Skip to main content
NCBI home page
Food Science & Nutrition logoLink to Food Science & Nutrition
. 2020 Mar 17;8(4):2134–2142. doi: 10.1002/fsn3.1511

Effects of Chinese medicines on monacolin K production and related genes transcription of Monascus ruber in red mold rice fermentation

Lin Peng 1,2,3, Aisikaer Ai‐lati 1,2,3, Shuangping Liu 1,2,3, Zhongwei Ji 1,2,3, Jian Mao 1,2,3,4,✉, Xin Che 1,2,3
PMCID: PMC7174227  PMID: 32328280

Abstract

Monacolin K (MK) is a secondary metabolite synthesized by polyketide synthases of Monascus spp. In this study, the combined supplementation of three medicines, including Citri Reticulatae Pericarpium (CRP), Fructus crataegi (FC), and Radix Angelicae Dahuricae (RAD), were mixed with nonglutinous rice and were optimized by response surface methodology to enhance the production of MK in fermented red mold rice (RMR). Under the optimum condition, MK production achieved 3.60 mg/g, which was 41.18% higher than RMR without medicines. The improved MK production was mainly caused by the up‐regulated transcription level of mokA, mokB, mokF, mokH, mokI, and mplaeA. Meanwhile, the inhibitory effect of Poria cocos (PC) on MK production (only 0.436 mg/g) was caused by significantly down‐regulated transcription of six tested genes. Therefore, this study is beneficial for better understanding of the possible mechanism of enhanced MK production by optimization of fermentation conditions.

Keywords: Chinese medicine, monacolin K, Monascus ruber, red mold rice, response surface methodology

Mixed three Chinese traditional medicines enhanced monacolin K production in solid‐state fermentation of red mold rice. The possible mechanism may be attributed to the regulation of expression of genes related to MK synthesis.

graphic file with name FSN3-8-2134-g006.jpg

1. INTRODUCTION

Cardiovascular disease is the major factor leading mortality and morbidity of human, and hyperlipidemia is the main reason for its occurrence and development (Lewington et al., 2007). In 1979, Endo (1980) first isolated monacolin K (known as Lovastatin in Aspergillus terreus (Alberts et al., 1980)) from red mold rice (RMR) and found MK effectively inhibiting cholesterol synthesis. Currently, MK is used as hypocholesterolemic drug approved by FDA (Manzoni & Rollini, 2002). Due to its abundant content of MK, some RMR products are also used as anti‐hypercholesterolemic drugs, including LipoCol Forte, Cholestin, and Xuezhikang. Compared to tablets containing MK, the bioavailability of MK is significantly enhanced by oral administration of RMR products (Chen, Yang, Uang, & Lin, 2013). Besides lipid‐lowering effect, previous studies verified that MK also has several other activities, including preventing the formation of thrombus (Lee, Lee, Hwang, Lee, & Wang, 2013), reducing the occurrence of atherosclerosis (Lin, Li, & Lai, 2005; Wei et al., 2003), stimulating bone formation (Gutierrez et al., 2006), inducing the apoptosis of cancer cells (Kurokawa, Ito, & Matsui, 2017; Lee, Shih, Lee, et al., 2013), curing Parkinson's (Lin, Lin, Lin, Huang, & Lee, 2015) and Alzheimer's (Lee, Wang, & Pan, 2008) diseases. Therefore, RMR could be regarded as functional ingredient and applied in food industry.

Red mold rice is an important food additive used in some Chinese traditional foods and alcoholic beverages due to its abundant red pigments and MK. The function and color of red rice wine, a Chinese traditional alcoholic beverage, was caused by the addition of RMR during fermentation process (Zhou, 1996). With the increased attention paying to functional foods, some methods are developed to improve the production of MK in RMR, which could be used to further enhance MK content in foods. These methods include the optimization of culture medium (Panda, Javed, & Ali, 2010; Subhagar, Aravindan, & Viruthagiri, 2010; Suraiya et al., 2018) and the establishment of fermentation strategies in solid‐state fermentation (Gum, Nguyen, Lee, Han, & Cho, 2017; Lin, Wang, Li, Wu, & Chen, 2017; Tsukahara, Shinzato, Tamaki, Namihira, & Matsui, 2009). All these researches enhancing MK production in RMR were focusing on genes related to MK synthesis. After screening and characterization, nine genes related to MK synthesis in Monascus pilosus were identified by comparing with that of A. terreus genes related to lovastatin synthesis (Chen et al., 2008). Furthermore, the addition of some nutrients during RMR fermentation leads to the up‐regulation of some genes, which further enhance MK production (Huang, Liao, & Li, 2017; Zhang, Liang, Yang, Sun, & Wang, 2017). Therefore, the enhancement of MK production by optimization of culture medium is associated with the modulation of the expression of MK synthesis‐related genes.

In Chinese traditional medicines, some herbs could be used in both food processing and clinical treatment. Meanwhile, some functional components in Chinese medicines could effectively enhance the production of functional products in edible fungi (Zhou, Liu, Huang, Wu, & Yang, 2014). Therefore, we determined the effects of various Chinese medicines on MK production of Monascus ruber in RMR fermentation, and three Chinese medicines, including Citri Reticulatae Pericarpium (CRP), Fructus crataegi (FC), and Radix Angelicae Dahuricae (RAD), showed a significantly enhanced effect on MK production in M. ruber (Che et al., 2016). The addition amount of Chinese medicines was optimized by response surface methodology to obtain high MK production. Meanwhile, the transcriptional levels of six genes related to MK synthesis were investigated during RMR fermentation. The variety of transcription level between mixed medicines (enhanced MK production) and Poria cocos (PC) (inhibited MK production) was compared to gain better understanding of the modulation of genes related to MK synthesis.

2. MATERIALS AND METHODS

2.1. Microorganisms and solid‐state fermentation

Monascus ruber M2‐1 used in this study was isolated from commercial red mold rice and preserved in our laboratory (Che, Mao, Liu, Zhou, & Xue, 2016). The strain was incubated on potato dextrose agar medium containing 1.5% agar at 28°C for 7 days. Spore suspension preparation was prepared by adding sterilized water to M. ruber M2‐1 growing PDA plates and scraped aseptically. The concentration of spores in homogenous spore suspension was counted by hemocytometer. After dilution with sterilized water, 1.0 × 105 spores/g rice were adding to the steamed nonglutinous rice mixed with various Chinese medicines, and moisture content was adjusted with lactic acid solution (pH 5.0) to 44%. Chinese medicines used in this study were Citri Reticulatae Pericarpium (CRP), Fructus crataegi (FC), Folium mori (FM), Radix Angelicae Dahuricae (RAD), and P. cocos (PC). In solid‐state fermentation, 35 g medium containing nonglutinous rice and Chinese medicines was placed in 250‐ml Erlenmeyer flask and incubated at 28°C for 12 days.

2.2. Experimental design and statistical analysis

In this study, Box–Behnken design was used to assess the main and interaction effects of various Chinese medicines: CRP (x 1), FC (x 2), and RAD (x 3). The range and level of the variables analyzed in this study was shown in Table S1. The statistical model was based on the RSM by liner regression analyzing by software Design‐Expert version 8.4.

2.3. Biomass and moisture content analysis

Biomass during RMR fermentation was analyzed according to method reported by Liu, Xu, and Cen (2000). The intracellular nucleic acid of M. ruber mycelial in insoluble substrate (0.25 g) was extracted by 5% (v/v) trichloroacetic acid at 80°C for 30 min. After centrifugation (10,000 g, 4°C) for 15 min, the absorbance at 260 nm was measured. The standard curve was established from the value of OD 260 nm and biomass obtained in submerged fermentation, and this curve was used to calculate the biomass of M. ruber mycelial in RMR fermentation. The moisture of RMR during fermentation was analyzed by drying at 60°C for 12 hr.

2.4. Extraction and HPLC analysis of MK

Red mold rice (0.5 g) obtained from solid‐state fermentation was mixed with 30 ml 70% (v/v) ethanol, and MK was extracted by ultrasonic treatment (250 W, 40 kHz) at 50°C for 1 hr. After centrifugation (10,000 g, 4°C) for 5 min, supernatant was filtered by 0.22‐μm filter. The concentration of MK in supernatant was analyzed by HPLC under the following conditions: Athena C18 column (Athena 250 mm × 4.6 mm), mobile phase (acetonitrile:0.1% phosphorus acid = 65:35 v/v), flow rate 1.0 ml/min, column temperature 30°C, and wavelength 238 nm. The content was calculated according to MK standard (Sigma).

2.5. Quantitative real‐time PCR

Mycelial in red mold rice was frozen by liquid nitrogen, and total RNA was extracted by TRIzol Total RNA Purification Kit (Sangon), and reverse transcription was carried out with RevertAid First Strand cDNA Synthesis Kit (Fermentas). The 20 μl reaction mixture contained 2 μl cDNA as template, 1 μM primers, along with SYBR green reagent (TaKaRa) according to manufacturer's instruction. Primers for genes related to MK synthesis were listed in Table 1. The amplification program was described as follow: 94°C for 5 min, followed by 40 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 2 min. Gene expression level was normalized against that of GAPDH gene expression.

Table 1.

Primer sequences for genes related to MK synthesis

Gene Sequence Length (bp)
mokA Forward CCGTGAAACCTTGCTCTG 1,151
Reverse TCTGATGGGCTACGACTACA
mokB Forward CATAGCTGTAGTGGGCA 1,658
Reverse TGCTCGTCGATATTCTCG
mokF Forward CGCCCAATCCGAGACGTTAT 1,425
Reverse CGTTGGGTCGATTTGCTGTAATAG
mokI Forward GAATGTATGGTCTATCCCTTTA 1,705
Reverse TTCCGTTTACGCTGTAGTG
mokH Forward TTATACCCAGTCTTGGATGACTCGC 1,464
Reverse CTAGATTTCTCAGAACTAAATCTATCTATTTA
mplaeA Forward AGGTGCGTTGGCCTGATGTT 1,194
Reverse GTGATTCAATTGGAAATTGGCTTC
GAPDH Forward TTGAGGTCCACTATGCTGTA 1,013
Reverse GCGATGTAGGCAATGAGG
Open in a new tab

3. RESULTS AND DISCUSSION

3.1. Effects of various Chinese medicine on MK production in solid‐state fermentation

In our previous study, a MK‐producing strain M. ruber M2‐1 was isolated from commercial RMR, and 15 Chinese traditional medicines were mixed with nonglutinous rice to assess effects on MK production (Che et al., 2016). In these tested Chinese medicines, we found four medicine, Citri Reticulatae Pericarpium (CRP), Fructus crataegi (FC), F. mori (FM), and Radix Angelicae Dahuricae (RAD), effectively enhanced the MK production in 12‐day solid‐state fermentation. In this study, various additional amount (0.5–7 g/100 g) of four medicines were mixed with rice, and MK production in RMR was shown in Figure 1. Among these tested conditions, the highest MK production of 2.508 mg/g was achieved at an additional of 4 g/100 g CRP. Meanwhile, order preference of four medicines on MK production was also performed by (Technique for order preference by similarity to an ideal solution, TOPSIS), and results indicated that the preferred order was as follow: CRP, FC, RAD, and FM. Therefore, CRP, FC, and RAD were mixed to add into RMR fermentation, and optimized addition amounts of these three medicines for MK production were further determined by response surface methodology.

Figure 1.

Figure 1

Open in a new tab

Monacolin K production by Monascus ruber with supplementation of different concentration of Citri Reticulatae Pericarpium (CRP), Fructus crataegi (FC), Folium mori (FM), and Radix Angelicae Dahuricae (RAD)

3.2. Response surface analysis

As shown in Table S2, MK production ranging from 2.890 mg/g to 3.550 mg/g was obtained under various conditions. Results were fitted into a second order quadratic model of coded units, and equation was listed as follow:

y=3.53+0.076x1+0.013x2+0.034x3-0.040x1x2-0.028x1x3-0.018x2x3+0.15x12+0.19x22+0.26x32 (1)

In this obtained equation, MK production had linear and quadratic effects with three process variables. The correlation value (R 2) was .9865, indicating that 98.65% of the total variation in results can be attributed to the independent tested variables. Therefore, the value of Equation (1) had a good agreement between predicted and experimental MK production in this regression model. Statistical analysis based on ANOVA for model was shown in Table S3. The value of p‐value indicates that there is very low chance for F‐value occur due to noise in the experiments. Besides, the “Lack of Fit F‐value” of 13.01 implied that this value was not significant relative to pure error. Therefore, only a 7.22% chance for “Lack of Fit” occurring due to noise factor caused by experimental errors.

In this study, the interactions between variables were investigated to show the significant effect on the MK production. Effects of CRP and FC addition into RMR on MK production were analyzed in three‐dimensional surface response and two‐dimensional interaction plots (Figure 2a). With the level increasing from −1 to 1, MK production of RMR added with CRP or FC showed an upward‐before‐downward trend. Similarly, MK production in interaction experiment of CRP and RAD (Figure 2b), or FC and RAD (Figure 2c), was also shown an upward‐before‐downward as addition level increasing from −1 to 1. After optimization by response surface methodology, the optimum combination conditions for maximum MK production was obtained and conditions were composed of: 3.75% CRP, 2.55% PC, and 2.01% RAD. Under this optimum condition, the predicted MK production was 3.545 mg/g. The optimum condition was further verified by three independent experiments, and the average experimental MK yield was 3.6 mg/g, indicating that the experimental value is well in agreement with the predicted value (Table S4). Meanwhile, a relatively insignificant error of 2.1% was also obtained from three independent experiments. It can be concluded that the proposed model is adequate for predicting the MK production in RMR fermentation with the addition of three Chinese medicines.

Figure 2.

Figure 2

Open in a new tab

Response surface plots showing effects of three tested parameters on monacolin K production during solid‐state fermentation

3.3. Comparison of MK production in RMS containing optimized medicines or Poria cocos (PC)

Among 15 medicines tested in previous study, we also found medicine P. cocos (PC) had negative effect on MK production, which was only 0.478 mg/g (Che et al., 2016). Therefore, the MK production, biomass, and moisture content of RMR containing optimized medicines or PC were analyzed to compare the difference during 12‐day fermentation (Figure 3a). Results showed that MK content in RMR with mixed medicines increased during the whole fermentation time, and the highest content was 3.601 mg/g on day 12. However, the MK production of RMR with addition of PC during time course was not changed, and only 0.431 mg/g MK was determined at the end of fermentation. The result indicated that MK production was obviously inhibited by the addition of PC, comparing with MK production (1.472 mg/g) in control without adding medicines (data not shown). Moreover, we found that biomass and moisture content of RMR with mixed medicines or PC had a similar curve during 12‐day solid‐state fermentation (Figure 3b,c). Therefore, effects of Chinese medicine (positive or negative) on MK production in RMR fermentation were not achieved by affecting fermentation environment.

Figure 3.

Figure 3

Open in a new tab

Monacolin K production (a), biomass (b), and moisture content (c) of red mold rice during solid‐state fermentation with supplementation of mixed medicines or Poria cocos (PC)

3.4. The expression of genes related to MK biosynthesis

Monacolin K is a secondary metabolite produced by Monascus and shares the same structure with lovastatin produced by A. terreus. Chen et al. (2008) design the conserved region of lovB gene in A. terreus and identify nine gene (mokA‐I) related to MK synthesis in M. pilosus. All these identified gene in M. pilosus are highly homologous to genes related to lovastatin synthesis in A. terreus (Kennedy et al., 1999). The synthesis of monacolin K is directly associated with polyketide synthases (PKS). Lovastatin nonaketide synthase (LNKS) and lovastatin diketide synthase (LDKS), belonged to PKS, are responsible for the synthesis of nonaketide and diketide, which are substrate for MK synthesis. In Monascus, LNKS and LDKS are encoded by mokA and mokB, respectively, which share approximately 70% similarity (Chen et al., 2008). Moreover, trans‐esterase encoding gene mokF also modulates MK synthesis, and expression level of mokF is related to MK production (Zhang et al., 2017). Besides PKS and trans‐esterase, MK synthesis is regulated by transcription factor and some other regulators. The gene mokH is encoding transcription factor acting as the linker region of GAL4 and PPR1 and is regarded as the activator for MK production (Chen, Yuan, et al., 2013). Moreover, the methyltransferase gene (laeA) is regarded as a global regulator for secondary metabolites cluster of filamentous fungi (Lee, Lee, & Lee, 2013), and deletion of laeA blocks the expression of several secondary metabolite gene cluster (Bok & Keller, 2004). In M. pilosus, a similar methyltransferase gene (mplaeA) is found to have similar conserved region, and down‐regulation of mplaeA resulted in the decrease of MK production (Zhang & Miyake, 2009). Therefore, the gene mokH and mplaeA may regulate the MK synthesis in M. ruber. In addition, mokI shares 81% similarity to lovI, which acts as efflux pump in MK synthesis (Chen et al., 2008). Gutierrez et al. (2006) reported that the maximum MK content of intracellular in submerged fermentation is approximately fivefold higher than that of extra‐cellular, and this may be attributed to the block of mokI expression.

All genes discussed above were highly related to MK synthesis in Monascus. Therefore, the transcription level of mokA, mokB, mokF, mokH, mokI, and mplaeA was analyzed by qRT‐PCR. The function of these genes was investigated under RMR fermentation with optimized medicine condition (positive) or PC (negative), and results were shown in Figure 4. During 12‐day fermentation with PC, transcription of mokA, mokB, and mokH was positively detected only on the beginning of fermentation (day 1 to day 3), and then down‐regulated after day 6 (Figure 4a,b,d). Comparing with RMR containing mixed medicines, the transcription level of six detected genes was all highly down‐regulated during all fermentation time in RMR with PC (Figure 4). It has been reported that the mokA‐disrupted M. pilosus strain completely block MK production, indicating the importance of mokA gene in the MK synthesis (Chen et al., 2008). Meanwhile, high transcription levels of mokE, mokF, and mokH are effectively enhanced the production of MK in Monascus (Chen, Yuan, et al., 2013; Lin et al., 2018; Zhang et al., 2017). Therefore, the decrease of MK production after adding PC is achieved by the transcription suppression of genes related to MK synthesis and transportation. The accumulation of MK in RMR containing PC may be achieved at the beginning of fermentation, when the transcription of mokA, mokB, and mokH is not completely blocked.

Figure 4.

Figure 4

Open in a new tab

Effects of mixed Chinese medicines and Poria cocos (PC) on the transcription level of mokA (a), mokB (b), mokF (c), mokH (d), mokI (e), and mplaeA (f)

Depending on this study, we proposed the possible biosynthesis pathway of MK production by M. ruber influenced by Chinese medicines (Figure 5). One or some key components in Chinese medicines are transported into intracellular of M. ruber mycelial and influence (down‐ or up‐regulate) the transcription level of PKS (LNKS and LDKS) and trans‐esterase, which affect the synthesis of precursors for MK. Meanwhile, key components also influence the expression transcription factor (encoded by mokH) of MK and regulator (encoded by mplaeA) of secondary metabolites, and these two regulators further affect the synthesis of precursors and MK. In addition, MK transportation protein encoding by gene mokI is also highly related to the secretion of MK. Further research focused on the identification of key components in Chinese medicine may be beneficial for better understanding the mechanism and pathway of MK synthesis in Monascus.

Figure 5.

Figure 5

Open in a new tab

Possible mechanism of Chinese medicines modulating the transcription level of genes related to monacolin K production in Monascus ruber

4. CONCLUSION

In this work, MK production of M. ruber in RMR fermentation was effectively enhanced with supplementation of combined three Chinese medicines. With the optimum combined addition of three medicines, MK production achieves 3.60 mg/g. Moreover, results of transcription level analysis indicate that six genes in M. ruber involve in MK biosynthesis.

CONFLICT OF INTEREST

The authors have no conflict of interest relevant to this work.

ETHICAL APPROVAL

Experiments in this study did not involve any human or animal subjects.

Supporting information

Table S1‐S4

Click here for additional data file. (21.2KB, docx)

ACKNOWLEDGMENTS

This work was financially supported by National Key Research and Development Program of China (Nos. 2016YFD0400504, 2017YFD0400103, and 2018YFD0400401), National Natural Science Foundation of China (Nos. 31771968 and 31571823), the National First‐Class Discipline Program of Light Industry Technology and Engineering (No. LITE2018‐13), and the Free Exploration Funding Project of the State Key Laboratory of Food Science and Technology in Jiangnan University (No. SKLF‐ZZB‐201804).

Peng L, Ai‐lati A, Liu S, Ji Z, Mao J, Che X. Effects of Chinese medicines on monacolin K production and related genes transcription of Monascus ruber in red mold rice fermentation. Food Sci Nutr. 2020;8:2134–2142. 10.1002/fsn3.1511

REFERENCES

  1. Alberts, A. W. , Chen, J. , Kuron, G. , Hunt, V. , Huff, J. , Hoffman, C. , … Springer, J. (1980). Mevinolin: A highly potent competitive inhibitor of hydroxymethylglutaryl‐coenzyme A reductase and a cholesterol‐lowering agent. Proceedings of the National Academy of Sciences of the United States of America, 77(7), 3957–3961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bok, J. W. , & Keller, N. P. (2004). LaeA, a regulator of secondary metabolism in Aspergillus spp. Eukaryotic Cell, 3(2), 527–535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Che, X. , Mao, J. , Liu, S. , Zhou, Z. , & Xue, J. (2016). Screening of monacolin K-producing Monascus and effects of Chinese medicinal herbs on its solid-state fermentation. Food Science, 37(13), 114–119. (in Chinese) [Google Scholar]
  4. Chen, C.‐H. , Yang, J.‐C. , Uang, Y.‐S. , & Lin, C.‐J. (2013). Improved dissolution rate and oral bioavailability of lovastatin in red yeast rice products. International Journal of Pharmaceutics, 444(1–2), 18–24. [DOI] [PubMed] [Google Scholar]
  5. Chen, Y. P. , Tseng, C. P. , Liaw, L. L. , Wang, C. L. , Chen, I. C. , Wu, W. J. , … Yuan, G. F. (2008). Cloning and characterization of monacolin K biosynthetic gene cluster from Monascus pilosus . Journal of Agriculture and Food Chemistry, 56(14), 5639–5646. [DOI] [PubMed] [Google Scholar]
  6. Chen, Y. P. , Yuan, G. F. , Hsieh, S. Y. , Lin, Y. S. , Wang, W. Y. , Liaw, L. L. , & Tseng, C. P. (2013). Identification of the mokH gene encoding transcription factor for the upregulation of monacolin K biosynthesis in Monascus pilosus . Journal of Agricultural & Food Chemistry, 58(1), 287–293. [DOI] [PubMed] [Google Scholar]
  7. Endo, A. (1980). Monacolin K, a new hypocholesterolemic agent that specifically inhibits 3‐hydroxy‐3‐methylglutaryl coenzyme A reductase. Journal of Antibiotics, 33(3), 334–336. [DOI] [PubMed] [Google Scholar]
  8. Gum, S. I. , Nguyen, P. A. , Lee, J. R. , Han, Y. H. , & Cho, M. K. (2017). The physico‐chemical alteration of lovastatin and enhanced antioxidant effect of Bacillus subtilis fermented‐red yeast rice product. Food Chemistry, 232, 203–209. [DOI] [PubMed] [Google Scholar]
  9. Gutierrez, G. E. , Mundy, B. , Rossini, G. , Garrett, I. R. , Chen, S. T. , & Mundy, G. R. (2006). Red yeast rice stimulates bone formation in rats. Nutrition Research, 26(3), 124–129. [Google Scholar]
  10. Huang, J. , Liao, N. Q. , & Li, H. M. (2017). Linoleic acid enhance the production of moncolin K and red pigments in Monascus ruber by activating mokH and mokA, and by accelerating cAMP‐PkA pathway. International Journal of Biological Macromolecules, 109, 950–954. 10.1016/j.ijbiomac.2017.11.074. [DOI] [PubMed] [Google Scholar]
  11. Kennedy, J. , Auclair, K. , Kendrew, S. G. , Park, C. , Vederas, J. C. , & Hutchinson, C. R. (1999). Modulation of polyketide synthase activity by accessory proteins during lovastatin biosynthesis. Science, 284(5418), 1368–1372. [DOI] [PubMed] [Google Scholar]
  12. Kurokawa, H. , Ito, H. , & Matsui, H. (2017). Monascus purpureus induced apoptosis on gastric cancer cell by scavenging mitochondrial reactive oxygen species. Journal of Clinical Biochemistry & Nutrition, 61(3), 189–195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Lee, C.‐I. , Lee, C.‐L. , Hwang, J.‐F. , Lee, Y.‐H. , & Wang, J.‐J. (2013). Monascus‐fermented red mold rice exhibits cytotoxic effect and induces apoptosis on human breast cancer cells. Applied Microbiology & Biotechnology, 97(3), 1269–1278. [DOI] [PubMed] [Google Scholar]
  14. Lee, C.‐I. , Shih, C.‐D. , Lee, C.‐L. , Kuo, S.‐L. , Jheng, S.‐C. , & Wang, J.‐J. (2013). Effect of red mold rice on blood coagulation and anticoagulation factors in a rat model of hyperlipidemia. Journal of Functional Foods, 5(4), 1956–1965. [Google Scholar]
  15. Lee, C.‐L. , Wang, J.‐J. , & Pan, T.‐M. (2008). Red mold rice extract represses amyloid beta peptide‐induced neurotoxicity via potent synergism of anti‐inflammatory and antioxidative effect. Applied Microbiology and Biotechnology, 79(5), 829–841. [DOI] [PubMed] [Google Scholar]
  16. Lee, S. S. , Lee, J. H. , & Lee, I. (2013). Strain improvement by overexpression of the laeA gene in Monascus pilosus for the production of Monascus‐fermented rice. Journal of Microbiology & Biotechnology, 23(7), 959. [DOI] [PubMed] [Google Scholar]
  17. Lewington, S. , Whitlock, G. , Clarke, R. , Sherliker, P. , Emberson, J. , Halsey, J. , … Collins, R. (2007). Blood cholesterol and vascular mortality by age, sex, and blood pressure: A meta‐analysis of individual data from 61 prospective studies with 55,000 vascular deaths. The Lancet, 370(9602), 1829–1839. [DOI] [PubMed] [Google Scholar]
  18. Lin, C. C. , Li, T. C. , & Lai, M. M. (2005). Efficacy and safety of Monascus purpureus Went rice in subjects with hyperlipidemia. European Journal of Endocrinology, 153(5), 679–686. [DOI] [PubMed] [Google Scholar]
  19. Lin, C. M. , Lin, Y. T. , Lin, R. D. , Huang, W. J. , & Lee, M. H. (2015). Neurocytoprotective effects of aliphatic hydroxamates from lovastatin, a secondary metabolite from Monascus‐fermented red mold rice, in 6‐hydroxydopamine (6‐OHDA)‐treated nerve growth factor (NGF)‐differentiated PC12 cells. ACS Chemical Neuroscience, 6(5), 716. [DOI] [PubMed] [Google Scholar]
  20. Lin, L. , Wang, C. , Li, Z. , Wu, H. , & Chen, M. (2017). Effect of temperature‐shift and temperature‐constant cultivation on the monacolin K biosynthetic gene cluster expression in Monascus sp. Food Technology and Biotechnology, 55(1), 40–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lin, L. , Wu, S. , Li, Z. , Ren, Z. , Chen, M. , & Wang, C. (2018). High expression level of mok E enhances the production of monacolin K in Monascus . Food Biotechnology, 32(1), 35–46. [Google Scholar]
  22. Liu, G. , Xu, Z. N. , & Cen, P. (2000). A Morphologically structured model for mycelial growth and secondary metabolite formation. Chinese Journal of Chemical Engineering, 8(1), 46–51. [Google Scholar]
  23. Manzoni, M. , & Rollini, M. (2002). Biosynthesis and biotechnological production of statins by filamentous fungi and application of these cholesterol‐lowering drugs. Applied Microbiology & Biotechnology, 58(5), 555–564. [DOI] [PubMed] [Google Scholar]
  24. Panda, B. P. , Javed, S. , & Ali, M. (2010). Optimization of fermentation parameters for higher lovastatin production in red mold rice through co‐culture of Monascus purpureus and Monascus ruber . Food and Bioprocess Technology, 3(3), 373–378. [Google Scholar]
  25. Subhagar, S. , Aravindan, R. , & Viruthagiri, T. (2010). Response surface optimization of mixed substrate solid state fermentation for the production of lovastatin by Monascus purpureus . Engineering in Life Sciences, 9(4), 303–310. [Google Scholar]
  26. Suraiya, S. , Kim, J.‐H. , Tak, J. Y. , Siddique, M. P. , Young, C. J. , Kim, J. K. , & Kong, I.‐S. (2018). Influences of fermentation parameters on lovastatin production by Monascus purpureus using Saccharina japonica as solid fermented substrate. LWT, 92, 1–9. [Google Scholar]
  27. Tsukahara, M. , Shinzato, N. , Tamaki, Y. , Namihira, T. , & Matsui, T. (2009). Fermentation by selected Monascus sp. with deep‐red color, lovastatin production but no citrinin, and effect of temperature‐shift cultivation on lovastatin production. New Biotechnology, 25(2), 476–482. [DOI] [PubMed] [Google Scholar]
  28. Wei, W. , Li, C. , Wang, Y. , Su, H. , Zhu, J. , & Kritchevsky, D. (2003). Hypolipidemic and anti‐atherogenic effects of long‐term Cholestin (Monascus purpureus‐fermented rice, red yeast rice) in cholesterol fed rabbits. Journal of Nutritional Biochemistry, 14(6), 314–318. [DOI] [PubMed] [Google Scholar]
  29. Zhang, C. , Liang, J. , Yang, L. E. , Sun, B. , & Wang, C. (2017). De NovoRNA sequencing and transcriptome analysis of Monascus purpureus and analysis of key genes involved in monacolin K biosynthesis. PLoS ONE, 12(1), e0170149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zhang, M. Y. , & Miyake, T. (2009). Development and media regulate alternative splicing of a methyltransferase pre‐mRNA in Monascus pilosus . Journal of Agricultural & Food Chemistry, 57(10), 4162. [DOI] [PubMed] [Google Scholar]
  31. Zhou, H. , Liu, G. , Huang, F. , Wu, X. , & Yang, H. (2014). Improved production, purification and bioactivity of a polysaccharide from submerged cultured Ganoderma lucidum . Archives of Pharmacal Research, 37(12), 1530–1537. [DOI] [PubMed] [Google Scholar]
  32. Zhou, J. (1996). Chinese rice wine brewing process. Beijing, China: China Light Industry Press. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Table S1‐S4

Click here for additional data file. (21.2KB, docx)

Articles from Food Science & Nutrition are provided here courtesy of Wiley

RESOURCES