Periostin interaction with discoidin domain receptor-1 (DDR1) promotes cartilage degeneration

Tianzhen Han; Paolo Mignatti; Steven B Abramson; Mukundan Attur

doi:10.1371/journal.pone.0231501

. 2020 Apr 24;15(4):e0231501. doi: 10.1371/journal.pone.0231501

Periostin interaction with discoidin domain receptor-1 (DDR1) promotes cartilage degeneration

Tianzhen Han ¹, Paolo Mignatti ¹, Steven B Abramson ¹, Mukundan Attur ^1,^*

Editor: Dominique Heymann²

PMCID: PMC7182230 PMID: 32330138

Abstract

Osteoarthritis (OA) is characterized by progressive loss of articular cartilage accompanied by the new bone formation and, often, a synovial proliferation that culminates in pain, loss of joint function, and disability. However, the cellular and molecular mechanisms of OA progression and the relative contributions of cartilage, bone, and synovium remain unclear. We recently found that the extracellular matrix (ECM) protein periostin (Postn, or osteoblast-specific factor, OSF-2) is expressed at high levels in human OA cartilage. Multiple groups have also reported elevated expression of Postn in several rodent models of OA. We have previously reported that in vitro Postn promotes collagen and proteoglycan degradation in human chondrocytes through AKT/β-catenin signaling and downstream activation of MMP-13 and ADAMTS4 expression. Here we show that Postn induces collagen and proteoglycan degradation in cartilage by signaling through discoidin domain receptor-1 (DDR1), a receptor tyrosine kinase. The genetic deficiency or pharmacological inhibition of DDR1 in mouse chondrocytes blocks Postn-induced MMP-13 expression. These data show that Postn is signaling though DDR1 is mechanistically involved in OA pathophysiology. Specific inhibitors of DDR1 may provide therapeutic opportunities to treat OA.

Introduction

Osteoarthritis (OA) affects more than 20% of the population over age 60 and is a significant cause of disability for millions of people. The precise cellular mechanisms that drive OA progression are not fully understood; however, it is clear that events in all three compartments–cartilage, bone, and synovium–play important roles in the initiation and progression of OA. The analysis of the molecular mechanisms underlying dysregulation of cartilage homeostasis and alteration of subchondral bone in OA can provide important insights, and lead to novel strategies for disease-modifying treatments and joint repair. Periostin (Postn), a TGFβ-inducible, ECM protein, also known as Osteoblast-Specific Factor 2 (OSF2), is expressed in multiple joint compartments (cartilage, subchondral bone, meniscus, ligaments, and osteophytes) [1–5]. Our previous studies have shown that Postn is overexpressed in human OA cartilage and surgical models of OA in rodents (MM, ACL, and ACL/PM) [1]. These findings suggest that Postn, first reported by us to be upregulated in human OA, plays a role in the pathogenesis of OA, where it exerts catabolic effects in cartilage. Furthermore, Postn also plays a role in tissue repair. Insufficient levels of Postn result in impaired tissue remodeling [6], whereas elevated expression of Postn is associated with chronic diseases such as liver fibrosis, atherosclerotic and rheumatic cardiac valve degeneration, as well as OA [7–9].

The nature of Postn receptor(s) in chondrocytes is unknown. A recent study reported that Postn interacts with discoidin domain receptor 1 (DDR1), a collagen-binding receptor in myofibroblasts, and promotes lysyl oxidase expression [8, 10]. DDR1, a type I transmembrane protein with a cytoplasmic C-terminal tyrosine kinase domain, undergoes ligand-induced autophosphorylation, with maximal activation (phosphorylation) achieved hours after ligand binding [11]. DDR1 and the closely related DDR2 are expressed in chondrocytes, and both DDR1 and DDR2 bind collagen [12]. Upon collagen-binding, DDR1 dimerizes, with autophosphorylation of tyrosine-residues and activation of downstream signaling pathways, including p38, ERK1/2, and JNK MAP kinases, as well as PI3 kinase-AKT [13, 14] and Wnt/β-catenin signaling [15]. Since DDR1 is a putative binding partner of Postn and can activate inflammatory signaling pathways [16–18], we investigated the involvement of the Postn—DDR1 interaction in cartilage degeneration.

Materials and methods

Reagents

All media and FBS were purchased from Thermo Fisher Scientific (Waltham, MA); proMMP-13 enzyme-linked immunosorbent assay (ELISA) kits from R&D systems (Minneapolis, MN); Phosphatase Inhibitor Cocktail [#5870; Cell signaling, Danvers, MA, USA] and protease inhibitor cocktail (#539131, Calbiochem, San Diego, CA, USA); The Wnt signaling inhibitor CCT031374 hydrobromide (cat. no. 4675/10, R&D Systems, Minneapolis, MN), antibodies to β-Catenin (D10A8; XP® Rabbit mAb #8480), α-Tubulin (11H10; Rabbit mAb#2125), Akt (#9272); Phospho-Akt (Ser473) (193H12; Rabbit mAb #4058), Phospho-DDR1 (Tyr792; #11994) and total DDR1 (D1G6; XP® Rabbit mAb #5583) from Cell Signaling Technology (Danvers, MA 01923); the antibodies to human Phospho-DDR2 (Y740; #1119D) and human DDR1 (AF2538) from R&D system (Minneapolis, MN); HRP-conjugated rabbit anti-goat (#305-036-047), HRP-conjugated goat anti-rabbit (#111-035-144), AffiniPure goat anti-human lgG, F(ab’)2 fragment specific (#109-005-097) and peroxidase affinipure goat anti-human lgG(H+L; #109-035-088) from Jackson ImmunoResearch (West Grove, PA, USA). Human DDR1-full length [19] and DDR1-Fc [20] were kind gifts from Dr. Friedemann Kiefer, Max Planck Institute for Molecular Biomedicine, Germany, and from Birgit Leitinger, National Heart and Lung Institute, Imperial College London, London UK, respectively.

Procurement of human cartilage

Tibial and femoral knee articular cartilage was obtained from patients with advanced OA (age 50–70 yrs.) undergoing knee replacement surgery at NYU Langone Orthopedic Hospital. The patients had been free of non-steroidal anti-inflammatory drugs for at least two weeks before surgery. A certified pathologist inspected the cartilage for gross morphology prior to chondrocyte isolation. All specimens exhibited large areas of thinning of the cartilage, granularity, and focal eburnation of the underlying bone. Thus, the cartilage in our studies was heterogeneous with respect to the OA disease stage. Their use in the de-identified form in the current research was in accordance with the ethical standards of the Helsinki Declaration of 1975, as revised in 2000, and was approved (#i9018) by the institutional review board (IRB) of the NYU School of Medicine. The ethics committee waived the requirement for informed consent. The surgical discards from knee replacement surgery were obtained for human chondrocyte isolation and cartilage for histology and immunohistochemistry (IHC) studies.

Ddr1 knock out mice

Ddr1^-/- mice were kindly provided by Dr. Edward Skolnik [21] (NYU School of Medicine). Ddr1^-/- and wt mice were maintained on a C57BL6 background, and heterozygote (Ddr1^+/-) males and females were bred to produce wild type (wt) and Ddr1 knockout (Ddr1^-/-) littermates for analysis. The mice were fed standard pelleted chow and allowed access to water ad libitum. Mice were euthanized by CO₂ inhalation and cervical dislocation, and joint tissues were harvested at 10–12 weeks for chondrocyte isolation. All animals were used in accordance with scientific, humane, and ethical principles and compliance with regulations approved by the New York University School of Medicine Institutional Animal Care and Use Committee (IACUC). Genotyping performed using genomic DNA isolated from mouse tail biopsies using the following primers: Primer 1, GCAGCGCATCGCCTTCTATC, and primer 2, AGACAATCTCGAGATGCTGG, to amplify the wild-type allele, generating a 250-bp PCR product; Primer 3, GTTGCGTTACTCCCGAGATG and primer 1 to identify the mutant allele, amplifying a 160-bp PCR product.

OA chondrocyte culture

Human OA chondrocytes were harvested from discarded end-stage knee OA cartilage as described [1]. Briefly, cartilage slices were minced finely and digested with 0.2% collagenase for 12–16 h in Ham’s F12 medium supplemented with 5% FBS. The resulting cell suspension was seeded into T175 flasks and allowed to grow for 48 h. In all experiments, primary chondrocytes used between passage 1 and 2, plated at 80% confluence in 6- or 12- or 24-well plates.

Mouse chondrocyte isolation

Cultures of murine chondrocytes were established by a modification of the method described [22, 23]. Mouse primary articular chondrocytes from 10-12-week old mice were isolated from four mice for each genotype (approximately 5 x 10⁶ cells) and were grown in DMEM containing 10% FBS and antibiotics. Passage-1 or -2 chondrocytes were used in all the experiments. The experiments were repeated at least twice, with cells isolated from different sets of animals. We also confirmed the chondrocyte phenotype by determining type I and II collagen and aggrecan expression, as well as the ratio between type II and I collagen levels by qRT-PCR. Cells were grown in 12–well plates were also stained with Alcian blue to confirm the chondrocyte phenotype.

Measurement of proMMP-13 protein and activity

Secreted MMP-13 levels were measured in the cell-conditioned medium of monolayer cultures by an ELISA kit from R&D Systems (Minneapolis, MN). To measure MMP-13 activity, the culture supernatant was incubated with Assay Buffer [50 mM Tris.Cl (pH7.5), 10 mM Cacl2, 150 mM NaCl, 0.05% Brij35] and APMA (p-aminophenylmercuric acetate) for two hours at 37^o C. APMA-activated samples (20 μL) were incubated with the MMP-13-specific fluorogenic substrate, MOCAc-Pro-Cha-Gly-Nva-His-Ala-Dap (DNP)-NH2 (Peptide International, Louisville, KY) at 37^o C for one hour, and the fluorescence was measured with a Synergy HT microplate reader at 360/40 nm (excitation) and 460/40 nm (emission). Recombinant pro-MMP-13 (R&D) was used as a positive control and for generating a standard curve.

Transient transfection

C28/I2 chondrocytes (a human chondrocyte cell line kindly provided by Dr. Mary B. Goldring, Hospital for Special Surgery, New York, NY, USA) were seeded in 10-cm dishes at 80% confluency in DMEM supplemented with 10% FBS, and transfected with 10 μg of the full-length Postn and/or DDR1-Fc cDNAs described under Reagents, using the TransIT-LT1 transfection reagent (Mirus Bio, Madison, WI, USA) in Opti-MEM. After 24 h, the medium was changed to serum-free DMEM. Twenty-four to 48 h post-transfection, the cells were lysed for immunoprecipitation (IP).

Adenovirus transduction

Mouse or human chondrocytes seeded at 70% confluency were grown for 24 h in DMEM supplemented with 10% FBS. After replacing the medium with fresh medium, the cells were transduced with control, empty adenovirus (ad-CMV-Null)#1300) or a mouse Postn-encoding adenovirus (Ad-m-Postn; #ADV-269083; (Vector Biolabs, Malvern, PA, USA) at MOI = 100 for four hours, after which the medium was changed to serum-free medium. Twenty-four-hours post-transduction, the cells, and supernatants were collected for the MMP-13 activity assay, and the cells lysed in TRIzol for RNA extraction.

Western blotting and immunoprecipitation

Cells were lysed with RIPA buffer containing a phosphatase and protease inhibitor cocktail. Cell protein (30–40 μg) was used for Western blotting analysis as described [1, 24]. C28/I2 cells seeded at 80% confluency were grown overnight in DMEM supplemented with 10% FBS, and then starved for 24 h in serum-free medium. The cells were then transfected with DDR1-Fc and/or Postn cDNA as described [1]. After 24–48 h, the cells were washed with cold PBS and lysed with RIPA buffer containing phosphatase and protease inhibitors. One milligram of cell extract protein was mixed with 10 μl Protein A & G Sepharose (Sigma-Aldrich) and 10 μl anti-Postn (Sigma-Aldrich) or anti-DDR1 antibodies (Cell Signaling), or with control IgG for 24 h at 4° C. Antigen-antibody complexes were then analyzed by Western blotting as described above.

RNA extraction and qRT-PCR analysis

Total RNA was extracted from chondrocyte cultures using TRIzol, precipitated with isopropanol, and further purified using the micro RNeasy column cleanup kit (Qiagen) following the manufacturer’s instructions. One microgram of RNA was used for cDNA synthesis using the Advantage® RT-for-PCR Kit (Takara Bio USA, Inc. Mountain View, CA). Pre-designed TaqMan primer sets were purchased from Thermo Fisher Scientific (Waltham, MA USA). Real-time PCR was run in an Applied Biosystems Prism 7300 sequence detection system. Messenger RNA levels were normalized to GAPDH and 18S mRNA, and the relative expression levels of various transcripts were calculated using an approximation method or the 2 delta CT method [25].

Densitometry

Quantitative analysis of Western blot bands was performed with ImageJ 1.52a software (National Institutes of Health). The results are presented as the fold change between the reading of the sample and that of the corresponding loading control.

Statistical analysis

All the experiments were done with three to four chondrocyte cultures from individual OA patients, and each sample was assayed in duplicate or triplicate. The data are expressed as mean ± standard deviation (m ± SD). The non-parametric Mann-Whitney test was used to calculate p values. For the analysis of the experiments with AdCon or AdPostn and the DDR1 inhibitor 7rH, one-way ANOVA was performed with multiple testing using Prism 7 (GraphPad). P values <0.05 were considered statistically significant.

Ethics statement

This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The Institutional Animal Care and Use Committee (IACUC) of the New York University School of Medicine under protocol number IA16-00601 approved all procedures performed in the study.

Results

Expression of DDR1 in human OA and normal cartilage

We first analyzed DDR1 expression in human OA and normal cartilage. As shown in Fig 1, DDR1 mRNA expression was comparable in OA and normal cartilage by microarray (Fig 1A). These data were further validated by qPCR (ct values 26.66 and 26.74 respectively) in different sets of human OA and normal cartilage samples (Fig 1B), and also by immunohistochemistry (Fig 1C) of lesional (damaged) and non-lesional areas (preserved) of the cartilage from the same patient. Thus, DDR1 is not differentially expressed in OA relative to age-matched, normal, or preserved cartilage.

DDR1—Postn interaction

To investigate whether Postn binds to DDR1 in chondrocytes, we performed co-immunoprecipitation (co-IP) experiments with anti-Postn and DDR1 antibodies using primary OA chondrocytes. As shown in Fig 2, DDR1 and Postn co-immunoprecipitate, showing the presence of DDR1—Postn complexes in human primary chondrocytes.

Fig 2 — A: Western blotting analysis of immunoprecipitates from primary human OA chondrocytes. No antigens are seen in the non-immunoprecipitated cell lysate (lysate) because their concentration is too low. B: Co-immunoprecipitation of DDR1/Postn complexes in human chondrocyte C28/I2 cells. A representative Western blot of immunoprecipitates from chondrocytes is shown. Purified DDR1 and DDR2 proteins were loaded as a positive control.

In primary chondrocytes, the level of Postn expression was too low relative to DDR1. Therefore, we took an alternative approach to verify the Postn—DDR1 interaction using the human chondrocyte cell line C28/I2. We transfected C28/I2 cells with a pDDR1-Fc fusion protein construct and with a plasmid expressing human pPostn and analyzed them by IP 24–48 h later. As shown in Fig 2, the results of these co-IP experiments showed that Postn forms complexes with DDR1 but not with DDR2.

DDR1 inhibition abrogates postn induction of MMP-13 expression

We next examined the effect of DDR1 inhibition on Postn induction of MMP-13 expression. As shown in Fig 3, human primary OA chondrocytes constitutively express MMP-13 mRNA and protein, which were strongly upregulated following transduction with adenovirus encoding human Postn (Ad-hPostn). The addition of the synthetic DDR1 inhibitor 7rh to the culture medium dose-dependently inhibited this effect. As expected, based on our previous results [1], Wnt signaling inhibition significantly blocked Ad-hPostn-induced expression of MMP-13. We next investigated the effect of Postn on DDR1 and DDR2 phosphorylation. As shown in Fig 4A, Postn induced DDR1 but not DDR2 phosphorylation without affecting the total levels of either protein.

Fig 4 — DDR1 kinase mediates Postn activation of AKT and β-catenin signaling in human chondrocytes: **A: Postn induces DDR1 but not DDR2 phosphorylation. Upper panel:** Western blotting analysis of phosphorylated (p) and total (t) DDR1 and DDR2 in human chondrocytes treated with Postn (5 μg/ml) for the indicated times. Total DDR1 and DDR2, are shown as loading controls. A representative Western blot is shown. Lower panel: densitometric analysis of two similar Western blots. The columns represent the densitometric readings of the indicated bands normalized to those of the corresponding loading controls. **B: Postn activates AKT and β-catenin signaling.** Upper panel: Western blotting analysis of AKT and β-catenin activation in human articular chondrocytes treated with Postn (5 μg/ml) for the indicated times. A representative Western blot of two independent primary human chondrocyte cultures is shown. Lower panel: densitometric analysis of two similar Western blots. The columns represent the densitometric readings of the indicated bands normalized to those of the corresponding loading controls. **C: Inhibition of DDR1 kinase blocks Postn induction of AKT and β-catenin signaling.** Western blotting analysis of AKT phosphorylation (pAKT473) and β-catenin levels in human articular chondrocytes treated with Postn (5 μg/ml) in the presence or absence of the DDR1 inhibitor 7rh (1 μM) for the indicated times. Pan AKT and 4E-BP1 are shown as loading controls. A representative blot of two independent chondrocyte cultures is shown. *p<0.05 versus control.

DDR1 –ß-catenin mediates postn signaling in chondrocytes

We have previously shown that inhibition of the Wnt signaling pathway blocks the Postn-induction of MMP-13 expression in OA chondrocytes [1]. Therefore, we investigated whether DDR1- Postn interaction activates AKT-ß-catenin signaling in human OA chondrocytes. Western blotting analysis of phosphorylated DDR1 and AKT, and of total β-catenin showed that treatment of human OA chondrocytes with Postn (5 μg/ml) induced DDR1 and AKT phosphorylation and increased β-catenin levels in a time-dependent manner (Fig 4B). Furthermore, the DDR1 inhibitor 7rh blocked Postn induction of AKT phosphorylation and decreased β-catenin level (Fig 4C), showing that Postn activation of DDR1 leads to β-catenin signaling and MMP-13 expression in human chondrocytes.

Since Postn interaction with αvβ3 and αvβ5 integrins activates downstream signaling in bone and other cells [26–28], we also tested the effect of neutralizing antibodies to αvβ3 (LM609) or αvβ5 (P1F6) on chondrocyte expression of MMP-13. Neither antibody blocked Postn induction of MMP-13 expression or activity (data not shown).

Postn dost not induce MMP-13 expression in Ddr1 deficient chondrocytes

To investigate whether receptors other than DDR1 can mediate Postn induction of MMP-13 expression, we examined the effect of Postn on MMP-13 expression in Ddr1-deficient mouse chondrocytes.

For this purpose, we isolated chondrocytes from Ddr1^-/- and Ddr1^+/+ (wt) mice. Adenovirus-mediated overexpression of mouse Postn (Ad-mPostn; Vector Labs) increased MMP-13 expression (Fig 5A), and activity (Fig 5B) in wt chondrocytes but had no such effect in Ddr1^-/- chondrocytes. However, expression of exogenous human DDR1 (hDDR1) rescued MMP-13 expression in Ddr1^-/- chondrocytes (Fig 5B). In hDDR1-transfected wt cells, MMP-13 activity increased in both control and Ad-mPostn transduced cells. Conversely, Ad-mPostn transduction had no such effect in Ddr1^-/- cells. Thus, consistent with our previous results (Fig 3), these results showed that Postn-dependent MMP-13 expression requires signaling via DDR1.

Fig 5 — Mouse chondrocytes were isolated from three *wt and Ddr1* deficient mice, as described in Materials and Methods. Cells were grown in 12-well plates at a density of 5x10⁴ cells/well. Chondrocytes were transfected with human DDR1 (hDDR1) and also transduced with AdCon or Ad-mPostn in triplicate. Cells were lysed 24 h post- adenovirus transduction in TRIzol for RNA isolation, and the supernatant was collected for MMP-13 activity as described in methods. RNA expression was normalized to GAPDH and expressed as relative fold-change to wt non-transfected and -transduced cells. Mean ± SD of triplicate samples are shown. *: p<0.05 by 1-way ANOVA; vs. wt hDDR1 transfected or AdCon-transduced cells.

Discussion

Our results provide strong evidence that the effects of Postn on MMP-13 expression require interaction with DDR1 and activation of the Wnt/β-catenin signaling pathway. Several lines of evidence support this conclusion. First, co-immunoprecipitation experiments show Postn association with DDR1, but not with DDR2. Second, exposure of human chondrocytes to Postn induces DDR1, but not DDR2, phosphorylation. Third, periostin–DDR1 interaction results in AKT activation and increased β-catenin levels. We have previously reported that Postn activates Wnt/β-catenin signaling, and the Wnt signaling inhibitor CCT031374 hydrobromide, which blocks β-catenin stabilization and thus inhibits TCF-dependent transcription, abrogates Postn induction of MMP-13 expression in human chondrocytes [29]. In the present study, the DDR1 inhibitor 7rh also blocked Postn-induced MMP-13 upregulation, as well as AKT phosphorylation and β-catenin stabilization. Finally, Postn did not induce MMP-13 expression in Ddr1^-/- chondrocytes.

These findings show that Postn–DDR1 signaling is mediated by β-catenin stabilization, and therefore by canonical Wnt signaling. We propose that activation of β-catenin stabilization is mediated by DDR1 activation of the PI3K-AKT pathway. AKT can stabilize β-catenin by two mechanisms: phosphorylation of β-catenin at Ser⁵⁵² [30] and inhibition of glycogen synthase kinase-3 (GSK3) [31], which phosphorylates β-catenin, causing its ubiquitination and degradation. Another potential mechanism could consist of AKT upregulation of canonical Wnt growth factors; however, we could not find any such report in the literature.

What is the relevance of these findings to the pathogenesis of OA? Postn has the unique property of stimulating catabolic effects in cartilage while promoting osteogenesis in bone. Postn is produced by multiple joint tissues, including bone, cartilage, ligaments, meniscus, and synovium under normal or injury-induced conditions [29]. Karlsson et al. and two other groups have independently shown increased expression of Postn in cartilage and subchondral bone of human OA-affected joints [3, 4, 32–34]; and elevated levels of Postn have also been reported in human OA synovial fluids, as well as in synovial fluids of anterior cruciate ligament injury patients [35–37]. Loeser et al. have reported that Postn expression is elevated in murine knee cartilage and menisci with surgically-induced OA [5], and elevated levels of Postn have also been described in the anterior cruciate ligament (ACL), as well as in murine models of surgically-induced post-traumatic OA [1–3, 5, 33, 38, 39]. Furthermore, plasma Postn levels are markedly elevated in post-menopausal women with non-vertebral fractures, even after adjustment for bone mineral density (BMD) [40]. Recent studies also reported that Postn levels in synovial fluid correlate with radiographic signs of knee OA [41], and that Postn is the only protein whose expression levels significantly correlate with OARSI score, synovitis, and microCT-based bone parameters (e.g., Structure Model Index and trabecular threshold). Postn influences ECM homeostasis, bone remodeling, and OA development [42]. Therefore, Postn offers a unique target for OA treatment since it can mediate pathogenic events in both cartilage and bone. Furthermore, we have previously shown that Postn signals via the AKT-Wnt signaling pathway to induce MMP-13 and ADAMTS 4 expression [1]. Postn interacts with integrins αvβ3 and αvβ5 to activate downstream signaling in bone and other cells [26–28, 43, 44]. Postn also promotes macrophage proliferation and polarization [45]. Our preliminary qRT-PCR analysis has shown that DDR1 is expressed in normal human and mouse chondrocytes and is not differentially expressed in OA cartilage. The DDR1 inhibitor 7rh blocks constitutive and Postn-induced MMP-13 expression in human chondrocytes with a dose-dependent effect. This inhibitor has 3–4 fold selectivity for DDR1 over DDR2 [46, 47] (currently no DDR2-specific inhibitor is available).

In our in vitro experiments with human chondrocytes, the addition of Postn to the culture medium induced DDR1, but not DDR2, phosphorylation, and the DDR1 inhibitor 7rh blocked AKT phosphorylation and β-catenin stabilization. Ddr1^-/- mice were recently found to spontaneously develop osteoarthritis of the temporomandibular joint, suggesting that loss of Ddr1 and associated increases in Ddr2 may initiate MMP-13 upregulation, resulting in type 2-collagen degradation [48]. However, in our in vitro studies, we did not observe increased Ddr2 expression in Ddr1 deficient chondrocytes (data not shown). Whether Postn-DDR1 interaction also promotes catabolic events in other joint tissues, including synovial proliferation, remains an open question. Postn has been shown to promote liver and adipose tissue inflammation and fibrosis [8, 49].

In conclusion, our data shed new light on the mechanism of Postn induction of catabolic effects in knee joint cartilage. MMP-13 upregulation by Postn requires interaction with and activation of DDR1, which signals via the AKT-Wnt/ β-catenin pathway. Inhibition of Postn signaling through DDR1, therefore, could provide therapeutic opportunities for OA.

Supporting information

S1 Fig

(PPTX)

Click here for additional data file.^{(890.6KB, pptx)}

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

Funding for this project provided by the National Institute of Health grant AR054817, AR068341, and AR070934. The funders had no role in study design, data collection, and analysis, decision to publish, or preparation of the manuscript

References

1.Attur M, Yang Q, Shimada K, Tachida Y, Nagase H, Mignatti P, et al. Elevated expression of periostin in human osteoarthritic cartilage and its potential role in matrix degradation via matrix metalloproteinase-13. FASEB J. 2015;29(10):4107–21. 10.1096/fj.15-272427 [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Chinzei N, Brophy RH, Duan X, Cai L, Nunley RM, Sandell LJ, et al. Molecular influence of anterior cruciate ligament tear remnants on chondrocytes: a biologic connection between injury and osteoarthritis. Osteoarthritis Cartilage. 2018;26(4):588–99. 10.1016/j.joca.2018.01.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Chijimatsu R, Kunugiza Y, Taniyama Y, Nakamura N, Tomita T, Yoshikawa H. Expression and pathological effects of periostin in human osteoarthritis cartilage. BMC Musculoskelet Disord. 2015;16:215 10.1186/s12891-015-0682-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Chou CH, Wu CC, Song IW, Chuang HP, Lu LS, Chang JH, et al. Genome-wide expression profiles of subchondral bone in osteoarthritis. Arthritis Res Ther. 2013;15(6):R190 10.1186/ar4380 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Loeser RF, Olex AL, McNulty MA, Carlson CS, Callahan MF, Ferguson CM, et al. Microarray analysis reveals age-related differences in gene expression during the development of osteoarthritis in mice. Arthritis Rheum. 2012;64(3):705–17. 10.1002/art.33388 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Oka T, Xu J, Kaiser RA, Melendez J, Hambleton M, Sargent MA, et al. Genetic manipulation of periostin expression reveals a role in cardiac hypertrophy and ventricular remodeling. Circ Res. 2007;101(3):313–21. 10.1161/CIRCRESAHA.107.149047 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Hakuno D, Kimura N, Yoshioka M, Mukai M, Kimura T, Okada Y, et al. Periostin advances atherosclerotic and rheumatic cardiac valve degeneration by inducing angiogenesis and MMP production in humans and rodents. J Clin Invest. 2010;120(7):2292–306. 10.1172/JCI40973 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Kumar P, Smith T, Raeman R, Chopyk DM, Brink H, Liu Y, et al. Periostin promotes liver fibrogenesis by activating lysyl oxidase in hepatic stellate cells. J Biol Chem. 2018;293(33):12781–92. 10.1074/jbc.RA117.001601 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Jia Y, Zhong F, Jiang S, Guo Q, Jin H, Wang F, et al. Periostin in chronic liver diseases: Current research and future perspectives. Life Sci. 2019;226:91–7. 10.1016/j.lfs.2019.04.021 [DOI] [PubMed] [Google Scholar]
10.Alfieri C, Kavvadas P, Simonini P, Ikehata M, Dussaule JC, Chadjichristos CE, et al. Discoidin domain receptor-1 and periostin: new players in chronic kidney disease. Nephrol Dial Transplant. 2015;30(12):1965–71. 10.1093/ndt/gfv074 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Leitinger B. Discoidin domain receptor functions in physiological and pathological conditions. Int Rev Cell Mol Biol. 2014;310:39–87. 10.1016/B978-0-12-800180-6.00002-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Leitinger B. Molecular analysis of collagen binding by the human discoidin domain receptors, DDR1 and DDR2. Identification of collagen binding sites in DDR2. J Biol Chem. 2003;278(19):16761–9. 10.1074/jbc.M301370200 [DOI] [PubMed] [Google Scholar]
13.Kerroch M, Alfieri C, Dorison A, Boffa JJ, Chatziantoniou C, Dussaule JC. Protective effects of genetic inhibition of Discoidin Domain Receptor 1 in experimental renal disease. Sci Rep. 2016;6:21262 10.1038/srep21262 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Fu HL, Valiathan RR, Arkwright R, Sohail A, Mihai C, Kumarasiri M, et al. Discoidin domain receptors: unique receptor tyrosine kinases in collagen-mediated signaling. J Biol Chem. 2013;288(11):7430–7. 10.1074/jbc.R112.444158 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Karimaian A, Majidinia M, Bannazadeh Baghi H, Yousefi B. The crosstalk between Wnt/beta-catenin signaling pathway with DNA damage response and oxidative stress: Implications in cancer therapy. DNA Repair (Amst). 2017;51:14–9. [DOI] [PubMed] [Google Scholar]
16.Das S, Ongusaha PP, Yang YS, Park JM, Aaronson SA, Lee SW. Discoidin domain receptor 1 receptor tyrosine kinase induces cyclooxygenase-2 and promotes chemoresistance through nuclear factor-kappaB pathway activation. Cancer Res. 2006;66(16):8123–30. 10.1158/0008-5472.CAN-06-1215 [DOI] [PubMed] [Google Scholar]
17.Rammal H, Saby C, Magnien K, Van-Gulick L, Garnotel R, Buache E, et al. Discoidin Domain Receptors: Potential Actors and Targets in Cancer. Front Pharmacol. 2016;7:55 10.3389/fphar.2016.00055 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Coelho NM, McCulloch CA. Mechanical signaling through the discoidin domain receptor 1 plays a central role in tissue fibrosis. Cell Adh Migr. 2018;12(4):348–62. 10.1080/19336918.2018.1448353 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Neuhaus B, Buhren S, Bock B, Alves F, Vogel WF, Kiefer F. Migration inhibition of mammary epithelial cells by Syk is blocked in the presence of DDR1 receptors. Cell Mol Life Sci. 2011;68(22):3757–70. 10.1007/s00018-011-0676-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Xu H, Raynal N, Stathopoulos S, Myllyharju J, Farndale RW, Leitinger B. Collagen binding specificity of the discoidin domain receptors: binding sites on collagens II and III and molecular determinants for collagen IV recognition by DDR1. Matrix Biol. 2011;30(1):16–26. 10.1016/j.matbio.2010.10.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Soomro I, Hong A, Li Z, Duncan JS, Skolnik EY. Discoidin Domain Receptor 1 (DDR1) tyrosine kinase is upregulated in PKD kidneys but does not play a role in the pathogenesis of polycystic kidney disease. PLoS One. 2019;14(7):e0211670 10.1371/journal.pone.0211670 [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Gosset M, Berenbaum F, Thirion S, Jacques C. Primary culture and phenotyping of murine chondrocytes. Nat Protoc. 2008;3(8):1253–60. 10.1038/nprot.2008.95 [DOI] [PubMed] [Google Scholar]
23.Jonason JH, Hoak D, O'Keefe RJ. Primary murine growth plate and articular chondrocyte isolation and cell culture. Methods Mol Biol. 2015;1226:11–8. 10.1007/978-1-4939-1619-1_2 [DOI] [PubMed] [Google Scholar]
24.Katsara O, Attur M, Ruoff R, Abramson SB, Kolupaeva V. Increased Activity of the Chondrocyte Translational Apparatus Accompanies Osteoarthritic Changes in Human and Rodent Knee Cartilage. Arthritis Rheumatol. 2017;69(3):586–97. 10.1002/art.39947 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
26.Matsuzawa M, Arai C, Nomura Y, Murata T, Yamakoshi Y, Oida S, et al. Periostin of human periodontal ligament fibroblasts promotes migration of human mesenchymal stem cell through the alphavbeta3 integrin/FAK/PI3K/Akt pathway. J Periodontal Res. 2015;50(6):855–63. 10.1111/jre.12277 [DOI] [PubMed] [Google Scholar]
27.Bonnet N, Conway SJ, Ferrari SL. Regulation of beta catenin signaling and parathyroid hormone anabolic effects in bone by the matricellular protein periostin. Proc Natl Acad Sci U S A. 2012;109(37):15048–53. 10.1073/pnas.1203085109 [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Li G, Jin R, Norris RA, Zhang L, Yu S, Wu F, et al. Periostin mediates vascular smooth muscle cell migration through the integrins alphavbeta3 and alphavbeta5 and focal adhesion kinase (FAK) pathway. Atherosclerosis. 2010;208(2):358–65. 10.1016/j.atherosclerosis.2009.07.046 [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Cai L, Brophy RH, Tycksen ED, Duan X, Nunley RM, Rai MF. Distinct expression pattern of periostin splice variants in chondrocytes and ligament progenitor cells. FASEB J. 2019;33(7):8386–405. 10.1096/fj.201802281R [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Fang D, Hawke D, Zheng Y, Xia Y, Meisenhelder J, Nika H, et al. Phosphorylation phosphorylation of beta-catenin by AKT promotes beta-catenin transcriptional activity. J Biol Chem. 2007;282(15):11221–9. 10.1074/jbc.M611871200 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 1995;378(6559):785–9. 10.1038/378785a0 [DOI] [PubMed] [Google Scholar]
32.Karlsson C, Dehne T, Lindahl A, Brittberg M, Pruss A, Sittinger M, et al. Genome-wide expression profiling reveals new candidate genes associated with osteoarthritis. Osteoarthritis Cartilage. 2010;18(4):581–92. 10.1016/j.joca.2009.12.002 [DOI] [PubMed] [Google Scholar]
33.Zhang R, Fang H, Chen Y, Shen J, Lu H, Zeng C, et al. Gene expression analyses of subchondral bone in early experimental osteoarthritis by microarray. PLoS One. 2012;7(2):e32356 10.1371/journal.pone.0032356 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Chou CH, Lee CH, Lu LS, Song IW, Chuang HP, Kuo SY, et al. Direct assessment of articular cartilage and underlying subchondral bone reveals a progressive gene expression change in human osteoarthritic knees. Osteoarthritis Cartilage. 2013;21(3):450–61. 10.1016/j.joca.2012.11.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Lourido L, Calamia V, Mateos J, Fernandez-Puente P, Fernandez-Tajes J, Blanco FJ, et al. Quantitative proteomic profiling of human articular cartilage degradation in osteoarthritis. J Proteome Res. 2014;13(12):6096–106. 10.1021/pr501024p [DOI] [PubMed] [Google Scholar]
36.Brophy RH, Cai L, Duan X, Zhang Q, Townsend RR, Nunley RM, et al. Proteomic analysis of synovial fluid identifies periostin as a biomarker for anterior cruciate ligament injury. Osteoarthritis Cartilage. 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Balakrishnan L, Bhattacharjee M, Ahmad S, Nirujogi RS, Renuse S, Subbannayya Y, et al. Differential proteomic analysis of synovial fluid from rheumatoid arthritis and osteoarthritis patients. Clin Proteomics. 2014;11(1):1 10.1186/1559-0275-11-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Chou CH, Lee MT, Song IW, Lu LS, Shen HC, Lee CH, et al. Insights into osteoarthritis progression revealed by analyses of both knee tibiofemoral compartments. Osteoarthritis Cartilage. 2015;23(4):571–80. 10.1016/j.joca.2014.12.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Brophy RH, Tycksen ED, Sandell LJ, Rai MF. Changes in Transcriptome-Wide Gene Expression of Anterior Cruciate Ligament Tears Based on Time From Injury. Am J Sports Med. 2016;44(8):2064–75. 10.1177/0363546516643810 [DOI] [PubMed] [Google Scholar]
40.Kim BJ, Rhee Y, Kim CH, Baek KH, Min YK, Kim DY, et al. Plasma periostin associates significantly with non-vertebral but not vertebral fractures in post-menopausal women: Clinical evidence for the different effects of periostin depending on the skeletal site. Bone. 2015;81:435–41. 10.1016/j.bone.2015.08.014 [DOI] [PubMed] [Google Scholar]
41.Honsawek S, Wilairatana V, Udomsinprasert W, Sinlapavilawan P, Jirathanathornnukul N. Association of plasma and synovial fluid periostin with radiographic knee osteoarthritis: Cross-sectional study. Joint Bone Spine. 2015;82(5):352–5. 10.1016/j.jbspin.2015.01.023 [DOI] [PubMed] [Google Scholar]
42.Chinzei N, Rai MF, Hashimoto S, Schmidt EJ, Takebe K, Cheverud JM, et al. Evidence for Genetic Contribution to Variation in Posttraumatic Osteoarthritis in Mice. Arthritis Rheumatol. 2019;71(3):370–81. 10.1002/art.40730 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Orecchia P, Conte R, Balza E, Castellani P, Borsi L, Zardi L, et al. Identification of a novel cell binding site of periostin involved in tumour growth. Eur J Cancer. 2011;47(14):2221–9. 10.1016/j.ejca.2011.04.026 [DOI] [PubMed] [Google Scholar]
44.Watanabe T, Yasue A, Fujihara S, Tanaka E. PERIOSTIN regulates MMP-2 expression via the alphavbeta3 integrin/ERK pathway in human periodontal ligament cells. Arch Oral Biol. 2012;57(1):52–9. 10.1016/j.archoralbio.2011.07.010 [DOI] [PubMed] [Google Scholar]
45.Kormann R, Kavvadas P, Placier S, Vandermeersch S, Dorison A, Dussaule JC, et al. Periostin Promotes Cell Proliferation and Macrophage Polarization to Drive Repair after AKI. J Am Soc Nephrol. 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Gao M, Duan L, Luo J, Zhang L, Lu X, Zhang Y, et al. Discovery and optimization of 3-(2-(Pyrazolo[1,5-a]pyrimidin-6-yl)ethynyl)benzamides as novel selective and orally bioavailable discoidin domain receptor 1 (DDR1) inhibitors. J Med Chem. 2013;56(8):3281–95. 10.1021/jm301824k [DOI] [PubMed] [Google Scholar]
47.Kim HG, Tan L, Weisberg EL, Liu F, Canning P, Choi HG, et al. Discovery of a potent and selective DDR1 receptor tyrosine kinase inhibitor. ACS Chem Biol. 2013;8(10):2145–50. 10.1021/cb400430t [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Schminke B, Muhammad H, Bode C, Sadowski B, Gerter R, Gersdorff N, et al. A discoidin domain receptor 1 knock-out mouse as a novel model for osteoarthritis of the temporomandibular joint. Cell Mol Life Sci. 2014;71(6):1081–96. 10.1007/s00018-013-1436-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Nakazeki F, Nishiga M, Horie T, Nishi H, Nakashima Y, Baba O, et al. Loss of periostin ameliorates adipose tissue inflammation and fibrosis in vivo. Sci Rep. 2018;8(1):8553 10.1038/s41598-018-27009-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0231501.r001

Decision Letter 0

Dominique Heymann

21 Jan 2020

PONE-D-19-33141

PERIOSTIN INTERACTION WITH DISCOIDIN DOMAIN RECEPTOR-1 (DDR1) PROMOTES CARTILAGE DEGENERATION

PLOS ONE

Dear Dr Attur,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by 22 March 2020. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Dominique Heymann, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In the ethics statement in the manuscript and in the online submission form, please provide additional information about the human cartilage used in your study. Specifically, please ensure that you have discussed whether researchers had access to potentially identifying information and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have their discarded cartilage tissue used in research, please include this information.

- In the Methods, please provide the following information about the mice used in this study: (1) Please state the genetic background of the Ddr1-/- mice; (2) Please provide details of animal welfare (e.g., shelter, food, water, environmental enrichment); (3) Please include the method of euthanasia.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

"Funding for this project was provided by the National Institute of Health grant

AR054817, AR068341, and AR070934. The funders had no role in study design, data

collection, and analysis, decision to publish, or preparation of the manuscript."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"None"

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this report, authors would like to prove the interaction of DDR1 and periostin and its signal in chondrocyte. However, the interaction of DDR1 and periostin and DDR1/periostin-MMP13 signal were already proved in several years ago. It is hard to find new finding.

Here author show that MMP13 was increased when periostin overexpressed chondrocyte cell line, and it is inhibited by DDR1 inhibitor. However, biological meaning of this phenotype is not significant. In OA patient, DDR1 and periostin were not increased by q-PCR and IHC. Actually, periostin and MMP13 increase in OA was reported and recombinant periostin induces DDR1-MMP13 relation was also proved in previously.

Please show us new signaling of periostin-DDR1 or new biological meaning.

Reviewer #2: Excellent paper with solid evidences deciphering the periostin pathway in chondrocytes, and showing that the pathway is different from bone pathway.

The discussion is very well constructed, with the question raised by the spontaneous OA developped by ddr-/- mice.

Just minors punctuation errors (pg 10 line 12 .,. , and some "Figure" instead "Fig. ")

Reviewer #3: In a paper previously published in FASEB J in 2015, the authors reported high periostin levels in human and mouse OA cartilage. Gain and loss of function experiments indicated that periostin stimulated MMP13 expression and promoted cartilage degradation. In the present article, they report that periostin induces collagen and proteoglycan degradation by signaling through discoidin domain receptor-1 (DDR1).

They first show that DDR1 mRNA and protein levels are not different between non-lesion and lesion OA, and was cell-associated. In contrast periostin protein was more expressed in OA lesions and was both cell and ECM-associated. Then by performing co-immunoprecipitation, they show in OA chondrocytes and in the C28I2 cell line that DDR1 interacts with periostin. Inhibition of DDR1 with the 7rh molecule blocked the increase in MMP13 levels induced by periostin adenoviral overexpression. Moreover, authors show that periostin activates AKT phosphorylation and increased beta-catenin levels, and that these effects are prevented by inhibition of DDR1. Finally, in chondrocytes from Ddr1 deficient mice, periostin does not increase MMP13 expression and activity further suggesting that periostin signals through DDR1.

This is an interesting article with original results. The results are convincing. However, the methods used and the experimental conditions are insufficiently detailed in the materials and methods section and in the figure legends.

- Abstract line 16: 2 spaces between DDR1 and is. Several other similar errors throughout the text

- Introduction: periostin is presented as a TGFb-inducible protein. TGFb is known as an anabolic cartilage GF and periostin catabolic in the context of OA. Can authors explain this apparent opposition?

- Please indicate whether you used human chondrocytes with several passages or only freshly isolated cells.

- Please indicate in the legend of figure 3 what corresponds to A or B.

- Page 11 first sentence: “strongly upregulated” written twice

- Page 11, first paragraph, last sentence (and figure 3). It is necessary to explain why authors used a wnt inhibitor in this experiment. They also have to explain which Wnt inhibitor was used, at which concentration, and discuss the results (MMP13 levels completely dropped). Is this Wnt inhibitor cytotoxic at the concentration used?

- Page 11 and Figure 4A: authors should perform densitometric quantification of the bands from several independent experiments and calculate the mean to better analyze DDR1 phosphorylation in response to periostin.

- Page 11 figure 4B: same remark. The authors have to perform densitometric analyses to fully convince the readers.

- Page 11 and page 13: authors should explain the molecular link between Akt and b-catenin. Is this activation of b-catenin independent from the canonical Wnt signaling pathway activated by Wnt growth factors?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: 12891_2015_Article_682.pdf

Click here for additional data file.^{(7.7MB, pdf)}

PLoS One. 2020 Apr 24;15(4):e0231501. doi: 10.1371/journal.pone.0231501.r002

Author response to Decision Letter 0

11 Mar 2020

Dr. Dominique Heymann, Ph.D.

Academic Editor

PLOS ONE

Sub: Submission of revised manuscript - PONE-D-19-33141

Dear Dr. Heymann

Thank you very much for your email of Jan-21-2020 with the reviews of our manuscript “PERIOSTIN INTERACTION WITH DISCOIDIN DOMAIN RECEPTOR-1 (DDR1) PROMOTES CARTILAGE DEGENERATION” (PONE-D-19-33141).

We are very grateful for your decision to allow us to resubmit our revised manuscript. We appreciate that Reviewers 2 and 3 agree with importance our findings on the role of periostin in osteoarthritis.

Please find below our point-by-point responses to the editorial and reviewers’ comments, with detailed indication of the changes we made.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

Response: OA cartilage samples were collected from end-stage knee OA patients undergoing knee replacement surgery at NYU Langone Orthopedic Hospital. Their use in de-identified form in the current study was in accordance with the ethical standards of the Helsinki Declaration of 1975, as revised in 2000, and was approved (#i9018) by the institutional review board (IRB) of the NYU School of Medicine. The surgical discards from knee replacement surgery were obtained for human chondrocyte isolation and cartilage for histology and Immunohisto-chemistry (IHC) studies. The current study was approved by the Institutional Review Board (IRB) of the NYU School of Medicine, and the ethics committee waived the requirement for informed consent. We have included this information in the Methods section (page no:5; line 7-20).

Response: Ddr1-/- and wt mice were maintained on a C57BL6 background, and heterozygote (Ddr1+/-) males and females were bred to produce wild-type (wt) and Ddr1 knockout (Ddr1-/-) littermates for analysis. Mice were fed standard pelleted chow and allowed access to water ad libitum. Mice were euthanized by CO2 inhalation and cervical dislocation, and joint tissues harvested at ages 10-12 weeks for chondrocyte isolation. All animals used in accordance with scientific, humane, and ethical principles and in compliance with regulations approved by the New York University School of Medicine Institutional Animal Care and Use Committee. We have included this information in the Methods section (page no: 6; line 2-10).

Genotyping was performed from 0.5-cm tail snips collected at 14-21 days postnatally. Genomic DNA was isolated from tail tissues and amplified by PCR using primers used to amplify a 159 (using primer 1 & 2) and 250 base pair (bp) product using (primer 2 & 3) from the mouse Ddr1 gene in wt and mutant respectively were: Primer 1:GCAGCGCATCGCCTTCTATC AND Primer 2: AGACAATCTCGAGATGCTGG AND Primer 3: GTTGCGTTACTCCCGAGATG.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

"Funding for this project was provided by the National Institute of Health grant

AR054817, AR068341, and AR070934. The funders had no role in study design, data

collection, and analysis, decision to publish, or preparation of the manuscript."

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"None"

Response: As per the Journal regulation we have removed the funding information from the acknowledgement section. However, we would like to acknowledge the funding sources in in a funding statement as follow: Funding for this project provided by the National Institute of Health grant AR054817, AR068341, and AR070934. The funders had no role in study design, data collection, and analysis, decision to publish, or preparation of the manuscript."

Response:

We provided the uncropped images of our Western blots in Supporting Information.

Review Comments to the Author

Reviewer #1:

In this report, authors would like to prove the interaction of DDR1 and periostin and its signal in chondrocyte. However, the interaction of DDR1 and periostin and DDR1/periostin-MMP13 signal were already proved in several years ago. It is hard to find new finding.

Response: We respectfully disagree with the reviewer’s statement. An extensive literature review indicates that ours is the first report to demonstrate that periostin effects are mediated via the DDR1 signaling pathway. Our description of the DDR1/periostin signal is therefore novel, and we would be pleased to include in our discussion prior literature that demonstrates the DDR1 requirement for periostin signaling that the reviewer can provide.

Response: We respectfully disagree with this reviewer’s statement. Periostin is strongly elevated in OA cartilage relative to normal cartilage, as shown by qPCR, Western blotting and ELISA [1, 2]. Others have reported elevated expression of periostin in OA synovial fluid and associated with severity [1-8]. In our manuscript we do report that DDR1 is not differentially expressed in OA vs. normal cartilage. However, we point out to the reviewer that lack of upregulation of DDR1 per se does not diminish the “biological significance” of the finding as he/she suggests. First, because its “ligand” periostin is upregulated, and second, because signaling molecules need not be upregulated to become activated. We would like to highlight reviewer 3’s comments here “This is an interesting article with original results”.

Please show us new signaling of periostin-DDR1 or new biological meaning.

Response: In the current study we present evidence that periostin interacts with collagen receptor DDR1 tyrosine kinase receptor and activates the AKT/β-catenin pathway, inducing MMP-13 expression in human and mouse chondrocytes. As noted above, ours is the first report to show that periostin binds to collagen receptor DDR1 and induces MMP-13 expression through this interaction. The “new biological meaning” requested by the reviewer is apparent: this observation elucidates a new signaling mechanism for a periostin, a catabolic ECM molecule implicated in the pathogenesis of OA. Insight into its signaling pathway provides new opportunities for treatment strategies.

Reviewer #2:

Excellent paper with solid evidences deciphering the periostin pathway in chondrocytes, and showing that the pathway is different from bone pathway.

The discussion is very well constructed, with the question raised by the spontaneous OA developed by ddr-/- mice.

Response: We thank the reviewer for these comments.

Just minors punctuation errors (pg 10 line 12 .,. , and some "Figure" instead "Fig. ")

Response: We thank the reviewer for highlighting these errors, and corrected them all.

Reviewer #3:

In a paper previously published in FASEB J in 2015, the authors reported high periostin levels in human and mouse OA cartilage. Gain and loss of function experiments indicated that periostin stimulated MMP13 expression and promoted cartilage degradation. In the present article, they report that periostin induces collagen and proteoglycan degradation by signaling through discoidin domain receptor-1 (DDR1).

This is an interesting article with original results.

The results are convincing. However, the methods used and the experimental conditions are insufficiently detailed in the materials and methods section and in the figure legends.

Response: We have revised and updated the Methods section to provide detailed experimental conditions (page nos: 5-7).

- Abstract line 16: 2 spaces between DDR1 and is. Several other similar errors throughout the text

Response: We would like to thank the reviewer for highlighting these errors. We edited the manuscript accordingly.

- Introduction: periostin is presented as a TGFβ-inducible protein. TGFβ is known as an anabolic cartilage GF and periostin catabolic in the context of OA. Can authors explain this apparent opposition?

Response: Multiple lines of evidence show that TGF-β signaling acts as a double edge sword in healthy and OA joint tissues [9] . 1). TGF-β signals via multiple pathways. Different TGF-β receptors control different downstream signals: ALK5 binding of TGF-β leads to Smad2/3 signaling which is associated with an anabolic effect on cartilage, whereas ALK1 activation leads to Smad1/5/8 signaling associated with increased expression of MMP-13 and loss of matrix [10]. 2) TGF-β has been shown to exert catabolic effects following a shift in the ALK1 or ALK5 receptor expression with age and/or disease [10]. 3) Inhibition of Smad signaling protects against cartilage injury and osteoarthritis [11]. 4) Activation of TGF-β signaling in mesenchymal progenitor cells of subchondral bone also causes OA-like lesions [11]. 5) The circadian rhythm pathway is dysregulated in OA cartilage [12] and interference with circadian rhythmicity in chondrocytes affects TGF-β signaling, and cartilage homeostasis. 6) Periostin expression is lower in normal relative to OA cartilage. Only under pathological conditions is periostin expression elevated in cartilage. Periostin expression is increased during disease progression due to dysregulated TGFβ signaling, and leads to activation of AKT/ β-catenin signaling and MMP-13 expression.

- Please indicate whether you used human chondrocytes with several passages or only freshly isolated cells.

Response: We used primary human chondrocytes at passage 1 or 2 in all our experiments. We reported this information in the Methods section of our revised manuscript (page no 6; line 18-21).

- Please indicate in the legend of figure 3 what corresponds to A or B.

Response: We indicated panel A & B in the Figure 3 legend of our revised manuscript.

- Page 11 first sentence: “strongly upregulated” written twice

Response: We used the Wnt inhibitor CCT031374 hydrobromide (cat. no. 4675/10, R&D Systems, Minneapolis, MN, USA) at 1-50 uM concentrations in our in vitro experiments. CCT031374 was not toxic in human chondrocytes, as we reported in our previous publication [1], where we showed that this Wnt inhibitor blocked periostin-induced MMP-13 expression and enzyme activity. In the current study we used the Wnt inhibitor (10uM) as a positive control in our experiments.

- Page 11 figure 4B: same remark. The authors have to perform densitometric analyses to fully convince the readers.

Response: As requested, we performed quantitation of the Western blots. We thank the reviewer for this suggestion, which we believe significantly strengthened our manuscript.

Response: We thank the reviewer for this comment, which gave us the opportunity to better explain the signaling mechanism activated by Postn binding to DDR1. Our data show that periostin – DDR1 interaction results in AKT activation and increased b-catenin levels, as well as upregulation of MMP_13 expression, effects blocked by pharmacological inhibition or genetic deficiency of DDR1. We had previously reported that inhibition of b-catenin signaling abrogates periostin induction of MMP-13 expression. These findings show that periostin – DDR1 signaling is mediated by b-catenin stabilization, and therefore by canonical Wnt signaling. We propose that activation of b-catenin/Wnt signaling is mediated by DDR1 activation of the PI3K-AKT pathway. Active AKT stabilizes b-catenin by two mechanisms, phosphorylation of b-catenin at Ser552 [13] and inhibition of glycogen synthase kinase-3 [14], which phosphorylates β-catenin causing its ubiquitination and degradation. Another potential mechanism could consist of AKT upregulation of canonical Wnt growth factors. However, we could not find any such report in the literature. We briefly discussed these points in our revised manuscript (page no: 15; line 4-11). In addition, we changed the term “Wnt signaling” into “Wnt/ β-catenin signaling” in order to avoid confusion between canonical and non-canonical Wnt signaling.

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public.

Response: We agree to publish the peer review history of our article.

We hope that these responses have satisfactorily addressed the reviewers’ comments, and that our revised manuscript will now be acceptable for publication in PLOS ONE. Thank you again for considering our work; we look forward to hearing from you.

Sincerely,

Mukundan Attur PhD

References cited:

1. Attur M, Yang Q, Shimada K, et al. Elevated expression of periostin in human osteoarthritic cartilage and its potential role in matrix degradation via matrix metalloproteinase-13. FASEB J. 2015;29(10):4107-21.

2. Chinzei N, Brophy RH, Duan X, et al. Molecular influence of anterior cruciate ligament tear remnants on chondrocytes: a biologic connection between injury and osteoarthritis. Osteoarthritis Cartilage. 2018;26(4):588-99.

3. Brophy RH, Cai L, Duan X, et al. Proteomic analysis of synovial fluid identifies periostin as a biomarker for anterior cruciate ligament injury. Osteoarthritis Cartilage. 2019.

4. Lourido L, Calamia V, Mateos J, et al. Quantitative proteomic profiling of human articular cartilage degradation in osteoarthritis. J Proteome Res. 2014;13(12):6096-106.

5. Chijimatsu R, Kunugiza Y, Taniyama Y, Nakamura N, Tomita T, Yoshikawa H. Expression and pathological effects of periostin in human osteoarthritis cartilage. BMC Musculoskelet Disord. 2015;16:215.

6. Loeser RF, Olex AL, McNulty MA, et al. Microarray analysis reveals age-related differences in gene expression during the development of osteoarthritis in mice. Arthritis Rheum. 2012;64(3):705-17.

7. Chen KS, Tatarczuch L, Mirams M, Ahmed YA, Pagel CN, Mackie EJ. Periostin expression distinguishes between light and dark hypertrophic chondrocytes. Int J Biochem Cell Biol. 2010;42(6):880-9.

8. Fan B, Liu X, Chen X, et al. Periostin Mediates Condylar Resorption via the NF-kappaB-ADAMTS5 Pathway. Inflammation. 2019.

9. van der Kraan PM. Differential Role of Transforming Growth Factor-beta in an Osteoarthritic or a Healthy Joint. J Bone Metab. 2018;25(2):65-72.

10. Blaney Davidson EN, van Caam AP, van der Kraan PM. Osteoarthritis year in review 2016: biology. Osteoarthritis Cartilage. 2017;25(2):175-80.

11. Wang YJ, Shen M, Wang S, et al. Inhibition of the TGF-beta1/Smad signaling pathway protects against cartilage injury and osteoarthritis in a rat model. Life Sci. 2017;189:106-13.

12. Akagi R, Akatsu Y, Fisch KM, et al. Dysregulated circadian rhythm pathway in human osteoarthritis: NR1D1 and BMAL1 suppression alters TGF-beta signaling in chondrocytes. Osteoarthritis Cartilage. 2017;25(6):943-51.

13. Fang D, Hawke D, Zheng Y, et al. Phosphorylation of beta-catenin by AKT promotes beta-catenin transcriptional activity. J Biol Chem. 2007;282(15):11221-9.

14. Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 1995;378(6559):785-9.

Attachment

Submitted filename: DDR1_PLosone_response Mar 10 2020.docx

Click here for additional data file.^{(127.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0231501.r003

Decision Letter 1

Dominique Heymann

25 Mar 2020

PERIOSTIN INTERACTION WITH DISCOIDIN DOMAIN RECEPTOR-1 (DDR1) PROMOTES CARTILAGE DEGENERATION

PONE-D-19-33141R1

Dear Dr. Attur,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Dominique Heymann, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #3: Authors have answered the main concerns in a satisfyin way (better description of the materials and methods, densitometric analysis of western blots in particular)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: No

PLoS One. doi: 10.1371/journal.pone.0231501.r004

Acceptance letter

Dominique Heymann

27 Mar 2020

PONE-D-19-33141R1

Periostin Interaction With Discoidin Domain Receptor-1 (DDR1) Promotes Cartilage Degeneration

Dear Dr. Attur:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Pr. Dominique Heymann

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig

(PPTX)

Click here for additional data file.^{(890.6KB, pptx)}

Attachment

Submitted filename: 12891_2015_Article_682.pdf

Click here for additional data file.^{(7.7MB, pdf)}

Attachment

Submitted filename: DDR1_PLosone_response Mar 10 2020.docx

Click here for additional data file.^{(127.1KB, docx)}

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

[pone.0231501.ref001] 1.Attur M, Yang Q, Shimada K, Tachida Y, Nagase H, Mignatti P, et al. Elevated expression of periostin in human osteoarthritic cartilage and its potential role in matrix degradation via matrix metalloproteinase-13. FASEB J. 2015;29(10):4107–21. 10.1096/fj.15-272427 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref002] 2.Chinzei N, Brophy RH, Duan X, Cai L, Nunley RM, Sandell LJ, et al. Molecular influence of anterior cruciate ligament tear remnants on chondrocytes: a biologic connection between injury and osteoarthritis. Osteoarthritis Cartilage. 2018;26(4):588–99. 10.1016/j.joca.2018.01.017 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref003] 3.Chijimatsu R, Kunugiza Y, Taniyama Y, Nakamura N, Tomita T, Yoshikawa H. Expression and pathological effects of periostin in human osteoarthritis cartilage. BMC Musculoskelet Disord. 2015;16:215 10.1186/s12891-015-0682-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref004] 4.Chou CH, Wu CC, Song IW, Chuang HP, Lu LS, Chang JH, et al. Genome-wide expression profiles of subchondral bone in osteoarthritis. Arthritis Res Ther. 2013;15(6):R190 10.1186/ar4380 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref005] 5.Loeser RF, Olex AL, McNulty MA, Carlson CS, Callahan MF, Ferguson CM, et al. Microarray analysis reveals age-related differences in gene expression during the development of osteoarthritis in mice. Arthritis Rheum. 2012;64(3):705–17. 10.1002/art.33388 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref006] 6.Oka T, Xu J, Kaiser RA, Melendez J, Hambleton M, Sargent MA, et al. Genetic manipulation of periostin expression reveals a role in cardiac hypertrophy and ventricular remodeling. Circ Res. 2007;101(3):313–21. 10.1161/CIRCRESAHA.107.149047 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref007] 7.Hakuno D, Kimura N, Yoshioka M, Mukai M, Kimura T, Okada Y, et al. Periostin advances atherosclerotic and rheumatic cardiac valve degeneration by inducing angiogenesis and MMP production in humans and rodents. J Clin Invest. 2010;120(7):2292–306. 10.1172/JCI40973 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref008] 8.Kumar P, Smith T, Raeman R, Chopyk DM, Brink H, Liu Y, et al. Periostin promotes liver fibrogenesis by activating lysyl oxidase in hepatic stellate cells. J Biol Chem. 2018;293(33):12781–92. 10.1074/jbc.RA117.001601 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref009] 9.Jia Y, Zhong F, Jiang S, Guo Q, Jin H, Wang F, et al. Periostin in chronic liver diseases: Current research and future perspectives. Life Sci. 2019;226:91–7. 10.1016/j.lfs.2019.04.021 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref010] 10.Alfieri C, Kavvadas P, Simonini P, Ikehata M, Dussaule JC, Chadjichristos CE, et al. Discoidin domain receptor-1 and periostin: new players in chronic kidney disease. Nephrol Dial Transplant. 2015;30(12):1965–71. 10.1093/ndt/gfv074 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref011] 11.Leitinger B. Discoidin domain receptor functions in physiological and pathological conditions. Int Rev Cell Mol Biol. 2014;310:39–87. 10.1016/B978-0-12-800180-6.00002-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref012] 12.Leitinger B. Molecular analysis of collagen binding by the human discoidin domain receptors, DDR1 and DDR2. Identification of collagen binding sites in DDR2. J Biol Chem. 2003;278(19):16761–9. 10.1074/jbc.M301370200 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref013] 13.Kerroch M, Alfieri C, Dorison A, Boffa JJ, Chatziantoniou C, Dussaule JC. Protective effects of genetic inhibition of Discoidin Domain Receptor 1 in experimental renal disease. Sci Rep. 2016;6:21262 10.1038/srep21262 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref014] 14.Fu HL, Valiathan RR, Arkwright R, Sohail A, Mihai C, Kumarasiri M, et al. Discoidin domain receptors: unique receptor tyrosine kinases in collagen-mediated signaling. J Biol Chem. 2013;288(11):7430–7. 10.1074/jbc.R112.444158 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref015] 15.Karimaian A, Majidinia M, Bannazadeh Baghi H, Yousefi B. The crosstalk between Wnt/beta-catenin signaling pathway with DNA damage response and oxidative stress: Implications in cancer therapy. DNA Repair (Amst). 2017;51:14–9. [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref016] 16.Das S, Ongusaha PP, Yang YS, Park JM, Aaronson SA, Lee SW. Discoidin domain receptor 1 receptor tyrosine kinase induces cyclooxygenase-2 and promotes chemoresistance through nuclear factor-kappaB pathway activation. Cancer Res. 2006;66(16):8123–30. 10.1158/0008-5472.CAN-06-1215 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref017] 17.Rammal H, Saby C, Magnien K, Van-Gulick L, Garnotel R, Buache E, et al. Discoidin Domain Receptors: Potential Actors and Targets in Cancer. Front Pharmacol. 2016;7:55 10.3389/fphar.2016.00055 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref018] 18.Coelho NM, McCulloch CA. Mechanical signaling through the discoidin domain receptor 1 plays a central role in tissue fibrosis. Cell Adh Migr. 2018;12(4):348–62. 10.1080/19336918.2018.1448353 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref019] 19.Neuhaus B, Buhren S, Bock B, Alves F, Vogel WF, Kiefer F. Migration inhibition of mammary epithelial cells by Syk is blocked in the presence of DDR1 receptors. Cell Mol Life Sci. 2011;68(22):3757–70. 10.1007/s00018-011-0676-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref020] 20.Xu H, Raynal N, Stathopoulos S, Myllyharju J, Farndale RW, Leitinger B. Collagen binding specificity of the discoidin domain receptors: binding sites on collagens II and III and molecular determinants for collagen IV recognition by DDR1. Matrix Biol. 2011;30(1):16–26. 10.1016/j.matbio.2010.10.004 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref021] 21.Soomro I, Hong A, Li Z, Duncan JS, Skolnik EY. Discoidin Domain Receptor 1 (DDR1) tyrosine kinase is upregulated in PKD kidneys but does not play a role in the pathogenesis of polycystic kidney disease. PLoS One. 2019;14(7):e0211670 10.1371/journal.pone.0211670 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref022] 22.Gosset M, Berenbaum F, Thirion S, Jacques C. Primary culture and phenotyping of murine chondrocytes. Nat Protoc. 2008;3(8):1253–60. 10.1038/nprot.2008.95 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref023] 23.Jonason JH, Hoak D, O'Keefe RJ. Primary murine growth plate and articular chondrocyte isolation and cell culture. Methods Mol Biol. 2015;1226:11–8. 10.1007/978-1-4939-1619-1_2 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref024] 24.Katsara O, Attur M, Ruoff R, Abramson SB, Kolupaeva V. Increased Activity of the Chondrocyte Translational Apparatus Accompanies Osteoarthritic Changes in Human and Rodent Knee Cartilage. Arthritis Rheumatol. 2017;69(3):586–97. 10.1002/art.39947 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref025] 25.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref026] 26.Matsuzawa M, Arai C, Nomura Y, Murata T, Yamakoshi Y, Oida S, et al. Periostin of human periodontal ligament fibroblasts promotes migration of human mesenchymal stem cell through the alphavbeta3 integrin/FAK/PI3K/Akt pathway. J Periodontal Res. 2015;50(6):855–63. 10.1111/jre.12277 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref027] 27.Bonnet N, Conway SJ, Ferrari SL. Regulation of beta catenin signaling and parathyroid hormone anabolic effects in bone by the matricellular protein periostin. Proc Natl Acad Sci U S A. 2012;109(37):15048–53. 10.1073/pnas.1203085109 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref028] 28.Li G, Jin R, Norris RA, Zhang L, Yu S, Wu F, et al. Periostin mediates vascular smooth muscle cell migration through the integrins alphavbeta3 and alphavbeta5 and focal adhesion kinase (FAK) pathway. Atherosclerosis. 2010;208(2):358–65. 10.1016/j.atherosclerosis.2009.07.046 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref029] 29.Cai L, Brophy RH, Tycksen ED, Duan X, Nunley RM, Rai MF. Distinct expression pattern of periostin splice variants in chondrocytes and ligament progenitor cells. FASEB J. 2019;33(7):8386–405. 10.1096/fj.201802281R [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref030] 30.Fang D, Hawke D, Zheng Y, Xia Y, Meisenhelder J, Nika H, et al. Phosphorylation phosphorylation of beta-catenin by AKT promotes beta-catenin transcriptional activity. J Biol Chem. 2007;282(15):11221–9. 10.1074/jbc.M611871200 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref031] 31.Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 1995;378(6559):785–9. 10.1038/378785a0 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref032] 32.Karlsson C, Dehne T, Lindahl A, Brittberg M, Pruss A, Sittinger M, et al. Genome-wide expression profiling reveals new candidate genes associated with osteoarthritis. Osteoarthritis Cartilage. 2010;18(4):581–92. 10.1016/j.joca.2009.12.002 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref033] 33.Zhang R, Fang H, Chen Y, Shen J, Lu H, Zeng C, et al. Gene expression analyses of subchondral bone in early experimental osteoarthritis by microarray. PLoS One. 2012;7(2):e32356 10.1371/journal.pone.0032356 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref034] 34.Chou CH, Lee CH, Lu LS, Song IW, Chuang HP, Kuo SY, et al. Direct assessment of articular cartilage and underlying subchondral bone reveals a progressive gene expression change in human osteoarthritic knees. Osteoarthritis Cartilage. 2013;21(3):450–61. 10.1016/j.joca.2012.11.016 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref035] 35.Lourido L, Calamia V, Mateos J, Fernandez-Puente P, Fernandez-Tajes J, Blanco FJ, et al. Quantitative proteomic profiling of human articular cartilage degradation in osteoarthritis. J Proteome Res. 2014;13(12):6096–106. 10.1021/pr501024p [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref036] 36.Brophy RH, Cai L, Duan X, Zhang Q, Townsend RR, Nunley RM, et al. Proteomic analysis of synovial fluid identifies periostin as a biomarker for anterior cruciate ligament injury. Osteoarthritis Cartilage. 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref037] 37.Balakrishnan L, Bhattacharjee M, Ahmad S, Nirujogi RS, Renuse S, Subbannayya Y, et al. Differential proteomic analysis of synovial fluid from rheumatoid arthritis and osteoarthritis patients. Clin Proteomics. 2014;11(1):1 10.1186/1559-0275-11-1 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref038] 38.Chou CH, Lee MT, Song IW, Lu LS, Shen HC, Lee CH, et al. Insights into osteoarthritis progression revealed by analyses of both knee tibiofemoral compartments. Osteoarthritis Cartilage. 2015;23(4):571–80. 10.1016/j.joca.2014.12.020 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref039] 39.Brophy RH, Tycksen ED, Sandell LJ, Rai MF. Changes in Transcriptome-Wide Gene Expression of Anterior Cruciate Ligament Tears Based on Time From Injury. Am J Sports Med. 2016;44(8):2064–75. 10.1177/0363546516643810 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref040] 40.Kim BJ, Rhee Y, Kim CH, Baek KH, Min YK, Kim DY, et al. Plasma periostin associates significantly with non-vertebral but not vertebral fractures in post-menopausal women: Clinical evidence for the different effects of periostin depending on the skeletal site. Bone. 2015;81:435–41. 10.1016/j.bone.2015.08.014 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref041] 41.Honsawek S, Wilairatana V, Udomsinprasert W, Sinlapavilawan P, Jirathanathornnukul N. Association of plasma and synovial fluid periostin with radiographic knee osteoarthritis: Cross-sectional study. Joint Bone Spine. 2015;82(5):352–5. 10.1016/j.jbspin.2015.01.023 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref042] 42.Chinzei N, Rai MF, Hashimoto S, Schmidt EJ, Takebe K, Cheverud JM, et al. Evidence for Genetic Contribution to Variation in Posttraumatic Osteoarthritis in Mice. Arthritis Rheumatol. 2019;71(3):370–81. 10.1002/art.40730 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref043] 43.Orecchia P, Conte R, Balza E, Castellani P, Borsi L, Zardi L, et al. Identification of a novel cell binding site of periostin involved in tumour growth. Eur J Cancer. 2011;47(14):2221–9. 10.1016/j.ejca.2011.04.026 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref044] 44.Watanabe T, Yasue A, Fujihara S, Tanaka E. PERIOSTIN regulates MMP-2 expression via the alphavbeta3 integrin/ERK pathway in human periodontal ligament cells. Arch Oral Biol. 2012;57(1):52–9. 10.1016/j.archoralbio.2011.07.010 [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref045] 45.Kormann R, Kavvadas P, Placier S, Vandermeersch S, Dorison A, Dussaule JC, et al. Periostin Promotes Cell Proliferation and Macrophage Polarization to Drive Repair after AKI. J Am Soc Nephrol. 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref046] 46.Gao M, Duan L, Luo J, Zhang L, Lu X, Zhang Y, et al. Discovery and optimization of 3-(2-(Pyrazolo[1,5-a]pyrimidin-6-yl)ethynyl)benzamides as novel selective and orally bioavailable discoidin domain receptor 1 (DDR1) inhibitors. J Med Chem. 2013;56(8):3281–95. 10.1021/jm301824k [DOI] [PubMed] [Google Scholar]

[pone.0231501.ref047] 47.Kim HG, Tan L, Weisberg EL, Liu F, Canning P, Choi HG, et al. Discovery of a potent and selective DDR1 receptor tyrosine kinase inhibitor. ACS Chem Biol. 2013;8(10):2145–50. 10.1021/cb400430t [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref048] 48.Schminke B, Muhammad H, Bode C, Sadowski B, Gerter R, Gersdorff N, et al. A discoidin domain receptor 1 knock-out mouse as a novel model for osteoarthritis of the temporomandibular joint. Cell Mol Life Sci. 2014;71(6):1081–96. 10.1007/s00018-013-1436-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0231501.ref049] 49.Nakazeki F, Nishiga M, Horie T, Nishi H, Nakashima Y, Baba O, et al. Loss of periostin ameliorates adipose tissue inflammation and fibrosis in vivo. Sci Rep. 2018;8(1):8553 10.1038/s41598-018-27009-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Periostin interaction with discoidin domain receptor-1 (DDR1) promotes cartilage degeneration

Tianzhen Han

Paolo Mignatti

Steven B Abramson

Mukundan Attur

Roles

Abstract

Introduction

Materials and methods

Reagents

Procurement of human cartilage

Ddr1 knock out mice

OA chondrocyte culture

Mouse chondrocyte isolation

Measurement of proMMP-13 protein and activity

Transient transfection

Adenovirus transduction

Western blotting and immunoprecipitation

RNA extraction and qRT-PCR analysis

Densitometry

Statistical analysis

Ethics statement

Results

Expression of DDR1 in human OA and normal cartilage

Fig 1. Elevated expression of Postn but not DDR1 in OA cartilage.

DDR1—Postn interaction

Fig 2. Co-immunoprecipitation of DDR1-Postn complexes in human chondrocytes.

DDR1 inhibition abrogates postn induction of MMP-13 expression

Fig 3. The DDR1 inhibitor 7rh inhibits the Adenovirus-mediated induction of MMP-13 expression of human Postn (Ad-hPostn) in human OA chondrocytes.

Fig 4.

DDR1 –ß-catenin mediates postn signaling in chondrocytes

Postn dost not induce MMP-13 expression in Ddr1 deficient chondrocytes

Fig 5. DDR1 mediates Postn induction of MMP-13 expression in mouse chondrocytes.

Discussion

Supporting information

Data Availability

Funding Statement

References

Decision Letter 0

Dominique Heymann

Roles

Author response to Decision Letter 0

Decision Letter 1

Dominique Heymann

Roles

Acceptance letter

Dominique Heymann

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases