Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2020 Apr 17;86(9):e00145-20. doi: 10.1128/AEM.00145-20

A Novel Tail-Associated O91-Specific Polysaccharide Depolymerase from a Podophage Reveals Lytic Efficacy of Shiga Toxin-Producing Escherichia coli

Yibao Chen a,b, Xiangmin Li a,b,c,d, Shuang Wang a,b, Lingyu Guan a,b, Xinxin Li a,b, Dayue Hu a,b, Dongyang Gao a,b, Jiaoyang Song a,b, Huanchun Chen a,b,c,d, Ping Qian a,b,c,d,✉
Editor: Harold L Drakee
PMCID: PMC7170472  PMID: 32111587

Shiga toxin-producing Escherichia coli (STEC) is an important foodborne pathogen worldwide. The Shiga-like toxin causes diarrhea, hemorrhagic colitis, and life-threatening hemolytic uremic syndrome (HUS) in humans. Although antibiotic therapy is still used for STEC infections, this approach may increase the risk of HUS. Phages or phage-derived depolymerases have been used to treat bacterial infections in animals and humans, as in the case of the “San Diego patient” treated with a phage cocktail. Here, we showed that phage PHB19 and its O91-specific polysaccharide depolymerase Dep6 degraded STEC biofilms and stripped the lipopolysaccharide (LPS) from STEC strain HB10, which was subsequently killed by serum complement in vitro. In a mouse model, PHB19 and Dep6 protected against STEC infection and caused a significant reduction in the levels of proinflammatory cytokines. This study reports the use of an O91-specific polysaccharide depolymerase for the treatment of STEC infection in mice.

KEYWORDS: Shiga toxin-producing Escherichia coli, bacteriophage, O91-specific polysaccharide depolymerase, infection, therapy

ABSTRACT

Shiga toxin-producing Escherichia coli (STEC) strains are important zoonotic foodborne pathogens, causing diarrhea, hemorrhagic colitis, and life-threatening hemolytic uremic syndrome (HUS) in humans. However, antibiotic treatment of STEC infection is associated with an increased risk of HUS. Therefore, there is an urgent need for early and effective therapeutic strategies. Here, we isolated lytic T7-like STEC phage PHB19 and identified a novel O91-specific polysaccharide depolymerase (Dep6) in the C terminus of the PHB19 tailspike protein. Dep6 exhibited strong hydrolase activity across wide ranges of pH (pH 4 to 8) and temperature (20 to 60°C) and degraded polysaccharides on the surface of STEC strain HB10. In addition, both Dep6 and PHB19 degraded biofilms formed by STEC strain HB10. In a mouse STEC infection model, delayed Dep6 treatment (3 h postinfection) resulted in only 33% survival, compared with 83% survival when mice were treated simultaneously with infection. In comparison, pretreatment with Dep6 led to 100% survival compared with that of the control group. Surprisingly, a single PHB19 treatment resulted in 100% survival in all three treatment protocols. Moreover, a significant reduction in the levels of proinflammatory cytokines was observed at 24 h postinfection in Dep6- or PHB19-treated mice. These results demonstrated that Dep6 or PHB19 might be used as a potential therapeutic agent to prevent STEC infection.

IMPORTANCE Shiga toxin-producing Escherichia coli (STEC) is an important foodborne pathogen worldwide. The Shiga-like toxin causes diarrhea, hemorrhagic colitis, and life-threatening hemolytic uremic syndrome (HUS) in humans. Although antibiotic therapy is still used for STEC infections, this approach may increase the risk of HUS. Phages or phage-derived depolymerases have been used to treat bacterial infections in animals and humans, as in the case of the “San Diego patient” treated with a phage cocktail. Here, we showed that phage PHB19 and its O91-specific polysaccharide depolymerase Dep6 degraded STEC biofilms and stripped the lipopolysaccharide (LPS) from STEC strain HB10, which was subsequently killed by serum complement in vitro. In a mouse model, PHB19 and Dep6 protected against STEC infection and caused a significant reduction in the levels of proinflammatory cytokines. This study reports the use of an O91-specific polysaccharide depolymerase for the treatment of STEC infection in mice.

INTRODUCTION

Gram-negative Shiga toxin-producing Escherichia coli (STEC) is a zoonotic bacterial pathogen associated with diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome (HUS). In addition, STEC strains may induce severe diarrheagenic diseases in animals and humans (1). Shiga toxins (Stx), which can be divided into subgroups Stx1 and Stx2, are the main types of toxins produced by STEC. Upon entering the bloodstream, Stx cause renal failure, microvascular occlusion, and inflammation (2). Among human STEC infection cases, the incidence of HUS is highest in children aged 0 to 5 years (3). The use of antibiotics to treat HUS is controversial because studies such as that by Tarr et al. (4) have shown that antibiotic treatment is associated with an increased risk of HUS. A large proportion of reported STEC infection cases are attributed to E. coli O157 serogroup strains; however, severe cases of infection have also been associated with non-O157 serotypes (5, 6).

Biofilms are complex surface-associated bacterial communities encased in proteins, polysaccharides, and nucleic acids. Biofilm formation protects bacteria from the host immune response and can aid survival in harsh environments. E. coli biofilms consists of bacterial colonies embedded in an exopolysaccharide (EPS) matrix that enhances survival. Research indicates that biofilm-associated microorganisms cause a significant number of infections in humans (7). These infections are difficult to treat because of the inherent antibiotic resistance of the bacteria, leading to antimicrobial treatment failure and persistence of the biofilm.

Bacteriophages, or phages, are viruses that infect bacteria and have been used to treat bacterial infections for more than 100 years. Many studies have reported the use of single phages or phage cocktails to successfully treat bacterial infections in both animal models and human patients (8–10). A good example of this is the recent case of the “San Diego patient,” who was infected with a multidrug-resistant Acinetobacter baumannii strain while travelling in Egypt. After the failure of all available antibiotics, the patient made a full recovery following intravenous administration of a phage cocktail (8). Phage-associated enzymes, such as endolysin, lysin, and depolymerase, have also been used to treat bacterial infections in animal models (8–13).

Phages often possess a tail fiber, tail spikes, a base plate or neck, and even some soluble proteins that show depolymerization activity (13). The enzymes responsible for this activity can degrade bacterial polysaccharides (13, 14), including capsular polysaccharides (CPS), lipopolysaccharide (LPS), peptidoglycan, and essential components of the biofilm matrix. In addition, polysaccharides often act as an initial receptor, aiding in phage adsorption to the host surface. However, some phages are strictly O-antigen specific and cannot infect strains lacking O-antigen (15–18). For example, phage P22 tailspikes, which possess endoglycosidase activity, hydrolyzed O-antigen polysaccharide (18). Unlike other phage-related enzymes, depolymerases can strip bacterial surface polysaccharides, leaving the bacteria susceptible to host immune attack (19). Evidence has shown that depolymerases can degrade multidrug-resistant biofilms and protect mice from pathogen invasion, suggesting that depolymerases might potentially be used as antibacterial agents (9, 11, 20–23).

While several coliphage-derived depolymerases have been shown to improve survival in mouse models of bacterial infection (11, 22, 24, 25), little is known about the efficacy of depolymerases in the treatment of STEC-infected mice. In the current study, we identified a gene encoding a novel phage-derived depolymerase, Dep6, that specifically degrades STEC strain HB10 O91. In addition, both phage PHB19 and Dep6 effectively removed STEC biofilms in vitro. We also investigated the effects of PHB19 or Dep6 treatment in mice infected with STEC. This study reports the use of O91-specific polysaccharide depolymerase for the treatment of STEC in mice.

RESULTS

Morphological and genomic characteristics of phage PHB19.

Phage vB_EcoP_PHB19 was isolated from an environmental sewage sample. Analysis showed that it forms a halo with surrounding plaques (Fig. 1A) and has a latent period of 10 min and a burst size of 73 particles per cell (Fig. 1B). Transmission electron microscopy showed that PHB19 has an isometric polyhedral head (∼55 nm) and a short tail (∼7 nm) (Fig. 1A), while phylogenetic analysis indicated that it belongs to the Autographivirinae subfamily of T7-like viruses (Fig. 1C). Host range assays revealed that PHB19 could lyse only two strains of E. coli and had no lytic effects in E. coli belonging to other serotypes or in Salmonella spp. (see Table S1 in the supplemental material). Phage PHB19 contains a 40,037-bp double-stranded DNA genome with a G+C content of 48%. We identified 50 predicted open reading frames (ORFs), 30 of which had a predicted function. No tRNA genes were identified (Fig. 2A; Table S2). The functional open reading frames (ORFs) were clustered into four groups with functions related to replication and regulation, DNA packaging and morphogenesis, lysis, and a hypothetical function (Fig. 2A; Table S2). Protein basic local alignment search tool (BLASTP) analysis of ORF6 from the PHB19 genome revealed a conserved N-terminal moiety (amino acid residues 1 to 253) belonging to the T7 phage tail fiber superfamily (domain family PHBA00430) (Fig. 2B). The C-terminal moiety of ORF6 showed high sequence identity to tail fiber proteins from Escherichia virus Rtp and Escherichia phage IME253 and to a hypothetical protein from Shigella phage MK-13 (Fig. 2B). Neither the hypothetical protein mentioned above nor the tail fiber proteins have been examined in terms of their enzyme activities. The amino acid sequence of PHB19 ORF6 was used to generate a homology model using Phyre2 (Fig. S1). The results showed limited similarity to known functional proteins; however, we observed a low level of similarity to gp50 (Protein Data Bank accession number 5W5P) from phage AM24 (98.3% confidence; 27% coverage), which shows depolymerase activity (26).

FIG 1.

FIG 1

Morphological and genomic characteristics of phage PHB19. (A) Transmission electron micrograph of phage PHB19. Bar = 50 nm. Magnification = ×25,000. (B) One-step growth curves of phage PHB19 in host strain HB10. Data are represented as means ± SDs. (C) Phylogenetic analysis based on the major capsid protein (ORF14) of phage PHB19. The phylogenetic tree was generated using the neighbor-joining method and 1,000 bootstrap replicates.

FIG 2.

FIG 2

Whole-genome annotation and bioinformatic analysis of phage PHB19. (A) Genome map of PHB19. Fifty putative open reading frames (ORFs) were predicted in the PHB19 genome. Each arrow represents an annotated ORF. The color intensity is proportional to the sequence homology. (B) BLASTP analysis of the PHB19 tail fiber protein (ORF6) amino acid (aa) sequence (seq.) against those in the nonredundant sequence database.

Phenotypic parameters of Dep6.

On agar plates, a classic halo with possible depolymerase activity was observed around PHB19 plaques. Based on this phenotype, we carried out further analyses of the ORF6 tailspike protein, which had a conserved N-terminal moiety and a less-conserved C-terminal moiety. Cloning and purification of the C-terminal moiety, designated Dep6, showed that the recombinant protein was 82.5 kDa in size (Fig. 3A). The spotting method determined that critical enzymatic activity occurred at concentrations between 0.6 and 1.2 ng/μl (Fig. 3B). Assays to determine the development of resistance to Dep6 confirmed that Dep6-treated strains remained sensitive to Dep6 after 10 generations, suggesting a lack of resistance development (data not shown). As expected, phage-resistant strains were insensitive to depolymerase Dep6 activity (data not shown). The ability of Dep6 to degrade EPS was determined by measuring the generation of reducing ends using a dinitrosalicylic acid assay. Purified EPS was incubated with active or inactivated enzyme. As shown in Fig. 3C, the optical density at 450 nm (OD450) of the EPS treated with active Dep6 significantly increased compared with that of EPS treated with inactivated Dep6 (P < 0.001), suggesting the generation of reducing ends from the EPS substrate. As shown in Fig. 3D, active Dep6 degraded the EPS, suggesting that Dep6 can cleave polysaccharides on the surface of STEC strain HB10. Dep6 was highly stable at pH values ranging from 4 to 8 (Fig. 3E) and exhibited relatively good thermal stability at temperatures ranging from 20 to 60°C (Fig. 3F). However, at 70°C, less than half of the enzymatic activity observed at lower temperatures remained. No enzymatic activity was observed at 80°C (Fig. 3F).

FIG 3.

FIG 3

Stability of Dep6. (A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of purified Dep6. Lane MM, standard molecular mass marker; lane 1, unpurified Dep6 protein; lane 2, purified Dep6 protein. (B) Spot test of the activity of Dep6 against STEC strain HB10. (C, D) Analysis of Dep6-treated bacterial surface polysaccharide degradation. Lane 1, EPS plus active Dep6; lane 2, untreated EPS; lane 3, EPS plus inactivated Dep6; lane 4, Dep6. The release of reducing sugars from EPS was quantified at an optical density of 540 nm by reaction with dinitrosalicylic acid. Significance was determined by analysis of variance (ANOVA) (***, P < 0.001). (E) pH stability. Dep6 incubated at 37°C for 1 h in buffer at optimal pH was considered 100% activity. Data are expressed as means ± SDs (n = 3). (F) Thermal stability of Dep6. Dep6 incubated at 37°C for 1 h in buffer at optimal pH (pH 6.0) was considered 100% activity.

Receptor analysis assay.

To investigate the impact of O-antigen type on phage invasion, we performed inactivation assays using purified LPS-treated PHB19. Following LPS (O91) treatment (50 μg/ml), ∼95% of phage particles were inactivated within 30 min (Fig. 4A). However, other types of purified LPS (O34, O100, and O157) did not inactivate phage particles, suggesting that phage PHB19 may adsorb directly to specific LPS (O91) (Fig. 4A). Treatment of Dep6 significantly increased the nonadsorption of phage particles compared with the nonadsorption of the untreated Dep6 controls (P < 0.5) (Fig. 4B). As shown in Fig. S2, Dep6 can specifically degrade the O91 polysaccharide.

FIG 4.

FIG 4

Receptor analysis assay. (A) Titers of LPS-treated phage PHB19. (B) Relative numbers of infectious phage PHB19 particles in samples treated with LPS with different O-antigens. Data are expressed as means ± SDs (n = 3). Significance was determined by ANOVA (*, P < 0.05; ***, P < 0.001).

Antibiofilm activity.

The effects of PHB19 and Dep6 on established STEC HB10 biofilms in 96-well microplates were assessed at 37°C for 4 h. Crystal violet staining allowed changes in biomass to be determined based on absorbance. For a 24-h-old biofilm, PHB19 treatment reduced the absorbance value of the total biomass to 0.22 ± 0.03, compared with an absorbance of 0.51 ± 0.03 for the untreated control. Similarly, using a 48-h-old biofilm, PHB19 treatment reduced the absorbance from 0.64 ± 0.05 to 0.22 ± 0.04 (Fig. 5A and B). When biofilms were treated with Dep6, the absorbance values of the total biomass were 0.36 ± 0.03, compared with 0.51 ± 0.03 for the untreated control (24-h-old biomass), and 0.29 ± 0.04, compared with 0.64 ± 0.05 for the untreated control (48-h-old biomass) (Fig. 5A and B). The viable-cell counts showed that treatment with phage PHB19 (48-h-old biomass) resulted in a reduction of 1.9 log compared with the counts of the control (Fig. 5C). No significant difference was observed in the enzyme-treated sample (48-h-old biomass) (Fig. 5C).

FIG 5.

FIG 5

Antibiofilm and antibacterial activities of PHB19 and Dep6. (A) Crystal violet-stained biofilms. (B) Removal of static biofilms by PHB19 and Dep6. Biofilms were treated with 100 μl of phage PHB19 (107 PFU in PBS) or 100 μl of depolymerase Dep6 (30 μg in PBS) and incubated at 37°C for 4 h. (C) Viable-cell counts. Wells were treated as mentioned above. Three independent experiments were performed, and data are expressed as means ± SDs (n = 3). Significance was determined by ANOVA (*, P < 0.05; ***, P < 0.001).

Serum sensitivity.

The effects of Dep6 on the serum sensitivity of host strain HB10 were evaluated in vitro. As shown in Fig. 6, the addition of Dep6 enhanced the susceptibility of strain HB10 to serum killing, with an observed 4.2-log reduction in numbers of bacterial CFU in the Dep6-treated group compared with the those in the phosphate-buffered saline (PBS)-treated group (P < 0.001). As predicted, serum alone also decreased bacterial survival, while Dep6 alone had no effect.

FIG 6.

FIG 6

Serum sensitivity assay. (A) Susceptibility of host strain HB10 to killing by mouse serum. (B) Susceptibility of host strain HB10 to killing by human serum. Data are expressed as means ± SDs (n = 3). Significance was determined by ANOVA (***, P < 0.001, from a comparison with the PBS-treated group). For comparisons between enzyme plus serum and serum alone, significance is indicated by # (P < 0.05) and ### (P < 0.001).

In vitro and in vivo toxicity.

The toxicity of Dep6 in human lung carcinoma cells, human embryonic kidney cells, and human red blood cells was evaluated in vitro to assess the safety of the enzyme in animals and humans. Overall, no toxic effects were observed in any of the Dep6-treated cells (Fig. 7A and B).

FIG 7.

FIG 7

In vitro and in vivo safety assessments. (A) Hemolysis of red blood cells by Dep6. Data are expressed as means ± SDs (n = 3). Significant differences were determined by ANOVA (****, P < 0.001). (B) Cytotoxicity of Dep6. Dep6 was nontoxic to human cells (A549 and 293T cells). Data are expressed as means ± SDs (n = 3). Two-group comparisons were carried out using an independent Student t test. (C) Histopathological analysis of organ tissues from mice. Acute toxicity in mice treated with 100 μl of Dep6 (0.3 μg/μl), 100 μl of PHB19 (108 PFU), or 100 μl of PBS was assessed at 7 days postinoculation.

To examine toxicity in vivo, organs, including the liver, kidney, and small intestine, were collected from mice following Dep6 treatment and stained with hematoxylin and eosin. The mice were observed for 7 days prior to sacrifice. Pathological sections revealed no eosinophils or basophils in the collected tissues, and no other pathological changes were observed in the organs of the Dep6-treated mice compared with those of the PBS control group (Fig. 7C).

Therapeutic effects of PHB19 and Dep6 treatment.

Because the enzyme and phage appeared to be safe for use in mice based on in vitro and in vivo assays, we examined the therapeutic effects of Dep6 and PHB19 in mice. We used 2× the 100% minimum lethal dose (MLD100) (2.4 × 108 CFU) of STEC strain HB10 to infect the mice and a single dose of Dep6 (30 μg) or PHB19 (108 PFU) 3 h prior to challenge (pretoxin [PT] groups I and IV), at the same time as bacterial challenge (simultaneously with treatment [ST] groups II and V), or 3 h after challenge (delayed treatment [DT] groups III and VI). The challenged mice were monitored for 21 days. As shown in Fig. 8A, administration of Dep6 3 h after infection (DT group) resulted in a final survival rate of 33%, while simultaneous treatment with the enzyme (ST group) resulted in 83% survival. As expected, pretreatment with Dep6 resulted in 100% survival following infection with the STEC host strain (group VIII). Surprisingly, a single phage treatment resulted in 100% survival across all three treatment protocols (Fig. 8B). Following Dep6 treatment, no bacteria were detected in the lungs, liver, blood, or heart tissues of mice from the PT group (Fig. 8C). In the ST group, no bacteria were detected in the spleen, blood, or heart. However, in the DT group, bacteria were detected in all examined tissues (Fig. 8C). Following phage treatment, bacterial counts of <3.4 log CFU were detected in kidney, spleen, lung, liver, blood, and heart tissues from mice across the three treatment protocols (Fig. 8D); however, bacteria were not detected in any other tissue samples except for kidney samples from mice in the ST group (Fig. 8D). In comparison, phage counts of >3.8 log PFU were detected in each of the tissue samples from all phage treatment groups (Fig. 8E).

FIG 8.

FIG 8

Protective effects of Dep6 and PHB19 treatment in mice infected with pathogenic STEC strain HB10. (A) Survival of mice treated with Dep6 and infected with HB10. (B) Survival of mice treated with phage PHB19 and infected with HB10. Group I, mice treated with Dep6 3 h prior to challenge (51); group II, mice simultaneously treated with Dep6 and challenged with HB10 (ST group); group III, mice treated with Dep6 3 h postchallenge (DT group); group IV, mice treated with PHB19 3 h prior to challenge; group V, mice simultaneously treated with PHB19 and challenged with HB10; group VI, mice treated with PHB19 3 h postchallenge; group VII, mice challenged with pathogenic HB10 only (no treatment); group VIII, mice treated with PBS only. (C) Bacterial abundances in different tissues from mice treated with Dep6. (D) Bacterial abundances in different tissues from mice treated with PHB19. (E) Distribution of PHB19 in mice. The abundance of STEC strain HB10 or phage PHB19 was assessed in the kidney, spleen, lung, liver, blood, and heart at 6 h postinoculation. (F) Levels of proinflammatory cytokines in Dep6-treated and PHB19-treated mice. The experimental data were analyzed by ANOVA. For comparisons between group III or IV and group VII, significance is indicated by ** (P < 0.01) and *** (P < 0.001).

Reduced levels of proinflammatory cytokines (tumor necrosis factor alpha [TNF-α], gamma interferon [IFN-γ], interleukin 6 [IL-6], and IL-1β) were detected at 24 h postinfection in the mice in the DT group (groups III, VI, VII, PBS, and control) compared with levels in mice from the other treatment protocols (Fig. 8E). The purified phage significantly reduced the levels of all four proinflammatory factors (P < 0.01), while the purified Dep6 enzyme reduced the levels of TNF-α, IFN-γ, and IL-1β but not of IL-6 (P < 0.01) (Fig. 8F).

DISCUSSION

STEC is an important foodborne pathogen worldwide. More than half of all reported human STEC infection cases in Europe and the United States are caused by non-O157 serotype strains (27, 28). However, treatment of human STEC infections with antibiotics is no longer considered the best course of action because this approach may increase the risk of HUS (4). Therefore, given the urgent need for effective STEC therapies, phages or phage-derived enzymes should be considered an alternative to antibiotics. In this study, we isolated a podophage using STEC HB10 as the host strain. As with other T7-like phages (9, 29, 30), the isolated phage (PHB19) has an extremely narrow host range. Analysis of the PHB19 genome failed to identify any virulence or resistance genes, indicating that it has the potential to be used for therapeutic purposes.

We observed that the halos formed around PHB19 plaques expanded over time with incubation at 37°C, suggesting that the phage has depolymerase activity against the polysaccharide layer of the host bacterial capsule. Phage tail fibers, or tailspikes, which exhibit capsule depolymerization activities, target and degrade the LPS or CPS matrix. Detailed comparative genomic analysis revealed significant sequence divergence between the C terminus of the tailspike protein of PHB19 and those from other phages (Fig. 2B). This is in line with previous reports showing that phage tail fiber proteins contain conserved N-terminal domains and more variable C-terminal moieties, which are used for recognition (13, 31, 32). The depolymerase activity assay conducted in the current study suggested that ORF6 from phage PHB19 exhibited LPS depolymerase activity against host STEC strain HB10 (Fig. 4 and Fig. S2). Bacteria have systems in place to resist phage invasion. In addition, multiplex polysaccharides on the bacterial cell surface act as a natural barrier to phage invasion. However, these polysaccharides also act as primary receptors for phages (15, 16, 18, 32). Treatment of PHB19 with LPS revealed that LPS may be involved in PHB19 invasion of host cells (Fig. 4). Our results suggest that LPS material may act as a primary bacterial phage receptor, which has also been reported for other podophages (15, 33). Mutations rendering the host bacterium insensitive to PHB19 infection occurred at a frequency of ∼10−6, as determined by double-layer agar-based screening (data not shown). In addition, 20 enzyme-treated bacteria (HB10) were randomly selected; however, all 20 strains remained sensitive to Dep6. To our knowledge, there have been no other reports on mutations giving rise to phage-derived enzyme resistance (9–11, 13, 14, 23, 29, 34). Depolymerases only strip the bacterial polysaccharide and do not kill host bacteria. However, loss of the polysaccharide makes bacteria more susceptible to attack by host immune defenses (19). In the current study, Dep6 plus serum significantly reduced the number of viable bacterial cells in vitro compared with that with serum alone (P < 0.05) (Fig. 6). This result is in accordance with previous studies showing that depolymerase-treated bacteria are more sensitive to killing by serum (19, 23).

Phages and phage-derived enzymes can degrade the outer layer of the bacterial cell, which significantly impacts biofilm integrity. To our knowledge, there are only a few reports about the use of phage-derived depolymerases to effectively remove or inhibit existing biofilms (20, 35, 36). In our study, a 1.9-log reduction in the abundance of viable bacteria in a 48-h-old biofilm was observed following PHB19 administration. However, for the Dep6-treated biofilm, despite an observed decrease in the biomass of the 48-h-old biofilm, the numbers of viable bacteria remained unchanged between the treated and untreated groups (Fig. 5). One possible explanation is that crystal violet staining reflects the total biomass of biofilms, including bacterial polysaccharides, protein, and nucleic acids. We predict that Dep6 only degraded the LPS polysaccharide matrix and did not kill the host bacteria, resulting in a reduction of the bacterial biofilm matrix, with no change in the number of viable bacteria. Some studies have also shown that effective biofilm eradication is dependent on the age of the biofilm, the dose of the phage or enzyme, and/or the length of treatment (37–40). Thus, further studies should be conducted to investigate biofilm eradication by PHB19 and Dep6.

Previously, several coliphage depolymerases have exhibited efficacy in improving the survival of mice following bacterial infection. However, little is known about whether depolymerases can be used to treat STEC infections in mice. In our study, a single phage treatment 3 h after STEC infection resulted in 100% survival of the infected mice. Unexpectedly though, a single Dep6 treatment at the same time point resulted in a survival rate of only 33%, suggesting that delayed treatment with the Dep6 enzyme does not provide sufficient protection. One possible explanation is that the phage may have multiple bactericidal proteins other than Dep6. For example, phages are capable of specifically infecting and proliferating inside their host bacterium while also releasing free depolymerase. Alternatively, the treatment dose may have been too low. A recent study showed that different doses of depolymerase (2 to 20 μg per mouse) resulted in various levels of protection, with only the highest examined dose of K30 gp41 (20 μg per mouse) proving effective in mice (22). Therefore, dose optimization or multiple-dose enzyme assays should be conducted in the future. The treatment protocols examined in the current study were designed to simulate various clinical treatment protocols, such as prophylactic and therapeutic administration. Thus, the three treatment protocols used here will provide a reference for future therapeutic use of Dep6 or PHB19.

In conclusion, we isolated a STEC podophage and identified a gene encoding O91-specific polysaccharide depolymerase Dep6. Dep6 was active at concentrations ranging from 0.6 to 1.2 ng/μl. The C-terminal region of Dep6 exhibited high hydrolytic activity across a ranges of pH values (pH 4 to 8) and temperatures (20 to 60°C). In addition, phage PHB19 and Dep6 removed established STEC HB10 biofilms. We also confirmed that PHB19 and Dep6 are safe for use as therapeutics in vivo. Overall, our results indicate that PHB19 and Dep6 might be useful as alternative therapies for the treatment of STEC infections in animals and humans.

MATERIALS AND METHODS

Phage isolation and sequencing.

The host strain STEC HB10 (O91:H49) was grown at 37°C in Luria-Bertani (5) plates (Solarbio) or LB soy agar (1.5% [wt/vol] agar). Phage was isolated from sewage using a double-layer method as previously described (41). The phage particles were purified by CsCl gradient ultracentrifugation and observed with a transmission electron microscope (H-7650; Hitachi, Tokyo, Japan) at an acceleration voltage of 100 kV. Phage genomic DNA was extracted using phenol-chloroform as previously described (41). Complete genome sequencing of phage PHB19 was performed using the Illumina MiSeq (San Diego, CA, USA) system. The genomic library generated 2.05 Mb of data, with an average read length of 250 bp. Low-quality (Q value < 20) bases were filtered out using Trimmomatic, and the resulting data were assembled using Newbler v.3.0. Putative coding sequences were predicted using RAST (http://rast.nmpdr.org/). The final assembled genome sequence was searched against current protein and nucleotide databases (https://www.ncbi.nlm.nih.gov/) by means of the Basic Local Alignment Search Tool (BLAST). Protein BLAST (BLASTP) (https://www.ncbi.nlm.nih.gov/BLAST/) was used to identify putative homologies as well as proteins sharing similarities with the predicted phage proteins. Putative tRNA-encoding genes were predicted using tRNAscan-SE (http://lowelab.ucsc.edu/tRNAscan-SE/). Transmembrane domains were predicted using the TMHMM server, v.2.0 (http://www.cbs.dtu.dk/services/TMHMM/ ). The Position-Specific Iterative Basic Local Alignment Search Tool (https://www.ncbi.nlm.nih.gov/BLAST/) was used to identify putative depolymerase-encoding genes in the phage genome, and Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2) was used to predict the structure of the depolymerase. The HHpred interactive server (https://toolkit.tuebingen.mpg.de/tools/hhpred ) was used for protein homology detection and structure prediction. Phylogenetic analysis based on phage major capsid protein amino acid sequences was performed using ClustalW in MEGA 6 (42).

One-step group assay.

A one-step growth assay was performed as previously described (43). Briefly, the logarithmic-growth HB10 strain (20 ml) after addition of phage PHB19 at a multiplicity of infection (MOI) of 0.01 was incubated at 37°C for 5 min, followed by centrifugation at 12,000 × g for 30 s to remove unabsorbed free phage. The pellet was resuspended in LB medium (20 ml), followed by incubation at 37°C at 180 rpm. A 0.5-ml sample was collected after a total duration of 120 min. The PFU counts were obtained using the double-layer agar method. The experiments were repeated three times.

Phage exopolysaccharide depolymerase cloning and expression.

The ORF coding for a depolymerase domain was amplified by PCR using primers CGGAATTCAATGTGCTTACTCACGTTG (EcoRI) and GCGTCGACTTACTTCATGTAAATAGTGCGGAAC (SalI). The fragment from the C-terminal region of ORF6 (from bp 760 to bp 3078) in the PHB19 genome was cloned into the pET-28a vector, generating pET-ORF6, which was then transformed into E. coli BL21(DE3). The depolymerase Dep6 was expressed and purified by induction with 0.5 mM isopropyl-β-d-1-thiogalactopyranoside for 12 h at 25°C and then purified as previously described (43). Briefly, the recombinant His-tagged protein was purified from the soluble fraction using a Ni-nitrilotriacetic acid column (GenScript, Wuhan, China). The recombinant protein in imidazole-containing buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0) was dialyzed overnight at 4°C with phosphate-buffered saline (PBS) buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4). The purified Dep6 protein was concentrated by centrifugation over a 10-kDa ultrafiltration tube (Solarbio, Shanghai, China), and then Dep6 was quantified with the Bradford protein assay kit (ThermoFisher Scientific).

Spot test.

The spot test method was used to determine depolymerase Dep6’s activity against host strain HB10. The molten soft LB (0.75% agar) with 200 μl logarithmic-growth HB10 bacteria was poured into LB (1.5% agar) plates. After the LB dried, 5-μl aliquots of a serial dilution of purified protein (300 ng) was spotted onto the surface of the double-layer agar plates. The plates were observed for the formation of semiclear spots for 12 h at 37°C.

Resistance development assays.

We assessed the development of resistance to the depolymerase or phage as previously described (12), with minor modifications. Briefly, 100 μl of Dep6 (0.3 μg/μl) was incubated with 100 μl (106 CFU) of the host bacterial suspension at 37°C for 12 h. Twenty individual clones were randomly selected and cultured in LB medium. The 20 clones were then incubated with Dep6 as described above, and the steps were repeated for 10 generations. At the 10th generation, the sensitivity of the host bacteria to Dep6 was assessed by the formation of semiclear spots following incubation for 12 h at 37°C. To test the resistance of the strains to PHB19, 100 μl (108 PFU) of phage suspension was incubated with 100 μl (106 CFU) of the host bacterial suspension for 10 min to allow adsorption of the phage. The phage-bacterium mixture was then mixed with 6 ml of soft LB agar (0.75% agar) and poured onto the top of standard LB agar (1.5% agar) plates per the conventional double-layer agar method. Twenty individual clones were randomly selected and cultured in LB medium before being challenged with 10 μl (108 PFU) of phage PHB19. The sensitivities of the strains to the phage were assessed using the spot method. The sensitivities of the phage-resistant strains to Dep6 were assessed by the formation of semiclear spots, as described above.

Extraction of bacterial surface polysaccharides.

Bacterial surface polysaccharides were extracted and purified as described previously (29). Briefly, a 1-ml aliquot of an overnight bacterial culture was enriched and then resuspended in 150 μl of water. An equal volume of hot phenol (pH 6.6; Thermo Scientific) was added to the bacterial suspension, and the mixture was vortexed vigorously for 5 min. The mixture was then incubated at 65°C for 20 min before the addition of an equal volume of chloroform. The extracted EPS was lyophilized and stored at −20°C until use. An aliquot of the extracted EPS was separated by 12% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis, and the proteins were visualized by silver staining (Sigma).

Determination of the depolymerase’s stability.

The temperature and pH stability of the depolymerase were determined as described previously (23). Briefly, the lyophilized EPS was dissolved into different buffers, namely, 0.2 M sodium acetate buffer (pH 2.0 to 6.0), 0.2 M sodium phosphate buffer (pH 7 to 8), and 0.2 M Tris-HCl buffer (pH 9.0 to 12.0), to a final concentration of 4 mg/ml and incubated with 30 μg/ml Dep6 for 1 h at 37°C. The final reaction volume was 1 ml. The mixture incubated with the optimal-pH buffer was considered to exhibit 100% activity of Dep6. For the temperature sensitivity of Dep6, purified EPS mixed with Dep6 was added to the optimal-pH buffer at the equal concentrations mentioned above. Additionally, the mixture was tested at 20, 40, 50, 60, 70, and 80°C for 1 h. The final reaction volume was 1 ml. The mixture in optimal-pH buffer incubated at 37°C was considered to exhibit 100% activity of Dep6. The results of Dep6 activity were immediately determined by the 3,5-dinitrosalicylic acid (DNS) (Solarbio, Beijing, China) method. All the experiments were repeated at least three times, and the data are expressed as means ± standard deviations (SDs).

Extraction of bacterial LPS.

LPS was isolated using the hot-phenol–water method as previously described (44). LPS was lyophilized, weighed, and separated by 12% SDS-PAGE as described above.

Receptor analysis assay.

To explore whether phage PHB19 invasion of host bacteria is associated with LPS, we conducted inactivation assays using purified LPS with different O-antigen types and a blocking assay as previously described (17, 23), with minor modifications. For the inactivation assay, 100-μl aliquots of the various types of purified LPS (50 μg/ml) were mixed with 900-μl (∼5 × 103 PFU) volumes of PHB19 in 1 ml of SM buffer (5.8 g of NaCl, 2.0 g of MgSO4·7H2O, 50 ml of Tris-HCl [pH 7.4], 5.0 ml of 2% gelatin) and incubated for 30 min at 37°C. Following incubation, the phage titer in each of the mixtures was assessed using the double-layer agar method. For the blocking assay, 800 μl (∼2 × 107 CFU) of the STEC strain HB10 suspension was mixed with 100 μl of Dep6 (0.3 μg/μl), 100 μl of inactivated Dep6 (0.3 μg/μl), or an equal volume of PBS and incubated for 1 h at 37°C. A 100-μl aliquot of phage PHB19 was then added to each bacterial suspension to achieve a multiplicity of infection of 0.01, followed by incubation for 5 min at 37°C. The mixtures were then centrifuged at 12,000 × g for 30 s. PFU counts were obtained using the double-layer agar method. These assays were performed in triplicate.

Antibiofilm activity assay.

The effect of PHB19 and Dep6 on E. coli biofilms was assessed with 96-well microtiter plates or individual polystyrene plates as described previously (45–47). Briefly, E. coli biofilms were allowed to form in 96-well microtiter plates for 24 or 48 h at 37°C. Wells were then treated with 100 μl of PHB19 (107 PFU in PBS) or 100 μl of Dep6 (30 μg in PBS), and 100 μl of LB medium was added to each well. The plates were cultured at 37°C and 120 rpm for 4 h. Following incubation, biofilm degradation was evaluated by crystal violet staining as previously described (48, 49), and the OD of the wells was the measured at 590 nm using a spectrophotometer. The number of viable biofilm cells (CFU/cm2) was calculated by plate counting of 10-fold serial dilutions of the biofilm suspensions. The assay was performed in triplicate.

Serum sensitivity assay.

To evaluate the serum sensitivity, we used the sera of mice and healthy volunteers as previously described (19). Briefly, 100 μl (107 CFU) host bacteria mixed with Dep6 (30 μg/ml, final concentration) was incubated with the sera of mice and healthy volunteers (75% [vol/vol]) or heat-inactivated serum (95°C, 20 min) and PBS at 37°C for 2 h. Bacterial counts were determined by plating serial dilutions of cultures. This assay was repeated three times.

Hemolysis assay.

To assess the safety of the depolymerase, the ability of Dep6 to lyse human red blood cells was examined as previously described (12, 34). Briefly, 1 ml of blood from healthy volunteers (with serum removed) was washed three times with PBS (pH 7.4). The resulting red blood cells were resuspended in 1 ml of PBS. Aliquots (100 μl) of the red blood cell suspension were then mixed with 100 μl of Dep6 (0.3 μg/μl), PBS containing 0.1% (vol/vol) Triton X-100, or PBS alone and incubated at 37°C for 1 h with gentle shaking at 60 rpm. Red blood cells were then removed from the mixtures by centrifugation at 1,000 × g for 10 min, and the absorbance of the resulting supernatants was measured at 540 nm using a multimode microplate reader (10M; Tecan Spark). The assay was repeated three times.

Cytotoxicity assays.

A549 human lung carcinoma cells and 293T human embryonic kidney cells were used to evaluate the cytotoxicity of Dep6 in vitro. All cells were cultured in Dulbecco’s modified Eagle medium supplemented with 10% (vol/vol) fetal bovine serum (Gibco) at 37°C with 5% (vol/vol) CO2. For the cytotoxicity assays, cells were cultured in 96-well plates (5 × 103 cells/well) at 37°C for 24 h before being washed three times with PBS (pH 7.4). Dep6 (30 μg/ml, final concentration) or an equal volume of PBS was added to each well, and the plates were incubated at 37°C for 24 h. A 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) cell proliferation and cytotoxicity assay kit (Promega) was then used to assess cell viability and cytotoxicity, with measurements conducted at 490 nm. The assay was repeated three times.

Acute toxicity assay.

Five-week-old specific-pathogen-free BALB/c female mice (20 to 25 g in weight) were purchased from the Experimental Animal Centre of Huazhong Agricultural University, Wuhan, China. The ability of PHB19 or Dep6 to induce acute toxicity in mice was assessed as described previously (9). Briefly, the mice were inoculated intraperitoneally (i.p.) with 100 μl of Dep6 (0.3 μg/μl), 100 μl of PHB19 (108 PFU), or an equal volume of PBS. Each group of mice (n = 3) was then subjected to histopathological assessment at 7 days postinoculation. All animal procedures were performed with the approval of the Animal Welfare and Research Ethics Committee of Huazhong Agricultural University. Mice were sacrificed by CO2 asphyxiation at the end of the experiment.

Mouse infection assays.

STEC strain HB10 was used to generate the mouse infection model in this study. The MLD100 of strain HB10 was determined as described previously (9). Briefly, 100-μl aliquots of HB10 suspensions at different concentrations (5.0 × 106 CFU, 1.5 × 107 CFU, 3.0 × 107 CFU, 6.0 × 107 CFU, 1.2 × 108 CFU, and 5.0 × 108 CFU) were i.p. injected into separate groups of mice (n = 3 per group) (Fig. 9). A dose of 2× the MLD100 was used for the mouse challenge assays. For the infection assays, three groups of mice (n = 6 per group) were inoculated i.p. with 100 μl of Dep6 (0.3 μg/μl), 100 μl of PHB19 (108 PFU), or an equal volume of PBS near the left thigh. A 100-μl aliquot of the HB10 suspension (2.4 × 108 CFU) was then injected i.p. near the right thigh. To mimic a clinical treatment situation, we implemented three treatment methods, including one with mice prior to challenge (pretoxin [PT]; 3 h prior to challenge), one with treatment administered simultaneously with infection (ST), and one in which treatment was delayed (DT; 3 h postchallenge) (Fig. 10). Survival was then monitored daily for 21 days. Peripheral blood samples (∼15 μl) were obtained from the tail vein of each mouse in the delayed-treatment experiment (groups III, VI, VII, and VIII and a control group) for use in biochemical assessment assays.

FIG 9.

FIG 9

MLD100 scheme.

FIG 10.

FIG 10

Experimental scheme for the evaluation of Dep6 and phage PHB19 treatment efficacy in mice infected with STEC strain HB10.

To assess the mechanism of protection by Dep6 and PHB19 in mouse survival, challenge assays were set up as described above (groups I to VII), with three mice per group. All mice were then euthanized at 6 h postinoculation, and the amounts of HB10 and PHB19 present in kidney, spleen, lung, liver, blood, and heart tissues were measured as numbers of CFU per milliliter, CFU per gram, PFU per milliliter, or PFU per gram.

Blood biochemical assays.

Blood collected from mice at 24 h postinfection was centrifuged at 3,000 × g for 15 min to separate the serum. The abundances of tumor necrosis factor alpha (TNF-α), gamma interferon (IFN-γ), interleukin 6 (IL-6), and interleukin 1β (IL-1β) in the serum samples were determined by enzyme-linked immunosorbent assay (ELISA) using commercially available cytokine kits (LiankeBio).

Approval for use of animal subjects.

This study was approved by the Laboratory Animal Monitoring Committee of Huazhong Agricultural University and performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of Hubei Province, China (50).

Data availability.

The complete genome sequence of phage vB_EcoP_PHB19, with annotation, has been deposited in GenBank under accession number MN481365.

Supplementary Material

Supplemental file 1
AEM.00145-20-s0001.pdf (265.9KB, pdf)

ACKNOWLEDGMENTS

Y.C. drafted the main manuscript and performed the data analysis. Y.C., S.W., L.G., X.L., D.H., J.S., and D.G. planned and performed experiments. X.L., H.C., and P.Q. were responsible for experimental design. All authors reviewed the manuscript and agreed upon its publication.

This work was supported by grants from the National Program on Key Research Projects of China (2018YFD0500204), the Technology Base and Talents Special Program of Guangxi Province (2018AD09007), and the Natural Science Foundation of Hubei Province (2019CFA010).

We have no conflicts of interest to declare.

Footnotes

Supplemental material is available online only.

REFERENCES

  • 1.Kumar A, Taneja N, Kumar Y, Sharma M. 2012. Detection of Shiga toxin variants among Shiga toxin-forming Escherichia coli isolates from animal stool, meat and human stool samples in India. J Appl Microbiol 113:1208–1216. doi: 10.1111/j.1365-2672.2012.05415.x. [DOI] [PubMed] [Google Scholar]
  • 2.Hu Z, Rohde A, McMullen L, Ganzle M. 2019. Effect of sodium chloride and chitosan on the inactivation of heat resistant or Shiga-toxin producing Escherichia coli during grilling of burger patties. Int J Food Microbiol 308:108308. doi: 10.1016/j.ijfoodmicro.2019.108308. [DOI] [PubMed] [Google Scholar]
  • 3.Marder EP, Cieslak PR, Cronquist AB, Dunn J, Lathrop S, Rabatsky-Ehr T, Ryan P, Smith K, Tobin-D'Angelo M, Vugia DJ, Zansky S, Holt KG, Wolpert BJ, Lynch M, Tauxe R, Geissler AL. 2017. Incidence and trends of infections with pathogens transmitted commonly through food and the effect of increasing use of culture-independent diagnostic tests on surveillance—Foodborne Diseases Active Surveillance Network, 10 U.S. sites, 2013–2016. MMWR Morb Mortal Wkly Rep 66:397–403. doi: 10.15585/mmwr.mm6615a1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Tarr GAM, Oltean HN, Phipps AI, Rabinowitz P, Tarr PI. 2018. Strength of the association between antibiotic use and hemolytic uremic syndrome following Escherichia coli O157:H7 infection varies with case definition. Int J Med Microbiol 308:921–926. doi: 10.1016/j.ijmm.2018.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Buchholz U, Bernard H, Werber D, Böhmer MM, Remschmidt C, Wilking H, Deleré Y, An der Heiden M, Adlhoch C, Dreesman J, Ehlers J, Ethelberg S, Faber M, Frank C, Fricke G, Greiner M, Höhle M, Ivarsson S, Jark U, Kirchner M, Koch J, Krause G, Luber P, Rosner B, Stark K, Kühne M. 2011. German outbreak of Escherichia coli O104:H4 associated with sprouts. N Engl J Med 365:1763–1770. doi: 10.1056/NEJMoa1106482. [DOI] [PubMed] [Google Scholar]
  • 6.Coombes BK, Gilmour MW, Goodman CD. 2011. The evolution of virulence in non-O157 Shiga toxin-producing Escherichia coli. Front Microbiol 2:90. doi: 10.3389/fmicb.2011.00090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.del Pozo JL, Patel R. 2007. The challenge of treating biofilm-associated bacterial infections. Clin Pharmacol Ther 82:204–209. doi: 10.1038/sj.clpt.6100247. [DOI] [PubMed] [Google Scholar]
  • 8.Schooley RT, Biswas B, Gill JJ, Hernandez-Morales A, Lancaster J, Lessor L, Barr JJ, Reed SL, Rohwer F, Benler S, Segall AM, Taplitz R, Smith DM, Kerr K, Kumaraswamy M, Nizet V, Lin L, McCauley MD, Strathdee SA, Benson CA, Pope RK, Leroux BM, Picel AC, Mateczun AJ, Cilwa KE, Regeimbal JM, Estrella LA, Wolfe DM, Henry MS, Quinones J, Salka S, Bishop-Lilly KA, Young R, Hamilton T. 2017. Development and use of personalized bacteriophage-based therapeutic cocktails to treat a patient with a disseminated resistant Acinetobacter baumannii infection. Antimicrob Agents Chemother 61:e00954-17. doi: 10.1128/AAC.00954-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chen Y, Sun E, Yang L, Song J, Wu B. 2018. Therapeutic application of bacteriophage PHB02 and its putative depolymerase against Pasteurella multocida capsular type A in mice. Front Microbiol 9:1678. doi: 10.3389/fmicb.2018.01678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Gilmer DB, Schmitz JE, Euler CW, Fischetti VA. 2013. Novel bacteriophage lysin with broad lytic activity protects against mixed infection by Streptococcus pyogenes and methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother 57:2743–2750. doi: 10.1128/AAC.02526-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lin H, Paff ML, Molineux IJ, Bull JJ. 2018. Antibiotic therapy using phage depolymerases: robustness across a range of conditions. Viruses 10:622. doi: 10.3390/v10110622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Oliveira H, Costa AR, Ferreira A, Konstantinides N, Santos SB, Boon M, Noben JP, Lavigne R, Azeredo J. 2019. Functional analysis and antivirulence properties of a new depolymerase from a myovirus that infects Acinetobacter baumannii capsule K45. J Virol 93:e01163-18. doi: 10.1128/JVI.01163-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Latka A, Maciejewska B, Majkowska-Skrobek G, Briers Y, Drulis-Kawa Z. 2017. Bacteriophage-encoded virion-associated enzymes to overcome the carbohydrate barriers during the infection process. Appl Microbiol Biotechnol 101:3103–3119. doi: 10.1007/s00253-017-8224-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Majkowska-Skrobek G, Latka A, Berisio R, Squeglia F, Maciejewska B, Briers Y, Drulis-Kawa Z. 2018. Phage-borne depolymerases decrease Klebsiella pneumoniae resistance to innate defense mechanisms. Front Microbiol 9:2517. doi: 10.3389/fmicb.2018.02517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Olszak T, Shneider MM, Latka A, Maciejewska B, Browning C, Sycheva LV, Cornelissen A, Danis-Wlodarczyk K, Senchenkova SN, Shashkov AS, Gula G, Arabski M, Wasik S, Miroshnikov KA, Lavigne R, Leiman PG, Knirel YA, Drulis-Kawa Z. 2017. The O-specific polysaccharide lyase from the phage LKA1 tailspike reduces Pseudomonas virulence. Sci Rep 7:16302. doi: 10.1038/s41598-017-16411-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Broeker NK, Barbirz S. 2017. Not a barrier but a key: how bacteriophages exploit host’s O-antigen as an essential receptor to initiate infection. Mol Microbiol 105:353–357. doi: 10.1111/mmi.13729. [DOI] [PubMed] [Google Scholar]
  • 17.Washizaki A, Yonesaki T, Otsuka Y. 2016. Characterization of the interactions between Escherichia coli receptors, LPS and OmpC, and bacteriophage T4 long tail fibers. Microbiologyopen 5:1003–1015. doi: 10.1002/mbo3.384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Schmidt A, Rabsch W, Broeker NK, Barbirz S. 2016. Bacteriophage tailspike protein based assay to monitor phase variable glucosylations in Salmonella O-antigens. BMC Microbiol 16:207. doi: 10.1186/s12866-016-0826-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lin TL, Hsieh PF, Huang YT, Lee WC, Tsai YT, Su PA, Pan YJ, Hsu CR, Wu MC, Wang JT. 2014. Isolation of a bacteriophage and its depolymerase specific for K1 capsule of Klebsiella pneumoniae: implication in typing and treatment. J Infect Dis 210:1734–1744. doi: 10.1093/infdis/jiu332. [DOI] [PubMed] [Google Scholar]
  • 20.Hernandez-Morales AC, Lessor LL, Wood TL, Migl D, Mijalis EM, Cahill J, Russell WK, Young RF, Gill JJ. 2018. Genomic and biochemical characterization of Acinetobacter podophage petty reveals a novel lysis mechanism and tail-associated depolymerase activity. J Virol 92:e01064-17. doi: 10.1128/JVI.01064-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kim WS, Geider K. 2000. Characterization of a viral EPS-depolymerase, a potential tool for control of fire blight. Phytopathology 90:1263–1268. doi: 10.1094/PHYTO.2000.90.11.1263. [DOI] [PubMed] [Google Scholar]
  • 22.Lin H, Paff ML, Molineux IJ, Bull JJ. 2017. Therapeutic application of phage capsule depolymerases against K1, K5, and K30 capsulated E. coli in mice. Front Microbiol 8:2257. doi: 10.3389/fmicb.2017.02257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Oliveira H, Mendes A, Fraga AG, Ferreira A, Pimenta AI, Mil-Homens D, Fialho AM, Pedrosa J, Azeredo J. 2019. K2 capsule depolymerase is highly stable, is refractory to resistance, and protects larvae and mice from Acinetobacter baumannii sepsis. Appl Environ Microbiol 85:e00934-19. doi: 10.1128/AEM.00934-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Mushtaq N, Redpath MB, Luzio JP, Taylor PW. 2005. Treatment of experimental Escherichia coli infection with recombinant bacteriophage-derived capsule depolymerase. J Antimicrob Chemother 56:160–165. doi: 10.1093/jac/dki177. [DOI] [PubMed] [Google Scholar]
  • 25.Mushtaq N, Redpath MB, Luzio JP, Taylor PW. 2004. Prevention and cure of systemic Escherichia coli K1 infection by modification of the bacterial phenotype. Antimicrob Agents Chemother 48:1503–1508. doi: 10.1128/aac.48.5.1503-1508.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Popova AV, Shneider MM, Myakinina VP, Bannov VA, Edelstein MV, Rubalskii EO, Aleshkin AV, Fursova NK, Volozhantsev NV. 2019. Characterization of myophage AM24 infecting Acinetobacter baumannii of the K9 capsular type. Arch Virol 164:1493–1497. doi: 10.1007/s00705-019-04208-x. [DOI] [PubMed] [Google Scholar]
  • 27.European Food Safety Authority (EFSA) and European Centre for Disease Prevention and Control (ECDC). 2015. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food‐borne outbreaks in 2014. EFSA J 13:4329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Crim SM, Griffin PM, Tauxe R, Marder EP, Gilliss D, Cronquist AB, Cartter M, Tobin-D'Angelo M, Blythe D, Smith K, Lathrop S, Zansky S, Cieslak PR, Dunn J, Holt KG, Wolpert B, Henao OL, Centers for Disease Control and Prevention (CDC). 2015. Preliminary incidence and trends of infection with pathogens transmitted commonly through food—Foodborne Diseases Active Surveillance Network, 10 U.S. sites, 2006–2014. MMWR Morb Mortal Wkly Rep 64:495–499. [PMC free article] [PubMed] [Google Scholar]
  • 29.Hsieh PF, Lin HH, Lin TL, Chen YY, Wang JT. 2017. Two T7-like bacteriophages, K5-2 and K5-4, each encodes two capsule depolymerases: isolation and functional characterization. Sci Rep 7:4624. doi: 10.1038/s41598-017-04644-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Anand T, Bera BC, Virmani N, Vaid RK, Vashisth M, Tripathi BN. 2018. Isolation and characterization of a novel, T7-like phage against Aeromonas veronii. Virus Genes 54:160–164. doi: 10.1007/s11262-017-1517-0. [DOI] [PubMed] [Google Scholar]
  • 31.Veesler D, Cambillau C. 2011. A common evolutionary origin for tailed-bacteriophage functional modules and bacterial machineries. Microbiol Mol Biol Rev 75:423–433. doi: 10.1128/MMBR.00014-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Oliveira H, Costa AR, Konstantinides N, Ferreira A, Akturk E, Sillankorva S, Nemec A, Shneider M, Dotsch A, Azeredo J. 2017. Ability of phages to infect Acinetobacter calcoaceticus-Acinetobacter baumannii complex species through acquisition of different pectate lyase depolymerase domains. Environ Microbiol 19:5060–5077. doi: 10.1111/1462-2920.13970. [DOI] [PubMed] [Google Scholar]
  • 33.Welch TJ. 2019. Characterization of a novel Yersinia ruckeri serotype O1-specific bacteriophage with virulence-neutralizing activity. J Fish 43:285–293. doi: 10.1111/jfd.13124. [DOI] [PubMed] [Google Scholar]
  • 34.Liu Y, Leung SSY, Guo Y, Zhao L, Jiang N, Mi L, Li P, Wang C, Qin Y, Mi Z, Bai C, Gao Z. 2019. The capsule depolymerase Dpo48 rescues Galleria mellonella and mice from Acinetobacter baumannii systemic infections. Front Microbiol 10:545. doi: 10.3389/fmicb.2019.00545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Gutiérrez D, Briers Y, Rodríguez-Rubio L, Martínez B, Rodríguez A, Lavigne R, García P. 2015. Role of the pre-neck appendage protein (Dpo7) from phage vB_SepiS-phiIPLA7 as an anti-biofilm agent in Staphylococcal species. Front Microbiol 6:1315. doi: 10.3389/fmicb.2015.01315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Guo Z, Huang J, Yan G, Lei L, Wang S, Yu L, Zhou L, Gao A, Feng X, Han W, Gu J, Yang J. 2017. Identification and characterization of Dpo42, a novel depolymerase derived from the Escherichia coli phage vB_EcoM_ECOO78. Front Microbiol 8:1460. doi: 10.3389/fmicb.2017.01460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Islam MS, Zhou Y, Liang L, Nime I, Liu K, Yan T, Wang X, Li J. 2019. Application of a phage cocktail for control of Salmonella in foods and reducing biofilms. Viruses 11:841. doi: 10.3390/v11090841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Chen Y, Sun E, Song J, Tong Y, Wu B. 2018. Three Salmonella enterica serovar Enteritidis bacteriophages from the Siphoviridae family are promising candidates for phage therapy. Can J Microbiol 64:865–875. doi: 10.1139/cjm-2017-0740. [DOI] [PubMed] [Google Scholar]
  • 39.Cha Y, Son B, Ryu S. 2019. Effective removal of staphylococcal biofilms on various food contact surfaces by Staphylococcus aureus phage endolysin LysCSA13. Food Microbiol 84:103245. doi: 10.1016/j.fm.2019.103245. [DOI] [PubMed] [Google Scholar]
  • 40.Pennone V, Sanz-Gaitero M, O’Connor P, Coffey A, Jordan K, van Raaij MJ, McAuliffe O. 2019. Inhibition of L. monocytogenes biofilm formation by the amidase domain of the phage vB_LmoS_293 endolysin. Viruses 11:E722. doi: 10.3390/v11080722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Chen Y, Li X, Song J, Yang D, Liu W, Chen H, Wu B, Qian P. 2019. Isolation and characterization of a novel temperate bacteriophage from gut-associated Escherichia within black soldier fly larvae (Hermetia illucens L. [Diptera: Stratiomyidae]). Arch Virol 164:2277–2284. doi: 10.1007/s00705-019-04322-w. [DOI] [PubMed] [Google Scholar]
  • 42.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30:2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Chen Y, Yang L, Sun E, Song J, Wu B. 2019. Characterisation of a newly detected bacteriophage infecting Bordetella bronchiseptica in swine. Arch Virol 164:33–40. doi: 10.1007/s00705-018-4034-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Marolda CL, Welsh J, Dafoe L, Valvano MA. 1990. Genetic analysis of the O7-polysaccharide biosynthesis region from the Escherichia coli O7:K1 strain VW187. J Bacteriol 172:3590–3599. doi: 10.1128/jb.172.7.3590-3599.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Issa R, Chanishvili N, Caplin J, Kakabadze E, Bakuradze N, Makalatia K, Cooper I. 2019. Antibiofilm potential of purified environmental bacteriophage preparations against early stage Pseudomonas aeruginosa biofilms. J Appl Microbiol 126:1657–1667. doi: 10.1111/jam.14241. [DOI] [PubMed] [Google Scholar]
  • 46.Milho C, Silva MD, Alves D, Oliveira H, Sousa C, Pastrana LM, Azeredo J, Sillankorva S. 2019. Escherichia coli and Salmonella Enteritidis dual-species biofilms: interspecies interactions and antibiofilm efficacy of phages. Sci Rep 9:18183. doi: 10.1038/s41598-019-54847-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Wu Y, Wang R, Xu M, Liu Y, Zhu X, Qiu J, Liu Q, He P, Li Q. 2019. A novel polysaccharide depolymerase encoded by the phage SH-KP152226 confers specific activity against multidrug-resistant Klebsiella pneumoniae via biofilm degradation. Front Microbiol 10:2768. doi: 10.3389/fmicb.2019.02768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.O’Toole GA, Kolter R. 1998. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol 28:449–461. doi: 10.1046/j.1365-2958.1998.00797.x. [DOI] [PubMed] [Google Scholar]
  • 49.O’Toole GA. 2011. Microtiter dish biofilm formation assay. J Vis Exp 2011:2437. doi: 10.3791/2437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Laboratory Animal Monitoring Committee of Huazhong Agricultural University. 2015. Guide for the care and use of laboratory animals. Huazhong Agricultural University, Hubei Province, China. [Google Scholar]
  • 51.Sharma G, Sharma S, Sharma P, Chandola D, Dang S, Gupta S, Gabrani R. 2016. Escherichia coli biofilm: development and therapeutic strategies. J Appl Microbiol 121:309–319. doi: 10.1111/jam.13078. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
AEM.00145-20-s0001.pdf (265.9KB, pdf)

Data Availability Statement

The complete genome sequence of phage vB_EcoP_PHB19, with annotation, has been deposited in GenBank under accession number MN481365.


Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES