Skip to main content
NCBI home page
Molecules logoLink to Molecules
. 2020 Mar 31;25(7):1603. doi: 10.3390/molecules25071603

Analysis of Volatile Components in Different Ophiocordyceps sinensis and Insect Host Products

Xuehong Qiu 1, Li Cao 1, Richou Han 1,*
PMCID: PMC7181253  PMID: 32244487

Abstract

The artificial production of Ophiocordyceps sinensis mycelia and fruiting bodies and the Chinese cordyceps has been established. However, the volatile components from these O. sinensis products are not fully identified. An efficient, convenient, and widely used approach based on headspace solid-phase microextraction (HS-SPME) combined with comprehensive two-dimensional gas chromatography and quadrupole time-of-flight mass spectrometry (GC×GC-QTOFMS) was developed for the extraction and the analysis of volatile compounds from three categories of 16 products, including O. sinensis fungus, Thitarodes hosts of O. sinensis, and the Chinese cordyceps. A total of 120 volatile components including 36 alkanes, 25 terpenes, 17 aromatic hydrocarbons, 10 ketones, 5 olefines, 5 alcohols, 3 phenols, and 19 other compounds were identified. The contents of these components varied greatly among the products but alkanes, especially 2,5,6-trimethyldecane, 2,3-dimethylundecane and 2,2,4,4-tetramethyloctane, are the dominant compounds in general. Three categories of volatile compounds were confirmed by partial least squares-discriminant analysis (PLS-DA). This study provided an ideal method for characterizing and distinguishing different O. sinensis and insect hosts-based products.

Keywords: Ophiocordyceps sinensis, Thitarodes hosts, Chinese cordyceps, volatile compounds, HS-SPME GC×GC-QTOFMS, partial least squares-discriminant analysis

1. Introduction

The Chinese cordyceps, a parasitic Ophiocordyceps sinensis fungus-Thitarodes/Hepialus caterpillar complex endemic only at an elevation of 3000–5000 m in the Tibetan plateau, is a valuable health food and medicinal herb [1]. Modern pharmacological studies indicate that the Chinese cordyceps is good for human circulatory, immune, hematogenic, cardiovascular, respiratory, and glandular systems [2,3,4]. Due to the limited distribution, high cost, and over exploitation, the natural Chinese cordyceps is extremely expensive and not satisfactory for market demand [5]. Therefore, artificial cultivation is needed to satisfy the natural resource protection and human comsumption.

The artificial cultivation of O. sinensis fruiting bodies on rice media [6] and host caterpillar Thitarodes spp. [7,8] has been established. Mycelial products of O. sinensis fungus have also been manufactured by fermentation technology [9]. More excitingly, the success of cultivation on a large scale has been achieved recently in China [10,11].

Several main bioactive compounds were detected in natural and cultured Chinese cordyceps and fermented fungal products, such as nucleosides (adenosine and inosine), carbohydrates (mannitol, trehalose, and polysaccharides), sterols (ergosterol), and sphingolipids, etc. [12,13,14,15]. Some free fatty acids and sterols in natural and cultured Chinese cordyceps were determined by one-step derivatization and GC/MS [16].

From the mycelia of O. sinensis cultured with solid-state media and submerged fermentation, 51 volatile compounds were identified, and there is a great difference in the numbers of compounds in the two mycelia, but phenols, acids, and alkanes were the major classes of compounds, while butylated hydroxytoluene was the most abundant volatile compound in both mycelia [17]. The volatile components in several commercial fermentation products from mycelial strains isolated from natural Chinese cordyceps were also analyzed, and 5,6-Dihydro-6-pentyl-2H-pyran-2-one (massoia lactone) was discovered as the dominant component in the essential oils of Jinshuibao capsule volatiles, and fatty acids including palmitic acid (C16:0) and linoleic acid (C18:2) were also found to be major volatile compositions of the fermentation products [18]. It seems that products from different cultivation methods may exhibit different volatile components. However, a comprehensive volatile profiling from natural and artificially cultivated Chinese cordyceps is unknown.

The Green Analytical Chemistry technique of headspace solid-phase microextraction (HS-SPME) coupled with comprehensive two-dimensional gas chromatography time-of-flight mass spectrometry (GC×GC-TOFMS) proves to be a sensitive, accurate, efficient, and convenient approach for volatile compounds analysis [19,20,21,22,23,24]. HS-SPME can extract chemicals directly from sample headspace for volatile compounds analysis. It is well suitable for volatile sampling by the advantages of ease of automation, solvent-free procedure, high preconcentration capacity, little manipulation of the sample, and high cost-efficiency [19,20,21,24,25]. GC×GC is a powerful technique with high resolution and enhanced sensitivity for separating and analyzing complex samples [19,20,21,24,25,26,27]. In addition, with the strengths in accurate mass measurements and good sensitivity in full-scan acquisition mode of TOFMS, GC×GC-TOFMS becomes an increasingly popular analytical technique for characterization of the chemical compositions of biological samples [19,20,21,24,27]. Recently, the combination of HS-SPME and GC×GC-TOFMS has been applied to volatile analysis in many fields [19,20,21,24]. However, there is no report of the simultaneous analysis of volatile components in different O. sinensis and insect hosts-based products by this method.

In the present work, HS-SPME and GC×GC-QTOFMS were employed to analyze volatile compounds from three categories of samples, including O. sinensis fungus, insect hosts of O. sinensis, and the Chinese cordyceps. Qualitative analysis was performed by comparing the mass spectra with the library and confirmed by their retention indices and fragmentation patterns. In addition, the three categories (O. sinensis fungus, Thitarodes hosts of O. sinensis, and the Chinese cordyceps) of samples were comparatively analyzed and differentiated using this method combined with multivariate partial least squares-discriminant analysis (PLS-DA).

2. Results and Discussion

2.1. Comparison of 1-DGC and GC×GC

Using the technique of HS-SPME combined with GC×GC-QTOFMS, unknown analytes can be identified and quantified in one GC injection. To compare the techniques of GC-MS and GC×GC-MS, a quality control sample (mix of each collected sample) was analyzed by both techniques under the same chromatographic conditions as described by Xiang et al. [19]. The result shows that the number of detected peaks as well as the chromatographic response in the GC×GC-MS chromatogram significantly increase compared to that of the GC-MS (Figure 1). With the high chromatographic resolution, many overlapped peaks by 1-DGC were resolved by GC×GC. In the quality control sample, the higher resolving power of GC×GC is visibly demonstrated by the constituent D-limonene (peak 3), which appears as a single overlapped peak from 1D-GC (Figure 1A) and can be separated into seven individual peaks by GC×GC (Figure 1B), namely 2,5,9-trimethyldecane, 2,2,4,4-tetramethyloctane, o-cymene, 2,4-dimethyl-2,3-heptadien-5-yne, 3-octene-2-one, and 2,3-dihydropyran-6-one (peaks 1, 2, 4, 5, 6, 7, respectively); these compounds are separated only in the second dimension. The results revealed that the volatile components of O. sinensis and insect host products were complex and required GC×GC for complete characterization; GC×GC-MS has a superior sensitivity and resolution, providing an efficient and convenient approach for studying the volatile compounds of these products. Furthermore, the present method is automated and meets the requirement of the principles of green analytical chemistry, such as solvent-free sampling, small amounts of reagents, hermetic sealing of analytical process, reduced waste, and less time consumption [22,23].

Figure 1.

Figure 1

Open in a new tab

Comparison of an expanded region of the 1D GC (A) and the same region from GC × GC (B) chromatograms of volatile components from a quality control sample. Compounds identification: (1) 2,5,9-trimethyldecane; (2) 2,2,4,4-tetramethyloctane; (3) d-limonene; (4) o-cymene; (5) 2,4-dimethyl-2,3-heptadien-5-yne; (6) 3-octene-2-one; (7) 2,3-dihydropyran-6-one.

2.2. Identification of Volatile Components

Component identification was achieved by matching the QTOFMS spectral with a commercial mass spectral library (NIST 17), with a minimum match factor of 800. The current quantitative method was consistent with similarly reported references [25,26], and the qualitative data of volatile components in different analyzed products (Table 1) with their peak area percentages are presented in Table 2. A total of 120 volatile compounds were detected in all samples with various concentration levels. A total of 107, 101, 71, 70, 89, 89, 113, 103, 105, 107, 102, 99, 40, 45, 82, and 69 compounds (Figure 2A) were identified in the products of W, A, A0, A1, A2, A3, FB, FC20d, FC40d, FC60d, FC80d, FC100d, Tx-LU, Tx-LI, Tx-PU, and Tx-PI (Table 1), accounting for 95.70%, 88.14%, 91.96%, 89.50%, 90.59%, 90.73%, 93.42%, 91.08%, 89.84%, 87.04%, 91.54%, 91.45%, 87.10%, 90.15%, 87.63%, and 91.81% of the total peaks areas, respectively. The identified compounds included 36 alkanes, 25 terpenes, 17 aromatic hydrocarbons, 10 ketones, 5 olefines, 5 alcohols, 3 phenols, and 19 other compounds. The volatile compound amounts showed great variation in different samples and ranged from 40 compounds in Tx-LU to 113 compounds in FB. In general, natural and mature artificial Chinese cordyceps (fungus–insect complexes), fruiting bodies, and fermented products had more volatile compounds than insect larvae, insect pupae and immature artificial Chinese cordyceps.

Table 1.

Information.

Sample Code Sample Description
W Natural Chinese cordyceps from Kangding, Sichuan, China
A Artificial cultured Chinese cordyceps by Liyuan Co., Ltd., Guangzhou
A0 The mummified Thitarodes larvae before stroma development
A1 Artificial cultivated Chinese cordyceps with fruiting bodies (lengths about 1 cm)
A2 Artificial cultivated Chinese cordyceps with fruiting bodies (lengths about 2–3 cm)
A3 Artificial cultivated Chinese cordyceps with fruiting bodies (lengths about 4–5 cm)
FB Fruiting bodies of Ophiocordyceps sinensis on rice–wheat medium
FC20d Fermented culture in PM medium (200 g potato extract, 20 g maltose, 10 g peptone, 1.5 g KH2PO4, 0.5 g MgSO4, 20 mg vitamin B1, and 1000 mL distilled water) [11] supplemented with 0.5% Galleria mellonella larvae for 20 days, at 11 ± 2 °C
FC40d Fermented culture of Ophiocordyceps sinensis in PM medium [11] supplemented with 0.5% Galleria mellonella larvae for 40 days, at 11 ± 2 °C
FC60d Fermented culture of Ophiocordyceps sinensis in PM medium [11] supplemented with 0.5% Galleria mellonella larvae for 60 days, at 11 ± 2 °C
FC80d Fermented culture of Ophiocordyceps sinensis in PM medium [11] supplemented with 0.5% Galleria mellonella larvae for 80 days, at 11 ± 2 °C
FC100d Fermented culture of Ophiocordyceps sinensis in PM medium [11] supplemented with 0.5% Galleria mellonella larvae for 100 days, at 11 ± 2 °C
Tx-LU Uninfected L5-L6 instar larvae of Thitarodes xiaojinensisi
Tx-LI Infected L5-L6 instar larvae of Thitarodes xiaojinensisi with blastospores of Ophiocordyceps sinensis fungus
Tx-PU Uninfected pupae of Thitarodes xiaojinensisi
Tx-PI Infected pupae of Thitarodes xiaojinensisi with blastospores of Ophiocordyceps sinensis fungus
Open in a new tab

Table 2.

Volatile components identified in different products.

NO. Compound Class Retention Time (min) Formula RI Peak Area Percentage (%)
W A A0 A1 A2 A3 FB FC20d FC40d FC60d FC80d FC100d Tx-LU Tx-LI Tx-PU Tx-PI
C1 3-Prop-2-enylidenecyclobutene Olefine 8.50 C7H8 804 0.00 0.52 0.57 1.04 0.53 0.35 0.53 3.84 0.32 1.39 0.13 0.43 0.14 1.22 0.00 0.42
C2 2-Methyl cyclopentanol Alcohol 8.90 C6H12O 815 1.00 2.14 2.20 1.21 1.82 1.83 10.80 0.00 1.16 1.21 0.00 0.54 0.41 0.57 0.82 0.91
C3 Methyl carbamate Others 9.23 C2H5NO2 824 0.00 0.00 0.00 0.02 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.03 0.00 0.00 0.00
C4 4-Methyl pyrimidine Others 9.83 C5H6N2 842 0.00 0.00 0.00 0.00 0.00 0.00 0.04 0.00 0.15 0.25 0.00 0.07 0.00 0.00 0.17 0.00
C5 o-Xylene Aromatic hydrocarbon 11.23 C8H10 881 2.15 2.65 1.57 2.05 1.51 2.86 3.68 0.00 1.04 0.47 0.00 0.35 1.57 3.72 3.93 5.09
C6 2,2-Dimethoxy ethanol Alcohol 11.57 C4H10O3 890 0.00 0.00 0.00 0.02 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
C7 N-methoxy formamide Others 12.03 C2H5NO2 903 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.01 0.00 0.01 0.00 0.00 0.00 0.00 0.00
C8 2-Methyl cyclopentanone Ketone 12.03 C6H10O 904 0.07 0.04 0.14 0.02 0.32 0.11 0.05 0.65 1.00 0.95 0.83 0.74 0.00 0.00 0.18 0.00
C9 4,6-Dimethyl pyrimidine, Others 12.97 C6H8N2 928 0.05 0.04 0.00 0.00 0.00 0.00 0.18 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.75 0.19
C10 4-Carene Terpenes 13.57 C10H16 943 4.52 0.02 0.14 0.08 0.13 0.04 0.03 0.04 0.15 0.08 0.06 0.05 1.13 1.09 0.61 0.85
C11 (2,5-Dimethyloxan-2-yl) methanol Alcohol 14.83 C8H16O2 976 0.50 0.53 0.25 0.28 0.27 0.18 0.57 0.44 0.72 0.87 0.40 0.47 0.00 0.00 0.90 0.16
C12 1-Phenyl-1,2-propanedione Ketone 14.77 C9H8O2 975 0.94 0.76 1.27 0.13 0.10 1.55 1.52 0.23 0.29 0.34 0.01 0.20 0.00 0.00 1.71 1.85
C13 Sabinene Terpenes 15.03 C10H16 981 0.00 0.02 0.08 0.09 0.02 0.08 0.02 0.56 0.63 1.10 0.02 0.36 0.00 0.00 0.00 0.00
C14 6-Ethenyl-2,2,6-trimethyloxan-3-one Ketone 15.30 C10H16O2 988 0.45 0.51 0.46 0.18 0.34 0.76 5.29 0.12 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
C15 (4-Hydroxyphenyl) phosphonic acid Others 15.70 C6H7O4P 999 0.49 0.32 0.38 0.03 0.00 0.24 0.03 4.06 0.00 0.19 0.00 0.00 1.04 0.93 0.00 0.00
C16 (−)-β-Pinene Terpenes 15.70 C10H16 998 0.00 0.02 0.00 0.00 0.00 0.00 0.82 0.17 0.01 0.01 0.00 0.00 0.00 0.00 0.03 0.00
C17 1,2,3-Trimethyl benzene Aromatic hydrocarbon 15.90 C9H12 1004 0.27 0.36 0.16 0.09 0.09 0.24 0.11 0.22 0.39 0.28 0.29 0.25 0.00 0.05 0.04 0.67
C18 3-Carene Terpenes 16.50 C10H16 1019 4.78 1.19 1.11 1.31 1.05 0.60 1.17 0.80 0.75 1.43 0.21 0.50 0.29 0.17 1.60 1.14
C19 2,5,6-Trimethyl decane Alkane 16.57 C13H28 1020 8.24 21.12 13.94 20.95 17.49 17.56 8.18 0.00 9.40 0.00 7.63 0.00 1.29 1.09 14.60 29.16
C20 2,6,7-Trimethyl decane Alkane 16.83 C13H28 1027 2.91 2.12 10.77 8.39 9.75 6.41 3.03 5.63 0.00 9.35 0.00 7.61 0.39 0.29 3.69 3.82
C21 o-Cymene Aromatic hydrocarbon 17.10 C10H14 1034 0.19 0.32 1.72 0.00 0.10 7.31 1.41 0.12 0.16 0.21 7.69 5.17 0.99 0.61 0.04 0.21
C22 2,4-Dimethyl-2,3-heptadien-5-yne Olefine 17.10 C9H12 1034 0.49 0.08 0.00 0.02 0.05 0.02 0.12 0.03 0.03 0.03 0.10 0.00 0.00 0.00 0.00 0.00
C23 D-Limonene Terpenes 17.17 C12H26 1036 0.32 2.38 0.07 0.00 0.08 0.00 0.00 0.21 0.38 0.36 0.31 0.30 3.22 2.55 0.12 0.71
C24 2,2,4,4-Tetramethyl octane Alkane 17.23 C10H16 1037 11.42 1.19 3.24 6.32 2.61 4.13 2.55 6.73 9.70 8.54 7.56 5.38 56.02 61.87 0.68 1.50
C25 2,5,9-Trimethyl decane Alkane 17.37 C13H28 1041 0.76 4.31 1.17 1.58 1.42 1.13 0.70 0.00 0.00 0.00 0.08 0.00 0.33 0.00 1.83 1.37
C26 2,3-Dihydro pyran-6-one Ketone 17.57 C5H6O2 1046 0.25 0.15 0.04 0.05 0.09 0.25 2.36 0.17 0.18 0.09 0.02 0.07 0.00 0.00 0.00 0.00
C27 3-Octene-2-one Ketone 17.57 C8H14O 1046 1.39 0.30 0.34 0.19 0.19 0.33 2.50 0.24 0.01 0.19 0.00 0.00 0.00 0.00 0.00 0.00
C28 2,7,10-Trimethyl dodecane Alkane 18.23 C15H32 1063 0.15 0.04 0.00 0.00 0.07 0.11 0.51 0.10 0.04 0.11 0.10 0.07 0.00 0.00 0.00 0.00
C29 2-Propyl toluene Aromatic hydrocarbon 18.10 C10H14 1060 2.42 6.47 9.82 8.11 10.91 5.65 2.94 4.54 5.25 7.38 4.70 4.78 0.63 0.85 11.44 5.72
C30 2-Ethyl-1,4-dimethyl benzene Aromatic hydrocarbon 18.37 C10H14 1066 0.47 0.06 0.00 0.00 0.01 0.06 0.09 0.01 0.01 0.09 0.06 0.06 0.00 0.00 0.00 0.00
C31 2,4,6-Trimethyl decane Alkane 18.43 C13H28 1068 2.09 4.14 8.78 5.02 5.90 3.98 2.79 0.45 0.63 0.58 0.54 0.51 0.25 0.30 5.91 3.64
C32 Phenylglyoxyl monohydrate Others 18.77 C8H8O3 1077 0.18 0.11 0.03 0.00 0.07 0.14 0.52 0.46 0.16 0.02 0.16 0.14 0.00 0.00 0.24 0.00
C33 3,5-Octadien-2-one Ketone 18.83 C8H12O 1078 0.16 0.06 0.00 0.00 0.00 0.04 0.11 0.01 0.09 0.05 0.09 0.03 0.00 0.00 0.00 0.00
C34 2,6-Dimethyl-6-trifluoroacetoxyoctane Others 19.10 C12H21F3O2 1085 3.29 8.16 4.93 5.34 5.61 5.30 4.23 0.73 0.75 0.79 0.63 0.56 1.48 0.33 5.71 7.31
C35 1,3-Dimethyl-3-ethyl benzene Aromatic hydrocarbon 19.17 C10H14 1087 0.39 0.02 0.00 0.00 0.04 0.10 0.02 0.03 0.05 0.04 0.03 0.02 0.00 0.13 0.28 0.24
C36 Piperityl acetate Others 19.57 C12H20O2 1097 0.50 0.10 0.00 0.00 0.04 0.10 0.31 0.03 0.04 0.07 0.02 0.04 0.00 0.00 0.09 0.00
C37 1,2,4,5-Tetramethyl benzene Aromatic hydrocarbon 19.43 C10H14 1093 0.30 0.05 0.00 0.00 0.01 0.07 0.21 0.02 0.01 0.03 0.04 0.01 0.00 0.00 1.05 0.00
C38 1,2-Dimethoxyethyl benzene Aromatic hydrocarbon 19.43 C10H14O2 1094 0.00 0.00 0.00 0.00 0.03 0.02 0.00 6.28 8.33 1.12 6.72 7.70 0.00 0.00 0.29 0.03
C39 Dodecane,2,6,11-trimethyl Alkane 19.50 C15H32 1095 0.49 0.07 0.00 0.00 0.00 0.04 0.01 0.02 0.10 0.10 0.04 0.06 0.07 0.02 0.16 0.00
C40 4,5-Dimethylnonane Alkane 19.97 C11H24 1107 0.46 0.04 0.59 0.25 0.57 0.81 0.03 1.64 0.70 0.00 0.02 0.77 0.36 0.24 0.74 0.74
C41 Linalool Terpenes 19.90 C10H18O 1105 1.60 3.78 4.48 3.76 4.60 3.44 2.27 2.34 2.50 3.99 2.12 2.21 0.67 0.70 4.13 2.33
C42 2-Nonen-1-ol Alcohol 20.03 C9H18O 1109 1.20 0.02 0.59 0.52 0.57 0.81 0.30 1.03 0.70 0.98 0.73 0.77 0.36 0.24 0.74 0.74
C43 1,2,3,5-Tetramethyl benzene Aromatic hydrocarbon 20.30 C10H14 1116 0.23 0.06 0.00 0.00 0.04 0.08 0.14 0.06 0.04 0.05 0.01 0.05 0.00 0.00 0.05 0.08
C44 6-Ethyl-2-methyl octane Alkane 20.43 C11H24 1119 0.53 2.20 0.97 0.63 0.73 0.72 0.47 0.96 1.13 0.41 1.16 1.04 0.68 0.75 1.16 3.42
C45 1,5,6,7-Tetramethyl bicyclo[3.2.0]hepta-2,6-diene Olefine 20.57 C11H16 1123 0.14 0.11 0.42 0.10 0.21 0.34 0.21 0.03 0.02 0.02 0.02 0.02 0.00 0.00 0.31 0.00
C46 1,2,3,4-Tetramethyl benzene Aromatic hydrocarbon 20.83 C10H14 1130 1.29 0.31 0.18 0.26 0.23 0.26 0.28 0.04 0.03 0.04 0.03 0.03 0.00 0.00 0.25 0.16
C47 3,5-Diethyl-1-methyl benzene Aromatic hydrocarbon 21.43 C11H16 1146 0.12 0.12 0.00 0.00 0.00 0.00 0.07 0.04 0.03 0.04 0.00 0.01 0.00 0.00 0.00 0.00
C48 4-Methyl indane Others 21.57 C10H12 1149 0.10 0.03 0.00 0.00 0.01 0.01 0.03 0.01 0.00 0.01 0.05 0.01 0.00 0.00 0.00 0.00
C49 1,4-Diethyl-2-methyl benzene Aromatic hydrocarbon 21.70 C11H16 1153 0.27 0.07 0.00 0.01 0.03 0.06 0.14 0.23 0.01 0.12 0.02 0.06 0.00 0.00 0.00 0.00
C50 1,2,3,4-Tetramethyl fulvene Others 22.03 C10H14 1162 0.08 0.16 0.04 0.07 0.04 0.12 0.07 0.10 0.01 0.03 0.04 0.00 0.00 0.00 0.13 0.03
C51 [but-2-en-2-yl]Benzene Aromatic hydrocarbon 21.97 C10H12 1160 0.40 0.19 0.07 0.13 0.15 0.16 0.12 0.10 0.01 0.03 0.04 0.02 0.00 0.00 0.13 0.03
C52 2,3-Dimethyl decane Alkane 22.10 C12H26 1163 0.12 0.98 0.37 0.22 0.25 0.19 0.18 0.77 0.76 2.27 2.47 0.82 0.00 0.02 0.26 0.34
C53 4’-Methyl propiophenone Ketone 22.50 C10H12O 1174 0.23 0.52 0.56 0.51 0.61 0.41 0.42 2.34 2.37 0.53 3.39 2.26 0.00 0.02 0.56 0.24
C54 5-Butan-2-ylnonane Alkane 22.30 C13H28 1168 0.14 0.78 0.18 0.18 0.17 0.17 0.19 0.07 2.08 0.00 2.20 0.09 0.00 0.00 0.22 0.20
C55 9-Methyl heptadecane Alkane 22.50 C18H38 1174 0.16 0.09 0.02 0.00 0.02 0.02 0.12 0.11 0.04 0.04 0.02 0.00 0.00 0.00 0.00 0.00
C56 3-Methyl undecane Alkane 22.70 C12H26 1179 0.09 0.08 0.02 0.00 0.02 0.05 0.12 0.12 0.09 0.04 0.02 0.03 0.00 0.00 0.00 0.00
C57 1-Ethyl-2,4,5-trimethyl benzene Aromatic hydrocarbon 22.63 C11H16 1177 0.20 0.77 0.56 0.43 0.55 0.39 0.45 0.00 2.24 2.60 0.07 2.26 0.00 0.00 0.68 0.25
C58 1-Methyl-cyclododecene Olefine 22.83 C13H24 1183 0.23 0.17 0.08 0.05 0.00 0.07 1.91 0.02 0.05 0.05 0.04 0.02 0.00 0.22 0.93 0.73
C59 3,7,11-Trimethyl dodecan-1-ol Alcohol 23.30 C15H32O 1195 0.11 0.25 0.01 0.01 0.07 0.09 0.10 0.20 0.22 5.81 5.15 0.17 0.00 0.00 0.11 0.00
C60 Dodecane Alkane 23.57 C12H26 1202 0.02 0.00 0.00 0.00 0.01 0.05 0.42 0.05 0.04 0.04 0.02 0.03 0.00 0.00 0.00 0.00
C61 (+)-α-Terpineol Terpenes 23.50 C10H18O 1200 1.26 1.23 2.87 2.49 3.06 2.47 2.14 2.35 5.94 2.38 5.64 6.01 0.29 0.28 2.82 1.93
C62 3,4-Dimethyl cumene Aromatic hydrocarbon 23.70 C11H16 1206 0.18 0.04 0.00 0.00 0.05 0.05 0.11 0.02 0.09 0.01 0.02 0.02 0.00 0.00 0.00 0.00
C63 4,7-Dimethyl undecane Alkane 23.77 C13H28 1208 0.25 1.13 0.76 0.55 0.55 0.52 0.64 1.06 1.67 1.06 1.63 1.10 0.00 0.06 0.56 1.29
C64 Cyclodecanol Others 23.83 C10H20O 1210 0.12 0.14 0.04 0.08 0.07 0.09 0.15 0.33 0.08 0.02 0.08 0.07 0.00 0.00 0.03 0.04
C65 2,6-Dimethyl undecane Alkane 24.10 C13H28 1217 0.61 0.95 1.24 1.06 1.28 1.02 1.47 3.87 2.49 2.32 2.32 3.43 0.08 0.08 1.13 0.46
C66 2,4-Dimethyl acetophenone Ketone 24.17 C10H12O 1219 0.06 0.03 0.02 0.00 0.02 0.03 0.06 0.04 0.28 0.02 0.02 0.01 0.00 0.00 0.00 0.00
C67 2-Hydroxycineole Others 24.23 C10H18O2 1221 0.00 0.01 0.00 0.00 0.01 0.00 0.47 0.01 0.01 0.01 0.01 0.00 0.00 0.00 0.00 0.00
C68 2,8-Dimethyl undecane Alkane 24.37 C13H28 1225 0.11 0.12 0.39 0.33 0.40 0.28 0.38 0.28 0.20 0.23 0.21 0.26 0.06 0.04 0.42 0.48
C69 2,6-Dimethyl benzaldehyde Others 24.43 C9H10O 1227 0.01 0.00 0.00 0.00 0.05 0.06 0.01 0.42 0.21 0.29 0.20 0.23 0.00 0.00 0.00 0.00
C70 2-Hydroxycineol Others 24.63 C10H18O2 1232 0.00 0.10 0.00 0.00 0.00 0.00 0.51 0.02 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
C71 Thieno[2,2,3]pyridine Others 24.83 C7H5NS 1239 0.00 0.00 0.00 0.00 0.00 0.00 0.07 0.10 0.05 0.06 0.06 0.05 0.00 0.00 0.00 0.00
C72 3-Hydroxy cineole Others 25.23 C10H18O2 1249 0.00 0.00 0.00 0.00 0.00 0.00 0.30 0.10 0.10 0.06 0.03 0.03 0.00 0.00 0.00 0.00
C73 4-Methyl dodecane Alkane 25.57 C13H28 1258 0.81 1.52 1.43 1.74 1.84 1.68 2.44 2.22 1.23 1.39 1.26 1.40 0.18 0.10 1.00 1.89
C74 1,3-Di-tert-butyl benzene Aromatic hydrocarbon 25.70 C14H22 1262 0.04 0.01 0.00 0.00 0.01 0.00 0.07 0.01 0.02 0.01 0.00 0.03 0.00 0.00 0.00 0.00
C75 4,7-Dimethyl indan Others 25.63 C11H14 1261 0.13 0.89 0.27 0.24 0.28 0.96 0.39 3.83 3.36 3.66 3.34 3.69 0.15 0.12 0.33 0.75
C76 2,3-Dimethyl undecane Alkane 25.70 C13H28 1262 2.97 5.75 6.96 6.91 7.49 6.84 7.11 7.59 6.91 7.50 6.77 7.64 1.25 0.91 7.15 5.78
C77 2,4-Dimethyl dodecane Alkane 25.90 C14H30 1268 0.22 0.25 0.74 0.63 0.28 0.55 0.95 0.21 0.16 0.18 0.20 0.25 0.14 0.12 0.49 0.37
C78 2,6,11-Trimethyl dodecane Alkane 26.43 C15H32 1283 0.49 0.85 1.42 1.19 1.64 1.14 2.27 4.41 4.14 2.16 3.96 4.52 0.19 0.18 1.45 0.57
C79 2,3,4-Trimethyl dodecane Alkane 26.77 C13H28 1292 0.10 0.21 0.44 0.32 0.33 0.25 0.48 2.58 1.61 2.21 1.93 2.43 0.00 0.02 0.31 0.25
C80 1,5,6,7-Tetramethylbicyclo[3.2.0]hepta-2,6-diene Olefine 26.77 C11H16 1293 0.05 0.00 0.00 0.00 0.00 0.00 0.02 0.00 0.00 0.00 0.01 0.00 0.00 0.00 0.00 0.00
C81 1,7,7-Trimethylbicyclo[2.2.1]heptan-2-yl acetate Others 26.90 C12H20O2 1296 0.01 0.00 0.00 0.00 0.00 0.00 0.01 0.04 0.09 0.01 0.01 0.01 0.00 0.00 0.00 0.00
C82 2-Undecanone Ketone 26.97 C11H22O 1298 0.20 0.09 0.00 0.00 0.06 0.08 1.10 0.13 0.09 0.12 0.09 0.12 0.00 0.00 0.08 0.00
C83 Tridecane Alkane 27.17 C13H28 1304 0.17 0.00 0.11 0.00 0.14 0.15 0.00 2.78 1.44 2.13 1.30 2.34 0.15 0.06 0.32 0.17
C84 4,6-Dimethyl dodecane Alkane 27.23 C14H30 1306 0.12 0.24 0.28 0.41 0.32 0.28 0.63 2.04 0.26 1.61 0.27 1.72 0.20 0.08 0.34 0.13
C85 1-Methyl naphthalene Aromatic hydrocarbon 27.30 C11H10 1308 0.07 0.04 0.00 0.00 0.00 0.00 0.04 0.01 0.01 0.01 0.02 0.01 0.00 0.00 0.00 0.00
C86 2,3,5,8-Tetramethyl decane Alkane 27.43 C14H30 1312 0.68 1.50 0.94 1.51 1.52 1.48 2.42 0.43 0.31 0.29 0.27 0.38 0.22 0.08 1.20 0.93
C87 α-Methyl-1H-indene-1-methanol acetate Others 27.90 C13H14O2 1326 0.08 0.02 0.00 0.00 0.00 0.00 0.03 0.26 0.01 0.04 0.03 0.01 0.00 0.00 0.00 0.00
C88 2,7,10-Trimethyl dodecane Alkane 28.37 C15H32 1339 0.09 0.29 0.17 0.16 0.18 0.17 0.33 1.57 0.61 0.74 0.67 1.01 0.00 0.00 0.19 0.06
C89 Silphiperfol-5-ene Terpenes 28.37 C15H24 1339 0.17 0.00 0.00 0.00 0.00 0.00 0.07 0.01 0.03 0.02 0.02 0.01 0.00 0.00 0.12 0.00
C90 4-Ethyl undecane Alkane 28.97 C13H28 1357 0.08 0.11 0.06 0.10 0.09 0.09 0.18 0.20 0.00 0.21 0.44 0.68 0.00 0.00 0.13 0.14
C91 Silphinene Terpenes 29.10 C15H24 1361 0.45 0.02 0.00 0.00 0.00 0.00 0.03 0.01 0.00 0.01 0.02 0.00 0.00 0.00 0.05 0.00
C92 2,3-Dimethyl dodecane Alkane 29.30 C14H30 1367 0.05 0.13 0.12 0.16 0.14 0.18 0.11 0.44 0.37 0.48 0.44 0.61 0.00 0.00 0.07 0.08
C93 α-Longipinene Terpenes 29.30 C15H24 1367 0.10 0.02 0.00 0.00 0.00 0.00 0.01 0.01 0.02 0.01 0.02 0.02 0.00 0.00 0.10 0.00
C94 farnesane Alkane 29.70 C15H32 1378 0.05 0.08 0.03 0.03 0.05 0.05 0.19 0.21 0.25 0.28 0.41 0.58 0.07 0.04 0.04 0.06
C95 (+)-Cyclosativene Terpenes 29.83 C15H24 1382 0.15 0.01 0.00 0.00 0.00 0.00 0.14 0.01 0.02 0.02 0.02 0.02 0.00 0.00 0.10 0.13
C96 Modephene Terpenes 30.37 C15H24 1398 1.00 0.02 0.00 0.00 0.00 0.00 0.05 0.02 0.06 0.01 0.03 0.03 0.00 0.00 0.20 0.20
C97 Tetradecane Alkane 30.50 C14H30 1402 0.27 0.36 0.44 0.50 0.01 0.02 0.51 1.64 0.68 0.61 0.92 1.77 0.24 0.18 0.38 0.38
C98 α-Isocomene Terpenes 30.57 C15H24 1404 2.56 0.02 0.00 0.00 0.00 0.00 0.05 0.00 0.05 0.01 0.01 0.02 0.00 0.00 0.05 0.03
C99 (−)-α-Gurjunene Terpenes 30.97 C15H24 1417 6.99 0.02 0.07 0.06 0.12 0.60 0.10 0.07 0.03 0.03 0.03 0.04 0.00 0.00 0.06 0.00
C100 2,6-Dimethyl heptadecane Alkane 31.23 C19H40 1425 0.04 0.08 0.08 0.05 0.11 0.08 0.09 0.91 0.02 0.30 0.03 0.92 0.00 0.00 0.09 0.00
C101 β-Maaliene Terpenes 31.30 C15H24 1428 3.45 0.03 0.00 0.00 0.01 0.02 0.05 0.03 0.01 0.06 0.01 0.02 0.00 0.00 0.07 0.07
C102 (−)-Aristolene Terpenes 31.57 C15H24 1436 1.57 0.00 0.00 0.00 0.01 0.02 0.05 0.02 0.01 0.03 0.03 0.00 0.00 0.00 0.00 0.11
C103 2-Isopropyl-5-methyl-9-methylene[4.4.0]dec-1-ene Terpenes 31.70 C15H24 1441 0.29 0.01 0.00 0.00 0.00 0.00 0.05 0.00 0.03 0.03 0.05 0.05 0.00 0.00 0.12 0.12
C104 α-Bergamotene Terpenes 31.90 C15H24 1447 0.32 0.02 0.00 0.08 0.01 0.00 0.06 0.01 0.02 0.06 0.00 0.07 0.00 0.00 0.00 0.00
C105 Isoledene Terpenes 32.03 C15H24 1451 6.98 0.00 0.00 0.00 0.00 0.00 0.04 0.04 0.03 0.04 0.03 0.02 0.00 0.00 0.12 0.05
C106 Guaia-3,9-diene Terpenes 32.23 C15H24 1458 0.25 0.00 0.00 0.00 0.00 0.00 0.03 0.01 0.01 0.01 0.02 0.04 0.00 0.00 0.00 0.00
C107 2,10-Dimethyl heptadecane Alkane 32.50 C19H40 1466 0.58 0.00 0.00 0.00 0.00 0.00 0.03 0.06 0.01 0.01 0.00 0.00 0.00 0.00 0.00 0.00
C108 Seychellene Terpenes 32.43 C15H24 1464 0.17 0.22 0.21 0.28 0.23 0.24 0.46 1.21 0.77 0.20 0.92 0.89 0.14 0.11 0.20 0.17
C109 2,6-Di-tert-butyl-4-methyl-p-quinol Ketone 32.97 C15H24O2 1481 0.38 0.04 0.04 0.06 0.01 0.06 0.24 0.02 0.01 0.04 0.04 0.01 0.22 0.12 0.08 0.10
C110 Pentadecane Alkane 33.30 C15H32 1491 0.05 0.11 0.12 0.19 0.16 0.16 0.23 1.18 0.48 0.17 0.57 0.59 0.00 0.00 0.11 0.00
C111 (+)-Valencene Terpenes 33.30 C15H24 1492 0.22 0.00 0.00 0.00 0.00 0.00 0.01 0.00 0.05 0.02 0.02 0.03 0.83 0.42 0.03 0.03
C112 β-Sesquiphellandrene Terpenes 33.57 C15H24 1500 0.87 0.09 0.02 0.22 0.07 0.07 0.14 0.01 0.01 0.03 0.01 0.01 0.00 0.00 0.03 0.08
C113 1-Iodo-2-methyl undecane Alkane 33.90 C12H25I 1511 0.04 0.04 0.04 0.05 0.16 0.41 0.11 0.15 0.10 0.11 0.12 0.15 0.00 0.00 0.00 0.00
C114 α-Bulnesene Terpenes 33.97 C15H24 1514 0.19 0.04 0.00 0.00 0.02 0.06 0.02 0.00 0.00 0.00 0.02 0.03 0.07 0.03 0.00 0.04
C115 2,4-Di-tert-butyl phenol Phenols 34.17 C14H22O 1520 0.12 0.04 0.13 0.25 0.16 0.51 0.10 0.75 0.26 0.00 0.00 0.00 0.00 0.00 0.11 0.08
C116 2,4-Di-tert-butyl-6-methyl phenol Phenols 34.30 C15H24O 1525 0.00 0.01 0.00 0.00 0.00 0.00 0.08 0.00 0.00 0.02 0.70 0.76 11.27 9.14 0.10 0.21
C117 (+)-Cuparene Terpenes 34.37 C15H22 1527 0.06 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.80 0.00 0.00 0.00 0.00 0.00 0.00
C118 Hexadecane Alkane 36.70 C16H34 1605 0.06 0.09 0.11 0.12 0.06 0.11 0.08 0.11 0.06 0.02 0.12 0.15 0.02 0.02 0.12 0.24
C119 2,6-Di-tert-butyl-4-sec-butyl phenol Phenols 37.97 C18H30O 1649 0.01 0.03 0.03 0.03 0.02 0.03 0.01 0.02 0.02 0.02 0.02 0.02 0.00 0.00 0.03 0.06
C120 Pristane Alkane 39.70 C19H40 1710 0.02 0.02 0.03 0.04 0.03 0.05 0.05 0.03 0.04 0.04 0.04 0.03 0.00 0.00 0.02 0.06
Open in a new tab

Note: For descriptions of W, A, A-0, A-1, A-2, A-3, FB, FC20d, FC40d, FC60d, FC80d, FC100d, Tx-LU, Tx-LI, Tx-PU, and Tx-PI, please refer to Table 1.

Figure 2.

Figure 2

Open in a new tab

The number (A) and relative content (B) of volatile compounds of each class in different products. Note: For descriptions of W, A, A0, A1, A2, A3, FB, FC20d, FC40d, FC60d, FC80d, FC100d, Tx-LU, Tx-LI, Tx-PU, and Tx-PI, please refer to Table 1).

Twenty-four volatile compounds were identified in all the 16 samples, including 4-carene (C10), 3-carene (C18), 2,2,4,4-tetramethyloctane (24), 2-propyltoluene (C29), 2,4,6-trimethyldecane (C31), 2,6-dimethyl-6-trifluoroacetoxyoctane (C34), linalool (C41), 2-nonen-1-ol (C42), 6-ethyl-2-methyloctane (C44), (+)-α-terpineol (C61), 2,6-dimethylundecane (C65), 2,8-dimethylundecane (C68), 4-methyldodecane (C73), 4,7-dimethylindan (C75), 2,3-dimethylundecane (C76), 2,4-dimethyldodecane (C77), 2,6,11-trimethyldodecane(C78), 4,6-dimethyldodecane (C84), 2,3,5,8-tetramethyldecane (C86), farnesane (C94), tetradecane (C97), seychellene (C108), 2,6-di-tert-butyl-4-methyl-p-quinol (C109), and hexadecane (C118). The mutual volatile compounds accounted for 40.19%, 41.24%, 51.44%, 48.59%, 50.58%, 41.86%, 38.44%, 48.04%, 48.31%, 47.03%, 44.37%, 48.49%, 64.94%, 68.73%, 49.13%, and 40.87% of the total volatile compounds in W, A, A0, A1, A2, A3, FB, FC20d, FC40d, FC60d, FC80d, FC100d, Tx-LU, Tx-LI, Tx-PU, and Tx-PI, respectively. With the method of simultaneous distillation-extraction (SDE) and GC-MS, 17 and 42 volatile compounds were identified in the mycelia of O. sinensis from solid-state media and submerged fermentation, respectively [17]; in Bailing capsule and Zhiling capsule, the commercial fermentation products of O. sinensis mycelia, 39 and 56 volatile compounds were identified, respectively [18]. While by the technique of HS-SPME combined with GC×GC-QTOFMS in this study, 99–107 volatile compounds were identified from the fermentation cultures of O. sinensis mycelia, indicating the superior sensitivity and resolution of the present method.

2.3. Major Compounds in Different Products

The numbers and percentage contents of volatile compounds in samples are of marked differences. Alkanes are the dominant volatile compounds in all samples. Alkane is also the class with the largest number in all samples (Figure 2). The top five compounds in the concentration of each sample are shown in Table 3.

Table 3.

Top five compounds in concentration from different products.

Sample Top Five Compounds
1 2 3 4 5
Compound No. Peak Area Percentage (%) Compound No. Peak Area Percentage (%) Compound No. Peak Area Percentage (%) Compound No. Peak Area Percentage (%) Compound No. Peak Area Percentage (%)
W C24 11.42 C19 8.24 C99 6.99 C105 6.98 C17 4.78
A C19 21.12 C34 8.16 C29 6.47 C76 5.75 C25 4.31
A0 C19 13.94 C20 10.77 C29 9.82 C31 8.78 C76 6.96
A1 C19 20.95 C20 8.39 C29 8.11 C76 6.91 C24 6.32
A2 C19 17.49 C29 10.91 C20 9.75 C76 7.49 C31 5.90
A3 C19 17.56 C21 7.31 C76 6.84 C20 6.41 C29 5.65
FB C2 10.80 C19 8.18 C76 7.11 C14 5.29 C34 4.23
FC20d C76 7.59 C24 6.73 C38 6.28 C20 5.63 C29 4.54
FC40d C24 9.70 C19 9.40 C38 8.33 C76 6.91 C61 5.94
FC60d C20 9.35 C24 8.54 C76 7.50 C29 7.38 C59 5.81
FC80d C21 7.69 C19 7.63 C24 7.56 C76 6.77 C38 6.72
FC100d C38 7.70 C76 7.64 C20 7.61 C61 6.01 C24 5.38
Tx-LU C24 56.02 C116 11.27 C23 3.22 C5 1.57 C34 1.48
Tx-LI C24 61.87 C116 9.14 C5 3.72 C23 2.55 C1 1.22
Tx-PU C19 14.60 C29 11.44 C76 7.15 C31 5.91 C34 5.71
Tx-PI C19 29.16 C34 7.31 C76 5.78 C29 5.72 C5 5.09
Open in a new tab

Note: C1: 3-Prop-2-enylidenecyclobutene; C2: 2-methylcyclopentanol; C5: o-xylene; C14: 6-ethenyl-2,2,6-trimethyloxan-3-one; C17: 1,2,3-trimethylbenzene; C19: 2,5,6-trimethyldecane; C20: 2,6,7-trimethyldecane; C21: o-cymene; C23: D-limonene; C24: 2,2,4,4-tetramethyloctane; C25: 2,5,9-trimethyldecane; C29: 2-propyltoluene; C31: 2,4,6-trimethyldecane; C34: 2,6-dimethyl-6-trifluoroacetoxyoctane; C38: 1,2-dimethoxyethylbenzene; C59: 3,7,11-trimethyldodecan-1-ol; C61: (+)-α-terpineol; C76: 2,3-dimethylundecane; C99: (−)-α-gurjunene; C105: isoledene; C116: 2,4-ditert-butyl-6-methyl phenol. The compounds corresponding to the compound numbers are also shown in Table 2.

2,5,6-trimethyldecane (C19) is the most abundant compound in artificial cultivated Chinese cordyceps (A, A0, A1, A2, A3) and insect pupae (Tx-PU and Tx-PI), and it is also the major compound in W, FB, and FC40d, FC80d, and FC100d (Table 3). This compound is so far detected from beneficial plants such as Irish York cabbage [28], stevia Stevia rebaudiana leaves [29], an aquatic perennial herb Limnophila indica extract [30], plant-based food such as chestnut and jujube honey [31], and from exhaled breath in both children with allergic asthma and control [32]. 5,6-Dihydro-6-pentyl-2H-pyran-2-one (massoia lactone) is discovered as the dominant volatile component in a fermented mycelial product of Paecilomyces hepiali fungus [18]. 2,5,6-trimethyldecane is the first reported dominant volatile compound in O. sinensis-based products in the present study. Moreover, it seemed interesting that uninfected insect pupae also contained high concentrations of this compound. Its characteristics and possible pharmacological functions need further study.

2,3-dimethylundecane (C76) is another major component presented in 13 samples accounting for >5% of the total peak areas; however, the contents in samples of W, Tx-LU, and Tx-LI were lower, accounting for 2.97%, 1.25%, and 0.91%, respectively (Table 2 and Table 3). This compound was found from the essential oil of a small glabrous, perennial herb Viola serpens [33] and from the odors emitted from the dung of free-ranging white rhinos for differentiating sex [34].

A high content of 2,2,4,4-tetramethyloctane (C24) was found in the two larval samples of Tx-LU and Tx-LI, accounting for 56.02% and 61.87% of the total peak areas, although it is not reported from other insects. 2,2,4,4-tetramethyloctane is also the major compound of all the liquid fermentation samples (FC20d, FC40d, FC60d, FC80d, and FC100d). It was reported also in aged vinegar as an aroma compound [35], common wasp Vespula vulgaris colonies [36], Manchego and Gouda cheeses [37], Allium macrostemon flowers and aerial parts [38], the seeds and leaves of Synsepalum dulcificum [39], green teas [40], dry-cured meat products [41], and the stem of Guanyin tea [42]. It appears that this volatile mainly acts as an aroma compound from the plants and foods.

2,4-di-tert-butyl-6-methylphenol (C116) is the second principal component in the two larval samples of Tx-LU and Tx-LI, accounting for 11.27% and 9.14% of the total peak areas, but it accounts for little or no proportion in other samples. This volatile is detected from the essential oil in eaglewood [43] and entomopathogenic Metarhizium anisopliae fungus cultures [44].

The most abundant volatile compound was butylated hydroxytoluene, and the major classes compounds were phenols, acids, and alkanes in the mycelia of O. sinensis cultured by solid-state media and submerged fermentation [17]. 5,6-Dihydro-6-pentyl-2H-pyran-2-one (massoia lactone) was the dominant component in Jinshuibao capsule (Paecilomyces hepiali) volatiles, and fatty acids including palmitic acid (C16:0) and linoleic acid (C18:2) were also found to be major volatile compositions in the commercial fermentation products of Bailing capsule (O. sinensis), Zhiling capsule (Mortierella SP), Ningxinbao capsule (Cephalosporium sinensis), and Xinganbao capsule (Gliocladium roseum) [18]. In the present study, volatile compounds of alkanes are the most abundant all products, although there are differences among the volatile compound profiles of O. sinensis fungus, Thitarodes hosts of O. sinensis, and the natural and aritificial-producing Chinese cordyceps, even between the natural and artificial-producing Chinese cordyceps. It appeared that O. sinensis-based products from different culture conditions exhibit quite different metabolites.

The fermented products of O. sinensis mycelia are claimed to be used as sustainable substitutes for natural Chinese cordyceps [45]. However, from the view of the differences in volatile compounds, it seems that the fermented products are not the same as the natural and artificial Chinese cordyceps.

2.4. Multivariate PLS-DA Analysis

PLS-DA was performed to evaluate the variations among the volatile compound profiles obtained from GC×GC-QTOFMS data for different products. The PLS-DA scores plot shows clear classification of the three groups: fruiting bodies and fermented cultures of O. sinenis fungus, T. xiaojinensis insects, and insect–fungus complexes (Figure 3A). PLS (Partial least square) component 1 (PLS 1) and PLS component 2 (PLS 2) explained 21.5% and 19.0% of the variance, respectively, and hence together, they explained 40.05% of the total variance. The parameters of the cross-validation modeling for the fifth PLS component were R2X = 0.73, R2Y = 0.992, and Q2Y = 0.896, showing high levels of an explained variance and predictability. A permutation test involving 200 iterations was also conducted to validate the model, which yielded R2 = 0.770 and Q2 = −0.480.

Figure 3.

Figure 3

Open in a new tab

Partial least squares-discriminant analysis (PLS-DA) analysis of 16 products. (A): Scores plot, (B): variable importance projection (VIP) score plot, (C): loadings plot. F: Fungus of Ophiocordyceps sinensis; I: Larvae or pupae of Thitarodes xiaojinensis; FI: Fungus–insect complexes.

To explain the relationships between variables and products, loading scatter plots were performed (Figure 3B). As shown in the loadings plot PLS-DA model (Figure 3B), X-variables situated in the vicinity of the dummy Y-variables had the highest discriminatory power among the groups and had higher VIP (variable importance projection) values, thus contributing more to the differences of different groups. The VIP values of each compound were calculated (Figure 3C). The compounds with larger VIP values represent higher contributions to the discrimination of different groups. In the study, volatile components with VIP values > 1 and p < 0.05 were considered as representative differential compounds. A total of 28 differential volatile compounds were identified, although there were 48 volatile compounds with VIP values > 1. It showed that the majority of variables gave a not significant contribution to the model. The 28 differential volatile compounds included thieno [2,3-c] pyridine (C71), 2,6,11-trimethyldodecane (C78), 2,3,4-trimethyldodecane (C79), 4,7-dimethylindan (C75), 2,6-dimethylundecane (C65), farnesane (C94), 2,3-dimethyldodecane (C92), [but-2-en-2-yl] benzene (C51), 2-methylcyclopentanone (C8), 2-undecanone (C83), 2,8-dimethylundecane (C69), α-methyl-1H-indene-1-methanol acetate (C88), 2,6-dimethylheptadecane (C108), 1,2-dimethoxyethylbenzene (C38), 2,6-dimethyl-6-trifluoroacetoxyoctane (C34), modephene (C97), 4’-methylpropiophenone (C53), 2,6-di-tert-butyl-4-methyl-p-quinol (C110), o-xylene (C5), 3-methyl-undecane (C56), tridecane (C84), 2,5,6-trimethyldecane (C19), sabinene (C13), dodecane (C61), β-sesquiphellandrene (C113), 2,3-dimethyldecane (C52), 3,4-dimethylcumene (C63), and 4,7-dimethylundecane (C64). Among them, the first eight volatiles including thieno [2,3-c] pyridine (C71), 2,6,11-trimethyldodecane (C78), 2,3,4-trimethyldodecane (C79), 4,7-dimethylindan (C75), 2,6-dimethylundecane (C65), farnesane (C94), 2,3-dimethyldodecane (C92), and [but-2-en-2-yl] benzene (C51) showed higher discriminatory potential with VIP values greater than 1.5.

3. Materials and Methods

3.1. Chemicals

All solvents used were chromatographic grade. Phenylethyl acetate (internal standard) with purity greater than 99.0% was purchased from Sigma-Aldrich-Fluka (Buchs, Switzerland). The internal standard with a concentration of 22.9 µg/mL was prepared in acetonitrile. A standard series of n-alkanes (C8–C25) were provided by Dr. Ehrensorfer (Augsburg, Germany). Methanol (chromatographic grade purity) and acetonitrile (chromatographic grade purity) were purchased from Merck (LiChrosolv, Germany). All chemicals were stored at 4 °C until use. The SPME holder for manual sampling and fibers of 65 µm divinylbenzene/carboxen/polydimethylsiloxane (DVB/CAR/PDMS, 1 cm of length) were purchased from Supelco (Aldrich, Bellefonte, PA, USA).

3.2. Samples

The samples for GC-MS analysis are listed in Table 1. Natural Chinese cordyceps were collected from Kangding, Sichuan Province, China. The KD1223 strain of O. sinensis fungus isolated from the fruiting bodies of natural Chinese cordyceps was cultured in a 100 rpm shaker with potato dextrose liquid medium supplemented with 10% peptone (PPD) at 13 °C. The fungus was identified by molecular method using the internal transcribed spacer (ITS; ITS1-5.8S-ITS2) of nuclear ribosomal DNA amplification as described before. The identified O. sinensis strain was preserved at −80 °C at the Guangdong Institute of Applied Biological Resources, Guangzhou, China.

Artificial cultivation of fruiting bodies on rice media [6] or whole Chinese cordyceps by challenging T. xiaojinensis larvae with O. sinensis fungus [7,8,11] were established in low altitude Guangzhou, with mimicking environmental conditions. The insect species was identified using a molecular method by the amplification of the Cytochrome b sequences with the primers CB1 (TATGTACTACCATGAGGACAAATATC) and CB2 (ATTACACCTCCTAATTTATTAGGAAT) [46], as described previously [47,48]. The mummified cadavers with mycelia but without fruiting body (before stroma development), and the insect larvae and pupae with or without the injected blastospores (9 months for larvae or 9 months for pupae) were also used for the analysis. The existence of blastospores in the live larvae and pupae was confirmed by hemolymph microscopic examination.

A total of 50 individuals of each sample (for natural and artificial Chinese cordyceps, mummified cadavers, live larvae and pupae with or without blastospores), 30 g of fresh artificial fruiting bodies, and three flasks of fermentation cultures (150 mL/flask) were sampled. Samples were frozen at −80 °C overnight and lyophilized for 48–72 h by vacuum-freeze dryer (Alpha 1-2 LD plus, Marin Christ Gefriertrocknungsanlagen, Osterode, Germany) to consistent weight. The dried samples were grinded at 1000 rpm for 3 min by a multifunctional high-throughput tissue ball mill (GT100, Beijing Grinder Instrument Co., Ltd., Beijing, China) and stored at −80 °C. A quality control (QC) sample was prepared by mixing each collected sample in equal quantities and used for analytical method establishment and methodology examination.

3.3. GC×GC-QTOFMS Analysis for Volatile Components

The analysis of volatile composition and analytical method validation were referenced by the method of previous reports [19,21,24]. The volatile constituents of O. sinensis and host insects were analyzed by comprehensive two-dimensional gas chromatography (7890B-SSM1800, Agilent Technologies, Santa Clara, CA, USA and J&X Technologies, Shanghai, China) coupled with a high-resolution quadrupole time-of-flight mass spectrometry (QTOFMS) (7250, Agilent Technologies). First, 100 mg of samples were accurately weighed into a 20 mL vial, and then the SPME fiber that was equilibrated at 270 °C for 30 min in an autosampler (PAL RSI 120, CTC Technologies, Alexandria, VA, USA) was exposed to the headspace of the bottle for 20 min at 60 °C. Then, the SPME fiber was introduced into the GC splitless injector and kept there for 3.0 min to allow thermal desorption of the analytes. All samples were conducted in triplicate to check the repeatability and reliability of the method development. Reproducibility is expressed as the relative standard deviation (RSD). To compare the techniques of GC-MS and GC×GC-MS, a quality control sample (mix of each collected sample) was analyzed by both techniques under the same chromatographic conditions. The analytical system was equipped with simultaneous 1DGC and GC×GC in one instrument, which can conduct both techniques at the same time without any change of columns. The samples were introduced by a splitless injector (SSL) system equipped with an autosampler. Peak separation was performed on a weak-polar column HP-5 MS (5% phenyl-95% dimethylpolysiloxane, 30 m × 250 μm, 0.25 μm) in the first dimension and a more polar column DB-17 MS (50% phenyl-50% dimethylpolysiloxane, 1.2 m × 180 μm, 0.18 μm) in the second dimension (both from Agilent Technologies, USA).

The 1DGC and GC×GC conditions were the same. The GC injector was kept at 250 °C in splitless mode. The carrier gas was helium with a flow rate of 1.0 mL/min for the first dimensional column. The initial oven temperature was 50 °C; it was held for 3 min and then ramped at a rate of 4 °C/min to 230 °C and held for 1 min. For the GC×GC system, the carrier gas was helium with a flow rate of 3.14 mL/min for second dimensional column, and the cold zone temperature of modulator was set at −50 °C. The temperatures of the entry hot zone and exit hot zone were +30 and +120 °C relative to oven temperatures, respectively, with a cap temperature of 320 °C for both hot zones. The modulation period was 4 s.

The MS transfer line temperature was kept at 280 °C, and the ion source temperature was kept at 200 °C. Electron impact ionization was 70 eV. Data were collected as a mass range of 50–500 m/z at a sampling rate of 50 scan/s, and a solvent delay of 8 min was used.

3.4. Data Analysis

Qualitative and semi-quantitative methods primarily were referenced with similar reports [26,27]. Compound identification was based on mass spectra comparison with NIST 17 library (NIST/EPA/NIH 2017) with the minimum requirements of match factor above 800. Further confirmation was carried out using one-dimensional retention index (RI) and accurate mass, as described in many previous studies [49]. In order to compare the reference RI values with experimental RI values obtained in this work, a standard mixture of n-alkanes (C8–C25) was injected (0.5 μL) in the GC×GC-QTOFMS system under the same conditions used for the samples. The semi-quantitative method was performed based on peak area normalization. The 1-DGC data were processed using Agilent Mass Hunter Qualitative Analysis Navigator B.08.00. The GC×GC data were analyzed by a dedicated GC×GC data processing software Canvas (V1.4.0, J & X Technologies).

To visualize the clustering among categories and identify the differentially changed components responsible for the separation, supervised partial least squares discriminant analysis (PLS-DA) and variable importance in projection (VIP) score were carried out using SIMCA 14.1 software (Umetrics, Umea, Sweden). A data set consisting of a 16 × 120 matrix was conducted by PLS-DA. The rows represent the samples analyzed and the columns represent the relative contents of the volatile metabolites determined by GC×GC-QTOFMS. All variables were scaled with unit variance (UV) prior to PLS-DA. To gain the chemical markers for discrimination of the three groups in the PLS-DA model, VIP values were calculated and inspected for identified volatile compounds. Generally, VIP values > 1 and p < 0.05 are considered as significant contributors to the model [40,50,51]. In this study, seven-fold cross-validation and 200 response permutation testing (RPT) methods were used to investigate the quality of the model.

4. Conclusions

This study presents the volatile metabolite profiles by HS-SPME-GC×GC-QTOFMS from O. sinensis fungus and insect host-based products. A total of 120 volatile compounds including 36 alkanes, 25 terpenes, 17 aromatic hydrocarbons, 10 ketones, 5 olefines, 5 alcohols, 3 phenols, and 19 other compounds were identified. There are great differences in the volatile compounds among the three categories of O. sinensis fungus, Thitarodes hosts of O. sinensis, and the Chinese cordyceps. In general, natural and mature artificial Chinese cordyceps (fungus–insect complexes), fruiting bodies, and fermented products had more volatile compounds than insect larvae, insect pupae, and immature artificial Chinese cordyceps. Twenty-four volatile compounds were identified in all the 16 samples, including 4-carene (C10), 3-carene (C18), 2,2,4,4-tetramethyloctane (24), 2-propyltoluene (C29), 2,4,6-trimethyldecane (C31), 2,6-dimethyl-6-trifluoroacetoxyoctane (C34), linalool (C41), 2-nonen-1-ol (C42), 6-ethyl-2-methyloctane (C44), (+)-α-terpineol (C61), 2,6-dimethylundecane (C65), 2,8-dimethylundecane (C68), 4-methyldodecane (C73), 4,7-dimethylindan (C75), 2,3-dimethylundecane (C76), 2,4-dimethyldodecane (C77), 2,6,11-trimethyldodecane(C78), 4,6-dimethyldodecane (C84), 2,3,5,8-tetramethyldecane (C86), farnesane (C94), tetradecane (C97), seychellene (C108), 2,6-di-tert-butyl-4-methyl-p-quinol (C109), and hexadecane (C118). Alkanes are the dominant volatile compounds in all products. 2,5,6-trimethyldecane and 2,6,7-trimethyldecane are the major volatile compounds in all products except the larval ones, while 2,2,4,4-tetramethyloctane dominates in the larval products. From the view of the differences in volatile compounds, it seems that the fermented products are not the same as the natural and artificial Chinese cordyceps. Based on the volatile compounds, three classes (O. sinensis fungus, Thitarodes insect, and fungus–insect complexe) were confirmed by partial least squares-discriminant analysis (PLS-DA). Thieno [2,3-c] pyridine, 2,6,11-trimethyldodecane, 2,3,4-trimethyldodecane, 4,7-dimethylindan, 2,6-dimethylundecane, farnesane, 2,3-dimethyldodecane, and [but-2-en-2-yl] benzene are potential discriminatory compounds. The present results suggested that HS-SPME-GC×GC-QTOFMS combined with multivariate data analysis is an ideal method for analyzing and distinguishing different O. sinensis and insect hosts-based products. The information provided in this study is of importance for the further identification of bioactive components and for proposals of possible mechanisms to obtain those bioactive compounds in a different form than the traditional fungus-insect interaction.

Acknowledgments

The authors are grateful to Professor Zhangmin Xiang from Guangdong Institute of Analysis, Guangzhou, China for technical support.

Author Contributions

R.H. and X.Q. conceived and designed the experiments; L.C. and X.Q. prepared experimental samples; X.Q. performed the experiments and analyzed the data; X.Q. and R.H. wrote the manuscript. All the authors reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by Guangzhou Science and Technology Projects (201803010087; 201604020030), GDAS Special Project of Science and Technology Development (2018GDASCX-0107), and Open Project of Guangdong Key Laboratory of Animal Conservation and Resource Utilization (GIABR-KF201703).

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Sample Availability: Samples of the different Ophiocordyceps sinensis and insect host products in this study are available from the authors.

References

  • 1.Li S.P., Yang F.Q., Tsim K.W. Quality control of Cordyceps sinensis, a valued traditional Chinese medicine. J. Pharm. Biomed. Anal. 2006;41:1571–1584. doi: 10.1016/j.jpba.2006.01.046. [DOI] [PubMed] [Google Scholar]
  • 2.Zhou X.W., Gong Z.H., Su Y., Lin J., Tang K.X. Cordyceps fungi: Natural products, pharmacological functions and developmental products. J. Pharm. Pharmacol. 2009;61:279–291. doi: 10.1211/jpp.61.03.0002. [DOI] [PubMed] [Google Scholar]
  • 3.Shashidhar M.G., Giridhar P., Sankar K.U., Manohar B. Bioactive principles from Cordyceps sinensis: A potent food supplement–A review. J. Funct. Food. 2013;5:1013–1030. doi: 10.1016/j.jff.2013.04.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Yue K., Ye M., Zhou Z.J., Sun W., Lin X. The genus Cordyceps: A chemical and pharmacological review. J. Pharm. Pharmacol. 2013;65:474–493. doi: 10.1111/j.2042-7158.2012.01601.x. [DOI] [PubMed] [Google Scholar]
  • 5.Li Y., Wang X.L., Jiao L., Jiang Y., Li H., Jiang S.P., Lhosumtseiring N., Fu S.Z., Dong C.H., Zhan Y., et al. A survey of the geographic distribution of Ophiocordyceps sinensis. J. Microbiol. 2011;49:913–919. doi: 10.1007/s12275-011-1193-z. [DOI] [PubMed] [Google Scholar]
  • 6.Cao L., Ye Y., Han R. Fruiting body production of the medicinal Chinese caterpillar mushroom, Ophiocordyceps sinensis (Ascomycetes), in artificial medium. Int. J. Med. Mushrooms. 2015;17:1017–1022. doi: 10.1615/IntJMedMushrooms.v17.i11.110. [DOI] [PubMed] [Google Scholar]
  • 7.Cao L., Han R.C. Artificial Cultivation of Host Insects of Ophiocordyceps sinensis in Low Altitude Areas. No. ZL201410413333.7. Chinese Patent. 2014 Aug 20;
  • 8.Tao Z., Cao L., Zhang Y., Ye Y., Han R. Laboratory rearing of Thitarodes armoricanus and Thitarodes jianchuanensis (Lepidoptera: Hepialidae), hosts of the Chinese medicinal fungus Ophiocordyceps sinensis (Hypocreales: Ophiocordycipitaceae) J. Econ. Entomol. 2016;109:176–781. doi: 10.1093/jee/tov319. [DOI] [PubMed] [Google Scholar]
  • 9.Yan J.K., Wang W.Q., Wu J.Y. Recent advances in Cordyceps sinensis polysaccharides: Mycelial fermentation, isolation, structure, and bioactivities: A review. J. Funct. Food. 2014;6:33–47. doi: 10.1016/j.jff.2013.11.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Li X., Liu Q., Li W., Li Q., Qian Z., Liu X., Dong C. A breakthrough in the artificial cultivation of Chinese cordyceps on a large-scale and its impact on science, the economy, and industry. Crit. Rev. Biotechnol. 2019;39:181–191. doi: 10.1080/07388551.2018.1531820. [DOI] [PubMed] [Google Scholar]
  • 11.Liu G., Han R., Cao L. Artificial cultivation of the Chinese cordyceps from injected ghost moth larvae. Environ. Entomol. 2019;48:1088–1094. doi: 10.1093/ee/nvz099. [DOI] [PubMed] [Google Scholar]
  • 12.Yuan J.P., Zhao S.Y., Wang J.H., Kuang H.C., Liu X. Distribution of nucleosides and nucleobases in edible fungi. J. Agric. Food Chem. 2008;56:809–915. doi: 10.1021/jf0719205. [DOI] [PubMed] [Google Scholar]
  • 13.Zhao J., Xie J., Wang L.Y., Li S.P. Advanced development in chemical analysis of Cordyceps. J. Pharm. Biomed. Anal. 2014;87:271–289. doi: 10.1016/j.jpba.2013.04.025. [DOI] [PubMed] [Google Scholar]
  • 14.Liu Y., Wang J.H., Wang W., Zhang H.Y., Zhang X.L., Han C.C. The chemical constituents and pharmacological actions of Cordyceps sinensis. Evid.-Based Complement. Altern. Med. 2015;2015:575063. doi: 10.1155/2015/575063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mi J., Han Y., Xu Y., Kou J., Li W.J., Wang J.R., Jiang Z.H. Deep profiling of immunosuppressive glycosphingolipids and sphingomyelins in wild Cordyceps. J. Agric. Food. Chem. 2018;66:8991–8998. doi: 10.1021/acs.jafc.8b02706. [DOI] [PubMed] [Google Scholar]
  • 16.Yang F.Q., Feng K., Zhao J., Li S.P. Analysis of sterols and fatty acids in natural and cultured Cordyceps by one-step derivatization followed with gas chromatography–mass spectrometry. J. Pharm. Biomed. Anal. 2009;49:1172–1178. doi: 10.1016/j.jpba.2009.02.025. [DOI] [PubMed] [Google Scholar]
  • 17.Yu S., Zhang Y., Fan M. Analysis of volatile compounds of mycelia of Hirsutella sinensis, the anamorph of Ophiocordyceps sinensis. Appl. Mech. Mater. 2012;140:253–257. doi: 10.4028/www.scientific.net/AMM.140.253. [DOI] [Google Scholar]
  • 18.Zhang H., Li Y., Mi J., Zhang M., Wang Y., Jiang Z., Hu P. GC-MS profiling of volatile components in different fermentation products of Cordyceps sinensis mycelia. Molecules. 2017;22:1800. doi: 10.3390/molecules22101800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xiang Z., Chen X., Zhao Z., Xiao X., Guo P., Song H., Yang X., Huang M. Analysis of volatile components in Dalbergia cochinchinensis Pierre by a comprehensive two-dimensional gas chromatography with mass spectrometry method using a solid-state modulator. J. Sep. Sci. 2018;41:1–8. doi: 10.1002/jssc.201800636. [DOI] [PubMed] [Google Scholar]
  • 20.Wang C.C., Zhang W.J., Li H.D., Mao J.S., Guo C.Y., Ding R.Y., Wang Y., Fang L.P., Chen Z.L., Yang G.S. Analysis of volatile compounds in pears by HS-SPME-GC×GC-TOFMS. Molecules. 2019;24:1795. doi: 10.3390/molecules24091795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Qian C.Y., Quan W.X., Xiang Z.M., Li C.C. Characterization of volatile compounds in four different Rhododendron Flowers by GC×GC-QTOFMS. Molecules. 2019;24:3327. doi: 10.3390/molecules24183327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gałuszka A., Konieczka P., Migaszewski Z.M., Namiesnik J. Analytical Eco-Scale for assessing the greenness of analytical procedures. Trends Anal Chem. 2012;37:61–72. doi: 10.1016/j.trac.2012.03.013. [DOI] [Google Scholar]
  • 23.Plotka-Wasylka J. A new tool for the evaluation of the analytical procedure: Green Analytical Procedure Index. Talanta. 2018;181:204–209. doi: 10.1016/j.talanta.2018.01.013. [DOI] [PubMed] [Google Scholar]
  • 24.Xiang Z., Cai K., Liang G., Zhou S., Ge Y., Zhang J., Geng Z. Analysis of volatile flavour components in flue-cured tobacco by headspace solid-phase microextraction combined with GC×GC-TOFMS. Anal. Methods. 2014;6:3300–3308. doi: 10.1039/c3ay41956h. [DOI] [Google Scholar]
  • 25.Wajs A., Pranovich A., Reunanen M., Willfor S., Holmbom B. Headspace-SPME analysis of the sapwood and heartwood of Picea abies, Pinus sylvestris and Larix decidua. J. Essent. Oil. 2007;19:125–133. doi: 10.1080/10412905.2007.9699244. [DOI] [Google Scholar]
  • 26.Hantao L.W., Toledo B.R., Ribeiro F.A., Pizetta M., Pierozzi C.G., Furtado E.L., Augustoa F. Comprehensive two-dimensional gas chromatography combined to multivariate data analysis for detection of disease-resistant clones of Eucalyptus. Talanta. 2013;116:1079–1084. doi: 10.1016/j.talanta.2013.08.033. [DOI] [PubMed] [Google Scholar]
  • 27.Tajuddin S.N., Muhamad N.S., Yarmob M.A., Yusoff M.M. Characterization of the chemical constituents of agarwood oils from malaysia by comprehensive two-dimensional gas chromatography–time-of-flight mass spectrometry. Mendeleev Commun. 2013;23:51–52. doi: 10.1016/j.mencom.2013.01.019. [DOI] [Google Scholar]
  • 28.Lonchamp J., Barry-Ryan C., Devereux M. Identification of volatile quality markers of ready-to-use lettuce and cabbage. Food Res. Int. 2009;42:1077–1086. doi: 10.1016/j.foodres.2009.05.002. [DOI] [Google Scholar]
  • 29.Gasmalla M.A.A., Tessema H.A., Alahmed K., Hua X., Liao X., Yang R. Effect of different drying techniques on the volatile compounds, morphological characteristics and thermal stability of Stevia rebaudiana Bertoni leaf. Trop. J. Pharm. Res. 2017;16:1399–1406. doi: 10.4314/tjpr.v16i6.26. [DOI] [Google Scholar]
  • 30.Kumar R., Kumar R., Prakash O., Srivastava R.M., Pant A.K. GC-MS analysis of the hexane extract of Limnophila indica (L.) Druce, its total phenolics, in-vitro antioxidant, anti-inflammatory and antifeeding activity against Spilosoma obliqua. J. Entomol. Zool. Stud. 2019;7:970–975. [Google Scholar]
  • 31.Dekebo A., Kwon S.Y., Kim D.H., Jung C. Volatiles analysis of honey by gas chromatography-mass spectrometry (GC-MS): Comparison of SPME volatiles extraction methods. J. Apiculture. 2018;33:117–128. doi: 10.17519/apiculture.2018.06.33.2.117. [DOI] [Google Scholar]
  • 32.Caldeira M., Barros A.S., Bilelo M.J., Parada A., Câmara J.S., Rocha S.M. Profiling allergic asthma volatile metabolic patterns using a headspace-solid phase microextraction/gas chromatography based methodology. J. Chromatogr. A. 2011;1218:3771–3780. doi: 10.1016/j.chroma.2011.04.026. [DOI] [PubMed] [Google Scholar]
  • 33.Chandra D., Kohli G., Prasad K., Bisht G., Punetha V.D., Pandey H.K. Chemical composition of the essential oil of Viola serpens from Bageshwar (Shama), Uttarakhad, India. J. Med. Plants Res. 2017;11:513–517. [Google Scholar]
  • 34.Marneweck C., Jürgens A., Shrader A.M. Dung odours signal sex, age, territorial and oestrous state in white rhinos. Proc. R. Soc. 2017;284:20162376. doi: 10.1098/rspb.2016.2376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Li S., Li P., Liu X., Luo L., Lin W. Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar. Appl. Microbiol. Biotechnol. 2016;100:4395–4411. doi: 10.1007/s00253-016-7284-3. [DOI] [PubMed] [Google Scholar]
  • 36.Oliveira R.C., Oi C.A., Vollet-Neto A., Wenseleers T. Intraspecific worker parasitism in the common wasp, Vespula vulgaris. Anim. Behav. 2016;113:79–85. doi: 10.1016/j.anbehav.2015.12.025. [DOI] [Google Scholar]
  • 37.Fernández M., Hospital X.F., Arias K., Hierro E. Application of pulsed light to sliced cheese: Effect on Listeria inactivation, sensory quality and volatile profile. Food Bioprocess Technol. 2016;9:1335–1344. doi: 10.1007/s11947-016-1721-2. [DOI] [Google Scholar]
  • 38.Yang S. Master’s Thesis. Northwest University; Xian, China: 2018. Study on the Volatile Components of Thirteen Medicinal Plants by SHS/GC-MS. [Google Scholar]
  • 39.Jian H.J., Qiao F. Analysis of nutritional and volatile components in seeds and leaves of Synsepalum dulcificum. Stor. Proc. 2018;18:149–155. [Google Scholar]
  • 40.Yang Y., Zhang M., Yin H., Deng Y., Jiang Y., Yuan H., Dong C., Li J., Hua J., Wang J. Rapid profiling of volatile compounds in green teas using Micro-Chamber/Thermal Extractor combined with thermal desorption coupled to gas chromatography-mass spectrometry followed by multivariate statistical analysis. LWT-Food Sci. Technol. 2018;96:42–50. doi: 10.1016/j.lwt.2018.04.091. [DOI] [Google Scholar]
  • 41.Domínguez R., Purriños L., Pérez-Santaescolástica C., Pateiro M., Barba F.J., Tomasevic I., Campagnol P.C.B., Lorenzo J.M. Characterization of volatile compounds of dry-cured meat products using HS-SPME-GC/MS technique. Food Anal. Method. 2019;12:1263–1284. doi: 10.1007/s12161-019-01491-x. [DOI] [Google Scholar]
  • 42.Wang W., Huang X., Lin Y., Tang R., Guo Y. Analysis of volatile compounds in Guanyin tea stem. Chinese J. Trop. Crop. 2019;40:965–972. [Google Scholar]
  • 43.He Z., Fan Y., Xie X., Yuan G. GC-MS analysis of fragrance constituents from offcuts of eaglewood and Chinese Eaglewood in Guangdong. Adv. Mater. Res. 2012;550–553:1904–1907. doi: 10.4028/www.scientific.net/AMR.550-553.1904. [DOI] [Google Scholar]
  • 44.Hussain A., Tian M.Y., He Y.R., Lei Y.Y. Differential fluctuation in virulence and VOC profiles among different cultures of entomopathogenic fungi. J. Invertebr. Pathol. 2010;104:166–171. doi: 10.1016/j.jip.2010.03.004. [DOI] [PubMed] [Google Scholar]
  • 45.Zhang Y., Li E., Wang C., Li Y., Liu X. Ophiocordyceps sinensis, the flagship fungus of China: Terminology, life strategy and ecology. Mycology. 2012;3:2–10. [Google Scholar]
  • 46.Simon C., Frati F., Beckenbach A., Crespi B., Liu H., Flook P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 1994;87:651–701. doi: 10.1093/aesa/87.6.651. [DOI] [Google Scholar]
  • 47.Quan Q.M., Chen L.L., Wang X., Li S., Yang X.L., Zhu Y.G., Wang M., Cheng Z. Genetic diversity and distribution patterns of host insects of caterpillar fungus Ophiocordyceps sinensis in the Qinghai-Tibet plateau. PLoS ONE. 2014;9:e92293. doi: 10.1371/journal.pone.0092293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zhang Y.J., Zhang S., Li Y.L., Ma S.L., Wang C.S., Xiang M.C., Liu X.Z. Phylogeography and evolution of a fungal-insect association on the Tibetan plateau. Mol. Ecol. 2014;23:5337–5355. doi: 10.1111/mec.12940. [DOI] [PubMed] [Google Scholar]
  • 49.Silva É.A.S., Saboia G., Jorge N.C., Hoffmann C., Dos Santos Isaias R.M., Soares G.L.G., Zini C.A. Development of a HS-SPME-GC/MS protocol assisted by chemometric tools to study herbivore-induced volatiles in Myrcia splendens. Talanta. 2017;175:9–20. doi: 10.1016/j.talanta.2017.06.063. [DOI] [PubMed] [Google Scholar]
  • 50.Wu Y., Xu J., He Y., Shi M., Han X., Li W., Zhang X., Wen X. Metabolic profiling of pitaya (Hylocereus polyrhizus) during fruit development and maturation. Molecules. 2019;24:1114. doi: 10.3390/molecules24061114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Yan Y., Chena S., Niea Y., Xua Y. Characterization of volatile sulfur compounds in soy sauce aroma type Baijiu and changes during fermentation by GC×GC-TOFMS, organoleptic impact evaluation, and multivariate data analysis. Food Res. Int. 2020;131:109043. doi: 10.1016/j.foodres.2020.109043. [DOI] [PubMed] [Google Scholar]

Articles from Molecules are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES