemagglutination when pre‐treated with trypsin. These findings, together with data from other AAvV‐6, suggest potential epidemiological intercontinental spreads among AAvV‐6 transmission by wild migratory birds, and reveal potential threats to wild birds and domestic poultry worldwide.

Keywords: AAvV‐6, domestic poultry, genotype, intercontinental transmission, wild bird

1. INTRODUCTION

Over the last 40 years, many viruses from the Paramyxoviridae family isolated from not only human or animal but also in birds have been newly identified (Kolakofsky & Roux, 1987; Samal, 2011). Paramyxoviruses are enveloped, non‐segmented, pleomorphic RNA viruses containing a single stranded, negative‐sense genome. Avian paramyxoviruses that have been isolated from birds; however, due to changes in taxonomy is now referred to as avian avulavirus (AAvV) (Amarasinghe et al., 2017). There are 13 described AAvV serotypes (AAvV‐1 to ‐13) based on neuraminidase inhibition tests and hemagglutination inhibition (HI), and eight another putative serotypes have been recently isolated (AAvV‐14 to ‐21) (Jeong et al., 2017; Lee et al., 2017; Neira et al., 2017; Thampaisarn et al., 2017; Thomazelli et al., 2017; Yamamoto, Ito, & Ito, 2016). While very limited information is known about the biological and molecular characteristics of AAvV‐2 to ‐21, extensive study has been mainly conducted on AAvV‐1 (Newcastle disease virus, NDV) (Cardenas‐Garcia et al., 2015; Umali, Ito, Katoh, & Ito, 2014).

Newcastle disease (ND), caused by the virulent AAvV‐1, a well‐characterized AAvV serotype, is a highly contagious devastating viral disease to the domestic poultry worldwide because of its high mortality and heavy losses for economy (Saif & Barnes, 2008). Other serotypes AAvV, such as AAVV‐2, ‐3 and ‐7, are also known to cause reproductive and respiratory diseases in turkeys and chickens, sometimes resulting in death of the infected birds (Samuel, Subbiah, Shive, Collins, & Samal, 2011; Warke, Stallknecht, Williams, Pritchard, & Mundt, 2008). Meanwhile, some serotypes AAvV strains display their specific host restriction, such as AAvV‐5 cause diarrhoea and high mortality in budgerigars but not in chickens and ducks (Briand, Henry, Massin, & Jestin, 2012). However, AAvV‐6 was first identified at a domestic duck in 1977 from Hong Kong (duck/Hong Kong/18/199/77) and then was found to cause drop in egg production and mild respiratory disease in turkeys, but was avirulent in chickens (Chang et al., 2001; Tian et al., 2012; Xiao et al., 2010). But recent serosurveillance of commercial chickens in the USA showed the likely prevalence of all serotypes AAvV including AAvV‐6, excepted with AAvV‐5 (Warke, Appleby, & Mundt, 2008).

The genome size of AAvV range from 14.9 to 17.4 kb that is transcribed into at least six genes, which separately encode for up to nine different proteins (Saif & Barnes, 2008). However, AAvV‐6 has an RNA genome consists of seven genes in the order of 3′‐NP(56–1,626)‐P(1,634–3,119)‐M(3,122–4,526)‐F(4,586–6,420 or 4,586–6,416)‐SH(6,470–7,061 or 6,464–7,037)‐HN(7,072–9,102 or 7,066–9,096)‐L(9,166–16,182 or 9,160–16,176)‐5′ in length with 16,230 or 16,236 nucleotides (Xiao et al., 2010; Yamamoto, Ito, Tomioka, & Ito, 2015). Six major proteins are encoded, including the nucleocapsid protein (NP, 128–1,525, 1,398 nt), phosphoprotein (P, 1,687–2,979, 1,293 nt), matrix protein (M, 3,235–4,335, 1,101 nt), fusion protein (F, 4,598–6,265, 1,668 nt or 4,628–6,265, 1,638 nt), haemagglutinin‐neuraminidase (HN, 7,122–8,963 or 7,116–8,957, 1,842 nt) and large polymerase protein (L, 9,278–16,003 or 9,272–15,997, 6,726 nt). In addition, the small hydrophobic protein (SH, 6,542–6,970 or 6,536–6,964, 429 nt) that AAvV‐6 has, is not found in the other serotypes (Sobolev et al., 2016; Warke et al., 2008).

The few reports on the incidence of AAvV‐6 in commercial and domestic poultry from different parts of the world have shown a notable presence of several of this virus (Chang et al., 2001; Warke et al., 2008). Despite this, knowledge about the regularities of transmission, genetic and biological characteristics of AAvV‐6 viruses in commercial poultry and wild birds in the China recent years remains limited. Therefore, in this study, an AAvV‐6 surveillance of domestic poultry and wild birds in six provinces of China suspected of sites of inter‐species transmission and being intercontinental flyways from December 2013 to June 2017 was conducted.

2. MATERIALS AND METHODS

2.1. Ethical states

All experimental protocols (Approval ID: 20130113–1, approval date: 15th Jan 2013) used in this work were reviewed and approved by the Experimental Animal Council of Jilin University, China.

2.2. Sample collection

Nine thousand eight hundred and seventy‐two faecal samples were obtained from wild birds of wetlands and 1,642 cloacal and tracheal swab samples were collected from clinically healthy domestic poultry of live bird market (LBM) in China for AAvV‐6 epidemiological surveillances from December 2013 to June 2017. The samples were obtained in one province in north China (Neimenggu), two in central China (Hubei and Hunan), one in east China (Anhui), one in northeast China (Jilin) and one in northwest China (Qinghai).

2.3. Virus identification and isolation

Presence and identification of AAvV‐6 in each individual collected specimen was performed through allantoic cavities inoculation of 9 to 10‐day‐old specific‐pathogen‐free (SPF) chicken embryos (Merial, Beijing, China) (Kim, King, Suarez, Wong, & Afonso, 2007; Yin et al., 2017). The presence of the AAvV‐6 in allantoic fluid was identified by RT‐PCR and sequencing for paramyxoviruses (Tong, Chern, Li, Pallansch, & Anderson, 2008).

2.4. Cell culture and virus infection of cells

The chicken fibroblast cell line DF‐1 and the chicken bone marrow macrophages cell line HD11 were grown in DMEM containing 10% foetal bovine serum (FBS) (Gibco, Life Technologies) and complete DMEM/F12 containing 10% FBS respectively. Cells were planted into a 24‐well cell culture plate at a viable cell density (determined by Trypan blue exclusion, Sigma, Shanghai, China) of 3 × 105 cells per well at 37°C under 5% CO2 for 8 hr. Cells then were washed three times with phosphate buffered saline and supernatant was changed into fresh medium supplemented with 100 μg/ml streptomycin and 100 U/ml penicillin without FBS. Thereafter, cells were absorbed with virus at 100 μl allantoic fluid containing the Hubei isolate for 1 hr in the presence or absence of TPCK‐trypsin (Sigma, Shanghai, China) and fresh medium was added into the well and then incubated with 72 hr post infection (hpi). Subsequent to infection, virus titre in the supernatants was measured using a micro‐hemagglutination assay (HA) method (Zhang et al., 2018).

2.5. RNA extraction, RT‐PCR and sequencing

Viral RNA was isolated from allantoic fluid using the AxyPrep Body Fluid Viral DNA/RNA Miniprep Kit (Axygen, Shanghai, China) according to the manufacturer's instructions. Following extraction, cDNA synthesis was performed by using GoScript™ Reverse Transcription System (Promega, Shanghai, China) following the manufacturer's instructions using random primer. Then samples were measured by seminested PCR for L gene of paramyxoviruses using 2×EasyTaq PCR kit (TransGen Biotech, Beijing, China) (Tong et al., 2008). The first amplification in the seminested PCR assay consists of 10 μl 2×EasyTaq PCR supermix, 2 μl cDNA, 10 μM PAR‐F1 primer, 10 μM PAR‐R primer and H2O to achieve a final volume of 20 μl. The cycling reactions consisted of a cycle of 94°C for 2 min followed by 40 cycles of 94°C for 15 s, 48–50°C for 30 s and 72°C for 30 s. For the second amplification in the seminested PCR assay, we used 2 μl aliquot from the first PCR reaction, 10 μl 2×EasyTaq PCR supermix,10 μM PAR‐F2 primer, 10 μM PAR‐R primer and H2O to achieve a final volume of 20 μl. The cycling conditions consisted of an initial denaturation at 94°C for 2 min followed by 40 cycles of 94°C for 15 s, 48–50°C for 30 s and 72°C for 30 s. After that, the PAR‐F2 and PAR‐R primers were used for PCR amplicons sequencing (Sangon Biotech, Shanghai, China).

The BLAST search identified the relatedness of the isolated viruses with other reported AAvV‐6 strains and therefore this Hubei stain was designated as AAvV‐6/mallard/Hubei/2015. After that this AAvV‐6 in this study were amplified for the entire genome using 16 primer pairs (Table 1). The cycling reactions consisted of a cycle of 95°C for 3 min followed by 40 cycles of 95°C for 1 min, 45–57°C for 45 s and 72°C for 150 s. PCR amplicons sequencing was performed by Major‐bio Company (Beijing, China).

Table 1.

Primers used in this study

Name Primer sequence (5′‐3′) Length (bp)
1‐F GCAGCCCCTTTGTAAATAGAGAC 494
1‐R AAATGCCATGTAGGGTCCATC
2‐F AACACGACGCGATATTATGCC 1049
2‐R TCCGTGTTGCCCTTACTGTC
3‐F ACACCCCTCAGAGAGATCCAA 979
3‐R TAATCAGCGTCAAGAGTGTCCA
4‐F CTCACCCCGTACTCTGACA 2455
4‐R CGCTTGAAGTTGCATAGATGTACC
5‐F AGAATAATCTAACAGCCCAACCAA 2392
5‐R GGCGATCCTCCAGTCTCC
6‐F TAGCAGCCACAGAATCAGGT 2387
6‐R TTACTGCCCCGATTAGCCT
7‐F AAGCAGCATACTCATTAACCAC 1977
7‐R CGCTCAGATCTTCAACTAAGTCA
8‐F CTCCCGCGTCTCTAGCAAGG 2396
8‐R TCCCTGGATTCCCTTACGTG
9‐F GGAATACAAACTCTCGAGGCTA 536
9‐R TCAATAGTCATGTCAGGCTAGTGT
10‐F ATATGCTTGGGGAATTTACGAGA 486
10‐R CATACATCTGGCGTGCTCT
11‐F AGGAAACCATATGCTTGGGGA 724
11‐R GTACTCCGGATCACTCTGTTT
12‐F CTGCATCACCCTTGGCAGCAT 977
12‐R CTAAGGAAGGAATAGTTAGGAAG
13‐F CAGGGTTATGGCCAAGTGTCA 1458
13‐R GAGATGGTTCAGGCTCCAAGG
14‐F TTTTACACCTATTAAGGCGAAC 1759
14‐R AGCACCTGCATGATTACCTG
15‐F CCATAACCGGAAGTATTGCTG 1844
15‐R TTCAGGCAGAACACTAAGGA
16‐F TGCTCTCTGATTAAGATCTCG 780
16‐R TCAGATTATTAATTGCCGGTA
Open in a new tab

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

2.6. Pathogenicity test

The pathogenicity of the AAvV‐6 isolate was determined by (a) mean death time (MDT) in 9 to 10‐day‐old embryonated SPF eggs, (b) Intra‐cerebral pathogenicity index (ICPI) tests in 1‐day‐old SPF chickens (Merial, Beijing, China) and (c) the intravenous pathogenicity index (IVPI) in 6‐week‐old chickens (Merial, Beijing, China) according to the Office International des Epizooties (OIE) manual of standards (Newcastle disease 2018).

2.7. Hemagglutination (HA) and Hemagglutination Inhibition (HI) assay

HA and HI assay were carried out according to the OIE guidelines (Newcastle disease 2018). In HI tests, anti‐sera against avian influenza virus (AIV) H1, H5 and H9 (Weike Biotechnology, Harbin, China) and NDV LaSota strain (Weike Biotechnology, Harbin, China), AAvV‐4 (prepared by our lab) were used as references.

2.8. Phylogenetic analysis

Nucleotide sequences of AAvV‐6 in this study were aligned through Mega X software with the sequences of representative AAvV‐6 strains retrieved from GenBank database (http://www.ncbi.nlm.nih.gov/GenBank). The homology analysis was carried out using the maximum likelihood method through MegAlign (DNASTAR). The phylogenetic consensus tree of complete F gene and viral whole genome sequence were generated a Maximum Likelihood method based on the General Time Reversible model through MEGA X software (Kumar, Stecher, Li, Knyaz, & Tamura, 2018).

3. RESULTS AND DISCUSSION

Only one sample from mallard in 2015 at a wetland of Hubei province, China, produced suspect AAvV‐6 positive result for the L gene by seminested PCR for paramyxoviruses, and then genome sequencing and phylogenetic analysis was conducted on this Hubei isolate (AAvV‐6/mallard/Hubei/2015, GenBank accession number MH551526). Surveillance data were also observed by researchers who performed similar monitoring researches of wild birds and domestic poultry and identified AAvV‐6 viruses (Shortridge, Alexander, & Collins, 1980; Sobolev et al., 2016), such as the isolate rate of AAvV‐6 in shorebirds was 2.4% in Germany during the year 2001–2002 (Hlinak et al., 2006) and in free‐living wild ducks was 0.76‰ in South Korea during the winter season (November to February) between 2010 and 2014 (Choi et al., 2018). However, our current data clearly indicate that AAvV‐6 is a lower isolated virus (the isolate rate was 0.1‱, 1/9, 872) in wild birds in China from the year 2013–2017 as compared with other AAvVs, such as AAvV‐1 and ‐4 (Yin et al., 2017; Zhang et al., 2015). Meanwhile, no AAvV‐6 isolate was obtained from domestic poultry. To our best knowledge, most of reported AAvV‐6 viruses were isolated from waterfowl species, such as geese, teal, mallard and so on (Figure 1). Therefore, future AAvV‐6 monitoring studies in domestic poultry should include more samples from LBMs as well as their susceptibility to AAvV‐6 viruses may differ from that of wild bird species.

Figure 1.

Figure 1

Open in a new tab

Phylogenetic analysis of whole genome sequence (a) and complete F gene sequences (b) of AAvV‐6. The evolutionary history was inferred by using the Maximum Likelihood method based on the General Time Reversible model. The tree with the highest log likelihood (−48402.50) (a) and (−5766.82) (b) is shown. Initial tree(s) for the heuristic search were obtained by applying the Neighbour‐Joining method to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 10 (a) and 24 (b) nucleotide sequences. Codon positions included were 1st+2nd+3rd+Non‐coding. All positions containing gaps and missing data were eliminated. There were a total of 16,192 (a) and 1,638 (b) positions in the final dataset. Evolutionary analyses were conducted in MEGA X

The complete sequence obtained for the genome of this Hubei isolate consisted of 16,236 nucleotides, which is the same in size as the other reported AAvV‐6 strains excepted with two isolates that is AAvV‐6/duck/Italy/4524‐2/07 and AAvV‐6/red‐necked_stint/Japan/8KS0813/2008 (16,230 nucleotides genome length). As same as other reported AAvV‐6 isolates, the genome of this Hubei isolate also encoding seven structural proteins (NP, P, M, F, SH, HN and L) in the order 3′ leader‐N‐P‐M‐F‐SH‐HN‐ L ‐trailer 5′.

To further determine the virulence of the AAvV‐6/mallard/Hubei/2015, the cleavage site in the fusion (F) protein, MDT, ICPI and IVPI were determined. For AAvV‐6/mallard/Hubei/2015, deduced amino acid sequence of the cleavage site of the F protein, 112PAPEPR*L117, that contains a monobasic aa residue (arginine, R), is identical to most of AAvV‐6 strains (Table 2). However, there are several differences in the cleavage site of AAvV‐6/duck/Italy/4524‐2/07 and AAvV‐6/red‐necked stint/Japan/8KS0813/2008 (112SIREPR*L117) strains. In addition, this Hubei isolate was able to grown in chicken cell lines HD11 and DF‐1 only with the addition of trypsin. The MDT score was more than 168 hr, with no mortality after 7 days, as well as both ICPI and IVPI were 0, suggesting this Hubei isolate is a low virulent virus for chickens.

Table 2.

Detailed information of AAvV‐6 isolates obtained from GenBank

GenBank accession numbers Strain Cleavage site
KF267717.1 AAvV‐6/mallard/Jilin/127/2011 PAPEPR↓L
JX522537.1 AAvV‐6/mallard/Jilin/190/2011 PAPEPR↓L
KP762799.1 AAvV‐6/red‐crested pochard/Balkhash/5842/2013 PAPEPR↓L
KT962980.1 AAvV‐6/teal/Novosibirsk region/455/2009 PAPEPR↓L
NC003043.1 AAvV‐6/duck/Taiwan/Y1/98 PAPEPR↓L
EF569970.1 AAvV‐6/Goose/Fareast/4440/2003 PAPEPR↓L
EU622637.2 AAvV‐6/duck/Hong Kong/18/199/77 PAPEPR↓L
JN571486.1 AAvV6‐/mallard/Belgium/12245/07 PAPEPR↓L
AB759118.1 AAvV‐6/red‐necked stint/Japan/8KS0813/2008 SIREPR↓L
GQ406232.1 AAvV‐6/duck/Italy/4524‐2/07 SIREPR↓L
MH551526 AAvV‐6/mallard/Hubei/2015 PAPEPR↓L
Open in a new tab

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

Interestingly, infective allantoic fluid of AAvV‐6/mallard/Hubei/2015 only produced HA positive results after five passages in 9 to 10‐day‐old SPF embryonated chicken eggs. Meanwhile, the HA‐negative allantoic fluid of this Hubei isolate was negative for avian coronavirus (infectious bronchitis virus), avian avastrovirus and avian adenovirus serotype 4. Furthermore, the HA‐positive allantoic fluid from AAvV‐6/mallard/Hubei/2015 was negative for AIV, NDV and AAvV‐4 based on the HI test and PCR. However, the HA‐negative allantoic fluid of AAvV‐6/mallard/Hubei/2015 restored the HA‐positive results when the virus pre‐treated with 1% trypsin for 30 min. But the nucleotide and aa (amino acid) sequences homologies of the HN gene between this novel HA negative Hubei isolate and a reported HA‐positive isolate AAvV‐6/teal/Novosibirsk region/455/2009 (128 hemagglutination units (HAU) per 50 μl, GenBank No: KT962980) (Sobolev et al., 2016) was 100%. Therefore, more research is needed to elucidate the molecular mechanisms of HA‐negative AAvV‐6 isolates in the field.

HA and HI assays are the classical methods to identify AAvV worldwide. Novel non‐hemagglutination AAvV‐6 isolates that are not detected by traditional HI assay, suggesting it is critical to continuously update surveillance systems, comprising biosecurity measures, research and diagnostic assays, to protect domestic poultry across the globe.

To further study the genetic characteristics of this AAvV‐6 virus, phylogenetic trees were generated based on the genome sequence and the complete F gene sequence respectively. However, the complete F gene sequence is considered as the main target for molecular epidemiological investigations and genotyping of AAvV. Meanwhile, a unified nomenclature and classification system of the NDV (AAvV‐1) genotyping method based on the mean inter‐populational evolutionary distances of the complete F gene sequence, with cut‐off values more than 10% to assign new genotypes (Diel et al., 2012), will provide a more rational and scientific genotyping method for epidemiological studies of other serotypes AAvV. Therefore, 24 reported AAvV‐6 isolates, including this Hubei isolate, were classified into two genotypes (I and II, with the mean inter‐populational evolutionary distances between groups varying of 0.476 [47.6%] (Figure 1b; Table 3a). Furthermore, the isolates within genotype I and II were grouped into two subgenotypes (Ia and Ib, with the mean inter‐populational evolutionary distances between groups was 0.0485 [4.85%] and IIa and IIb, with the mean inter‐populational evolutionary distances between groups was 0.0438 [4.385%]) respectively (Figure 1b; Table 3b). To our interestingly, no similar genotype II isolates were detected in domestic poultry and wild birds of this study during the year 2015–2017, suggesting that no genotype II viruses were introduced into China from nearby country Japan and south Korea and limited virus circulation. Taken together, at least two genotypes (I and II) is existed within AAvV‐6, based on the evolutionary distances of the complete F gene. Meanwhile, highly similar genotype I and II AAvV‐6 isolates from distinct bird species in different regions of America, Asian and Europe clearly demonstrate that AAvV‐6 can be intercontinental and inter‐species transmitted by wild migratory birds.

Table 3.

Estimates of evolutionary distances between AAvV‐6 genotypes (A) and subgenotypes (B)

Genotype No. of base substitutions per site or standard error estimate (a)
I II
(A)
I (0.437)
II 0.476
Subgenotype No. of base substitutions per site or standard error estimate (b) Subgenotype No. of base substitutions per site or standard error estimate (c)
Ia Ib IIa IIb
(B)
Ia (0.0102) IIa (0.0099)
Ib 0.0485 IIb 0.0438
Open in a new tab

The number of base substitutions per site from averaging over all sequence pairs between groups are shown. Standard error estimate(s) are shown above the diagonal and were obtained by a bootstrap procedure (500 replicates). Analyses were conducted using the Maximum Composite Likelihood model. The rate variation among sites was modelled with a gamma distribution (shape parameter = 1). The analysis involved (a) 24 nucleotide sequences (I, n = 13; II, n = 11), (b) 13 nucleotide sequences (Ia, n = 8; Ib, n = 4) and 11 nucleotide sequences (IIa, n = 5; IIb, n = 6). Codon positions included were 1st+2nd+3rd+Non‐coding. All positions containing gaps and missing data were eliminated. There were a total of 1,638 positions in the final dataset. Evolutionary analyses were conducted in MEGA X.

This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.

A tremendous amount of information about AAvV‐1 is available on the characteristics and genetic relationships because of the severe disease it causes in poultries worldwide (Shittu, Joannis, Odaibo, & Olaleye, 2016; Xue et al., 2017, 2017; Zhang et al., 2015). By comparison, the pathological phenomenon which AAvV‐6 causes are relatively weak, just manifested in decreased egg production and mild respiratory disease in turkeys and was avirulent in chickens under normal circumstances (Alexander, 2000; Saif & Barnes, 2008; Sobolev et al., 2016). As a low virulence virus for chickens and low separation rate, the potential harm of the AAvV‐6 is easily overlooked. However, in a recent study of the pathogenicity of two AAvV‐6 variant isolates, AAvV‐6/red‐necked stint/Japan/8KS0813/2008 and AAvV–6/duck/Hong Kong/18/199/1977, as representative isolate of genotype I and II respectively, could replicate in respiratory tissues of infected mice and induce respiratory disease, sometimes resulting in death of the infected mice (Bui et al., 2017). Further researches about the virulence and susceptibility of AAvV‐6 should be include more isolates, since differences of viral propagation properties in same cells were observed between the two variant isolates, owing to the change of host from red‐necked stint to duck and sites where the two variant isolates separated at such a distance to some extent (Bui et al., 2014). Therefore, the identification and isolation of Hubei isolate is beneficial for the further understanding of HA‐negative AAvV‐6 in this study for the high sequence identity (99.1%–99.2%) with two Jilin isolates (AAvV‐6/mallard/Jilin/190/2011 and AAvV‐6/mallard/Jilin/127/2011) and the same cleavage site with other AAvV‐6 isolates.

In conclusion, our current data indicate that AAvV‐6 is distributed sporadically in wild migratory birds, not in domestic birds, in China during the year 2013–2017. Because the Russian Far East, eastern Mongolia, eastern Siberia, Alaska, Black Sea/Mediterranean and Asian are linked by the migratory routes of the migratory wild bird species investigated here, our conclusion should commonly be applicable to other similar Asian AAvV‐6 isolates. Bird shows, import and trade are other potential opportunities that easily allow the introduce of emerging isolates to susceptible populations, unless strict control measures are complied. The AAvV‐6 Hubei isolate here is epidemiological connected to AAvV‐6 from other geographical areas, such as FarEast, Siberia, Kazakhstan and South Korea, therefore their presence implies the potential risk of AAvV‐6 being spread into the region and country, possibly causing to domestic poultry and wild birds infections. It also necessitates the demand for constant epidemiological surveillance for AAvV‐6 isolates among domestic poultry and wild birds in China to discover the potential spread of novel variants from other countries and regions.

AUTHOR CONTRIBUTIONS

RY, XL, YC and ZD designed and performed the study, drafted the manuscript and analyzed the data. All authors collected clinical samples. RY, XL, ZD and YC carried out experiments.

ACKNOWLEDGEMENTS

This study was partly supported by three grants from the Key Project of Chinese National Programs for Research and Development (2017YFD0500800, 2018YFD051404 and 2018YFD0500100), one grant from the Natural Science Foundation of Jilin Province (20160414029GH), and three grants from the National Science Foundation of China (31402195, 31472195 and 31570026).

Chen Y, Ding Z, Liu X, et al. Biological and phylogenetic characterization of a novel hemagglutination‐negative avian avulavirus 6 isolated from wild waterfowl in China. Transbound Emerg Dis. 2018;65:1421–1428. 10.1111/tbed.13005

REFERENCES

  1. Alexander, D. J. (2000). Newcastle disease and other avian paramyxoviruses. Revue Scientifique et Technique, 19(2), 443–462. 10.20506/rst.19.2.1231 [DOI] [PubMed] [Google Scholar]
  2. Amarasinghe, G. K. , Bao, Y. , Basler, C. F. , Bavari, S. , Beer, M. , Bejerman, N. , … Kuhn, J. H. (2017). Taxonomy of the order Mononegavirales: update 2017. Archives of Virology, 162(8), 2493–2504. 10.1007/s00705-017-3311-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Briand, F. X. , Henry, A. , Massin, P. , & Jestin, V. (2012). Complete genome sequence of a novel avian paramyxovirus. Journal of Virology, 86(14), 7710 10.1128/JVI.00946-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bui, V. N. , Mizutani, T. , Nguyen, T. H. , Trinh, D. Q. , Awad, S. S. , Minoungou, G. L. , … Imai, K. (2014). Characterization of a genetic and antigenic variant of avian paramyxovirus 6 isolated from a migratory wild bird, the red‐necked stint (Calidris ruficollis). Archives of Virology, 159(11), 3101–3105. 10.1007/s00705-014-2162-8 [DOI] [PubMed] [Google Scholar]
  5. Bui, V. N. , Trinh, D. Q. , Abao, L. N. B. , Ozeki, Y. , Runstadler, J. , Nakamura, K. , … Imai, K. (2017). Evaluation of the replication and pathogenicity of a variant avian paramyxovirus serotype 6 in mice. Archives of Virology, 162(10), 3035–3043. 10.1007/s00705-017-3459-1 [DOI] [PubMed] [Google Scholar]
  6. Cardenas‐Garcia, S. , Diel, D. G. , Susta, L. , Lucio‐Decanini, E. , Yu, Q. , Brown, C. C. , … Afonso, C. L. (2015). Development of an improved vaccine evaluation protocol to compare the efficacy of Newcastle disease vaccines. Biologicals, 43(2), 136–145. 10.1016/j.biologicals.2014.11.003 [DOI] [PubMed] [Google Scholar]
  7. Chang, P. C. , Hsieh, M. L. , Shien, J. H. , Graham, D. A. , Lee, M. S. , & Shieh, H. K. (2001). Complete nucleotide sequence of avian paramyxovirus type 6 isolated from ducks. Journal of General Virology, 82(Pt 9), 2157–2168. 10.1099/0022-1317-82-9-2157 [DOI] [PubMed] [Google Scholar]
  8. Choi, K. S. , Kim, J. Y. , Lee, H. J. , Jang, M. J. , Kwon, H. M. , & Sung, H. W. (2018). Genetic diversity of avian paramyxovirus type 6 isolated from Wild Ducks in the Republic of Korea. Journal of Wildlife Diseases, 54(3), 558–563. 10.7589/2017-07-158 [DOI] [PubMed] [Google Scholar]
  9. Diel, D. G. , da Silva, L. H. , Liu, H. , Wang, Z. , Miller, P. J. , & Afonso, C. L. (2012). Genetic diversity of avian paramyxovirus type 1: Proposal for a unified nomenclature and classification system of Newcastle disease virus genotypes. Infection, Genetics and Evolution, 12(8), 1770–1779. 10.1016/j.meegid.2012.07.012 [DOI] [PubMed] [Google Scholar]
  10. Hlinak, A. , Muhle, R. U. , Werner, O. , Globig, A. , Starick, E. , Schirrmeier, H. , … Muller, T. (2006). A virological survey in migrating waders and other waterfowl in one of the most important resting sites of Germany. Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health, 53(3), 105–110. 10.1111/j.1439-0450.2006.00935.x [DOI] [PubMed] [Google Scholar]
  11. Jeong, J. , Kim, Y. , An, I. , Wang, S. J. , Kim, Y. , Lee, H. J. , … Jheong, W. (2017). Complete genome sequence of a novel avian paramyxovirus isolated from wild birds in South Korea. Archives of Virology, 10.1007/s00705-017-3588-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kim, L. M. , King, D. J. , Suarez, D. L. , Wong, C. W. , & Afonso, C. L. (2007). Characterization of class I Newcastle disease virus isolates from Hong Kong live bird markets and detection using real‐time reverse transcription‐PCR. Journal of Clinical Microbiology, 45(4), 1310–1314. 10.1128/JCM.02594-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kolakofsky, D. , & Roux, L. (1987). The Molecular Biology of Paramyxoviruses In Bercoff R. P. (Ed.), The Molecular Basis of Viral Replication (pp. 277–297). Boston, MA: Springer, US; 10.1007/978-1-4684-5350-8 [DOI] [Google Scholar]
  14. Kumar, S. , Stecher, G. , Li, M. , Knyaz, C. , & Tamura, K. (2018). MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35(6), 1547–1549. 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lee, H. J. , Kim, J. Y. , Lee, Y. J. , Lee, E. K. , Song, B. M. , Lee, H. S. , & Choi, K. S. (2017). A novel avian paramyxovirus (putative serotype 15) isolated from wild birds. Frontiers in Microbiology, 8, 786 10.3389/fmicb.2017.00786 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Neira, V. , Tapia, R. , Verdugo, C. , Barriga, G. , Mor, S. , Ng, T. F. F. , … Gonzalez‐Acuna, D. (2017). Novel avulaviruses in penguins, Antarctica. Emerging Infectious Diseases, 23(7), 1212–1214. 10.3201/eid2307.170054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Newcastle disease . (2018). Chapter 2.3.14 In Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (pp. 555–574). Paris, France: OIE, the World Organisation for Animal Health; Retrieved from http://oie.int/international-standard-setting/terrestrial-manual/ [Google Scholar]
  18. Saif, Y. M. , & Barnes, H. J. (2008). Newcastle Disease, Pneumovirus Infection and Other Paramyxoviruses In Saif Y. M. & Fadly A. M.… [et al.], associate editors (Eds.), Diseases of poultry (12th edn, pp. 75–116). Oxford, UK: Blackwell. [Google Scholar]
  19. Samal, S. K. (2011). The Biology of paramyxoviruses. Norfolk, UK: Caister Academic Press. [Google Scholar]
  20. Samuel, A. S. , Subbiah, M. , Shive, H. , Collins, P. L. , & Samal, S. K. (2011). Experimental infection of hamsters with avian paramyxovirus serotypes 1 to 9. Veterinary Research, 42, 38 10.1186/1297-9716-42-38 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Shittu, I. , Joannis, T. M. , Odaibo, G. N. , & Olaleye, O. D. (2016). Newcastle disease in Nigeria: Epizootiology and current knowledge of circulating genotypes. Virusdisease, 27(4), 329–339. 10.1007/s13337-016-0344-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Shortridge, K. F. , Alexander, D. J. , & Collins, M. S. (1980). Isolation and properties of viruses from poultry in Hong Kong which represent a new (sixth) distinct group of avian paramyxoviruses. Journal of General Virology, 49(2), 255–262. 10.1099/0022-1317-49-2-255 [DOI] [PubMed] [Google Scholar]
  23. Sobolev, I. A. , Sharshov, K. , Yurchenko, K. , Korneev, D. , Glushchenko, A. , Alikina, T. , … Shestopalov, A. (2016). Characterization of avian paramyxovirus type 6 isolated from a Eurasian teal in the intersection of migratory flyways in Russia. Archives of Virology, 161(11), 3275–3279. 10.1007/s00705-016-3029-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Thampaisarn, R. , Bui, V. N. , Trinh, D. Q. , Nagai, M. , Mizutani, T. , Omatsu, T. , … Imai, K. (2017). Characterization of avian paramyxovirus serotype 14, a novel serotype, isolated from a duck fecal sample in Japan. Virus Research, 228, 46–57. 10.1016/j.virusres.2016.11.018 [DOI] [PubMed] [Google Scholar]
  25. Thomazelli, L. M. , de Araujo, J. , Fabrizio, T. , Walker, D. , Reischak, D. , Ometto, T. , … Durigon, E. L. (2017). Novel avian paramyxovirus (APMV‐15) isolated from a migratory bird in South America. PLoS ONE, 12(5), e0177214 10.1371/journal.pone.0177214 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Tian, Z. , Chai, H. , Li, F. , Sun, J. , Chen, G. , Hu, X. , … Xiang, W. (2012). Complete nucleotide sequence of avian paramyxovirus type 6 strain JL isolated from mallard ducks in China. Journal of Virology, 86(23), 13112 10.1128/JVI.02317-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Tong, S. , Chern, S. W. , Li, Y. , Pallansch, M. A. , & Anderson, L. J. (2008). Sensitive and broadly reactive reverse transcription‐PCR assays to detect novel paramyxoviruses. Journal of Clinical Microbiology, 46(8), 2652–2658. 10.1128/JCM.00192-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Umali, D. V. , Ito, H. , Katoh, H. , & Ito, T. (2014). Surveillance of avian paramyxovirus in migratory waterfowls in the San‐in region of western Japan from 2006 to 2012. Journal of Veterinary Medical Science, 76(3), 423–430. 10.1292/jvms.13-0539 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Warke, A. , Appleby, L. , & Mundt, E. (2008). Prevalence of antibodies to different avian paramyxoviruses in commercial poultry in the United States. Avian Diseases, 52(4), 694–697. 10.1637/8390-070308-RESNOTE.1 [DOI] [PubMed] [Google Scholar]
  30. Warke, A. , Stallknecht, D. , Williams, S. M. , Pritchard, N. , & Mundt, E. (2008). Comparative study on the pathogenicity and immunogenicity of wild bird isolates of avian paramyxovirus 2, 4, and 6 in chickens. Avian Pathology, 37(4), 429–434. 10.1080/03079450802216645 [DOI] [PubMed] [Google Scholar]
  31. Xiao, S. , Subbiah, M. , Kumar, S. , De, N. R. , Terregino, C. , Collins, P. L. , & Samal, S. K. (2010). Complete genome sequences of avian paramyxovirus serotype 6 prototype strain Hong Kong and a recent novel strain from Italy: Evidence for the existence of subgroups within the serotype. Virus Research, 150(1), 61–72. 10.1016/j.virusres.2010.02.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Xue, C. , Cong, Y. , Yin, R. , Sun, Y. , Ding, C. , Yu, S. , … Ding, Z. (2017). Genetic diversity of the genotype VII Newcastle disease virus: Identification of a novel VIIj sub‐genotype. Virus Genes, 53(1), 63–70. 10.1007/s11262-016-1404-0 [DOI] [PubMed] [Google Scholar]
  33. Xue, C. , Xu, X. , Yin, R. , Qian, J. , Sun, Y. , Wang, C. , … Ding, Z. (2017). Identification and pathotypical analysis of a novel VIk sub‐genotype Newcastle disease virus obtained from pigeon in China. Virus Research, 238, 1–7. 10.1016/j.virusres.2017.05.011 [DOI] [PubMed] [Google Scholar]
  34. Yamamoto, E. , Ito, T. , & Ito, H. (2016). Completion of full length genome sequence of novel avian paramyxovirus strain APMV/Shimane67 isolated from migratory wild geese in Japan. Journal of Veterinary Medical Science, 78(10), 1583–1594. 10.1292/jvms.16-0264 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yamamoto, E. , Ito, H. , Tomioka, Y. , & Ito, T. (2015). Characterization of novel avian paramyxovirus strain APMV/Shimane67 isolated from migratory wild geese in Japan. Journal of Veterinary Medical Science, 77(9), 1079–1085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Yin, R. , Zhang, P. , Liu, X. , Chen, Y. , Tao, Z. , Ai, L. , … Ding, Z. (2017). Dispersal and transmission of avian paramyxovirus serotype 4 among wild birds and domestic poultry. Frontiers in Cellular and Infection Microbiology, 7, 212 10.3389/fcimb.2017.00212 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang, P. , Ding, Z. , Liu, X. , Chen, Y. , Li, J. , Tao, Z. , … Yin, R. (2018). Enhanced replication of virulent newcastle disease virus in chicken macrophages is due to polarized activation of cells by inhibition of TLR7. Frontiers in Immunology, 9, 366 10.3389/fimmu.2018.00366 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhang, P. , Xie, G. , Liu, X. , Ai, L. , Chen, Y. , Meng, X. , … Yin, R. (2015). High genetic diversity of newcastle disease virus in wild and domestic birds in Northeastern China from 2013 to 2015 reveals potential epidemic trends. Applied and Environment Microbiology, 82(5), 1530–1536. 10.1128/AEM.03402-15 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Transboundary and Emerging Diseases are provided here courtesy of Wiley

RESOURCES