Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2020 Apr 17;86(9):e00130-20. doi: 10.1128/AEM.00130-20

Autotoxic Ginsenoside Disrupts Soil Fungal Microbiomes by Stimulating Potentially Pathogenic Microbes

Yunlong Li a,#, Shenyan Dai a,#, Baoying Wang a, Yuting Jiang a, Yanyu Ma a, Leilv Pan a, Kai Wu d, Xinqi Huang a,b,f, Jinbo Zhang a,b,c,e, Zucong Cai a,b,c,e,f, Jun Zhao a,b,c,e,f,✉
Editor: Claire Vieilleg
PMCID: PMC7170491  PMID: 32086303

Sanqi ginseng [Panax notoginseng (Burk.) F. H. Chen] is geoauthentically produced in a restricted area of southwest China, and successful replanting requires a rotation cycle of more than 15 to 30 years. The increasing demand for Sanqi ginseng and diminishing arable land resources drive farmers to employ consecutive monoculture systems. Replant failure has severely threatened the sustainable production of Sanqi ginseng and causes great economic losses annually. Worse still, the acreage and severity of replant failure are increased yearly, which may destroy the Sanqi ginseng industry in the near future. The significance of this work is to decipher the mechanism of how autotoxic ginsenosides promote the accumulation of soilborne pathogens and disrupt the equilibrium of soil fungal microbiomes. This result may help us to develop effective approaches to successfully conquer the replant failure of Sanqi ginseng.

KEYWORDS: allelopathic effect, autotoxic ginsenosides, fungal disequilibrium, Panax notoginseng, soilborne pathogen

ABSTRACT

Autotoxic ginsenosides have been implicated as one of the major causes for replant failure of Sanqi ginseng (Panax notoginseng); however, the impact of autotoxic ginsenosides on the fungal microbiome, especially on soilborne fungal pathogens, remains poorly understood. In this study, we aimed to investigate the influence of the ginsenoside monomers Rg1, Rb1, and Rh1, and that of their mixture (Mix), on the composition and diversity of the soil fungal community, as well as on the abundance and growth of the soilborne pathogen Fusarium oxysporum in pure culture. The addition of autotoxic ginsenosides altered the composition of the total fungal microbiome, as well as the taxa within the shared and unique treatment-based components, but did not alter alpha diversity (α-diversity). In particular, autotoxic ginsenosides enriched potentially pathogenic taxa, such as Alternaria, Cylindrocarpon, Gibberella, Phoma, and Fusarium, and decreased the abundances of beneficial taxa such as Acremonium, Mucor, and Ochroconis. Relative abundances of pathogenic taxa were significantly and negatively correlated with those of beneficial taxa. Among the pathogenic fungi, the genus Fusarium was most responsive to ginsenoside addition, with the abundance of Fusarium oxysporum consistently enhanced in the ginsenoside-treated soils. Validation tests confirmed that autotoxic ginsenosides promoted mycelial growth and conidial germination of the root rot pathogen F. oxysporum. In addition, the autotoxic ginsenoside mixture exhibited synergistic effects on pathogen proliferation. Collectively, these results highlight that autotoxic ginsenosides are capable of disrupting the equilibrium of fungal microbiomes through the stimulation of potential soilborne pathogens, which presents a significant hurdle in remediating replant failure of Sanqi ginseng.

IMPORTANCE Sanqi ginseng [Panax notoginseng (Burk.) F. H. Chen] is geoauthentically produced in a restricted area of southwest China, and successful replanting requires a rotation cycle of more than 15 to 30 years. The increasing demand for Sanqi ginseng and diminishing arable land resources drive farmers to employ consecutive monoculture systems. Replant failure has severely threatened the sustainable production of Sanqi ginseng and causes great economic losses annually. Worse still, the acreage and severity of replant failure are increased yearly, which may destroy the Sanqi ginseng industry in the near future. The significance of this work is to decipher the mechanism of how autotoxic ginsenosides promote the accumulation of soilborne pathogens and disrupt the equilibrium of soil fungal microbiomes. This result may help us to develop effective approaches to successfully conquer the replant failure of Sanqi ginseng.

INTRODUCTION

Sanqi ginseng [Panax notoginseng (Burk.) F. H. Chen] is a highly valuable medicinal herb, as its bioactive compounds have manifold benefits to human health (1). However, the production of Sanqi ginseng has been seriously restricted by replant failure that is driven by several mechanisms, e.g., the accumulation of allelochemical compounds and soilborne pathogens, soil nutrient imbalances, and the deterioration of soil physicochemical properties (2, 3). As these biotic and abiotic obstacles coexist and interact with one another, replant failure is especially difficult to cure (4, 5). Therefore, understanding the formation mechanisms of these biotic and abiotic obstacles and deciphering their inherent interactions may allow for the development of suitable approaches to successfully overcome replant failure of Sanqi ginseng.

The accumulation of host-specific phytopathogens is one of the key biotic obstacles underlying replant failure and likely leads to severe disease incidence, with concomitant declines in yield (6, 7). For example, the relative abundance of the pathogen Fusarium oxysporum increased continually over replanted continuous cropping years and was positively correlated with the death rate of Sanqi ginseng (8). Root rot caused by various fungal pathogens, such as Fusarium spp., Phoma spp., Alternaria spp., Cylindrocarpon spp., etc., has been reported as one of the most severe soilborne diseases that hinders the replantation of Sanqi ginseng (9–11). An increasing body of evidence suggests that the accumulation of plant pathogens is often at the expense of decreasing abundances of beneficial fungal taxa, which can ultimately result in microbiome disequilibrium, followed by the outbreak of soilborne disease (12, 13). Plant secondary metabolites are also capable of structuring soil fungal microbiomes (14, 15). Luo et al. (16) observed that fungal pathogens such as F. oxysporum, Fusarium solani, and Monographella cucumerina were significantly enriched, while the beneficial fungal genera Trichoderma, Acremonium, Aspergillus, and Ochroconis depleted in response to root secretions of Sanqi ginseng seedlings. However, there is still a lack of direct evidence for the responses of soilborne pathogens and fungal diversity to Sanqi ginseng phytochemicals.

The accumulation of allelochemical substances is considered one of the primary abiotic factors that underlies replant issues among diverse medicinal plants, such as American ginseng (Panax quinquefolium L.), false starwort [Pseudostellaria heterophylla (Miq.) Pax], Chinese foxglove [Rehmannia glutinosa (Gaertn.) Steud.], etc. (13, 17, 18). Phenols and terpenoids are some of the major allelochemical compounds produced by medicinal herbs (19). The direct influences of phenols on soil fungal microbiomes and soilborne pathogens have been extensively studied (18, 20, 21). For example, vanillic acid was found to shift soil fungal community structure, principally by modulating both the composition and diversity of Fusarium spp. and Trichoderma spp. (21), while mixed phenolic acids have been shown to stimulate the proliferation of the soilborne pathogens Talaromyces helices and Kosakonia sacchari in the rhizosphere soil of monocropped Radix pseudostellariae (13). However, understanding of how terpenoids affect soil fungal microbiomes and soilborne pathogens remains limited. Ginsenosides, a special group of triterpenoid saponins, are the primary biologically active compounds of Sanqi ginseng and are allelopathic stimulators that induce mycelial growth of soilborne pathogens such as Phytophthora cactorum and Pythium irregulare (22, 23). Therefore, we hypothesized that ginsenosides will stimulate potential soilborne pathogens and alter soil fungal community composition. Since the utilization efficiencies of different monomers of ginsenoside (Rg1, Rb1, Rb2, Re, Rc, and Rd) are known to differ between F. solani and F. oxysporum (24), we reasoned that different ginsenosides were capable of reassembling distinct fungal microbiomes.

The objectives of this study were (i) to evaluate the effects of autotoxic ginsenosides on soil fungal diversity and community composition, (ii) to decipher the potential responses of soil pathogenic taxa and beneficial taxa to the addition of ginsenosides, and (iii) to determine whether mixtures of ginsenosides exhibit synergistic effects on pathogen proliferation. To address these objectives, ginsenosides Rg1, Rb1, and Rh1 were selected; their autotoxicities were confirmed by a previous study (22) and our preliminary experiment (data not shown). High-performance liquid chromatography (HPLC) analysis and molecular techniques (high-throughput sequencing and real-time PCR) were used to investigate the changes in ginsenoside content, pathogen abundance, and fungal community structure.

RESULTS

Recovery and utilization rates of ginsenosides and total microbial activity.

HPLC analysis showed that the absorption capacities of soil particles for different ginsenoside monomers were significantly different (P < 0.05), with the recovery rates being 40.5, 55.6, and 59.6% for Rg1, Rb1, and Rh1, respectively (see Table S1 in the supplemental material). Similarly, the utilization efficiencies of soil microorganisms of different type of ginsenosides were significantly different (P < 0.05), with the utilization rate being highest for Rh1, followed by those for Rb1 and Rg1, after the 4-week incubation (Table 1). Only ginsenoside Rg1 was detected in the Rg1, Rb1, and Rh1 mixture (Mix) treatment, with a utilization rate of 50.1% (Table 1; see also Table S2 in the supplemental material).

TABLE 1.

The utilization rate of ginsenosides and soil total microbial activity under different treatments after a 4-week incubation

Treatmentc Utilization ratea ,b (%) Microbial activity of fluorescein (μg · g−1 · h−1)a
CK 4.29 ± 0.08 D
Rg1 31.5 ± 0.6 D 6.68 ± 0.01 B
Rb1 43.7 ± 0.8 C 6.01 ± 0.14 C
Rh1 54.5 ± 0.4 A 5.86 ± 0.19 C
Mix 50.1 ± 0.1 B 8.33 ± 0.28 A
a

Values (means ± SE, n =3) within the same column followed by different letters are significantly different at P < 0.05 according to Duncan’s multiple range test.

b

The utilization rate of ginsenosides in the “Mix” treatment was calculated based on the average value of Rg1, Rb1, and Rh1.

c

Treatment abbreviations: CK, nonsterilized soil supplemented with sterile water; Rg1, Rb1, Rh1, and Mix, nonsterilized soils supplemented with ginsenoside monomers Rg1, Rb1, Rh1, and a mixture of Rg1, Rb1, and Rh1, respectively, to a final concentration of 6 μg · g−1 dry soil.

Compared to the CK (preincubated soils supplemented with sterile water only) treatment, the addition of ginsenosides significantly (P < 0.05) increased soil microbial activity after the 4-week incubation (Table 1). Microbial activity (as measured in the fluorescein diacetate hydrolysis assay) in the Mix-treated soil was significantly (P < 0.05) higher than those in the ginsenoside Rg1-, Rb1-, and Rh1-treated soils.

Fungal abundance, α-diversity, and β-diversity.

In general, fungal abundances were significantly (P < 0.05) higher in the ginsenoside-treated soils than in the CK soil, and were also significantly (P < 0.05) higher in the Mix-treated soil than in the Rg1- and Rb1-treated soils (Fig. 1A). No significant differences were observed between the ginsenoside-treated soils and the CK soil for fungal richness, Shannon diversity and Pielou’s evenness (Fig. 1B to D).

FIG 1.

FIG 1

Fungal abundance (A) revealed by real-time PCR; richness (B), Shannon diversity (C), and evenness (D) calculated based on the rarefied operational taxonomic unit (OTU) table at a depth of 44,000 sequences per sample generated by MiSeq sequencing in different treatments. Error bars indicate the standard errors of the means of three replicates. Different letters represent significant differences at a P value of <0.05 according to Duncan’s multiple range test. Treatment abbreviations: CK, nonsterilized soil supplemented with sterile water; Rg1, Rb1, Rh1, and Mix, nonsterilized soils supplemented with ginsenoside monomers Rg1, Rb1, Rh1, and a mixture of Rg1, Rb1, and Rh1, respectively, to a final concentration of 6 μg · g−1 dry soil.

Unlike the results of fungal α-diversity, the addition of ginsenosides significantly (permutational multivariate analysis of variance [PERMANOVA], P < 0.05) altered soil fungal community structure, with the effects differing with the ginsenoside type (Fig. 2A).

FIG 2.

FIG 2

Principal-coordinate analysis of the fungal community (A), average relative abundances of the top 15 fungal genera (B), shared OTUs (C), and unique OTUs (D). The key from blue to red represents the least abundant to most abundant in each row for a given genus. The numbers in each treatment represent the relative abundance of a given genus. *, P < 0.05; **, P < 0.01; significantly different according to the Duncan’s multiple range test. The treatment abbreviations are defined in the Fig. 1 legend.

Fungal community composition.

The alteration in fungal community composition was most pronounced at the genus level, rather than at the phylum and class levels (Fig. 2B; see also Fig. S2 in the supplemental material). In particular, the relative abundance of the genus Fusarium was significantly (P < 0.01) enhanced in the Mix-treated soil (7.33%), followed by those in the Rh1- (2.90%), Rb1- (0.91%), and Rg1-treated soils (0.77%) compared to the CK soil (0.50%) (Fig. 2B). The magnitudes of the increases and decreases in relative abundances of fungal genera differed with the type of ginsenoside applied.

The addition of ginsenosides altered the abundance and composition of the shared and unique fungal microbiomes (Table 2 and Fig. 2C and D). Overall, the total numbers of unique and shared operational taxonomic units (OTUs) in all treatments were 235 and 127, which accounted for 33.9 and 18.3%, respectively, of the total number of retained OTUs (n = 693) (Table 2). The percentage of shared OTUs among the retained OTUs decreased markedly from the CK soil (51.6%) to the Rg1- (32.5%), Rb1- (31.2%), Rh1- (25.4%), and Mix-treated (36.9%) soils, with the proportion of the sequences belonging to shared OTUs to retained sequences declining from 58.0% in the CK soil to 43.7 to 50.6% in the ginsenoside-treated soils (Table 2, Table S3). Conversely, the number of treatment-unique OTUs increased considerably in the Rg1- (n = 41), Rb1- (n = 37), Rh1- (n = 103), and Mix-treated (n = 39) soils compared with the CK soil (n = 15) (Table 2). The proportion of the number of sequences belonging to these unique OTUs to the number of retained sequences increased from 0.37% in the CK soil to 0.87 to 3.97% in the ginsenoside-treated soils (see Table S3 in the supplemental material).

TABLE 2.

The number of unique OTUs for each treatment and overlapped OTUs for every pair of treatments per 44,000 sequencesb

Treatmentc No. of OTUs for:
CK Rg1 Rb1 Rh1 Mix
CK 15a
Rg1 187 41
Rb1 194 289 37
Rh1 195 311 335 103
Mix 161 243 260 276 39
Shared OTUs 127 127 127 127 127
Total OTUs 246 391 407 500 344
a

Only the OTUs present in all biological replicates of each treatment were retained for analyses.

b

Boldface type represents unique OTUs in each treatment, and italic type represents overlapped OTUs between two treatments.

c

The treatment abbreviations are defined in Table 1, footnote c.

Sequences that belonged to the shared OTUs (23.8 to 49.3%) were affiliated with 16 fungal genera. Among these taxa, the relative abundances of Alternaria, Clonostachys, Mortierella, and Trichoderma differed significantly (P < 0.05) among treatments (Fig. 2C). Different types of ginsenosides exhibited distinct impacts on the fungal shared microbiomes. For instance, the relative abundances of Cryptococcus, Cylindrocarpon, and Fusarium were highest in the Rh1-treated soil, whereas the relative abundances of Alternaria, Mortierella, Pseudophialophora, and Trichoderma were highest in the Mix-treated soil (Fig. 2C). In addition, 15.3 to 46.1% of the sequences that belonged to the treatment-unique OTUs were clustered into 39 fungal genera, with the CK, Rg1-, Rb1-, Rh1-, and Mix-treated soils harboring 2, 12, 10, 14, and 13 unique genera, respectively (Fig. 2D; see also Table S4 in the supplemental material), indicating that the ginsenoside-treated soils were capable of assembling a more diverse unique microbiome than the CK soil. These results strongly suggest that the addition of ginsenosides markedly shaped the soil fungal microbiome, principally by impacting the composition of shared and unique fungal taxa.

Fungal functional predictions via FUNGuild.

In general, ginsenoside addition induced changes in the relative abundances of potential pathogenic and beneficial fungal groups. Such changes were associated with the type of ginsenoside applied (Fig. 3A and B). In particular, the relative abundance of potentially pathogenic taxa increased from 7.19% in the CK soil to 11.7 to 21.8% in the ginsenoside-treated soils, and it was significantly (P < 0.05) higher in the Rg1- and Mix-treated soils than in the CK soil (Fig. 3A). In contrast, the relative abundance of potentially beneficial taxa declined in the ginsenoside-treated soils (in comparison to the CK soil), with a significant (P < 0.05) reduction in the Mix-treated soil (Fig. 3B). No significant differences were observed for the relative abundance of beneficial fungal taxa among the ginsenoside-treated soils. The ratio of Fusarium to Trichoderma in the Rh1-treated soil was significantly higher (P < 0.05) than that in the CK soil, and the ratio of Fusarium to Mortierella in the Rh1- and Mix-treated soils was significantly higher (P < 0.05) than that in the CK soil (see Fig. S3 in the supplemental material), suggesting that ginsenoside stimulation of the genus Fusarium was more effective than that of Trichoderma and Mortierella.

FIG 3.

FIG 3

Changes in relative abundances of potential pathogenic fungal genera (A) and beneficial fungal genera (B) as predicted by FUNGuild; logarithm regression relationships between the relative abundances of potentially pathogenic and beneficial fungal genera (C); and Spearman’s correlations between potentially pathogenic and beneficial fungal genera (D). The key from red to green represents the negative correlation to positive correlation. Different letters represent significant differences at P < 0.05 according to Duncan’s multiple range test. *, P < 0.05; **, P < 0.01. The treatment abbreviations are defined in the Fig. 1 legend.

Logarithmic regression analysis revealed that the cumulative relative abundances of potential pathogenic fungal groups were negatively and significantly (P < 0.05) correlated with the cumulative relative abundances of beneficial fungal taxa (Fig. 3C), thus indicating that the increase of pathogenic taxa induced by ginsenoside addition may indirectly negatively impact the function of beneficial fungal taxa by reducing the relative proportion of these taxa. Relative abundances of individual pathogenic fungal genera also exhibited significantly (P < 0.05) negative relationships with those of the individual beneficial taxa (Fig. 3D). For instance, the relative abundance of Alternaria was significantly (P < 0.05) negatively correlated with the relative abundance of Ypsilina, while the relative abundance of Fusarium was significantly (P < 0.05) negatively correlated with the relative abundance of Ochroconis. The relative abundance of Phoma was significantly (P < 0.05) negatively correlated with the relative abundances of Acremonium, Myxocephala, and Ochroconis, while the relative abundance of Clonostachys was significantly (P < 0.05) negatively correlated with the relative abundance of Mucor.

Abundance of potential pathogens.

After the 4-week incubation, the population size of F. oxysporum increased significantly (P < 0.05) in the ginsenoside-treated soils compared to the CK soil, with an abundance significantly (P < 0.05) higher in the Rh1- and Mix-treated soils than in the Rg1- and Rb1-treated soils (Fig. 4A). Similarly, the population size of F. solani was significantly (P < 0.05) higher in the Mix-treated soil, whereas the Rg1-, Rb1-, and Rh1-treated soils showed no significant differences compared to CK soil (Fig. 4B). The abundance of F. solani in the Rh1- and Mix-treated soils was significantly (P < 0.05) higher than that in the Rg1-treated soil. No significant differences were observed among treatments for the population sizes of Alternaria and Cylindrocarpon (Fig. 4C and D). However, the population size of Alternaria increased significantly (t test; P < 0.05) in the Mix-treated soil compared with that in the CK soil. The ratio of F. oxysporum to total fungi increased significantly (P < 0.05) in the Rh1- and Mix-treated soils, while the ratios of F. solani to fungi and F. oxysporum and F. solani to fungi were significantly (P < 0.05) higher only in the Mix-treated soil than in the CK soil (see Fig. S4A to B and D in the supplemental material). The abundance of the genus Fusarium (F. oxysporum and F. solani tested in this study) was highest in the Mix-treated soil, followed by the Rh1-, Rb1-, Rg1-, and CK soils (Fig. S4C).

FIG 4.

FIG 4

The populations of Fusarium oxysporum (A), Fusarium solani (B), Alternaria (C), and Cylindrocarpon (D) in different treatments. Error bars indicate the standard errors of the means of three replicates. Different letters represent significant differences at P < 0.05 according to Duncan’s multiple range test. The treatment abbreviations are defined in the Fig. 1 legend.

Mycelial growth and conidial germination rate of F. oxysporum.

Based on the results of MiSeq sequencing and real-time PCR, F. oxysporum was identified as the root rot pathogen of Sanqi ginseng that was most responsive to ginsenoside addition. Therefore, the effects of ginsenosides (Rg1, Rb1, Rh1, and Mix) on the growth and conidial germination of F. oxysporum were tested. Overall, the growth of the Sanqi ginseng root rot pathogen F. oxysporum was promoted by ginsenoside addition during the 120 h of incubation, with a weakened effect over time (Fig. 5A). In particular, the Rb1 and Mix additions significantly (P < 0.01) promoted the growth of F. oxysporum at 48 h, while the Rb1, Rh1, and Mix treatments significantly (P < 0.05) enhanced the growth of F. oxysporum at 72 h, compared to the CK treatment (Fig. 5A). After incubation for 96 h, no significant differences in mycelial growth were observed among treatments. Compared to the control, the conidial germination rate was significantly (P < 0.05) enhanced by the ginsenoside treatment for 12 h (Fig. 5B). Conidial germination rate was highest in the Mix treatment and was significantly (P < 0.05) higher than those for the Rg1, Rb1, and Rh1 treatments.

FIG 5.

FIG 5

Mycelial growth (A) and conidial germination rate (B) of F. oxysporum in different treatments. Error bars indicate the standard errors of the means of three replicates. Different letters represent significant differences at P < 0.05 according to Duncan’s multiple range test. *, P < 0.05; **, P < 0.01. The treatment abbreviations are defined in the Fig. 1 legend.

DISCUSSION

Autotoxicity caused by allelochemical compounds has been shown to be one of the major factors leading to the replant failure of medicinal plants such as American ginseng, Chinese foxglove, and Sanqi ginseng (17, 18, 22). Ginsenosides, considered to be the primary allelochemical compounds of Sanqi ginseng, are known to exhibit strong negative impacts on seedling germination and growth (22). In the present study, we attempted to discern the potential allelopathic effects of autotoxic ginsenosides on soil fungal microbiomes, especially in the context of potential soilborne pathogens.

Autotoxic ginsenosides promoted fungal abundance and microbial activity.

In this study, soil fungal abundance and microbial activity increased significantly in the ginsenoside-treated soil. This is similar to a previous finding (25) that soil metabolic activity, assessed by Biolog assay, was stimulated by the addition of ginsenoside mixtures. It is likely that several specific microbial groups activated by autotoxic ginsenosides can not only metabolize ginsenosides but also hydrolyze fluorescein diacetate (26, 27). In addition, high microbial activity induced by autotoxic ginsenosides can also be influenced by significant increases in fungal population abundances. Soil microbial activity is widely used as a biological indicator of soil functions (28), thus indicating that the ginsenoside addition could enhance soil functions.

Autotoxic ginsenosides significantly altered fungal community structure but not α-diversity.

In the present study, the fungal α-diversity remained unchanged in response to autotoxic ginsenosides, inconsistent with a recent study that reported the fungal diversity was significantly higher in the rhizosphere soils of Sanqi ginseng (16). This difference may be attributed to a more abundant and diverse composition of plant root exudates that supports a more diverse rhizospheric fungal community (15, 29). This is supported by an observed stimulation of fungal diversity in the presence of plants and coumarin application compared to that with coumarin addition alone (30).

Unlike fungal diversity, fungal community composition was significantly altered by autotoxic ginsenosides (Fig. 2A). The combination of the fungal diversity and composition results allows the inference that autotoxic ginsenosides could stimulate several specific fungal taxa while inhibiting others. Specially, the shared and unique fungal microbiome taxa were dramatically influenced by the type of autotoxic ginsenoside (Fig. 2C and D). In particular, ginsenoside-treated soils exhibited unique fungal microbiomes characterized by higher diversities, and the compositions of these unique microbiomes were heavily reliant on the type of ginsenoside used (Fig. 2D). This ginsenoside-specific effect is likely due to different chemical structures that exert distinct selective effects on the assembly of soil fungal microbiomes (1).

Autotoxic ginsenosides specifically enriched the potential pathogen of Sanqi ginseng.

Increasing lines of evidence indicate that allelochemical substances enable the stimulation and proliferation of soilborne pathogens (13, 21, 23), one of the biotic mechanisms underlying replant failure (7). In this study, we observed that the relative abundances of the genera Clonostachys, Fusarium, Gibberella, Phoma, Cylindrocarpon, Ilyonectria, and Periconia were increased in the ginsenoside-treated soils compared to those in the CK soil (Fig. 2B and 3A). Members of the Fusarium genus, such as F. oxysporum and F. solani, are known as common soilborne pathogens that can cause root rot disease of Sanqi ginseng (10, 11). Similarly, Phoma spp., Cylindrocarpon spp., and Ilyonectria spp. are reported as causal pathogens of Sanqi ginseng root rot disease and are always enriched in the rhizosphere soil of Sanqi ginseng seedlings (9, 11, 31, 32). Members of the genus Clonostachys are reported to cause root rot disease, and their relative abundance was remarkably higher in the monocropped soils of Sanqi ginseng than that in in maize-Sanqi ginseng rotated soils (3, 33).

Besides the consistently increased abundances of some taxa that were observed in all ginsenoside-treated soils, the relative abundances of Alternaria and Pestalotiopsis were only enriched in the Rg1- and Mix-treated soils (Fig. 3A). Previous studies demonstrated that Alternaria spp. and Pestalotiopsis spp. could contribute to root rot disease of Sanqi ginseng, and they are thereby considered obstacles in the continuous cropping of Sanqi ginseng (9, 11). This outcome indicates that the allelopathic effect of ginsenosides varies not only due to the type of ginsenosides but also due to the type of soilborne pathogen. Moreover, the population sizes of F. oxysporum and F. oxysporum plus F. solani were significantly higher in the ginsenoside-treated soils, consistent with the relative abundance of genus Fusarium. These results together suggest that autotoxic ginsenosides specifically enrich the potential pathogens of Sanqi ginseng, with the genus Fusarium being the most responsive. This is supported by the promotion of mycelial growth and the conidial germination rate of root rot pathogen F. oxysporum by ginsenoside application (Fig. 5) and by a previous study in which soilborne pathogens were stimulated by ginsenosides (23).

Autotoxic ginsenosides potentially inhibited the growth of beneficial taxa and disrupted fungal equilibrium.

In addition to the stimulation of soilborne pathogens, autotoxic ginsenosides also inhibited the growth of several beneficial microorganisms, such as Acremonium, Dictyochaeta, and Mucor (Fig. 3B). Members of the genus Acremonium have been shown to exhibit antimicrobial activity against soilborne pathogens of Sanqi ginseng root rot disease (34, 35), possibly by the production of antifungal compounds. Grunewaldt-Stöcker and von Alten (36) demonstrated that the preinoculation of roots with the endophyte Acremonium could significantly reduce the incidence and severity of Fusarium wilt disease in tomato and flax, principally by triggering the systemic resistance of the host plant. Similarly, Mucor spp. were isolated from the roots of Sanqi ginseng and exerted antimicrobial activity against Alternaria (35), which may act as a potential biological control agent against Sanqi ginseng root rot disease. The genus Dictyochaeta, known as a prevalent endophytic fungus, is able to produce a mixture of volatile organic compounds that are lethal to plant-pathogenic fungi and bacteria (37).

The relative abundance of Mortierella increased in the Rh1- and Mix-treated soils, while that of Trichoderma increased only in the Mix-treated soil (Fig. 2B). Members of the genus Mortierella are known to produce various antibiotics to suppress soilborne pathogens and are considered one of the important disease-suppressive agents (38). Trichoderma spp. are ubiquitous soil fungi that exhibit effective antagonism toward a variety of plant pathogens via the production of enzymes and antibiotics, as well as through mycoparasitism (39). Moreover, the ratios of Fusarium to Mortierella and Fusarium to Trichoderma were higher in the Rh1- and Mix-treated soils than in the CK soil (Fig. S3). This suggests that some common beneficial fungi are also stimulated by ginsenoside addition, although the promotion effect appears to be much weaker than that of the potential soilborne pathogens. Thus, autotoxic ginsenosides indirectly negatively impacted the function of beneficial fungal taxa by reducing the relative proportion of these taxa within the context of the whole fungal community. Collectively, autotoxic ginsenosides are capable of disrupting the equilibrium of soil fungal microbiota, principally through the stimulation of pathogenic taxa and the inhibition of beneficial taxa. It is well recognized that the winner of conflicts between phytopathogens and plant-beneficial microbes determines soil health and plant performance (7, 40). Hence, further studies are still needed to investigate the impacts of the ginsenoside-induced fungal microbiota on plant health.

An autotoxic ginsenoside mixture had a synergistic effect on pathogen proliferation.

It has been recognized that the combined actions of different allelochemical compounds might be additive, synergistic, or antagonistic (41–43). In this study, we observed that the relative abundance of the Fusarium genus in the Mix-treated soil (7.33%) was considerably higher than that in the Rg1- (0.77%), Rb1- (0.91%), and Rh1-treated (2.90%) soils (Fig. 2B), thus indicating that the mixture of autotoxic ginsenosides induced an enhanced effect on the proliferation of genus Fusarium. This was further validated by quantitative PCR (qPCR) assays. Moreover, the Mix treatment also exhibited synergistic effects on the conidial germination rate but not on the mycelial growth of F. oxysporum (Fig. 4), likely due to sufficient nutrition from the culture medium weakening the impact of ginsenosides on mycelial growth (44). In addition, the relative abundances of Phoma, Gibberella, and Alternaria were highest in the Mix-treated soil, which further confirmed that the autotoxic ginsenoside mixture exerted synergistic effects on the proliferation of potential pathogens. The impact on both pathogen accumulation and the composition of the fungal microbiome by root exudates of medicinal herbs that contain various types of allelochemicals (17, 45) may underlie the severity of replant diseases of medicinal plants (5, 8, 19).

In conclusion, this research provides evidence that autotoxic ginsenosides can disrupt the equilibrium of soil fungal microbiota via the stimulation of potential pathogenic groups and the inhibition of beneficial taxa. In particular, the Fusarium genus was the most responsive potential pathogen in response to the addition of autotoxic ginsenosides, and the extent of the response was associated with the type of ginsenoside applied. Moreover, the autotoxic ginsenoside mixture exerted synergistic effects on the proliferation of F. oxysporum and F. solani, as well as enhancing the conidial germination of the tested root rot pathogen F. oxysporum. Therefore, ginsenoside mixtures are capable of triggering the accumulation of soilborne pathogens and may contribute to the development of soilborne disease and replant failure in Sanqi ginseng.

MATERIALS AND METHODS

Soil and ginsenosides.

The soil used in this study was collected from hillside land near Miaoxiang Sanqi Technology Co., Ltd., Wenshan County, Yunnan Province, China (23°42′ N, 104°16′ E), that was covered with shrub and had been undisturbed for decades. Surface soil (0 to 20 cm) was collected, sieved (2-mm mesh), and then stored at 4°C until use. Since this soil was suitable for Sanqi ginseng cultivation, it was considered to have an appropriate baseline condition to imitate the influence of ginsenosides on soil microbiomes, due to the lack of human disturbance such as agricultural cultivation and agrochemical inputs. The soil had the following properties: pH, 5.7; electrical conductivity (EC), 12.4 μS · cm−1; total organic carbon (TOC), 6.1 g · kg−1; total nitrogen (TN), 0.3 g · kg−1. It should be noted that no ginsenosides were detected in the soil.

Standard ginsenosides Rg1 (CAS number 22427-39-0), Rb1 (CAS number 41753-43-9), and Rh1 (CAS number 63223-86-9) (purity ≥ 98%) were purchased from Beijing Beina Science & Technology Co., Ltd. (Beijing, China), for the downstream soil addition experiment (see Fig. S1 in the supplemental material).

Sequential addition of ginsenosides to soil.

Before ginsenoside supplements were applied, sieved (2 mm) soil samples were preincubated at 20°C at constant (35%) moisture content in the dark for 2 weeks to restore soil microbial activity and stabilize the soil microbial community. After preincubation, 24 sterilized bottles (500 ml) were prepared, and 60 g of soil (dry weight equivalent) was added to each. Ginsenosides were dissolved in sterile deionized water and filter sterilized through a 0.22-μm hydrophilic membrane before use. Eight treatments belonging to two groups were involved in this study. The first group included the following five treatments: (i) CK, preincubated soils supplemented with sterile water only, and (ii to v) Rg1, Rb1, Rh1, and Mix, preincubated soils supplemented respectively with ginsenoside monomers Rg1, Rb1, Rh1, or a mixture of Rg1, Rb1, and Rh1. The second group included the following three treatments (vi to viii) in order to evaluate the absorption capacity of the tested soil: sterilized-Rg1, sterilized-Rb1, and sterilized-Rh1, preincubated soils supplemented respectively with ginsenoside monomers Rg1, Rb1, and Rh1 after heat sterilization (80°C for 2 h). Each treatment contained three biological replicates, and each replicate received 2 ml of ginsenoside solution (22.5 μg · ml−1 for each monomer in Rg1, Rb1, and Rh1 treatment; 7.5 μg · ml−1 for each monomer in the Mix treatment) once. The ginsenoside solution was added twice a week at 3- to 4-day intervals for a period of 4 weeks, resulting in a final concentration of 6 μg · g−1 dry soil, which was close to the concentration of ginsenosides observed in the Sanqi ginseng cultivated soils (5, 22). The CK treatment received the same volume of sterile deionized water during the incubation. All soil samples were incubated at 20°C at constant (35%) moisture content in the dark during the entirety of the experiment, which is similar to the growth condition of Sanqi ginseng seedlings. After the 4-week treatment, the soil samples were collected and processed for the determination of ginsenoside concentration, microbial activity, abundance, and community composition.

Determination of ginsenoside content and total microbial activity.

Ginsenosides were extracted from 50 g of air-dried soils (sieved using a 0.25-mm-pore-size sieve) using 100% methanol (MeOH) as described in detail by Li et al. (5). After extraction, supernatants were dried by using a vacuum rotary evaporator at 30°C, and the obtained residues were redissolved in 100% MeOH. The resulting soil extracts were then filtered through a nylon syringe filter (0.22 μm, catalog no. 5020-2225; Taoyuan Membrane Separation Equipment Factory, Haining, China) and stored at 4°C for downstream analysis. Ginsenosides in soil extracts were analyzed using a high-performance liquid chromatography (HPLC) system (Waters, Milford, MA) with a Zorbax XDB-C18 column [250 mm × 4.6 mm, 5 μm; Agilent Technologies (China) Co., Ltd., Beijing, China]. The gradient flow program, flow rate, injective volume, and column temperature were set according to a previous study (5). Chromatograms were monitored at 203 nm, and the concentrations of ginsenosides were calculated based on their peak areas and expressed as μg per g dry soil. The recovery rates of ginsenosides in both sterilized and nonsterilized soils and the utilization rate of soil microorganisms in nonsterilized soils were calculated by the following formulas:

Recovery rate (%)=(Csterilized (nonsterilized)×m)×100/(Cadded×m)
Utilization rate (%)=(Csterilized−Cnonsterilized)×m×100/(Cadded×m)

where Csterilized (nonsterilized) is the concentration of ginsenosides determined from HPLC analysis; m is the total amount of soil samples; and Cadded is the concentration of ginsenosides we added.

Total soil microbial activity was determined using the fluorescein diacetate (FDA) hydrolysis method (27) and expressed as μg of fluorescein released per g of dry soil per hour, as described previously (46).

DNA extraction and MiSeq sequencing.

Soil DNA was isolated from 0.5 g of fresh soil using the FastDNA Spin kit (MP Biomedicals, Cleveland, OH), following the manufacturer’s instructions. Extracted DNA samples were dissolved into 100 μl DNase/pyrogen-free water (DES), quality controlled, and stored at −80°C for subsequent molecular analyses. MiSeq sequencing was used to characterize the fungal community structure and diversity in response to ginsenoside addition. The fungal internal transcribed spacer 2 (ITS2) region was amplified using the primer set ITS3F (5′-adapter-MID-GCATCGATGAAGAACGCAGC-3′) and ITS4R (5′-adapter-MID-TCCTCCGCTTATTGATATGC-3′ [where MID indicates multiple identifiers]) with the reaction mixture and thermal profile described in detail by Zhao et al. (47). After successful amplification, PCR products were purified by using Agencourt AMPure XP beads (Beckman Coulter, CA, USA), quantified using a Qubit double-stranded DNA (dsDNA) broad-range (BR) assay kit on a Qubit spectrophotometer (both from Invitrogen, Carlsbad, CA) and then adjusted in equimolar concentrations. Bidirectional sequencing was implemented on a MiSeq platform (Illumina, USA) at Genesky Biotechnologies, Inc. (Shanghai, China).

Bioinformatic analyses.

Sequencing data were processed and analyzed using the QIIME software package (version 1.9.1) (48). Paired-end reads were merged, barcodes were removed, and libraries were quality controlled using the “multiple_join_paired_ends.py,” “multiple_extract_barcodes.py,” and “multiple_split_libraries_fastq.py” scripts, respectively. The resulting high-quality sequences were then clustered into operational taxonomic units (OTUs) using the “pick_open_reference_otus.py” script with a threshold of 97% identity against the UNITE database (49). Both singleton OTUs and chimeric OTUs were discarded from downstream analyses. Representative sequences of each OTU were then selected and taxonomically classified using the RDP naive Bayesian rRNA Classifier (50) with a confidence threshold of 50%. To even the sequencing depth, all samples were rarefied to 44,000 sequences.

Fungal α-diversity (observed OTU richness [Sobs], Shannon diversity, and Pielou’s evenness) indices were calculated based on the rarefied OTU table at a depth of 44,000 sequences per sample. Principal-coordinate analysis (PCoA) was conducted to compare the fungal community structure using Bray-Curtis distances. Permutational multivariate analysis of variance (PERMANOVA) (51) was performed to evaluate the community differences among treatments. The treatment-shared OTUs and treatment-unique OTUs were analyzed by retaining the OTUs that consistently appeared in the three biological replicates for each treatment. Potentially pathogenic and beneficial fungi were predicted according to potential relationships with a plant using FUNGuild (52).

Quantitative real-time PCR assay.

The population size of fungi (ITS1f/5.8S) was quantified using a CFX-96 real-time PCR Detection system (Bio-Rad Laboratories Inc., CA, USA), as well as the population sizes of the potential pathogens F. oxysporum (ITS1F/AFP308R), F. solani (ITS1F/AFP346R), Alternaria (AltF/AltR; TaqMan probe AltTM), and Cylindrocarpon (CDU2/CDUL2b), to complement the results of MiSeq sequencing. Primer sets, TaqMan probes, and thermal conditions are listed in Table 3. The 20-μl reaction mixture contained 10 μl of SYBR Premix Ex Taq (TaKaRa Bio Inc., Kyoto, Japan), 2 μl of template DNA, 6 μl of sterile distilled water, and 1 μl of each primer (10 μM) for the fungi F. oxysporum, F. solani, and Cylindrocarpon; and 6.5 μl of sterile distilled water, 0.5 μl of each primer (10 μM), and 0.5 μl of TaqMan probe (10 μM, GenScript Corporation, Nanjing, China) for Alternaria. Standard curves were generated using 10-fold serial dilutions of the plasmid DNA inserted with the fragment of interest, according to a previously established protocol (53); the amplification efficiencies ranged from 94.8 to 107.5% for different genes. Melting curves were recorded to evaluate the amplification specificity at the end of each PCR run.

TABLE 3.

Primers, probe, and program used for real-time PCR in this study

Target gene Primer or probe Sequence (5′–3′)a Program Reference
Fungal ITS ITS1f-F TCCGTAGGTGAACCTGCGG 2 min at 95°C, followed by 39 cycles of 5 s at 95°C, 30 s at 60°C 55
5.8s-R CGCTGCGTTCTTCATCG 56
F. oxysporum ITS ITS1F-F CTTGGTCATTTAGAGGAAGTAA 2 min at 95°C, followed by 39 cycles of 5 s at 95°C, 30 s at 60°C 55
AFP308-R CGAATTAACGCGAGTCCCAAC 57
F. solani ITS ITS1F-F CTTGGTCATTTAGAGGAAGTAA 2 min at 95°C, followed by 39 cycles of 5 s at 95°C, 30 s at 60°C 55
AFP346-R GGTATGTTCACAGGGTTGATG 57
Alternaria 18S rRNA Alt-F TGTCTTTTGCGTACTTCTTGTTTCCT 2 min at 95°C, followed by 40 cycles of 10 s at 95°C and 40 s at 58°C 58
Alt-R CGACTTGTGCTGCGCTC
AltTM (probe) 6FAM-AACACCAAGCAAAGCTTGA-GGGTACAAAT-TMR 59
Cylindrocarpon ITS CDU2 GCTACCCTATAGCGCAGGTG 2 min at 95°C, followed by 39 cycles of 5 s at 95°C and 30 s at 58°C 60
CDUL2b CCGTACTGGCTGAAGAGTCA
a

6FAM, 6-carboxyfluorescein; TMR, tetramethylrhodamine.

Validation of ginsenoside effect on representative root rot pathogen.

The target F. oxysporum strain was isolated from a rotten root of Sanqi ginseng and identified according to morphology and ITS sequence (3). After confirming the pathogenicity by Koch’s postulates, the target strain was cultured for further experimentation on potato dextrose agar (PDA) medium in petri dishes at 28°C for 7 days in the dark.

For mycelial growth, the F. oxysporum mycelium block (0.55 cm in diameter) was placed in the center of quarter-strength PDA plates containing the four ginsenosides at a final concentration of 6 μg/ml. Plates without ginsenosides were used as controls. Each treatment contained three replicate plates, and all plates were incubated at 28°C for 5 days in the dark. The mycelium growth of the pathogen was determined daily for 5 days by measuring the colony diameter. For conidial germination, 2-ml conidial suspensions of F. oxysporum (105 conidia · ml−1) were added into sterile 4-ml tubes containing each ginsenoside at a final concentration of 6 μg/ml. The conidial suspension was obtained according to an established procedure (54), and the tubes without ginsenosides were used as control. Each treatment contained six replicate tubes, and all tubes were incubated at 28°C for 12 h in the dark. After incubation, the conidia were resuspended in sterile water and quantified using a hemocytometer.

Statistical analysis.

Gene copy numbers were log10 transformed before statistical analysis. All statistical analyses were performed using PASW Statistics 18 (SPSS Inc., Chicago, IL). Significant differences among treatments were analyzed using one-way ANOVA test, and the means were compared using Duncan’s multiple range test. A two-sample t test was also performed in order to compare the difference between the ginsenoside-treated soil and the CK soil. Regression analysis and Spearman’s correlation were performed to investigate the relationships between the pathogenic and beneficial taxa. Differences were considered statistically significant at a P value of <0.05.

Data availability.

Sequence data have been deposited in the NCBI Sequence Read Archive (SRA) database under the accession number SRP211774.

Supplementary Material

Supplemental file 1
AEM.00130-20-s0001.pdf (512.6KB, pdf)

ACKNOWLEDGMENTS

This study was financially supported by the National Natural Science Foundation of China (grants 41701277 and 41771281), the National Key Research and Development Program of China (grant 2017YFD0200600), the China Postdoctoral Science Foundation (grants 2018M630573 and 2019T120442), the Yunnan Science and Technology Program (grants 2016FB076 and 2016FD019), the Startup Funds of Nanjing Normal University (grant 184080H202B136), the Postgraduate Research & Practice Innovation Program of Jiangsu Province, China (grant KYCX18_1201), the Priority Academic Program Development (PAPD) of Jiangsu Higher Education Institutions, and the Key Subjects of Jiangsu Province (Ecology).

We also thank the anonymous referees for their constructive comments, which significantly improved the manuscript.

Footnotes

Supplemental material is available online only.

REFERENCES

  • 1.Christensen LP. 2008. Ginsenosides: chemistry, biosynthesis, analysis, and potential health effects. Adv Food Nutr Res 55:1–99. doi: 10.1016/S1043-4526(08)00401-4. [DOI] [PubMed] [Google Scholar]
  • 2.Wu L, Zhao Y, Guan Y, Pang S. 2008. A review on studies of the reason and control methods of succession cropping obstacle of Panax ginseng CA Mey. Spec Wild Econ Anim Plant Re 2:68–72. [Google Scholar]
  • 3.Zhao J, Li Y, Wang B, Huang X, Yang L, Lan T, Zhang J, Cai Z. 2017. Comparative soil microbial communities and activities in adjacent Sanqi ginseng monoculture and maize-Sanqi ginseng systems. Appl Soil Ecol 120:89–96. doi: 10.1016/j.apsoil.2017.08.002. [DOI] [Google Scholar]
  • 4.Dong L, Xu J, Li Y, Fang H, Niu W, Li X, Zhang Y, Ding W, Chen S. 2018. Manipulation of microbial community in the rhizosphere alleviates the replanting issues in Panax ginseng. Soil Biol Biochem 125:64–74. doi: 10.1016/j.soilbio.2018.06.028. [DOI] [Google Scholar]
  • 5.Li Y, Wang B, Chang Y, Yang Y, Yao C, Huang X, Zhang J, Cai Z, Zhao J. 2019. Reductive soil disinfestation effectively alleviates the replant failure of Sanqi ginseng through allelochemical degradation and pathogen suppression. Appl Microbiol Biotechnol 103:3581–3595. doi: 10.1007/s00253-019-09676-4. [DOI] [PubMed] [Google Scholar]
  • 6.Liu X, Zhang J, Gu T, Zhang W, Shen Q, Yin S, Qiu H. 2014. Microbial community diversities and taxa abundances in soils along a seven-year gradient of potato monoculture using high throughput pyrosequencing approach. PLoS One 9:e86610. doi: 10.1371/journal.pone.0086610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhao J, Mei Z, Zhang X, Xue C, Zhang C, Ma T, Zhang S. 2017. Suppression of Fusarium wilt of cucumber by ammonia gas fumigation via reduction of Fusarium population in the field. Sci Rep 7:43103. doi: 10.1038/srep43103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Dong L, Xu J, Feng G, Li X, Chen S. 2016. Soil bacterial and fungal community dynamics in relation to Panax notoginseng death rate in a continuous cropping system. Sci Rep 6:31802. doi: 10.1038/srep31802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Jiang N, Liu Y, Ye Y. 2011. Research advances in diseases of Panax notoginseng. J South Agric 42:1070–1074. [Google Scholar]
  • 10.Miao C, Mi Q, Qiao X, Zheng Y, Chen Y, Xu L, Guan H, Zhao L. 2016. Rhizospheric fungi of Panax notoginseng: diversity and antagonism to host phytopathogens. J Ginseng Res 40:127–134. doi: 10.1016/j.jgr.2015.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Miao Z, Li S, Liu X, Chen Y, Li Y, Wang Y, Guo R, Xia Z, Zhang K. 2006. The causal microorganisms of Panax notoginseng root rot disease. Sci Agric Sin 39:1371–1378. [Google Scholar]
  • 12.Li X, Ding C, Zhang T, Wang X. 2014. Fungal pathogen accumulation at the expense of plant-beneficial fungi as a consequence of consecutive peanut monoculturing. Soil Biol Biochem 72:11–18. doi: 10.1016/j.soilbio.2014.01.019. [DOI] [Google Scholar]
  • 13.Wu H, Wu L, Wang J, Zhu Q, Lin S, Xu J, Zheng C, Chen J, Qin X, Fang C, Zhang Z, Azeem S, Lin W. 2016. Mixed phenolic acids mediated proliferation of pathogens Talaromyces helicus and Kosakonia sacchari in continuously monocultured Radix pseudostellariae rhizosphere soil. Front Microbiol 7:335. doi: 10.3389/fmicb.2016.00335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Broeckling CD, Broz AK, Bergelson J, Manter DK, Vivanco JM. 2008. Root exudates regulate soil fungal community composition and diversity. Appl Environ Microbiol 74:738–744. doi: 10.1128/AEM.02188-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hugoni M, Luis P, Guyonnet J, Haichar F. 2018. Plant host habitat and root exudates shape fungal diversity. Mycorrhiza 28:451–463. doi: 10.1007/s00572-018-0857-5. [DOI] [PubMed] [Google Scholar]
  • 16.Luo L, Guo C, Wang L, Zhang J, Deng L, Luo K, Huang H, Liu Y, Mei X, Zhu S, Yang M. 2019. Negative plant-soil feedback driven by re-assemblage of the rhizosphere microbiome with the growth of Panax notoginseng. Front Microbiol 10:1597. doi: 10.3389/fmicb.2019.01597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.He C, Gao W, Yang J, Bi W, Zhang X, Zhao Y. 2009. Identification of autotoxic compounds from fibrous roots of Panax quinquefolium L. Plant Soil 318:63–72. doi: 10.1007/s11104-008-9817-8. [DOI] [Google Scholar]
  • 18.Du J, Yin W, Zhang Z, Hou J, Huang J, Li J. 2009. Autotoxicity and phenolic acids content in soils with different planting interval years of Rehmannia glutinosa. Chin J Ecol 28:445–450. [Google Scholar]
  • 19.Zhang Z, Lin W. 2009. Continuous cropping obstacle and allelopathic autotoxicity of medicinal plants. Chinese J Eco-Agriculture 17:189–196. doi: 10.3724/SP.J.1011.2009.00189. [DOI] [Google Scholar]
  • 20.Zhao Y, Cheng Y, Ma Y, Chen C, Xu F, Dong X. 2018. Role of phenolic acids from the rhizosphere soils of Panax notoginseng as a double-edge sword in the occurrence of root-rot disease. Molecules 23:819. doi: 10.3390/molecules23040819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chen S, Yu H, Zhou X, Wu F. 2018. Cucumber (Cucumis sativus L.) Seedling rhizosphere Trichoderma and Fusarium spp. communities altered by vanillic acid. Front Microbiol 9:2195. doi: 10.3389/fmicb.2018.02195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yang M, Zhang X, Xu Y, Mei X, Jiang B, Liao J, Yin Z, Zheng J, Zhao Z, Fan L, He X, Zhu Y, Zhu S. 2015. Autotoxic ginsenosides in the rhizosphere contribute to the replant failure of Panax notoginseng. PLoS One 10:e0118555. doi: 10.1371/journal.pone.0118555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Nicol RW, Yousef L, Traquair JA, Bernards MA. 2003. Ginsenosides stimulate the growth of soilborne pathogens of American ginseng. Phytochemistry 64:257–264. doi: 10.1016/s0031-9422(03)00271-1. [DOI] [PubMed] [Google Scholar]
  • 24.Jiao X, Lu X, Chen J, Luo Y, Hao J, Gao W. 2015. Effects of Fusarium solani and F. oxysporum infection on the metabolism of ginsenosides in American ginseng roots. Molecules 20:10535–10552. doi: 10.3390/molecules200610535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhang A, Lei F, Fu J, Zhou R, Zhang L. 2017. Influence of exogenous ginsenosides on new forest soil microbial communities. Chin J Chin Mat Med 42:4756–4761. [DOI] [PubMed] [Google Scholar]
  • 26.Choi JR, Hong SW, Kim Y, Jang SE, Kim NJ, Han MJ, Kim DH. 2011. Metabolic activities of ginseng and its constituents, cinsenoside Rb1 and Rg1, by human intestinal microflora. J Ginseng Res 35:301–307. doi: 10.5142/jgr.2011.35.3.301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Adam G, Duncan H. 2001. Development of a sensitive and rapid method for the measurement of total microbial activity using fluorescein diacetate (FDA) in a range of soils. Soil Biol Biochem 33:943–951. doi: 10.1016/S0038-0717(00)00244-3. [DOI] [Google Scholar]
  • 28.Nannipieri P, Ascher J, Ceccherini M, Landi L, Pietramellara G, Renella G. 2003. Microbial diversity and soil functions. Eur J Soil Science 54:655–670. doi: 10.1046/j.1351-0754.2003.0556.x. [DOI] [Google Scholar]
  • 29.Chaparro JM, Badri DV, Bakker MG, Sugiyama A, Manter DK, Vivanco JM. 2013. Root exudation of phytochemicals in Arabidopsis follows specific patterns that are developmentally programmed and correlate with soil microbial functions. PLoS One 8:e55731. doi: 10.1371/journal.pone.0055731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Niro E, Marzaioli R, De Crescenzo S, D’Abrosca B, Castaldi S, Esposito A, Fiorentino A, Rutigliano FA. 2016. Effects of the allelochemical coumarin on plants and soil microbial community. Soil Biol Biochem 95:30–39. doi: 10.1016/j.soilbio.2015.11.028. [DOI] [Google Scholar]
  • 31.Mao Z, Long Y, Zhu Y, Zhu S, He X, Chen Z. 2014. First report of Cylindrocarpon destructans var. destructans causing black root rot of Sanqi (Panax notoginseng) in China. Plant Dis 98:162–162. doi: 10.1094/PDIS-11-12-1104-PDN. [DOI] [PubMed] [Google Scholar]
  • 32.Mi C, Yang R, Rao J, Yang S, Wei F, Li O, Hu X. 2017. Unveiling of dominant fungal pathogens associated with rusty root rot of Panax notoginseng based on multiple methods. Plant Dis 101:2046–2052. doi: 10.1094/PDIS-01-17-0135-RE. [DOI] [PubMed] [Google Scholar]
  • 33.Bienapfl JC, Floyd CM, Percich JA, Malvick DK. 2012. First report of Clonostachys rosea causing root rot of soybean in the United States. Plant Dis 96:1700–1700. doi: 10.1094/PDIS-06-12-0550-PDN. [DOI] [PubMed] [Google Scholar]
  • 34.Tan Y, Cui Y, Li H, Kuang A, Li X, Wei Y, Ji X. 2017. Rhizospheric soil and root endogenous fungal diversity and composition in response to continuous Panax notoginseng cropping practices. Microbiol Res 194:10–19. doi: 10.1016/j.micres.2016.09.009. [DOI] [PubMed] [Google Scholar]
  • 35.Zheng Y, Miao C, Chen H, Huang F, Xia Y, Chen Y, Zhao L. 2017. Endophytic fungi harbored in Panax notoginseng: diversity and potential as biological control agents against host plant pathogens of root-rot disease. J Ginseng Res 41:353–360. doi: 10.1016/j.jgr.2016.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Grunewaldt-Stöcker G, von Alten H. 2003. Plant health effects of Acremonium root endophytes compared to those of arbuscular mycorrhiza, p 445–454. In Abe J. (ed), Roots: the dynamic interface between plants and the earth: the 6th symposium of the international society of root research. Springer Netherlands, Dordrecht, Netherlands. [Google Scholar]
  • 37.Peitl DC, Araujo FA, Gonçalves RM, Santiago DC, Sumida CH, Balbi-Peña MI. 2017. Biological control of tomato bacterial spot by saprobe fungi from semi-arid areas of northeastern Brazil. Sca 38:1251–1263. doi: 10.5433/1679-0359.2017v38n3p1251. [DOI] [Google Scholar]
  • 38.Xiong W, Li R, Ren Y, Liu C, Zhao Q, Wu H, Jousset A, Shen Q. 2017. Distinct roles for soil fungal and bacterial communities associated with the suppression of vanilla Fusarium wilt disease. Soil Biol Biochem 107:198–207. doi: 10.1016/j.soilbio.2017.01.010. [DOI] [Google Scholar]
  • 39.Vinale F, Sivasithamparam K, Ghisalberti EL, Marra R, Woo SL, Lorito M. 2008. Trichoderma-plant-pathogen interactions. Soil Biol Biochem 40:1–10. doi: 10.1016/j.soilbio.2007.07.002. [DOI] [Google Scholar]
  • 40.Huang X, Zhao J, Zhou X, Han Y, Zhang J, Cai Z. 2019. How green alternatives to chemical pesticides are environmentally friendly and more efficient. Eur J Soil Sci 70:518–529. doi: 10.1111/ejss.12755. [DOI] [Google Scholar]
  • 41.Jilani G, Mahmood S, Chaudhry AN, Hassan I, Akram M. 2008. Allelochemicals: sources, toxicity and microbial transformation in soil—a review. Ann Microbiol 58:351–357. doi: 10.1007/BF03175528. [DOI] [Google Scholar]
  • 42.Yang J, Deng X, Xian Q, Qian X, Li A. 2014. Allelopathic effect of Microcystis aeruginosa on Microcystis wesenbergii: microcystin-LR as a potential allelochemical. Hydrobiologia 727:65–73. doi: 10.1007/s10750-013-1787-z. [DOI] [Google Scholar]
  • 43.Santos WDD, Ferrarese M. 2008. Ferulic acid: an allelochemical troublemaker. Funct Plant Sci Biotechnol 2:47–55. [Google Scholar]
  • 44.Liu J, Li X, Jia Z, Zhang T, Wang X. 2017. Effect of benzoic acid on soil microbial communities associated with soilborne peanut diseases. Appl Soil Ecol 110:34–42. doi: 10.1016/j.apsoil.2016.11.001. [DOI] [Google Scholar]
  • 45.Ren X, Yan Z, He X, Li X, Qin B. 2017. Allelochemicals from rhizosphere soils of Glycyrrhiza uralensis Fisch: discovery of the autotoxic compounds of a traditional herbal medicine. Ind Crops Prod 97:302–307. doi: 10.1016/j.indcrop.2016.12.035. [DOI] [Google Scholar]
  • 46.Zhao J, Zhou X, Jiang A, Fan J, Lan T, Zhang J, Cai Z. 2018. Distinct impacts of reductive soil disinfestation and chemical soil disinfestation on soil fungal communities and memberships. Appl Microbiol Biotechnol 102:7623–7634. doi: 10.1007/s00253-018-9107-1. [DOI] [PubMed] [Google Scholar]
  • 47.Zhao J, Ni T, Li Y, Xiong W, Ran W, Shen B, Shen Q, Zhang R. 2014. Responses of bacterial communities in arable soils in a rice-wheat cropping system to different fertilizer regimes and sampling times. PLoS One 9:e85301. doi: 10.1371/journal.pone.0085301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Peña AG, Goodrich JK, Gordon JI, Huttley GA, Kelley ST, Knights D, Koenig JE, Ley RE, Lozupone CA, McDonald D, Muegge BD, Pirrung M, Reeder J, Sevinsky JR, Turnbaugh PJ, Walters WA, Widmann J, Yatsunenko T, Zaneveld J, Knight R. 2010. QIIME allows analysis of high-throughput community sequencing data. Nat Methods 7:335–336. doi: 10.1038/nmeth.f.303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Kõljalg U, Nilsson RH, Abarenkov K, Tedersoo L, Taylor AFS, Bahram M, Bates ST, Bruns TD, Bengtsson-Palme J, Callaghan TM, Douglas B, Drenkhan T, Eberhardt U, Dueñas M, Grebenc T, Griffith GW, Hartmann M, Kirk PM, Kohout P, Larsson E, Lindahl BD, Lücking R, Martín MP, Matheny PB, Nguyen NH, Niskanen T, Oja J, Peay KG, Peintner U, Peterson M, Põldmaa K, Saag L, Saar I, Schüßler A, Scott JA, Senés C, Smith ME, Suija A, Taylor DL, Telleria MT, Weiss M, Larsson K-H. 2013. Towards a unified paradigm for sequence-based identification of fungi. Mol Ecol 22:5271–5277. doi: 10.1111/mec.12481. [DOI] [PubMed] [Google Scholar]
  • 50.Wang Q, Garrity GM, Tiedje JM, Cole JR. 2007. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol 73:5261–5267. doi: 10.1128/AEM.00062-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Anderson MJ. 2005. Permutational multivariate analysis of variance. Department of Statistics, University of Auckland, Auckland, New Zealand. [Google Scholar]
  • 52.Nguyen NH, Song Z, Bates ST, Branco S, Tedersoo L, Menke J, Schilling JS, Kennedy PG. 2016. FUNGuild: an open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecol 20:241–248. doi: 10.1016/j.funeco.2015.06.006. [DOI] [Google Scholar]
  • 53.Zhao J, Ni T, Li J, Lu Q, Fang Z, Huang Q, Zhang R, Li R, Shen B, Shen Q. 2016. Effects of organic–inorganic compound fertilizer with reduced chemical fertilizer application on crop yields, soil biological activity and bacterial community structure in a rice-wheat cropping system. Appl Soil Ecol 99:1–12. doi: 10.1016/j.apsoil.2015.11.006. [DOI] [Google Scholar]
  • 54.Jiao X, Bi W, Li M, Luo Y, Gao W. 2011. Dynamic response of ginsenosides in American ginseng to root fungal pathogens. Plant Soil 339:317–327. doi: 10.1007/s11104-010-0580-2. [DOI] [Google Scholar]
  • 55.Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—application to the identification of mycorrhizae and rusts. Mol Ecol 2:113–118. doi: 10.1111/j.1365-294x.1993.tb00005.x. [DOI] [PubMed] [Google Scholar]
  • 56.Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol 172:4238–4246. doi: 10.1128/jb.172.8.4238-4246.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Lievens B, Brouwer M, Vanachter AC, Lévesque CA, Cammue B, Thomma BP. 2005. Quantitative assessment of phytopathogenic fungi in various substrates using a DNA macroarray. Environ Microbiol 7:1698–1710. doi: 10.1111/j.1462-2920.2005.00816.x. [DOI] [PubMed] [Google Scholar]
  • 58.Pavón M, González I, Rojas M, Pegels N, Martín R, García T. 2011. PCR Detection of Alternaria spp. in processed foods, based on the internal transcribed spacer genetic marker. J Food Prot 74:240–247. doi: 10.4315/0362-028X.JFP-10-110. [DOI] [PubMed] [Google Scholar]
  • 59.Pavón MÁ, González I, Martín R, Lacarra TG. 2012. ITS-based detection and quantification of Alternaria spp. in raw and processed vegetables by real-time quantitative PCR. Food Microbiol 32:165–171. doi: 10.1016/j.fm.2012.05.006. [DOI] [PubMed] [Google Scholar]
  • 60.Wu Z, Hao Z, Zeng Y, Guo L, Huang L, Wang Y, Chen B. 2015. Molecular quantification of Cylindrocarpon destructans in the rhizosphere of Panax notoginseng for predicting plant growth response. Microbiology China 42:598–607. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1
AEM.00130-20-s0001.pdf (512.6KB, pdf)

Data Availability Statement

Sequence data have been deposited in the NCBI Sequence Read Archive (SRA) database under the accession number SRP211774.


Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES