Contributions of a LysR Transcriptional Regulator to Listeria monocytogenes Virulence and Identification of Its Regulons

Listeria monocytogenes is the causative agent of listeriosis, an infectious and fatal disease of animals and humans. In this study, we have shown that lysR contributes to Listeria pathogenesis and replication in cell lines. We also highlight the importance of lysR in regulating the transcription of genes involved in different pathways that might be essential for the growth and persistence of L. monocytogenes in the host or under nutrient limitation. Better understanding L. monocytogenes pathogenesis and the role of various virulence factors is necessary for further development of prevention and control strategies.

ABSTRACT

The capacity of Listeria monocytogenes to adapt to environmental changes is facilitated by a large number of regulatory proteins encoded by its genome. Among these proteins are the uncharacterized LysR-type transcriptional regulators (LTTRs). LTTRs can work as positive and/or negative transcription regulators at both local and global genetic levels. Previously, our group determined by comparative genome analysis that one member of the LTTRs (NCBI accession no. WP_003734782) was present in pathogenic strains but absent from nonpathogenic strains. The goal of the present study was to assess the importance of this transcription factor in the virulence of L. monocytogenes strain F2365 and to identify its regulons. An L. monocytogenes strain lacking lysR (the F2365ΔlysR strain) displayed significant reductions in cell invasion of and adhesion to Caco-2 cells. In plaque assays, the deletion of lysR resulted in a 42.86% decrease in plaque number and a 13.48% decrease in average plaque size. Furthermore, the deletion of lysR also attenuated the virulence of L. monocytogenes in mice following oral and intraperitoneal inoculation. The analysis of transcriptomics revealed that the transcript levels of 139 genes were upregulated, while 113 genes were downregulated in the F2365ΔlysR strain compared to levels in the wild-type bacteria. lysR-repressed genes included ABC transporters, important for starch and sucrose metabolism as well as glycerolipid metabolism, flagellar assembly, quorum sensing, and glycolysis/gluconeogenesis. Conversely, lysR activated the expression of genes related to fructose and mannose metabolism, cationic antimicrobial peptide (CAMP) resistance, and beta-lactam resistance. These data suggested that lysR contributed to L. monocytogenes virulence by broad impact on multiple pathways of gene expression.

IMPORTANCE Listeria monocytogenes is the causative agent of listeriosis, an infectious and fatal disease of animals and humans. In this study, we have shown that lysR contributes to Listeria pathogenesis and replication in cell lines. We also highlight the importance of lysR in regulating the transcription of genes involved in different pathways that might be essential for the growth and persistence of L. monocytogenes in the host or under nutrient limitation. Better understanding L. monocytogenes pathogenesis and the role of various virulence factors is necessary for further development of prevention and control strategies.

INTRODUCTION

The Gram-positive, intracellular bacterium Listeria monocytogenes is one of the most costly foodborne pathogens due to the costs of health care and significant food recalls (1). Listeria is responsible for 28% of annual deaths attributable to known foodborne pathogens (2). This bacterium has an extremely adaptable metabolism that enables survival under a variety of environmental conditions, including extracellular, abiotic, and intracellular environments. A successful transition of L. monocytogenes in response to these environmental changes requires a precise regulatory system that adjusts the metabolism (3, 4).

The transcription regulation of many L. monocytogenes virulence genes is controlled partially by the pleiotropic transcriptional activator PrfA, belonging to the Crp/Fnr family of transcription regulators (5). PrfA activates a cluster of L. monocytogenes virulence genes, including prfA, plcA, hly, mpl, actA, plcB, inlA, inlB, inlC, and hpt (6), and, thus, is regarded as a master or central virulence regulator (7). In addition, the presence and utilization of different carbohydrates has a significant impact on the virulence of L. monocytogenes (8). For example, metabolizable unphosphorylated sugars, cellobiose, and other fermentable sugars have been shown to inhibit the expression of PrfA-dependent virulence genes in L. monocytogenes. In fact, PrfA activity depends on a fully functional carbohydrate phosphotransferase (PTS) phosphorylation cascade (9). Although PrfA fulfills a central role in the virulence regulation of L. monocytogenes, several other important regulators have been identified and found to contribute to the Listeria virulence regulatory network, such as the stress-responsive alternative sigma factor σ^B (10), a response regulator of a two‐component system named VirR (11), the RNA-binding protein Hfq (12), and transcriptional repressors MogR (12), DegU, and GmaR (13).

Previously, our research group found, using orthology analysis, that a member of the LysR-type transcriptional regulators (LTTRs) (LMOf2365_0522) was present in pathogenic strains (EGD-e and F2365) but absent from nonpathogenic Listeria innocua strain CLIP1182 and L. monocytogenes strain HCC23 (14). The LMOf2365_0522 gene is composed of 302 amino acids and shares sequence similarity with members of the LTTRs. The family of LTTRs is the most abundant family of prokaryotic DNA-binding proteins, and these transcription factors can function as either activators or repressors of gene expression (15). The basic structure of LTTR family members includes an HTH domain at the N terminus, which is essential for binding target DNA and, thus, is crucial for its activity as a transcriptional regulator, whereas the C terminus possesses the regulatory domains 1 and 2, which are coinducer binding sites (16, 17) and exhibit low amino acid conservation. Despite their importance, no Listeria LTTRs have been characterized, and very little is known about the role of LTTRs in Listeria. The aim of the present study was to determine the role of this protein in L. monocytogenes virulence together with the identification of its regulon members.

RESULTS

The loss of LysR does not impact growth in rich or minimal medium.

The LMOf2365_0522 gene encodes the putative LysR-type transcriptional regulator found in an L. monocytogenes pathogenic strain (F2365) but absent from nonpathogenic strains. To gain insight into the function and role of lysR, an F2365ΔlysR strain containing an in-frame deletion in the LMOf2365_0522 was constructed by allelic exchange (18). To determine whether lysR gene deletion would influence bacterial growth, the growth rates of F2365ΔlysR and wild-type strains were analyzed in brain heart infusion (BHI) broth, as enriched medium, or in minimal medium (MM). The F2365ΔlysR strain exhibited growth curves similar to those of the wild-type strain in BHI broth or MM (Fig. 1). In addition, the cell wall of the F2365ΔlysR strain seemed to be intact, as the mutant strain exhibited no significant difference in sensitivity to lysozyme or treatment with penicillin (data not shown).

FIG 1.

F2365ΔlysR strain exhibits normal growth patterns in BHI broth, as enriched medium (A), and MM (B). Bacterial growth was determined by optical density measurements at 600 nm. All growth data are the results from three independent experiments. The growth assay was conducted with wild-type F2365, F2365ΔlysR, and complement strains.

LysR contributes to L. monocytogenes cellular adhesion and invasion.

Cellular adhesion and invasion are crucial steps in L. monocytogenes pathogenesis and for bacterial crossing of the intestinal epithelial barrier. Therefore, we investigated the importance of lysR in Listeria adhesion and invasion using Caco-2 intestinal epithelial cell lines. The F2365ΔlysR strain exhibited approximately 0.7-log and 0.9-log reductions in adhesion to and invasion of Caco-2 cells compared with levels for the parent strain, F2365 (Fig. 2A and B, respectively). These differences were statistically (P < 0.05) significant. Complementation of the mutations restored adhesion and invasion properties.

FIG 2.

F2365ΔlysR strain showed reduction in adhesion (A), invasion (B), plaque number (C), and plaque size (D) with respect to the wild type. Adherence and invasion were performed with Caco-2 cells at an MOI of 10 bacteria to 1 Caco-2 cell. The experiment was performed three independent times with four replicates. Data represent mean numbers of CFU from four replicates. Error bars reflect standard errors from each means. Asterisks indicate significant differences (P < 0.05) compared to the wild type. Plaque assays were performed with mouse L2 fibroblasts at an MOI of 10 bacteria to 1 fibroblast cell. The plaque number and plaque size were determined 96 h postinfection. The experiment was repeated 3 independent times. At least 10 plaques were measured each time. Error bars represent the standard errors of the means. The wild-type strain was set at 100%.

The ability of the F2365ΔlysR strain to invade cells, replicate, and spread cell to cell was analyzed using the plaque formation assays in fibroblast cells (19). The mean number of plaques formed by cells infected with the F2365ΔlysR strain was significantly (P < 0.05) lower than that of cells infected with parental strain F2365 and the complement strain, with an average of 42.86% reduction in plaque numbers observed with the F2365ΔlysR strain (Fig. 2C). The reduction in the total numbers of plaques is consistent with an adhesion/invasion defect for the F2365ΔlysR mutants. Moreover, the plaques formed by cells infected with the F2365ΔlysR strain were significantly smaller (13.48% reduction in plaques size) than those infected by the wild type (Fig. 2D). These findings indicate an important contribution of LysR to cellular invasion and suggest an additional defect exists that reduces plaque size, such as defects in bacterial intracellular replication and/or cell-to-cell spread.

LysR contributes to L. monocytogenes virulence in vivo.

Given that the deletion of lysR has an effect on adhesion, invasion, and possibly cell-to-cell spread, we predicted that LysR would similarly show defects in mouse infection models. To determine whether lysR plays a role in L. monocytogenes virulence in vivo, the bacterial burdens of the F2365ΔlysR and wild-type strains in liver and spleen were assessed following oral and intraperitoneal (i.p.) infection of BALB/c mice. In the case of oral infection, bacterial burdens of the wild-type F2365 strain in spleen and liver were found to be significantly (P < 0.05) higher than those of the F2365ΔlysR strain. Compared to the parental strain F2365, reduction in bacterial loads in liver and spleen were 3.69 log and 3.58 log, respectively (Fig. 3A and B). There was no significant difference in bacterial load between parental strain F2365 and the complementary strain in which lysR was restored. Following i.p. infection, bacterial loads in liver and spleen were reduced about 3.6 log and 2.2 log, respectively, in mice infected with the F2365ΔlysR strain compared with those infected with the wild-type strain (Fig. 3C and D). These differences were statistically significant (P < 0.05). There was no significant difference between the parental strain F2365 and the complemented strain.

FIG 3.

Strain lacking lysR is attenuated for virulence in a mouse model following oral (A and B) and intraperitoneal (C and D) infections. Mice (5 mice per group) were infected orally or intraperitoneally with 5.9 × 10⁷ or 1 × 10⁵ CFU/ml. The number of CFU in liver and spleen was determined by serial dilution and plating on BHI plates. Each dot represents the bacterial concentration in one mouse. Median numbers for each strain are indicated by horizontal lines. Data were analyzed using a nonparametric Mann-Whitney test. Data from two independent experiments (n = 5) are shown. Letter a, significant difference (P < 0.05) from the wild type.

To compare disease induced by the F2365ΔlysR and wild-type F2365 strains, histological analysis was performed on liver and spleen tissue collected from orally infected mice. Livers and spleens in mice infected with the F2364 strain had severe to mild/moderate pathological lesions. No severe to mild lesions were observed in the liver and spleen tissues of mice infected with the F2365ΔlysR strain (see Fig. S1 and S2 in the supplemental material). Taken together, these results indicate a significant role for LysR in L. monocytogenes pathogenesis.

Transcriptome analysis of F2365ΔlysR and F2365 strains indicates the extensive impact of LysR on L. monocytogenes gene expression.

Given that LTTR family members are known to positively and/or negatively regulate transcription at global genetic levels and the observation that LysR is required for bacterial pathogenesis, we examined the regulatory role played by LysR in L. monocytogenes during growth in J774A.1 macrophage cell lines (Fig. 4). Macrophage cells were infected at a range of multiplicities of infection (MOI) from 1 to 10 CFU, and bacterial RNA was harvested at 4 h postinfection. A total of 252 genes were found to be significantly differentially expressed (P < 0.05). Of these, 139 were upregulated and 113 were downregulated in the F2365ΔlysR strain compared to levels in the wild type (Fig. 4), indicating that LysR acts as both an activator and repressor of transcription. The most upregulated (20) and downregulated (18) genes are summarized in Tables 1 and 2. These included genes encoding products such as ABC transporters, proteins required for motility and quorum sensing, and transcriptional regulators. A notable number of gene products had roles relating to bacterial metabolism, including starch and sucrose metabolism, glycerolipid metabolism, fructose and mannose metabolism, and glycolysis/gluconeogenesis. In addition, gene products relating to cationic antimicrobial peptide (CAMP) resistance and two-component signaling systems were identified, as were products necessary for beta-lactam resistance and peptidoglycan biosynthesis and for genes of unknown function. The diversity and number of genes directly or indirectly regulated by LysR indicate the broad impact of this regulator on L. monocytogenes physiology.

FIG 4.

Volcano plot highlighting the differential expression genes modulated by J774A.1 macrophage cells at 4 h of infection by F2365ΔlysR and wild-type strains at an MOI range from 1 to 10. The fold change in expression of each gene is plotted against mean gene expression. Upregulated genes are plotted in red, and downregulated genes are in green. Numbers 1 to 5 represent the top upregulated genes, and 6 to 10 represent the top downregulated genes. Number 1 is type I 3-dehydroquinate dehydratase 1 (aroD). Number 2 is the DUF5067 domain-containing protein. Number 3 is a hypothetical protein. Number 4 is a hypothetical protein. Number 5 is an ABC transporter protein (extracellular solute-binding protein/arabinogalactan oligomer/maltooligosaccharide transport). Number 6 is an activator of the mannose operon, transcriptional antiterminator. Number 7 is mannosylglycerate hydrolase. Number 8 is PTS fructose transporter subunit IIC. Number 9 is an ABC transporter permease. Number 10 is a PspC domain-containing protein.

TABLE 1.

Most upregulated genes in the F2365ΔlysR strain compared to levels in the F2365 strain

Locus tag	Protein name	Log2 fold change	P value	Corrected P value
ABC transporter
LMOf2365_0190	Multiple sugar transport system permease protein	1.17	5.81E−07	3.65E−05
LMOf2365_0191	Putative multiple sugar transport system protein	1.39	8.83E−04	1.62E−02
LMOf2365_0267	Extracellular solute-binding protein/arabinogalactan oligomer/maltooligosaccharide transport	2.57	3.00E−05	9.76E−04
LMOf2365_0268	Sugar ABC transporter permease (arabinogalactan oligomer/maltooligosaccharide transport)	2.03	1.19E−10	2.14E−08
LMOf2365_0269	Sugar ABC transporter permease (arabinogalactan oligomer/maltooligosaccharide transport)	1.85	9.30E−06	3.84E−04
LMOf2365_2830	Multiple sugar transport system substrate-binding protein	2.18	2.74E−13	8.80E−11
LMOf2365_0570	ABC transporter substrate-binding protein, iron complex transport system substrate-binding protein	2.12	4.44E−05	1.35E−03
LMOf2365_2828	Carbohydrate ABC transporter permease, multiple sugar transport system permease protein	2.05	5.52E−12	1.33E−09
LMOf2365_2829	Sugar ABC transporter permease, multiple sugar transport system permease protein	2.01	4.37E−10	7.01E−08
LMOf2365_0044	SIS domain-containing protein glucoselysine-6-phosphate deglycase	2.39	3.41E−10	5.78E−08
LMOf2365_2732	ABC transporter ATP-binding protein	1.01	6.54E−04	1.26E−02
Starch and sucrose metabolism and PTS
LMOf2365_0388	Glycoside hydrolase family 1 protein	0.87	9.02E−04	1.64E−02
LMOf2365_0389	PTS system, beta-glucoside-specific, IIC component; PTS system, cellobiose-specific IIC component	0.89	1.33E−04	3.17E−03
LMOf2365_0043	PTS sugar transporter subunit IIC PTS system, cellobiose-specific IIC component	1.83	1.63E−09	2.24E−07
LMOf2365_0270	Alpha-glucosidase (malL-2)	1.68	3.85E−04	7.91E−03
LMOf2365_0271	Sucrose phosphorylase	1.85	2.01E−05	6.99E−04
LMOf2365_1271	Trehalose-6-phosphate hydrolase or alpha,alpha-phosphotrehalase	0.86	9.65E−05	2.47E−03
LMOf2365_2772	Beta-glucosidase (bglX-2)	1.02	2.51E−03	3.42E−02
Glycerolipid metabolism, glycolysis/ gluconeogenesis
LMOf2365_0364	d-Threitol dehydrogenase	2.26	4.14E−03	4.76E−02
LMOf2365_0365	Ribose 5-phosphate isomerase B′′	2.41	2.82E−03	3.65E−02
LMOf2365_0366	Triosephosphate isomerase	2.35	3.66E−03	4.35E−02
LMOf2365_0367	Dihydroxyacetone kinase subunit L (dhaL)	2.40	1.73E−03	2.58E−02
LMOf2365_0368	Dihydroxyacetone kinase subunit (dhaK)	2.14	2.61E−03	3.51E−02
LMOf2365_0369	Hypothetical protein	2.09	2.72E−03	3.59E−02
LMOf2365_0371	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit (dhaM)	1.46	3.66E−03	4.35E−02
LMOf2365_1055	Glycerol kinase (glpK1)	1.90	6.26E−05	1.82E−03
Quorum sensing
LMOf2365_0155	ABC transporter permease	1.06	6.00E−08	5.09E−06
LMOf2365_1830	Signal recognition particle-docking protein FtsY	0.89	1.86E−03	2.72E−02
LMOf2365_0058	Putative accessory gene regulator protein D (agrD)	0.49	9.17E−04	1.65E−02
LMOf2365_0059	Putative accessory gene regulator protein C (agrC)	0.49	9.17E−04	1.65E−02
Flagellar assembly
LMOf2365_0749	Flagellar basal body M-ring protein FliF	0.86	1.21E−03	2.02E−02
LMOf2365_0750	Flagellar motor switch protein FliG	0.99	1.72E−03	2.58E−02
LMOf2365_0751	Flagellar assembly protein H FliH	0.83	1.22E−03	2.02E−02
LMOf2365_0726	FliC/FljB family flagellin	0.71	5.00E−04	9.96E−03
Phenylalanine, tyrosine, and tryptophan biosynthesis: LMOf2365_0521	Type I 3-dehydroquinate dehydratase 1 (aroD)	5.30	1.04E−82	3.01E−79
Pentose phosphate pathway
LMOf2365_0362	Transketolase (tkt-1)	2.27	2.73E−03	3.59E−02
LMOf2365_1054	Putative transketolase, C-terminal subunit (tkt-2)	2.28	2.91E−05	9.66E−04
Transcriptional factor
LMOf2365_0041	ROK family protein	1.74	8.72E−08	7.00E−06
LMOf2365_0189	ROK family transcriptional regulator	1.50	4.49E−20	4.32E−17
LMOf2365_0042	Glycosyl hydrolase; glycosyl hydrolase, family 9	1.55	4.16E−08	3.88E−06
LMOf2365_0575	Hypothetical protein (oxidoreductase, putative)	1.25	1.65E−05	5.97E−04
LMOf2365_RS08335	Phage transcriptional regulator, ArpU family	1.74	1.12E−5	1.12E−05
Anaerobic regulatory protein: #x2003;LMOf2365_0626	Crp/Fnr family transcriptional regulator	1.32	4.40E−09	5.29E−07
Alanine aspartate and glutamate metabolism and pyrimidine metabolism
LMOf2365_1864	Carbamoyl-phosphate synthase small subunit (carA)	1.42	1.11E−09	1.61E−07
Call wall binding and surface protein
LMOf2365_0614	WxL domain-containing protein	1.12	6.19E−04	1.20E−02
LMOf2365_2495	LysM peptidoglycan-binding domain-containing protein	1.83	4.12E−09	5.17E−07
PTS
LMOf2365_1056	PTS beta-glucoside transporter subunit IIBCA (bglP)	1.28	1.21E−07	9.66E−04
LMOf2365_1900	Trypsin-like serine protease	1.60	2.68E−12	7.04E−10
Carbohydrate transport and metabolism
LMOf2365_2826	Sugar phosphate isomerase/epimerase YcjR	1.83	3.60E−07	2.41E−05
LMOf2365_2827	Zinc-binding alcohol dehydrogenase	1.75	8.01E−06	3.40E−04
Sucrose phosphorylase: LMOf2365_2831	Sucrose phosphorylase or sucrose glucosyltransferase, disaccharide glucosyltransferase	1.83	5.95E−19	4.29E−16
Miscellaneous and unknown
LMOf2365_0646	DUF5067 domain-containing protein	4.34	1.37E−16	9.30E−20
LMOf2365_0648	Hypothetical protein	2.76	6.44E−23	2.64E−06
LMOf2365_0649	DUF1398 domain-containing protein	0.94	2.65E−08	1.28E−03
LMOf2365_0650	Sulfite exporter TauE/SafE family protein	0.99	4.15E−05	8.14E−06
LMOf2365_1028	Hypothetical protein	2.87	1.27E−07	2.14E−03
LMOf2365_1052	Fucose isomerase	1.47	8.03E−05	9.30E−20
LMOf2365_2313	LLM class flavin-dependent oxidoreductase	1.35	0.00114	0.019598
LMOf2365_0526	DUF896 domain-containing protein	1.92	6.47E−07	3.98E−05
LMOf2365_2209	DUF4870 domain-containing protein	1.01	1.11E−08	1.19E−06
LMOf2365_2824	Glycoside hydrolase family 65 protein	1.69	1.65E−06	9.01E−05
LMOf2365_2825	Gfo/Idh/MocA family oxidoreductase	1.59	1.73E−03	2.58E−02

TABLE 2.

Most downregulated genes in the F2365ΔlysR strain compared to levels in the F2365 strain

Locus tag	Description	Log2 fold change	P value	Corrected P value
Fructose and mannose metabolism
LMOf2365_0115	PTS mannose/fructose/sorbose transporter family subunit IID	−0.95	1.18E−05	4.48E−04
LMOf2365_RS02125	PTS sugar transporter subunit IIA	−1.15	1.00E−05	3.94E−04
LMOf2365_RS02130	PTS fructose transporter subunit IIB	−1.36	3.08E−03	3.89E−02
LMOf2365_RS02135	PTS fructose transporter subunit IIC	−1.66	2.81E−11	5.41E−09
LMOf2365_0421	Mannosylglycerate hydrolase	−2.09	9.61E−13	2.78E−10
LMOf2365_0422	Activator of the mannose operon, transcriptional antiterminator	−2.14	1.71E−18	9.88E−16
CAMP resistance, two-component system
LMOf2365_0991	d-Alanyl-lipoteichoic acid biosynthesis protein DltD	−1.03	3.79E−05	1.19E−03
LMOf2365_0992	d-Alanine-poly(phosphoribitol) ligase subunit DltC	−1.31	1.54E−06	8.55E−05
LMOf2365_0993	d-Alanyl-lipoteichoic acid biosynthesis protein DltB	−1.09	6.47E−06	2.92E−04
LMOf2365_0994	d-Alanine-poly(phosphoribitol) ligase subunit DltA	−0.86	2.64E−05	8.96E−04
LMOf2365_0995	Teichoic acid d-Ala incorporation-associated protein DltX	−0.79	1.08E−04	2.69E−03
LMOf2365_0312	Serine protease Do	−0.83	5.33E−08	4.67E−06
Beta-lactam resistance: LMOf2365_2262	Penicillin-binding protein 1A	−1.09	1.31E−05	4.91E−04
ABC transporter permease: LMOf2365_2148	ABC transporter permease	−1.56	7.05E−06	3.13E−04
Membrane protein: LMOf2365_2457	Phage holin family protein	−1.23	1.47E−11	3.03E−09
Uncharacterized proteins with unknown function
LMOf2365_2411	YxeA family protein	−1.38	4.40E−08	3.97E−06
LMOf2365_0633	Hypothetical protein	−1.06	8.50E−06	3.56E−04
LMOf2365_2458	PspC domain-containing protein	−1.41	2.79E−05	9.36E−04
LMOf2365_2459	PspC domain-containing protein	−1.13	6.90E−16	2.85E−13

Functional classification of differentially expressed genes.

To better understand the impact of LysR on L. monocytogenes gene expression, gene ontology (GO) analysis was conducted to functionally categorize differentially expressed genes into three categories, as shown in Fig. 5: biological process, cellular component, and molecular function. Among the enriched categories in the biological process component were carbohydrate metabolic process, inorganic cation transmembrane transport, peptidoglycan turnover, cellular modified amino acid biosynthesis and metabolism, and ATP biosynthetic process. In the cellular component category, membrane protein complex, coated membrane, and proton-transporting ATPase were among the most enriched. In the molecular function category, electron carrier activity was the most enriched group (Fig. 5).

FIG 5.

GO functional enrichment analysis for all differentially expressed genes. The colors represent different GO types.

The main GO categories for upregulated and downregulated differentially expressed genes are shown in Fig. 6. The main categories represented among the upregulated genes were those involved in the carbohydrate metabolic process (17 genes), ATP biosynthetic process (5 genes), alcohol metabolic process (3 genes), glycerol metabolic process (2 genes), aminoglycan metabolic process (2 genes), glycosaminoglycan metabolic process (2 genes), phospholipid biosynthetic process (2 genes), and immune response (2). In contrast, the main categories represented among the downregulated genes were genes associated with ion transmembrane transport (5 genes), monocarboxylic acid metabolic process (6 genes), proton transport (4 genes), hydrogen transport (4 genes), inorganic cation transmembrane transport (6 genes), inorganic ion transmembrane transport (6 genes), cation transmembrane transport (6 genes), cellular modified amino acid metabolism (5 genes), and cellular modified amino biosynthesis (5 genes).

FIG 6.

GO categories for upregulated and downregulated genes based on differentially expressed genes in the RNA-seq.

Pathway analysis of differentially expressed genes.

Differentially expressed genes were mapped to reference pathways in the KEGG database to further identify the significantly enriched metabolic pathways or signal transduction pathways between the F2365ΔlysR strain and wild-type F2365. There were 21 upregulated pathways and 24 downregulated pathways (Tables 3 and 4). Some pathways were shared in both upregulated and downregulated genes, especially those including microbial metabolism in diverse environments (10 genes upregulated and 7 genes downregulated), biosynthesis of secondary metabolites (16 genes upregulated and 9 genes downregulated), biosynthesis of antibiotics (13 genes upregulated and 5 genes downregulated), fructose and mannose metabolism (4 genes upregulated and 4 genes downregulated), phosphotransferase system (PTS) (5 genes upregulated and 4 genes downregulated), carbon metabolism (9 genes upregulated and 4 genes downregulated), and metabolic pathways (28 genes upregulated and 21 genes downregulated).

TABLE 3.

KEGG pathway enrichment analysis for upregulated genes

Term	Sample no.	P value	Corrected P value
ABC transporters	7	9.51E−02	4.22E−01
Starch and sucrose metabolism	6	3.41E−04	1.60E−02
Metabolic pathways	28	1.08E−01	4.22E−01
Biosynthesis of secondary metabolites	16	7.35E−02	3.84E−01
Biosynthesis of antibiotics	13	5.44E−02	3.84E−01
Microbial metabolism in diverse environments	10	1.03E−01	4.22E−01
Carbon metabolism	9	1.97E−02	2.63E−01
Quorum sensing	3	2.60E−01	6.82E−01
Biosynthesis of amino acids	8	2.10E−01	6.18E−01
Glycerolipid metabolism	4	5.61E−03	1.32E−01
Flagellar assembly	4	3.42E−02	3.21E−01
Glycolysis/gluconeogenesis	5	5.93E−02	3.84E−01
PTS	5	3.21E−01	6.30E−01
Pyruvate metabolism	4	7.15E−02	3.84E−01
Fructose and mannose metabolism	4	2.40E−01	6.18E−01
Citrate cycle (TCA cycle)	3	2.23E−02	2.63E−01
Pentose phosphate pathway	3	2.10E−01	6.18E−01
Pyrimidine metabolism	3	3.12E−01	6.30E−01
RNA degradation	2	1.42E−01	5.12E−01
Homologous recombination	2	2.33E−01	6.18E−01
Methane metabolism	2	2.80E−01	6.18E−01

TABLE 4.

KEGG pathway enrichment analysis for downregulated genes

Term	Gene no.	P value	Corrected P value
Two-component system	10	1.87E−05	7.29E−04
CAMP resistance	5	4.77E−05	9.30E−04
Metabolic pathways	21	2.76E−01	6.82E−01
Fructose and mannose metabolism	4	1.54E−01	6.00E−01
Biosynthesis of secondary metabolites	9	5.28E−01	6.82E−01
Microbial metabolism in diverse environments	7	2.64E−01	6.82E−01
Biosynthesis of antibiotics	5	7.78E−01	8.42E−01
Oxidative phosphorylation	4	2.35E−02	1.63E−01
Beta-lactam resistance	2	5.36E−02	2.62E−01
PTS	4	3.74E−01	6.82E−01
Carbon metabolism	4	4.06E−01	6.82E−01
Pantothenate and coenzyme A biosynthesis	3	2.64E−02	1.63E−01
Ribosome	3	5.14E−01	6.82E−01
d-Alanine metabolism	2	2.24E−02	1.63E−01
Cyanoamino acid metabolism	2	2.24E−02	1.63E−01
Beta-alanine metabolism	2	2.92E−02	1.63E−01
Glyoxylate and dicarboxylate metabolism	2	1.28E−01	5.53E−01
Alanine, aspartate, and glutamate metabolism	2	2.02E−01	6.82E−01
Methane metabolism	2	2.15E−01	6.82E−01
Glycine, serine, and threonine metabolism	2	3.19E−01	6.82E−01
Amino sugar and nucleotide sugar metabolism	2	3.58E−01	6.82E−01
Pyrimidine metabolism	2	4.79E−01	6.82E−01
Purine metabolism	2	5.86E−01	7.14E−01
Biosynthesis of amino acids	2	9.48E−01	9.57E−01

On the other hand, genes in some pathways were either only upregulated or only downregulated. The primary pathways for upregulated differentially expressed genes were starch and sucrose metabolism (6 genes), glycolysis/gluconeogenesis (5 genes), glycerolipid metabolism (4 genes), flagellar assembly (4 genes), pyruvate metabolism (4 genes), citrate cycle (tricarboxylic acid [TCA] cycle; 3 genes), pentose phosphate pathway (3 genes), pyrimidine metabolism (3 genes), and RNA degradation (2 genes). Two-component systems (10 genes), CAMP resistance (10 genes), and oxidative phosphorylation (4 genes) were represented only among the downregulated differentially expressed genes.

Verification of gene expression using qRT-PCR.

Twelve upregulated and six downregulated genes were selected from the list based on functional categories and pathways to verify their expression by quantitative reverse transcription-PCR (qRT-PCR). The expression profiles of the examined genes were consistent with the transcriptome sequencing (RNA-seq) results (Fig. 7), although observed fold changes differed in qRT-PCR and RNA-seq data, which may reflect sensitivity and specificity differences between qRT-PCR and RNA-sequencing technology (21).

FIG 7.

RT-PCR analyses of selected differentially expressed genes. (A) Upregulated genes; (B) downregulated genes. The data represent means ± standard errors from four biological replicates.

DISCUSSION

In the present study, the infection of Caco-2 cells, fibroblast plaque assays, and a mouse model were used to determine the contribution of lysR to L. monocytogenes virulence. The F2365ΔlysR strain displayed attenuation in mice following oral and i.p. infection. Attenuation in cases of oral infection may include a contribution from defects in adherence to and penetration of the intestinal epithelium and/or systemic effects. The i.p. route allows Listeria to disseminate systemically via the lymphatic system and blood, but it bypasses the need for invasion of the intestine, as occurs in oral infection (22). Previous work showed that the disruption of LTTR family members caused a loss of virulence. For example, MvfR of P. aeruginosa reduced virulence in mice and plants (23, 24). ShvR of Burkholderia cenocepacia reduced virulence in a mammalian and plant model of infection (25). Several LTTRs are known to play a role in host-pathogen interactions by controlling the expression of virulence genes. Examples of bacterial virulence genes under LTTR are protease and type 2 secretion system (T2SS) genes of B. cenocepacia (ShvR) (25), ADP-ribosyltransferase toxin of Yersinia enterocolitica, the T3SS of P. aeruginosa (MexT) (26, 27), and a pathogenicity island (SPI-1) in Salmonella enterica serovar Typhimurium (LeuO) (28). In the present study, given the number of genes whose expression is affected by the deletion of lysR, it is difficult to attribute the virulence defects to any one type of gene or pathway, and it may be that the virulence effect stems from the misregulation of several sets of genes.

In the present study, the transcriptome data revealed 139 upregulated and 113 downregulated protein-coding genes in the F2365ΔlysR strain, including carbohydrate transport and metabolism, amino acid metabolism, flagellar assembly, the phosphotransferase system (PTS), cell wall binding and surface proteins, beta-lactam resistance, and two-component systems. Previously, it was shown that members of the LTTRs regulate the expression of a variety of genes, including those involved in virulence (29, 30), quorum sensing (25), motility (31), metabolism, and environmental recognition (32, 33). aphA of Vibrio cholerae controls the expression of nearly 300 genes, including genes involved in type III secretion systems, flagellum synthesis, pilus production, and members of the quorum-sensing circuit (34). ampR in Pseudomonas aeruginosa acts as a global transcriptional factor gene whose regulon includes genes for beta-lactamases, proteases, quorum sensing, and other virulence factors (35, 36). Clearly, the LysR family members appear to wield broad impacts on multiple pathways of gene expression.

L. monocytogenes can utilize glycerol as a source of carbon through a complex set of genes involved in the metabolism of glycerol (37). Indeed, glycerol and three other carbon sugars serve as the primary carbon source used by L. monocytogenes within the cytosol of infected host cells (38). In the current study, transcriptome analysis showed the upregulation of genes associated with glycerol metabolism and glycerol uptake (glpK, dhaL, dhaK, and dhaM). glpK encodes glycerol kinase and plays a role in converting glycerol to glycerol-3 phosphate. Dihydroxyacetone (dha) plays a role in phosphorylation and subsequent metabolization of glycerol (39). dhaKLM genes are part of an extended operon, and the entire operon was highly upregulated in the F2365ΔlysR strain compared to that in F2365. This operon encodes five other proteins that previously were shown to be involved in different metabolic pathways and metabolism (40). This result implies that the repression of lysR activity facilitates the uptake and utilization of glycerol as a carbon source by directly regulating glpK and dhaKLM genes.

Flagellar motility in Listeria plays an important role in facilitating adherence to abiotic and cellular surfaces and is important for biofilm formation and cellular invasion (41, 42). RNA-seq analysis revealed that the deletion of the lysR gene resulted in the upregulation of four genes involved in motility, including fliF, fliG, fliH, and fliC-fljB. A previous study in Campylobacter jejuni showed that the lysR regulator is involved in the upregulation of flagellum biogenesis (flaA, flaB, flgG2, flgH, fliD, and fliS) (43), whereas in Escherichia coli K-12, the LysR-type transcriptional regulator QseD represses motility (44). Despite these changes in transcript levels, motility in vitro of the F2365ΔlysR strain was unchanged compared to that of the wild-type strain (data not shown). Moreover, flagellar motility in Listeria differs from other bacterial species, because in L. monocytogenes flagellar motility is temperature dependent and is regulated by a distinctly different mechanism than the well-described regulation in Gram-negative bacteria. The regulation of flagellar synthesis genes in Listeria is controlled by sigma factors as well as by specific regulators (such as flgM) (45).

In the present study, RNA-seq revealed that the deletion of lysR led to the downregulation of an operon encoding fructose-specific components of the phosphotransferase transport system (PTS) permease. This operon contains three genes encoding the fructose-specific PTS, which consists of IIA, IIB, and IIC components. The PTS serves as a sugar transport system in bacteria, and there are approximately 30 copies of different PTS present in the genome of L. monocytogenes (46). A previous study demonstrated that an IIA component (LMOf2365_0442) is required for virulence in L. monocytogenes strain F2365 (47). Besides carbohydrate transporters, the PTS also regulates numerous cellular processes, including carbon catabolite repression (CCR) (48). Some PTSs also have been associated with stress response and biofilm formation (49). Therefore, it was suggested that metabolizable sugars that are taken up by the phosphoenolpyruvate (PEP)-dependent PTS, like glucose, mannose, and especially cellobiose, are negatively correlated with the activity of prfA (50–52). Results from the present study suggest that lysR indirectly modulates (interferes with) prfA activity through the decreased uptake of fructose, mannose, or other sugar components.

Another major finding in the present study was the downregulation of the gene encoding an activator of the mannose operon, a transcriptional antiterminator. The PTS encoded by the mannose permease (mpt) is the principal glucose transporter in L. monocytogenes (53–55). In Listeria species, mannose PTS permease has been shown to play a central role in class IIa bacteriocin resistance (56), CCR (57, 58), and downregulation of virulence gene expression in glucose medium (9, 59, 60). The downregulation of mpt may be an adaptable mechanism of Listeria to reduce the consumption of glucose as a carbon source in the F2365ΔlysR strain.

Another important finding in the present study was the downregulation of the clpP gene, encoding the serine protease Do. clpP is essential for the intracellular growth of L. monocytogenes in vivo and plays a major role in the induction of anti-Listeria protective immunity (20). An L. monocytogenes mutant with a deletion in the clpP gene failed to grow in macrophages during the early phase of infection (8 h). In the absence of clpP, the virulence of L. monocytogenes also was sharply reduced, and this behavior was due to the reduction in functional listeriolysin O (LLO), explaining the inability of the bacteria to escape the phagosomal compartment in macrophages (61). Accordingly, we speculate that the reduced virulence and defect in intracellular growth of the F2365ΔlysR strain is caused in part by clpP repression.

The present study represented transcriptome profiling of the L. monocytogenes F2365ΔlysR strain using RNA-seq technology. Thus, transcriptomic changes observed were adaptive responses of L. monocytogenes to the deletion of lysR in the context of bacterial growth within macrophages. Data presented in this study further extend our knowledge of the role of lysR in L. monocytogenes and also provide insight into the regulatory network of this bacterium. Because most LTTRs activate the transcription of target promoters only in the presence of small signaling molecules (coinducers), the identification of the coinducer molecule required for lysR expression needs to be examined in a further study.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

Bacterial strains and plasmids used in this study are listed in Table 5. Escherichia coli DH5α was grown in Luria-Bertani (LB) (Difco Laboratories) broth and agar. Listeria strains were grown in brain heart infusion (BHI) broth (Difco) at 37°C. Human enterocyte-like Caco-2 (TIB37; ATCC) and fibroblast (CRL-2648; ATCC) cell lines were grown in Dulbecco’s modified Eagle’s medium (DMEM) (ATCC, Manassas, VA) supplemented with 20% fetal bovine serum (FBS) (Atlanta Biologicals, Norcross, GA) and 1% glutamine. Cultures were maintained at 37°C with 5% CO₂ under humidified conditions.

TABLE 5.

Bacterial strains, plasmids, and primers used in this study

Bacterial strain, plasmid, or primer	Description or sequence	Source or reference
Strains
E. coli DH5α	Competent cells	Invitrogen
L. monocytogenes
F2365	Wild-type serotype 4b strain	72
F2365ΔlysR	F2365ΔlysR mutant strain	This study
F2365ΔlysR::pPL2-lysR	F2365ΔlysR::pPL2-lysR complemented strain	This study
Plasmids
pHoss1	8,995 bp, pMAD::secY antisense, ΔbgaB	18
pPL2	6,123 bp, PSA attPP, Chlr	62
pLmΔlysR	pHoss1::ΔlysR	This study
pPL2-lysR	pPL2::lysR	This study
Primers
LysR_F02	AAGTCGACCTTGGCGTTCACTTGGTTCTA	SalI
LysR_R938	GGATGGGTGCTCTTTACTCGT
LysR_F833	ACGAGTAAAGAGCACCCATCCTAACATCAATTTGCCCAGGAG
LysR_R02	AACCATGGCACACAAAGAAATGCCAGTTG	NcoI
LysR_seq	CTTGCCAGGGAGAGCATCGTT
LysR_Comp-F01	AAAGAGCTCGAGCACCCATCCTATATTCAGC	SacI
LysR_Comp-R01	AAAGTCGACCTGCTTCAAGAATTATTTTCGTTT	SalI

Construction of ΔlysR mutant and complemented strains.

The lysR gene (LMOf2365_0522) was targeted for in-frame deletion using an allelic exchange technique as previously published (18). The sequences of primers used for the construction and validation of the mutant are listed in Table 5. The mutant strain was complemented by inserting a copy of the wild-type gene with its promoter region using the pPL2 shuttle integration vector (62).

Growth assay.

Growth of wild-type F2365, F2365ΔlysR, and complemented strains in BHI broth and minimal medium (MM) (63) was analyzed. Bacterial curves were generated by measuring the optical density at 600 nm (OD₆₀₀) on a multimode reader (BioTek Cytation 5) every hour after a brief agitation for 24 h at 37°C. The growth assays were conducted in three independent experiments, and each experiment was run with six replicates.

MIC determination.

The MICs of penicillin and lysozyme were determined using a broth microdilution assay in 96-well plates. Bacteria were grown overnight, and then approximately 10⁵ cells were used to inoculate 200 μl BHI broth containing 2-fold dilutions of penicillin or lysozyme. The starting concentrations were 0.06 μg/ml for penicillin and 0.1 mg/ml for lysozyme. The OD₆₀₀ readings were determined after incubating the 96-well plates for 24 h at 37°C with shaking.

Adherence, invasion, and plaque assays.

Adherence and invasion of the F2365ΔlysR mutant to Caco-2 epithelial cells were evaluated as described previously (64). In brief, monolayer Caco-2 cells were grown into 24-well tissue culture plates at 10⁵ cells per well. For adhesion assay, cells were infected with bacteria (10⁶ CFU) at a multiplicity of infection (MOI) of 10 bacterial cells per Caco-2 cell and incubated at 37°C for 1 h, after which the medium was removed. Infected cells then were washed three times with phosphate-buffered saline (PBS) to eliminate nonadherent bacteria. Adherent Listeria organisms were lysed with 0.5% Triton X-100 and serially diluted and plated on BHI agar for enumeration. For the invasion assay, bacteria were added to the Caco-2 cell monolayer to yield an MOI of 10 bacteria per Caco-2 cell and incubated at 37°C for 1 h. Infected cells were washed three times with PBS and incubated in medium containing gentamicin (10 μg/ml) for 2 h to kill extracellular bacteria. Cells then were washed three times with PBS and lysed using 0.5% Triton X-100. Appropriate dilutions of the lysates were spread on BHI agar. All infections were performed three independent times, and four replicates were performed for each infection.

Plaque assays with murine fibroblast cell (ATCC CRL-2648) monolayers were conducted as described previously (19). Briefly, fibroblast cells were grown in DMEM in six-well tissue culture plates until confluence. Confluent monolayers were infected with bacteria for 1 h. DMEM agar containing 10 μg/ml gentamicin then was added to each well. The plates were incubated at 37°C and 5% CO₂ for 4 days. Living cells were visualized by adding an additional overlay consisting of DMEM, 0.5% agarose, and 0.1% neutral red and incubating the dishes overnight.

Murine infection.

The virulence of the F2365ΔlysR strain was compared with that of L. monocytogenes strain F2365 and a complemented strain in BALB/c mice through oral and intraperitoneal (i.p.) routes as previously described (65, 66). Animal studies were performed under a protocol (18-508) approved by the Animal Care and Use Committee at Mississippi State University. Female 8- to 12-week-old BALB/c mice were obtained from the Jackson Laboratory and were housed in 4 cages (5 mice/cage) according to treatment group. Animals were maintained under specific-pathogen-free conditions and provided with food and water ad libitum. In the case of oral infections, the OD₆₀₀ was adjusted so that approximately 5.9 × 10⁷ CFU/ml of each bacterial strain was orally infused by gavage needle in each mouse. For i.p. infection, mice were injected with 1 × 10⁵ CFU/ml bacteria suspended in 100 μl of sterile saline. Control mice were inoculated with sterile saline. Animals were monitored daily for signs of disease and mortality. For oral infection studies, mice were euthanized on day 5 postinfection. For i.p. infection studies, mice reached a moribund stage earlier and were euthanized on day 3 postinfection. After euthanasia, spleen and liver tissues were aseptically removed, weighed, and homogenized in sterile saline. Suspensions then were diluted and plated onto BHI agar plates to determine the number of CFU per gram. Portions of the liver and spleen from orally infected mice were fixed in 10% neutral buffered formalin for histopathological analysis. After fixation, tissues were embedded in paraffin, followed by sectioning at 5 μm and staining with hematoxylin and eosin (H&E) and Gram stain as previously described (67). The animal experiment was repeated independently twice, and bacterial strains were tested using groups of five animals.

Infection of J774A.1 cells by F2365ΔlysR strain.

A murine macrophage cell line, J774A.1, was grown in DMEM supplemented with 10% FBS at 37°C and 5% CO₂. Cells were passaged when they reached 70% to 80% confluence and seeded onto 12-well plates 2 days before infection. Overnight cultures of F2365ΔlysR and F2365 strains were harvested by centrifugation, and the pellet was resuspended in PBS. Cells were washed twice with Hanks’ balanced salt solution (HBSS) and covered for 1 h with DMEM containing a bacterial strain. The average MOI was calculated to range from 1 to 10. After the cells were washed once with HBSS, extracellular bacteria were removed by adding 0.5 ml DMEM containing 10 μg/ml gentamicin. After 4 h of incubation, the infected J774A.1 cells were washed again with HBSS and then lysed in 1 ml cold Triton X-100 (0.1%). RNA extraction was performed as described below.

RNA extraction.

Total RNA was isolated from macrophage cell lines infected with Listeria (F2365 or F2365ΔlysR strain) using the FastRNA spin kit for microbes and the FastPrep-24 instrument (MP Biomedicals, Santa Ana, CA) by following the manufacturer’s instructions. For each strain, total RNA was isolated from four independent biological replicates. Genomic DNA was eliminated from the total RNA by using on-column DNase treatment with an RNase-free DNase set (Qiagen, Hilden, Germany). The quantity and quality of total RNA were analyzed using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, USA) by measuring the OD₂₆₀/OD₂₈₀ ratio. A Ribo-Zero magnetic kit for Gram-positive bacteria (Epicentre) was used to remove rRNAs, and then a fragmentation buffer was added to fragment mRNAs. Before library construction, the concentration of RNA was normalized by using specific ScriptSeq kits (Epicentre).

Library preparation for strand-specific transcriptome sequencing.

Library construction and sequencing were performed by Novogene Corporation, Inc., Centre for Genomic Research (CGR). Briefly, strand-specific RNA-seq was performed as previously described (68). Using random hexamers as primers (Promega), mRNA fragments were reverse transcribed to single-stranded cDNAs. After the synthesis of single-stranded cDNAs, first-strand buffer (Invitrogen), deoxynucleoside triphosphates (dTTP was replaced by dUTP), DNA polymerase I, and RNase H were applied, and samples were incubated at 25°C for 2 min to synthesize complementary cDNA strands. Double-stranded cDNAs were purified using AMPure XP (Biolabs) beads according to the manufacturer’s instructions. Resultant double-stranded cDNAs were end repaired, polyadenylated, ligated with adapter sequences, and size selected using AMPure XP beads. Uracil-containing strands then were degraded with USER Enzyme (NEB, USA), and the remaining strands were amplified using PCR and purified using AMPure XP beads. The cDNA libraries then were subjected to sequencing using the HiSeq platform (Illumina). For each strain, four independent biological replicates were sequenced.

Gene annotation, alignment, and analysis.

Before analyzing data, raw reads were filtered to remove reads containing adapters or low-quality reads. The resulting reads were used for mapping sequences to the genome of a Listeria monocytogenes serotype 4b strain using Bowtie2 (69). Transcriptomic analysis was conducted using the Bioconductor Edge R analysis package (70). Transcripts for each sample were quantified and normalized as the number of reads per kilobase per million reads (RPKM). Four replicate RPKM values for each sample were standardized on the basis of their mean transcript values and were used to assess gene expression and fold change differences in expression between the F2365 and ΔlysR strains. To minimize false-positive results, a stringent cutoff false discovery rate (FDR) of 1 was applied when identifying differentially expressed genes of the wild-type compared to the mutant strains.

GO and KEGG pathway enrichment analyses.

GO enrichment analysis was conducted by GOseq (73), which is based on Wallenius noncentral hypergeometric distribution. GO covers molecular functions, biological processes, and cellular components. The differentially expressed gene list was mapped to the Kyoto Encyclopedia of Genes and Genomes (KEGG) to identify significantly enriched metabolic pathways or signal transduction pathways.

Verification of gene expression by qRT-PCR.

To validate gene expression and RNA-seq data, qRT-PCR was performed on the same RNAs as those used for transcriptome experiments. Primers and gene information are listed in Table 6. Primers were designed with IDT (Integrated DNA Technologies) software. Purified RNA (5 μg) was used for first-strand cDNA synthesis (Thermo Scientific kit), which was performed with the following steps: 10 min at 25°C followed by 30 min at 50°C, with reaction termination at 85°C for 5 min. The product of the first-strand cDNA synthesis was diluted 50 times for use in qRT-PCR. qRT-PCR was performed in a 20-μl reaction volume containing 5 μl of cDNA, 10 μl of SYBR green real-time PCR master mix (Roche Diagnostic GmbH, Mannheim, Germany), 0.6 μl of gene‐specific primers (10 μM), and 3.8 μl water. Amplification and detection of specific products were performed with the Mx3000P real-time PCR system (Stratagene) with the following cycle profile: initial denaturation at 95°C for 10 min, 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min. The expression of each gene was normalized against the expression of the housekeeping gene, 16S rRNA, before comparative analysis. Further, DNA melting curve analysis at the end of each run ensured that the desired amplicon was detected and that no secondary products were amplified. For each gene, triplicate assays were done. Expression levels of tested genes were quantified by the relative quantitative method (2^−△△CT) (71).

TABLE 6.

Primers used in qRT-PCR

Gene locus tag	Primer sequence (5′–3′)
	Forward	Reverse
LMOf2365_0190	CTCGTTTGGAAATGGCTGTTC	ACCAATATCTTTCCACGCACTAG
LMOf2365_0191	TGGCTGGTTGGATTCGTATG	GTAAAATGATTGGCACCGTCC
LMOf2365_2829	TGCAAACGGTCGATAAGTCG	AAGTACCGGCATAATCGCTG
LMOf2365_0044	TGGCAAGAGGAATTCGCTAC	GCCCATGCATAAACGCTTC
LMOf2365_0270	ATCAGCCGGGAATTGAAGAG	CAAACACCATACGGAAATGACC
LMOf2365_1271	TTATCATTCGGCAACCCTCC	GCGTTTCCACATCCACATAATC
LMOf2365_0362	GATTCGTTTGGTATGTCTGGC	GCTCCGTCAAGTTCTCTACAG
LMOf2365_0749	TGTCGTTGTCTGGGTTGATC	TCTTCGGTTGTCATATTAGGCG
LMOf2365_1054	AAGTGATTCAAGAGGATCCGC	GGCAATCCCAGTCTCAACTAG
LMOf2365_0521	TGCTGGAGACGTACTAACTTTAC	CATTGCGGAGCCAAATACTTC
LMOf2365_0155	ATGACCCTAATGCTCTTTCCG	CATCGCAAATACACCGACAAG
LMOf2365_2772	GTAGACCAATCGCTATCCCAG	CCGAAAAGAACCTCAGCAATC
LMOf2365_0992	TGCTTGATTCTATGGCTACGG	ATTTCAGGAGTAGCCCATTCG
LMOf2365_0312	AAGTGGTAACGGGAATGGTG	TCACCATTATCCCAAGCGAC
LMOf2365_0421	GTAATGACAGAGGGCGTACG	AACGATTGACTCACCGGAAG
LMOf2365_0422	GGTAGCCACTTATCAGCTCAG	GATTTCGATTTTGTATCCCGCG
LMOf2365_0633	CATTACTCCCGCGATTATCTGG	TCATTACAACTACACCAGCGAC
LMOf2365_2459	GAAGACCAAGACCAGAAAATGC	AGTAAAGGAACGGAAAGTCGC
16S rRNA	CAAGCGTTGTCCGGATTTATTG	GCACTCCAGTCTTCCAGTTT

Statistical analysis.

The dot plots and median values of bacterial numbers in each mouse were generated using GraphPad Prism 8 software. For in vivo experiments, a nonparametric Mann-Whitney test was used to detect the statistical significance in bacterial load in liver and spleen of infected mice with F2365, 2365ΔlysR, and complemented strains. Fold changes were calculated for each gene using the 2^−ΔΔCT formula and used for statistical analysis to determine significant differences in gene expression between F2365ΔlysR and F2365 strains. The statistical significance of differences was evaluated with one-way analysis of variance using PROC GLM in SAS (v 9.4; SAS Institute, Inc., Cary, NC). P values of <0.05 were considered statistically significant in all analyses.