Abstract
Prolactin (PRL) signaling has been implicated in the regulation of glucose homeostatic adaptations to pregnancy. In this report, the PRL receptor (Prlr) gene was conditionally disrupted in the pancreas, creating an animal model which proved useful for investigating the biology and pathology of gestational diabetes including its impacts on fetal and placental development. In mice, pancreatic PRLR signaling was demonstrated to be required for pregnancy-associated changes in maternal β cell mass and function. Disruption of the Prlr gene in the pancreas resulted in fewer insulin-producing cells, which failed to expand appropriately during pregnancy resulting in reduced blood insulin levels and maternal glucose intolerance. This inability to sustain normal blood glucose balance during pregnancy worsened with age and a successive pregnancy. The etiology of the insulin insufficiency was attributed to deficits in regulatory pathways controlling β cell differentiation. Additionally, the disturbance in maternal blood glucose homeostasis was associated with fetal overgrowth and dysregulation of inflammation and PRL-associated transcripts in the placenta. Overall, these results indicate that the PRLR, acting within the pancreas, mediates maternal pancreatic adaptations to pregnancy. PRLR dysfunction is associated with glucose intolerance during pregnancy and pathological features consistent with gestational diabetes.
Keywords: prolactin signaling, gestational diabetes, pregnancy, pancreas
Introduction
Glucose intolerance during pregnancy, known as gestational diabetes mellitus (GDM), is one of the most common pregnancy complications and affects nearly 17% of all pregnancies globally and ~7% in the United States (Newbern & Freemark 2011). Although diabetic symptoms associated with GDM disappear after delivery, its occurrence poses health risks for both the mother and fetus. GDM is associated with adverse pregnancy outcomes, including increased risk of miscarriage, hypertensive disorders, premature birth, cesarean delivery and development of metabolic disorders such as obesity and diabetes later in life (Vambergue & Fajardy 2011, Zhu & Zhang 2016). GDM is a consequence of unsatisfactory pregnancy-dependent adaptations of pancreatic β cells (Rieck & Kaestner 2010).
Pregnancy is associated with significant metabolic demands that require adjustments in glucose homeostasis to meet the nutrient needs of the maternal–fetal unit (Huang et al. 2009, Rieck & Kaestner 2010). These metabolic adjustments are accompanied by a decline in maternal insulin sensitivity, which is often compensated by increasing maternal β cell mass and insulin secretion to maintain euglycemia (Parsons et al. 1992, Huang et al. 2009, Rieck & Kaestner 2010, Huang 2013). It is hypothesized that these maternal pancreatic adaptations are driven by the pregnancy hormones, prolactin (PRL) and placental lactogens (PLs), acting through the PRL receptor (PRLR) at the β cells within the islets of Langerhans (Freemark et al. 2002, Huang et al. 2009, Sorenson & Brelje 2009, Newbern & Freemark 2011).
PRL is a cytokine/hormone produced by the anterior pituitary and in some extra-pituitary sites (Bole-Feysot et al. 1998, Soares 2004, Horseman & Gregerson 2014). PRL is part of a larger protein family that includes hormones that are produced by the placenta with a similar spectrum of biological activities, referred to as PLs (Soares 2004). PRL and PLs have numerous biological functions, including regulation of lactation, morphogenesis, reproduction, metabolism and adaptations to physiological stressors (Bole-Feysot et al. 1998, Soares et al. 2007, Horseman & Gregerson 2014, Bernard et al. 2015). PRL and PLs act on their target cells through binding and activating the PRLR (Bole-Feysot et al. 1998, Soares 2004). The PRLR is a transmembrane receptor expressed in myriad of cell types throughout the body, including the pancreas (Bole-Feysot et al. 1998, Soares 2004, Horseman & Gregerson 2014, Bernard et al. 2015).
Previous in vitro studies using β cell cultures (Brelje et al. 1993, Vasvada et al. 2000) and in vivo experiments examining mice with global germline mutations at either Prl or Prlr loci (Vasvada et al. 2000, Freemark et al. 2002, Huang et al. 2009) have implicated a role for PRLR signaling in maternal islet adaptations. These studies have demonstrated that the PRLR is present on β cells and that its expression increases during pregnancy (Nagano & Kelly 1994). Overexpression of mouse PL-I (also known as PRL3D1) in β cells (Vasvada et al. 2000) or exposure of isolated islets to PRL or PLs (Brelje et al. 1993) coincides with pregnancy-associated increases in β cell proliferation, islet mass, insulin secretion, and a reduced threshold of glucose-stimulated insulin secretion. Conversely, homozygous nonpregnant or pregnant mice heterozygous for the global Prlr-null allele have been reported to have decreased β cell mass, impaired glucose tolerance and a diminished insulin secretory response (Freemark et al. 2002, Huang et al. 2009). Collectively, these studies strongly support the idea that PRLR signaling is a key mediator of pregnancy-associated β cell proliferation, survival and insulin secretion, adaptations critical for maintaining maternal glycemic control.
Significant efforts have been directed at deciphering the in vivo role of PRLR signaling in regulating maternal islet cell adaptions and pregnancy-associated glucose homeostasis. Supporting data have been primarily accrued through experimentation with mice possessing global mutations at either Prl or Prlr loci (Vasvada et al. 2000, Freemark et al. 2002, Huang et al. 2009). Since Prlr-null mice are infertile, the experimental assessment of the in vivo role of PRLR signaling during pregnancy has been primarily restricted to assessment of maternal glucose homeostasis and pancreatic adaptations in mice heterozygous for the global Prlr-null allele (Huang et al. 2009). Although these investigations have suggested a role for PRLR signaling during maternal islet cell adaptations, the ubiquitous nature of PRLR expression does not permit a precise determination of the relative importance of PRLR signaling in the β cell versus some other targets in the body. To circumvent these impediments, Banerjee and colleagues have recently used the rat insulin promoter (RIP) Cre to conditionally delete Prlr from β cells (Banerjee et al. 2016). In their model, loss of PRLR signaling in β cells resulted in GDM, reduced β cell proliferation and impaired β cell mass expansion during pregnancy (Banerjee et al. 2016). The RIP-Cre has been shown to have significant Cre activity outside of the pancreas, including the hypothalamus (Wicksteed et al. 2010, Ladyman et al. 2017). Adding to the potential confusion, RIP-Cre has been demonstrated to develop glucose intolerance and impaired insulin secretion independent of a floxed target gene (Lee et al. 2006). Some of these actions may be the consequence of a human growth hormone minigene embedded in the RIP-Cre gene construct (Herrera 2000, Brouwers et al. 2014, De Faudeur et al. 2018).
In the current study, our goal was to investigate the role of PRLR signaling in maternal pancreatic adaptations to glucose homeostasis and islet function during pregnancy. To facilitate our investigation, we engineered a Prlr mutation in the mouse where exon 5, a region critical for PRLR activity (Brooks 2012), was conditionally deleted using pancreas-duodenum homeobox 1 (Pdx1) promoter Cre (Hingorani et al. 2003, Wicksteed et al. 2010, Arda et al. 2013, Snyder et al. 2013). The Pdx1 promoter is active in the pancreas during earlier phases of embryogenesis than the RIP promoter (Arda et al. 2013). Both Pdx1-Cre and RIP-Cre transgenic mice exhibit extra-pancreatic expression in the brain but most importantly expression is in spatially distinct regions of the brain (Honig et al. 2010, Wicksteed et al. 2010). Additionally, Pdx1-Cre, unlike RIP-Cre, does not contain the human growth hormone minigene (Herrera 2000, Hingorani et al. 2003) and its consequential artifacts. Similarities and differences achieved with Pdx1-Cre and RIP-Cre transgenic mice are informative and can provide insights into the importance of the pancreas in pregnancy-dependent glucose homeostasis. Using Pdx1-Cre, we show that pancreatic PRLR signaling controls pregnancy-dependent β cell expansion and prominently impacts maternal glucose homeostasis.
Materials and methods
Animals
All mice were maintained in accordance with institutional policies for the care and use of vertebrate animals in research using protocols approved by the University of Kansas Medical Center Animal Care and Use Committee. A targeting vector with LoxP sequences flanking Exon 5 of the mouse Prlr gene along with β-galactosidase (LacZ) and neomycin resistance (Neo) cassettes flanked by flippase (FLP) recognition target (FRT) sites within Intron 4 of the Prlr gene was designed and generated by the European Conditional Mouse Mutagenesis Program (EUCOMM) (Bradley et al. 2012). The targeting vector was transfected into E14Tg2a (129P2/OlaHsd) embryonic stem cells and G418-resistant clones were isolated and validated by PCR genotyping, DNA sequencing and karyotyping. Correctly targeted ES cells were used to generate chimeric mice via injection into C57BL/6 blastocysts by the Transgenic and Gene Targeting Facility of the University of Kansas Medical Center. Chimeras with an extensive agouti contribution were backcrossed with C57BL/6 mice, and germline transmission of the targeted allele was confirmed by PCR and genomic sequencing. The FRT-LacZ-neo cassette was removed by crossing with a FLP recombinase mouse (Jackson Laboratory; Stock No. 009086) (Farley et al. 2000) to generate Prlr-floxed mice (Prlrf/f, control). Prlr-floxed mice were crossed with mice expressing Cre recombinase under mouse Pdx1 promoter (Pdx1-Cre, Jackson Laboratory; Stock No. 014647) (Hingorani et al. 2003), generating pancreas-specific Prlr conditional knockout mice (PrlrPdx1-d/d).
Pdx1-Cre transgenic mice and Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J also known as ROSAmT/mG reporter mice were obtained from the Jackson Laboratory (Stock No. 007576). Both lines were initially generatedonamixedC57BL/6×129(129X1/SvJ×129S1/Sv) F1 background and backcrossed several generations onto C57BL/6. The ROSAmT/mG reporter transgene is driven by a chicken β actin promoter from the Gt(ROSA)26Sor genomic locus (Muzumdar et al. 2007). In the absence of Cre recombinase, ROSAmT/mG mice constitutively express membrane-targeted tdTomato (mT), a red fluorescent protein. When bred to mice expressing Cre recombinase, the mT cassette is excised in the Cre-expressing tissue(s), allowing expression of membrane-targeted enhanced green fluorescent protein (EGFP, mG) (Muzumdar et al. 2007, Snyder et al. 2013).
Genotyping was performed on DNA isolated from tail biopsies obtained just prior to weaning of litters (Ain et al. 2004, Alam et al. 2007, Bu et al. 2016, 2017) using primers provided in Table 1.
Table 1.
Primers for genotyping and qRT-PCR analyses.
| Target | Forward | Reverse |
|---|---|---|
| Genotyping primers | ||
| Pdx1-Cre | CTGGACTACATCTTGAGTTGCAGG | ACGGTGTACGGTCAGTAAATTTG |
| Prlr14732 | ATGCCACTTTCCAAGGTCTG | GCCATTGCAGCTGTAGTCAA |
| qRT-PCR primers | ||
| Prl5a1 | ATGCGGCTGTCTAAGATTCAAC | CTTCCATGATACATCTGGGCAC |
| Prl8a8 | ACCCACGGATGGAAACATTTG | TGCAGCTCTGAAAACAATCTCAT |
| Prl7a2 | GCCTCTGTACCTTTGAGTAGCA | CGCAGTTCCATGTTGAGGTTTTT |
| Tnfa | CCAGTGTGGGAAGCTGTCTT | AAGCAAAAGAGGAGGCAACA |
| Cxcl2 | AACATCCAGAGCTTGAGTGTGA | TTCAGGGTCAAGGCAAACTT |
| Socs1 | CTGCGGCTTCTATTGGGGAC | AAAAGGCAGTCGAAGGTCTCG |
| Il10 | TGGCCTTGTAGACACCTTGG | AGCTGAAGACCCTCAGGATG |
| Prlr | AAAACATGTCATCTGCACTT | TGGTAGGTGGCAACCATTTT |
| Foxm1 | CTGATTCTCAAAAGACGGAGGC | TTGATAATCTTGATTCCGGCTGG |
| Mafa | AGGAGGAGGTCATCCGACTG | CTTCTCGCTCTCCAGAATGTG |
| Ins2 | GCTTCTTCTACACACCCATGTC | AGCACTGATCTACAATGCCAC |
| Ngn3 | CCGGATGACGCCAAACTTA | CATAGAAGCTGTGGTCCGCTATG |
| Amy2a | TTGCCAAGGAATGTGAGCGAT | CCAAGGTCTTGATGGGTTATGAA |
| Pdx1 | CCCCAGTTTACAAGCTCGCT | CTCGGTTCCATTCGGGAAAGG |
| Sox17 | GATGCGGGATACGCCAGTG | CCACCACCTCGCCTTTCAC |
| Hnf4a | CACGCGGAGGTCAAGCTAC | CCCAGAGATGGGAGAGGTGAT |
| Tph1 | ACTGGAGAATAGAACACCAGAGC | TGTAACAGGCTCACATGATTCTC |
Validation of Pdx1-Cre specificity
To validate the specificity of Pdx1-Cre recombinase, we crossed Pdx1-Cre transgenic mice (Pdx-Cre+) with ROSAmT/mG heterozygotes. For imaging studies, 12-week-old littermates were killed and imaged simultaneously to establish optimal exposure times and to control for auto-fluorescence, particularly of the gastrointestinal tract. Fluorescence imaging of the abdominal cavity was performed using an IVIS small animal imaging system (Perkin-Elmer) with tdTomato or EGFP fluorescence illumination settings (tdTomato: 545/30 excitation and 598/55 emission; EGFP 475/40 excitation and emission 530/50).
Tissue collection
Prlrf/f mice were crossed with transgenic Pdx1-Cre mice to produce PrlrPdx1-d/d and Prlrf/f offspring. Males and females of appropriate age were caged together overnight. The presence of a seminal plug in the vagina was designated gestation day (gd) 0.5. Pancreas and placental tissues were collected on gd 15.5 and weighed. Placental tissues were frozen in dry-ice-cooled heptane for immunohistochemical staining or snap-frozen in liquid nitrogen and stored at −80°C until processing. Pancreas tissues were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) for histological analysis or stored in RNAlater stabilization solution (Thermo Fisher Scientific, catalog No. AM7020) at −80°C until processed.
RNA isolation, cDNA synthesis and transcript measurements
Total RNA was isolated from tissues from second pregnancies using TRIzol reagent (Thermo Fisher Scientific, catalog No. 15596018). cDNA was synthesized from 1 μg of total RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, catalog No. 4368813). Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was performed on a reaction mixture (20 μL) containing cDNA diluted five times with water and PowerSYBR Green PCR Master Mix (Applied Biosystems, catalog No. 4367659) using specific primer (250 nM) sequences (Table 1). Amplification and florescence detection were carried out using an ABI 7500 Real Time PCR system (Applied Biosystems) for 40 cycles (95°C for 10 min; 92°C for 15 s; 60°C for 1 min; 95°C for 15 s; 60°C for 15 s; and 95°C for 15 s). Relative transcript expression was calculated by ΔΔCt method and normalized to 18S rRNA.
Western blotting
Maternal pancreas tissues obtained from second pregnancies were homogenized in RIPA lysis buffer (Santa Cruz Biotechnology; catalog No. sc-24948A) supplemented with Halt Protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific, catalog No. 78443). Protein concentrations were determined by the DC protein assay (Bio Rad). A total of 50 μg of protein per reaction sample were separated on 4–20% ExpressPlus PAGE Gels (GenScript, Piscataway, NJ, USA; catalog Nos. M42012 and M42015) and transferred to PVDF Blotting Membrane (GE Healthcare; catalog No. 10600023). Following transfer, membranes were blocked in 5% non-fat milk in Tris-buffered saline with 0.1% Tween 20, for non-specific binding and subsequently probed with specific primary antibodies to SRY-box 17 (SOX17; 1:500, Santa Cruz Biotechnology, catalog No. sc-130295), phosphorylated signal transducer and activator of transcription 5 (STAT5pTyr694, DH47E7, 1:500, Cell Signaling Technology, catalog No. 4322), PDX1 (D59H3; 1:1000, Cell Signaling Technology, catalog No. 5679) and glyeraldehyde-3-phosphate dehydrogenase (GAPDH, 1:300, Abcam, catalog No. ab9485). Immunoreactive proteins were visualized by Luminata Crescendo Western HRP Substrate (Millipore, catalog No. WBLUR0500) according to the manufacturer’s protocol.
Histology, immunofluorescence and immunohistochemistry
Nonpregnant and gd15.5, Prlrf/f and PrlrlPdx1-d/d mice were killed, and the entire pancreas was removed, weighed and fixed in 4% paraformaldehyde-PBS solution at 4°C overnight. Tissues were dehydrated, embedded in paraffin and sectioned at 7 μm. Every 40th section was stained for insulin (1:250, Cell Signaling Technology, catalog No. C27C9 or 1:100, GeneTex, Irvine, CA, USA, catalog No. GTX27842) to identify β cells and β cell mass. Briefly, for each pancreas section, adjacent nonoverlapping areas of the entire pancreas section were imaged using fluorescence microscopy. NIH ImageJ software was used to measure β cell (insulin-positive) area and total pancreas area. The number of islets (defined as insulin-positive cell clusters at least 25 μm in diameter) were counted and mean islet size was calculated as the ratio of total insulin-positive cell area to the total islet number. β cell fraction was measured as the ratio of the insulin-positive cell area to the total tissue area represented on the section. Finally, β cell mass was determined by multiplying the β cell fraction by the weight of the pancreas.
Intraperitoneal glucose tolerance test (IGTT) and insulin measurements
IGTTs were performed on non-pregnant, gd 15.5 pregnant and postpartum day 4 females. Mice were fasted for 6 h with free access to water and then injected intraperitoneally (i.p.) with a D-glucose solution (2 g/kg body weight). Blood glucose levels were measured from the tail vein using the OneTouch Ultra Smart blood glucose monitoring system (Lifescan, Milpitas, CA, USA) just before the i.p. injection (time-0) and at 15, 30, 60, 90 and 120 min post injection. Glucose excursions were measured using standard methods. Blood samples (30 μL) were collected at time-0 and 30-min post glucose injection for measurement of insulin using a mouse insulin enzyme-linked immunosorbent assay kit (Crystal Chem, Elk Grove Village, IL, USA, catalog No. 90080).
Statistical analysis
Statistical analyses were performed using GraphPad Prism 6 software with either two-way ANOVA followed by Bonferroni multiple comparisons or unpaired Student’s t tests applied when appropriate. Data are represented as mean ± S.D. with the statistical significance level set at P < 0.05.
Results
Generation and validation of pancreatic disruption of the mouse Prlr gene
A germ line allele possessing LoxP sequences flanking Exon 5 of the Prlr gene was successfully generated (Fig. 1A). To validate Pdx1-Cre recombinase activity within the pancreas, we used the ROSAmT/mG indicator mouse, which constitutively expresses a conditional tdTomato transgene that converts to GFP expression following exposure to Cre recombinase. Bioluminescent images acquired using an IVIS small animal imaging system showed that tdTomato was ubiquitously expressed with brighter expression within the pancreas of the ROSAmT/mG littermate lacking Pdx1-Cre, whereas GFP expression was evident within the pancreas and duodenum of Pdx1-Cre/ROSAmT/mG littermates (Supplementary Fig. 1, see section on supplementary data given at the end of this article) confirming the activity of Pdx1-Cre recombinase (Snyder et al. 2013). To demonstrate the tissue specificity of the Prlr gene disruption, PCR was performed on genomic DNA samples from various tissues of PrlrPdx1-d/d mice. The deleted Prlr allele was only present in pancreatic DNA from mice of this genotype (Fig. 1B). Using specific primers, qRT-PCR verified the deletion of Exon 5 of the Prlr gene in RNA from pancreatic tissue of PrlrPdx1-d/d mice (Fig. 1C).
Figure 1.
Generation and characterization of Pdx1-Cre-driven disruption of the floxed Prlr allele. (A) Schematic representations of the mouse Prlr gene, the floxed Prlr allele and the null Prlr allele following deletion of floxed Exon 5 with Pdx1-Cre recombinase. (B) PCR of DNA from various tissues of PrlrPdx1-d/d mice and control pancreas. (C) qRT-PCR verification of the absence of the contributions of Exon 5 to the Prlr transcript in pancreas tissue of PrlrPdx1-d/d mice (mean ± S.D., Student’s t test, *P < 0.05).
We next investigated PRLR signaling in the pancreas of control (Prlrf/f) and pancreatic PRLR-deficient (PrlrPdx1-d/d) mice. It has been previously reported that PRLR signaling, in β cells, is mediated at least in part by activation of STAT5 (Brelje et al. 2002, Friedrichsen et al. 2003, Huang et al. 2009). Consequently, we determined the activation state of STAT5 by assessing its phosphorylation on Tyr-694. We also examined the expression of known transcriptional targets of PRLR signaling in pancreatic tissue (tryptophan hydroxylase-1, Tph1; Huang et al. 2009, Rieck & Kaestner 2010; forkhead box M1, Foxm1; Zhang et al. 2005, 2010; MAF BZIP transcription factor A, Mafa; Zhang et al. 2005) of pregnant Prlrf/f and PrlrPdx1-d/d mice. STAT5pTyr694 protein was diminished in tissue sections and lysates prepared from pancreatic tissue of gd 15.5 PrlrPdx1-d/d vs Prlrf/f mice (Fig. 2A and B). qRT-PCR results further demonstrated that Tph1, Foxm1 and Mafa were expressed at lower levels in gd 15.5 pancreatic tissue from PrlrPdx1-d/d compared to Prlrf/f mice (Fig. 2C).
Figure 2.
Characterization of PRL-responsive genes in the pancreas from pregnant Prlrf/f and PrlrPdx1-d/d dams on gd 15.5. (A) Immunofluorescence staining for phosphorylated STAT5pTyr694 protein (pSTAT5; red), insulin (green), and 4′,6-diamidino-2-phenylindole (DAPI) binding (blue), scale bar: 100 μm. (B) Detection of pSTAT5 protein abundance by western blotting and quantification by densitometry. (C) qRT-PCR measurements of transcripts for known targets of PRLR signaling within the pancreas: Tph1, Foxm1 and Mafa. Statistical analyses: n = 5, mean ± S.D., Student’s t test, *P < 0.05.
In summary, loss of the pancreatic Prlr in PrlrPdx1-d/d mice resulted in decreased pancreatic phosphorylation of STAT5 concomitant with diminished abundance of pancreatic Tph1, Foxm1 and Mafa transcripts, confirming the efficacy of interfering with β cell PRLR signaling.
Pancreatic deficient Prlr mice have impaired pregnancy-dependent glucose homeostasis
PRLR signaling has been implicated in the regulation of pancreatic adaptations to pregnancy (Vasvada et al. 2000, Freemark et al. 2002, Huang et al. 2009, Huang 2013). To examine the impact of pancreatic Prlr-null mutation on glucose homeostasis, we performed IGTT on virgin and pregnant Prlrf/f and PrlrPdx1-d/d mice at various ages. Inactivation of PRLR signaling in the pancreas did not affect body weight of either virgin (Fig. 3A) or pregnant mice (Fig. 3D). Loss of PRLR signaling in the pancreas did not significantly affect blood glucose levels in nonpregnant females (Fig. 3B and C). However, pregnant (gd 15.5) mice possessing a pancreatic PRLR deficiency had significantly elevated fasting blood glucose and impaired glucose tolerance in comparison to control pregnant mice. Furthermore, the inability to sustain normal blood glucose balance during pregnancy persisted with increased maternal age and a second pregnancy (Fig. 3E, F, G, H and I). PrlrPdx1-d/d dams returned to normal glycemic control 4 days postpartum (Fig. 3I). Insulin responses to bolus glucose injection were significantly blunted in PrlrPdx1-d/d dams versus age-matched Prlrf/f dams (Fig. 3H). Thus, pregnant mice possessing a pancreatic deficit in PRLR signaling exhibit poor glucose homeostasis, including impairments in glucose-dependent insulin responses.
Figure 3.
Glucose homeostasis in control (Prlrf/f) and pancreatic Prlr null (PrlrPdx1-d/d) mice. (A) Body weights for virgin Prlrf/f (8–10 week: n = 16; 20–22 week: n = 9) and PrlrPdx1-d/d (8–10 week: n = 24; 20–22 week: n = 10). (B) Intraperitoneal glucose tolerance tests (IGTT) for virgin Prlrf/f (8–10 week: n = 16) and PrlrPdx1-d/d (8–10 week: n = 24). (C) IGTT for virgin Prlrf/f (20–22 week: n = 9) and PrlrPdx1-d/d (20–22 week: n = 10) females following 6 h of fasting. (D) Body weights for pregnant Prlrf/f (8–10 week-first pregnancy: n = 9; 20–22 week-first pregnancy: n = 9; 20–22 week-second pregnancy: n = 6) and PrlrPdx1-d/d (8–10 week-first pregnancy: n = 9; 20–22 week-first pregnancy: n = 6; 20–22 week-second pregnancy: n = 6) females on gd 15.5. (E, F, G, H and I) IGTT were performed on gd 15.5 female mice after 6 h of fasting: (E) 8–10 week old-first pregnancy Prlrf/f (n = 9) and PrlrPdx1-d/d (n = 9) females; (F) 20–22 week old-first pregnancy Prlrf/f (n = 9) and PrlrPdx1-d/d (n = 6) females; (G) 20–22 week old-second pregnancy Prlrf/f (n = 6) and PrlrPdx1-d/d (n = 6) females. (H) Serum insulin levels at baseline (0) and 30 min following an intraperitoneal injection of glucose in 20–22 week-old-second pregnancy Prlrf/f (n = 6) and PrlrPdx1-d/d (n = 6) female mice. (I) IGTT were performed on 20–22 week-old postpartum day 4 Prlrf/f and PrlrPdx1-d/d female mice following their second pregnancy. Statistical analyses: mean ± S.D., Student’s t test, *P < 0.05.
Loss of pancreatic PRLR signaling results in diminished β cell mass
During pregnancy, maternal islets go through structural and functional changes to maintain glycemic control. In rodents, the number and size of maternal β cells increase during mid-gestation resulting in an increased capacity for insulin production (Freemark et al. 2002, Huang et al. 2009, Rieck & Kaestner 2010, Huang & Chang 2014). Here, we show that relative to control mice, both virgins and pregnant mice possessing a pancreatic PRLR deficit possessed significantly fewer β cells (Fig. 4A and B). β cells in PrlrPdx1-d/d mice failed to optimally expand during gestation leading to a diminished fractional area of insulin-positive cells (Fig. 4A) and a reduced β cell mass (Fig. 4C). Differences were not noted in the sizes of the pancreas between Prlrf/f and PrlrPdx1-d/d mice. The deficit in insulin-producing cells is consistent with sub-optimal glucose-stimulated insulin secretion and poor maternal glucose control observed in PrlrPdx1-d/d dams.
Figure 4.

Insulin-positive β cell distributions in pancreatic tissues from nonpregnant and gd 15.5 pregnant Prlrf/f and PrlrPdx1-d/d female mice. (A) Immunohistochemical staining for insulin (brown), scale bar: 100 μm. (B) Quantification of insulin-positive islets/pancreas. (C) Quantification of β cell mass (g). Statistical analyses: nonpregnant (n = 5) and pregnant (n = 5), mean ± S.D., analysis of variance followed by Bonferroni post hoc test. Group means identified by different letters are significantly different, (P < 0.05). A full colour version of this figure is available at https://doi.org/10.1530/JOE-18-0518.
PRLR signaling and pancreas adaptations to pregnancy
To elucidate molecular mechanisms intrinsic to the abnormal β cell adaptations in PrlrPdx1-d/d animals, we next analyzed the expression of genes associated with cell differentiation in pancreatic tissue from pregnant mice. qRT-PCR analyses showed that loss of pancreatic Prlr was associated with a significant decrease in the expression of transcripts linked to β cell differentiation and function, including Pdx1, Sox17, Hnf4a, Ngn3 and Ins2 (Fig. 5A), and an increase in the expression of an acinar cell biomarker, Amy2a (Fig. 5B). Consistent with the transcript analysis, immunoblotting revealed a significant reduction in SOX17 protein expression in pancreas lysates from pregnant PrlrPdx1-d/d compared to Prlrf/f dams (Fig. 5C). Differences were not noted for pancreatic transcript expression in virgin Prlrf/f and PrlrPdx1-d/d mice (Supplementary Fig. 2). Our data show that loss of pancreatic PRLR signaling negatively affects islet growth-dependent adaptations to pregnancy.
Figure 5.
PRLR signaling and maternal pancreas gene expression. qRT-PCR measurements in maternal pancreatic tissue of selected transcripts associated with β cell (A) and acinar cell differentiation (B) from the second pregnancy of gd 15.5 Prlrf/f and PrlrPdx1-d/d mice. Cycle threshold (Ct) values for pancreatic transcript expression at gd 15.5 Prlrf/f and PrlrPdx1-d/d mice (mean Ct values ± S.D.): Pdx1 (Prlrf/f: 20.68 ± 0.46 vs PrlrPdx1-d/d: 22.88 ± 0.58) Sox17 (Prlrf/f: 20.45 ± 0.78 vs PrlrPdx1-d/d: 26.75 ± 0.67), Hnf4a (Prlrf/f: 23.93 ± 0.97 vs PrlrPdx1-d/d: 27.40 ± 0.65), Ngn3 (Prlrf/f: 20.20 ± 0.35 vs PrlrPdx1-d/d: 30.02 ± 0.30), Ins2 (Prlrf/f: 15.39 ± 0.47 vs PrlrPdx1-d/d: 18.19 ± 0.65) and Amy2a (Prlrf/f: 18.36 ± 0.87 vs PrlrPdx1-d/d: 14.19 ± 0.75). Relative expression refers to the ratio of PrlPdx1-d/d transcript levels to Prlrf/f transcript levels. (C) Detection of SOX17 protein abundance by western blotting and quantification by densitometry. Relative expression refers to the ratio of PrlPdx1-d/d protein levels to Prlrf/f protein levels. Statistical analyses: n = 5, mean ± S.D., Student’s t test, *P < 0.05.
Loss of pancreatic PRLR signaling affects fetal growth and placental gene expression
GDM is associated with abnormalities in placental function and fetal growth (Vambergue & Fajardy 2011, Jarmuzek et al. 2015). Given the impaired glycemic control during pregnancy, we compared placental and fetal weights and placental gene expression in control and pancreatic PRLR-deficient dams. Although placental weights did not exhibit significant differences (Fig. 6A), gd 15.5 fetal and postnatal day 1 pup weights were significantly larger in second pregnancies from dams with a pancreatic deficiency in PRLR signaling (Fig. 6C and D). The disruption in pancreatic PRLR signaling was also associated with a significant dysregulation of placental PRL family and inflammation-related transcript expression (Fig. 6E and F).
Figure 6.
Loss of pancreatic PRLR signaling affects fetal growth and placental gene expression. Gestation day 15.5 placental weights from first and second pregnancies (A) and fetal weights from first (B) and second (C) pregnancies of Prlrf/f (first pregnancy: n = 57; second pregnancy: n = 27) and PrlPdx1-d/d (first pregnancy: n = 54; second pregnancy: n = 27). (D) Postnatal day 1 pup weights were also measured (Prlrf/f, n = 40; PrlPdx1-d/d, n = 69). qRT-PCR measurements in gd 15.5 placental tissue of selected downregulated (E) and upregulated (F) transcripts from Prlrf/f (n = 6) and PrlrPdx1-d/d (n = 6) genotypes. Relative expression refers to the ratio of PrlPdx1-d/d transcript levels to Prlrf/f transcript levels. Statistical analyses: mean ± S.D., Student’s t test, *P < 0.05.
Similar to GDM, mice with impaired pancreatic PRLR signaling exhibit maternal glucose intolerance, placental dysfunction and fetal overgrowth.
Discussion
Pregnancy is associated with significant metabolic demands that require adjustments in glucose homeostasis to meet the needs of the maternal–fetal unit. These adaptations involve a decline in maternal insulin sensitivity, which leads to a compensatory increase in maternal β cell mass and insulin secretion to maintain glucose homeostasis (Rieck & Kaestner 2010, Newbern & Freemark 2011). Failure to achieve optimal maternal β cell mass and function during pregnancy can result in insulin insufficiency and GDM, leading to immediate and/or long-term health complications for the mother and fetus (Vambergue & Fajardy 2011, Zhu & Zhang 2016). Although pancreatic β cell dysfunction is a primary cause of diabetes, we unfortunately do not understand all the molecular targets required for establishing and maintaining proper functional maternal pancreatic β cells during pregnancy. In this study, we established a mouse model with a Prlr gene disruption in the pancreas using Pdx1-Cre to test the hypothesis that PRLR signaling is required for pregnancy-dependent adaptations in maternal β cell mass and function. We report that inactivation of PRLR signaling using the Pdx1-Cre undermines β cell mass expansion and function, leading to impaired maternal glucose homeostasis, placental gene dysregulation and fetal overgrowth. We tracked the etiology of the insufficiency in β cells to deficits in regulatory pathways controlling their differentiation. The findings support a role for pancreatic PRLR signaling in mediating maternal islet adaptations to pregnancy.
Disrupting pancreatic PRLR signaling did not affect blood glucose levels in nonpregnant females; however, on gd 15.5, PrlrPdx1-d/d dams had elevated fasting blood glucose and impaired glucose tolerance which returned to normal glycemic control 4 days postpartum. These results are consistent with previous studies using mice heterozygous for the global Prlr-null allele (Huang et al. 2009) or RIP-Cre mediated inactivation of Prlr gene (Banerjee et al. 2016). In these studies, disruption of Prlr resulted in impaired maternal glucose homeostasis. Our data together with previous work support an in vivo role for pancreatic PRLR signaling as a key regulator of maternal glucose homeostasis during murine pregnancy. Some evidence is consistent with a role for PRLR signaling in human pregnancy. For example, SNPs of the PRLR gene can increase the risk of GDM by more than two-fold (Le et al. 2013) and serum PRL levels in human pregnancies predict postpartum β cell function and the risk of diabetes with lower levels being associated with poor β cell function and higher risk of diabetes (Retnakaran et al. 2016). Collectively, these results indicate that pancreatic PRLR signaling is involved in regulating maternal blood glucose homeostasis during pregnancy in vivo and that its inactivation can predispose the mother to poor glycemic control during pregnancy.
We observed that female mice lacking the Prlr gene in the pancreas have fewer insulin-producing cells, which fail to expand appropriately during pregnancy. The reduced number of β cells together with compromised pregnancy-induced β cell mass expansion in PrlrPdx1-d/d dams is a potential contributing factor to the observed glucose intolerance and insulin secretion dysregulation. Indeed, others have reported decreased β cell mass, impaired glucose tolerance and a diminished insulin secretory response following PRLR inactivation (Freemark et al. 2002, Huang et al. 2009, Arumugam et al. 2014, Banerjee et al. 2016). Conversely, overexpression of PL in β cells (Vasvada et al. 2000) or exposure of isolated islets to PRL or PLs (Brelje et al. 1993), coincide with pregnancy-associated increases in β cell proliferation, islet mass, insulin secretion and a reduced threshold of glucose-stimulated insulin secretion. Taken together, these results strongly support the idea that PRLR signaling is a mediator of β cell mass, survival and insulin secretion; adaptations critical during pregnancy to prevent pathological maternal glucose intolerance and its consequences.
PrlrPdx1-d/d female mice have fewer insulin-producing cells, which fail to expand appropriately during pregnancy, and diminished pancreatic expression of genes pivotal to the regulation of islet differentiation, including Pdx1, Sox17, Hnf4a and Ngn3. PDX-1 is a master regulator of islet development and function and controls insulin expression and other hormones produced by islet cells of the adult pancreas (Ohlsson et al. 1993, Miller et al. 1994, Gu et al. 2002, 2003). SOX17 is a transcription factor critical for pancreatic development (Spence et al. 2009) and regulates several factors involved in insulin trafficking and secretion in β cells (Jonatan et al. 2014). Loss of SOX17 results in improper secretion of insulin, β cell dysfunction and GLUT2 expression leading to a prediabetic state in mice (Jonatan et al. 2014). HNF4A directly regulates genes involved in glucose transport and glycolysis (Stoffel & Duncan 1997, Gupta et al. 2007). Mice carrying a null mutation in Hnf4a have impaired glucose-stimulated insulin secretion (Gupta et al. 2005, Miura et al. 2006). In humans, mutations in HNF4A are strongly associated with adult-onset diabetes (Yamagata et al. 1996, Stoffel & Duncan 1997, Harries et al. 2008) and recently haploinsufficiency HNF4A mutations have been associated with increased birthweight and macrosomia (Pearson et al. 2007). NGN3 is a transcription factor required for the development of pancreas and its expression defines progenitors that develop into endocrine cells of the pancreas (Gradwohl et al. 2000, Herrera et al. 2002, Gu et al. 2003, Rukstalis & Habner 2009, Wang et al. 2009, Gomez et al. 2015, Sheets et al. 2018). During midgestation, Ngn3 expression has been reported to increase in maternal endocrine and exocrine compartments of the pancreas where it is thought to play a role in β cell neogenesis and proliferation (Zhang et al. 2010, Søstrup et al. 2014). The identification of a role for PRLR signaling in the β cell differentiation emerged in this investigation as a consequence of utilization of Pdx1-Cre to disrupt the Prlr gene. Pdx1-Cre is activated during early stages of pancreas development, in contrast to the activation of RIP-Cre, which is activated in terminally differentiated β cells (Herrera et al. 2002, Gu et al. 2003, Lee et al. 2006, Wicksteed et al. 2010, Arda et al. 2013, Banerjee et al. 2016).
In summary, our data using a Pdx1-Cre conditional Prlr mutant mouse model support a role for pancreatic PRLR signaling in the regulation of pregnancy-dependent glucose homeostasis and strengthen earlier observations using the RIP-Cre conditional Prlr-mutant mouse (Banerjee et al. 2016). The similarities of the phenotypes in these two conditional mouse models are important. Although, Pdx1-Cre and RIP-Cre are islet-targeting Cre recombinases, they exhibit extra-pancreatic activities and in the case of RIP-Cre other potential artifacts. New insights into mechanisms underlying PRLR-dependent islet expansion were linked to the regulation of pathways controlling β cell differentiation. We also found that impairments in maternal glucose homeostasis led to placental gene dysregulation and fetal overgrowth. The findings reinforce the experimental value of implementation of multiple Cre recombinases in the dissection of critical events regulating physiological processes.
Supplementary Material
Acknowledgements
The authors thank Dr John P Thyfault and Dr Paige C Geiger for their advice and Regan Scott, Stacy Oxley and Priscilla Nechrebecki for their assistance. They also thank staff of the University of Kansas Medical Center Transgenic and Gene Targeting Facility.
Funding
The research was supported by a postdoctoral fellowship to J N from the American Diabetes Association (1–16-PMF-012), grants from the National Institutes of Health (HD020676, HD079363) and a pilot award to G D (DK097512). The University of Kansas Medical Center Transgenic Facility was supported by National Institutes of Health grants (U54HD090216, P30GM122731, P30CA168524).
Footnotes
Supplementary data
This is linked to the online version of the paper at https://doi.org/10.1530/JOE-18-0518.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
References
- Ain R, Dai G, Dunmore JH, Godwin AR & Soares MJ 2004. A prolactin family paralog regulates reproductive adaptations to a physiological stressor. PNAS 101 16543–16548. ( 10.1073/pnas.0406185101) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alam SM, Konno T, Dai G, Lu L, Wang D, Dunmore JH, Godwin AR & Soares MJ 2007. A uterine decidual cell cytokine ensures pregnancy-dependent adaptations to a physiological stressor. Development 134 407–415. ( 10.1242/dev.02743) [DOI] [PubMed] [Google Scholar]
- Arda HE, Benitez CM & Kim SK 2013. Gene regulatory networks governing pancreas development. Developmental Cell 25 5–13. ( 10.1016/j.devcel.2013.03.016) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arumugam R, Fleenor D & Freemark M 2014. Knockdown of prolactin receptors in a pancreatic beta cell line: effects on DNA synthesis, apoptosis, and gene expression. Endocrine 46 568–576. ( 10.1007/s12020-013-0073-1) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Banerjee RR, Cyphert HA, Walker EM, Chakravarthy H, Peiris H, Gu X, Liu Y, Conrad E, Goodrich L, Stein RW, et al. 2016. Gestational diabetes mellitus from inactivation of prolactin receptor and Mafb in islet β-cells. Diabetes 65 2331–2341. ( 10.2337/db15-1527) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bernard V, Young J, Chanson P & Binart N 2015. New insights in prolactin: pathological implications. Nature Reviews Endocrinology 11 265–275. ( 10.1038/nrendo.2015.36) [DOI] [PubMed] [Google Scholar]
- Bole-Feysot C, Goffin V, Edery M, Binart N & Kelly PA 1998. Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocrine Reviews 19 225–268. ( 10.1210/edrv.19.3.0334) [DOI] [PubMed] [Google Scholar]
- Bradley A, Anastassiadis K, Ayadi A, Battey JF, Bell C, Birling MC, Bottomley J, Brown SD, Burger A, Bult CJ, et al. 2012. The mammalian gene function resource: the international knockout mouse consortium. Mammalian Genome 23 580–586. ( 10.1007/s00335-012-9422-2) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brelje TC, Scharp DW, Lacy PE, Ogren L, Talamantes F, Robertson M, Friesen HG & Sorenson RL 1993. Effect of homologous placental lactogens, prolactins, and growth hormones on islet B-cell division and insulin secretion in rat, mouse, and human islets: implication for placental lactogen regulation of islet function during pregnancy. Endocrinology 132 879–887. ( 10.1210/endo.132.2.8425500) [DOI] [PubMed] [Google Scholar]
- Brelje TC, Svensson AM, Stout LE, Bhagroo NV & Sorenson RL 2002. An immunohistochemical approach to monitor the prolactin-induced activation of the JAK2/STAT5 pathway in pancreatic islets of Langerhans. Journal of Histochemistry and Cytochemistry 50 365–383. ( 10.1177/002215540205000308) [DOI] [PubMed] [Google Scholar]
- Brooks CL 2012. Molecular mechanisms of prolactin and its receptor. Endocrine Reviews 33 504–525. ( 10.1210/er.2011-1040) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brouwers B, de Foudeur G, Osipovich AB, Goyvaerts L, Lemaire K, Boesmans L, Cauwelier EJG, Granvik M, Pruniau VPEG, Van Lommel L, et al. 2014. Impaired islet function in commonly used transgenic mouse lines due to human growth hormone minigene expression. Cell Metabolism 20 979–990. ( 10.1016/j.cmet.2014.11.004) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bu P, Alam SMK, Dhakal P, Vivian JL & Soares MJ 2016. A prolactin family paralog regulates placental adaptations to a physiological stressor. Biology of Reproduction 94 107. ( 10.1095/biolreprod.115.138032) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bu P, Yagi S, Shiota K, Alam SMK, Vivian JL, Wolfe MW, Rumi MAK, Chakraborty D, Kubota K, Dhakal P, et al. 2017. Origin of a rapidly evolving homeostatic control system programming testis function. Journal of Endocrinology 234 217–232. ( 10.1530/JOE-17-0250) [DOI] [PMC free article] [PubMed] [Google Scholar]
- De Faudeur G, Browers B, Schuit F, Creemers JWM & Ramos-Molina B 2018. Transgenic artifacts caused by passenger human growth hormone. Trends in Endocrinology and Metabolism 29 670–674. ( 10.1016/j.tem.2018.05.005) [DOI] [PubMed] [Google Scholar]
- Farley FW, Soriano P, Steffen LS & Dymecki SM 2000. Widespread recombinase expression using FLPeR (flipper) mice. Genesis 28 106–110. () [DOI] [PubMed] [Google Scholar]
- Freemark M, Avril I, Fleenor D, Driscoll P, Petro A, Opara E, Kendall W, Oden J, Bridges S, Binart N, et al. 2002. Targeted deletion of the PRL receptor: effects on islet development, insulin production, and glucose tolerance. Endocrinology 143 1378–1385. ( 10.1210/endo.143.4.8722) [DOI] [PubMed] [Google Scholar]
- Friedrichsen BN, Richter HE, Hansen JA, Rhodes CJ, Nielsen JH, Billestrup N & Moldrup A 2003. Signal transducer and activator of transcription 5 activation is sufficient to drive transcriptional induction of cyclin D2 gen and proliferation of rat pancreatic beta-cells. Molecular Endocrinology 17 945–958. ( 10.1210/me.2002-0356) [DOI] [PubMed] [Google Scholar]
- Gomez DL, O’Driscoll M, Sheets TP, Hruban RH, Oberholzer J, McGarrigle JJ & Shamblott MJ 2015. Neurogenin 3 expressing cells in the human exocrine pancreas have the capacity for endocrine cell fate. PLoS ONE 10 e0133862. ( 10.1371/journal.pone.0133862) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gradwohl G, Dierich A, LeMeur M & Guillemot F 2000. Neurogenin 3 is required for the development of the four endocrine cell lineages of the pancreas. PNAS 97 1607–1611. ( 10.1073/pnas.97.4.1607) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gu G, Dubauskaite J & Melton DA 2002. Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 129 2447–2457. [DOI] [PubMed] [Google Scholar]
- Gu G, Brown JR & Melton DA 2003. Direct lineage tracing reveals the ontogeny of pancreatic cell fates during mouse embryogenesis. Mechanisms of Development 120 35–43. ( 10.1016/S0925-4773(02)00330-1) [DOI] [PubMed] [Google Scholar]
- Gupta RK, Vatamaniuk MZ, Lee CS, Flaschen RC, Fulmer JT, Matschinsky FM, Duncan SA & Kaestner KH 2005. The MODY1 gene HNF-4 alpha regulates selected genes involved in insulin secretion. Journal of Clinical Investigation 115 1006–1015. ( 10.1172/JCI22365) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gupta RK, Gao N, Gorski RK, White P, Hardy OT, Rafiq K, Brestelli JE, Chen G, Stoeckert CJ Jr & Kaestner KH 2007. Expansion of adult beta-cell mass in response to increased metabolic demand is dependent on HNF-4alpha. Genes and Development 21 756–769. ( 10.1101/gad.1535507) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Harries LW, Locke JM, Shields B, Hanley NA, Hanley KP, Steele A, Njolstad PR, Ellard S & Hattersley AT 2008. The diabetic phenotype in HNF4A mutation carriers is moderated by the expression of HNF4A isoforms from the P1 promoter during fetal development. Diabetes 57 1745–1752. ( 10.2337/db07-1742) [DOI] [PubMed] [Google Scholar]
- Herrera PL 2000. Adult insulin- and glucagon-producing cells differentiate from two independent cell lineages. Development 127 2317–2322. [DOI] [PubMed] [Google Scholar]
- Herrera PL, Nepote V & Delacour A 2002. Pancreatic cell lineage analyses in mice. Endocrine 19 267–278. ( 10.1385/ENDO:19:3:267) [DOI] [PubMed] [Google Scholar]
- Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jacobetz MA, Ross S, Conrads TP, Veenstra TD, Hitt BA, et al. 2003. Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell 4 437–450. ( 10.1016/S1535-6108(03)00309-X) [DOI] [PubMed] [Google Scholar]
- Honig G, Liou A, Berger M, German MS & Tecott LH 2010. Precise pattern of recombination in sertonergic and hypothalamic neurons in a Pdx1-cre transgenic mouse line. Journal of Biomedical Science 17 82. ( 10.1186/1423-0127-17-82) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Horseman ND & Gregerson KA 2014. Prolactin actions. Journal of Molecular Endocrinology 52 R95–R106. ( 10.1530/JME-13-0220) [DOI] [PubMed] [Google Scholar]
- Huang C 2013. Wild-type offspring of heterozygous prolactin receptor-null female mice have maladaptive beta-cell responses during pregnancy. Journal of Physiology 591 1325–1338. ( 10.1113/jphysiol.2012.244830) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang Y & Chang Y 2014. Regulation of pancreatic islet beta-cell mass by growth factor and hormone signaling. Progress in Molecular Biology and Translational Science 121 321–349. ( 10.1016/B978-0-12-800101-1.00010-7) [DOI] [PubMed] [Google Scholar]
- Huang C, Snider F & Cross JC 2009. Prolactin receptor is required for normal glucose homeostasis and modulation of beta-cell mass during pregnancy. Endocrinology 150 1618–1626. ( 10.1210/en.2008-1003) [DOI] [PubMed] [Google Scholar]
- Jarmuzek P, Wielgos M & Bomba-Opon D 2015. Placental pathologic changes in gestational diabetes mellitus. NeuroEndocrinology Letters 36 101–105. [PubMed] [Google Scholar]
- Jonatan D, Spence JR, Method AM, Kofron M, Sinagoga K, Haataja L, Arvan P, Deutsch GH & Wells JM 2014. Sox17 regulates insulin secretion in the normal and pathologic mouse beta cell. PLoS ONE 9 e104575. ( 10.1371/journal.pone.0104675) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ladyman SR, MacLeod MA, Khant Aung Z, Knowles P, Phillipps HR, Brown RSE & Grattan DR 2017. Prolactin receptors in Rip-cre cells, but not in AgRP neurons, are involved in energy homeostasis. Journal of Neuroendocrinology 29 e12474. ( 10.1111/jne.12474) [DOI] [PubMed] [Google Scholar]
- Le TN, Elsea SH, Romero R, Chaiworapongsa T & Francis GL 2013. Prolactin gene polymorphisms are associated with gestational diabetes. Genetic Testing and Molecular Biomarkers 17 567–571. ( 10.1089/gtmb.2013.0009) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee JY, Ristow M, Lin X, White MF, Magnuson MA & Hennighausen L 2006. RIP-Cre revisited, evidence for impairments of pancreatic beta-cell function. Journal of Biological Chemistry 281 2649–2653. ( 10.1074/jbc.M512373200) [DOI] [PubMed] [Google Scholar]
- Miller CP, McGehee RE Jr & Habener JF 1994. IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO Journal 13 1145–1156. ( 10.1002/j.1460-2075.1994.tb06363.x) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miura A, Yamagata K, Kakei M, Hatakeyama H, Takahashi N, Fukui K, Nammo T, Yoneda K, Inoue Y, Sladek FM, et al. 2006. Hepatocyte nuclear factor-4 alpha is essential for glucose-stimulated insulin secretion by pancreatic beta-cells. Journal of Biological Chemistry 281 5246–5257. ( 10.1074/jbc.M507496200) [DOI] [PubMed] [Google Scholar]
- Muzumdar MD, Tasic B, Miyamichi K, Li L & Luo L 2007. A global double-fluorescent Cre reporter mouse. Genesis 45 593–605. ( 10.1002/dvg.20335) [DOI] [PubMed] [Google Scholar]
- Nagano M & Kelly PA 1994. Tissue distribution and regulation of rat prolactin receptor gene expression. Quantitative analysis by polymerase chain reaction. Journal of Biological Chemistry 269 13337–13345. [PubMed] [Google Scholar]
- Newbern D & Freemark M 2011. Placental hormones and the control of maternal metabolism and fetal growth. Current Opinion in Endocrinology, Diabetes, and Obesity 18 409–416. ( 10.1097/MED.0b013e32834c800d) [DOI] [PubMed] [Google Scholar]
- Ohlsson H, Karlsson K & Edlund T 1993. IPF1, a homeodomain-containing transactivator of the insulin gene. EMBO Journal 12 4251–4259. ( 10.1002/j.1460-2075.1993.tb06109.x) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Parsons JA, Brelje TC & Sorenson RL 1992. Adaptation of islets of Langerhans to pregnancy: increased islet cell proliferation and insulin secretion correlates with the onset of placental lactogen secretion. Endocrinology 130 1459–1466. ( 10.1210/endo.130.3.1537300) [DOI] [PubMed] [Google Scholar]
- Pearson ER, Boj SF, Steele AM, Barrett T, Stals K, Shield JP, Ellard S, Ferrer J & Hattersley AT 2007. Macrosomia and hyperinsulinaemic hypoglycaemia in patients with heterozygous mutations in the HNF4A gene. PLoS Medicine 4 e118. ( 10.1371/journal.pmed.0040118) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Retnakaran R, Ye C, Kramer CK, Connelly PW, Hanley AJ, Sermer M & Zinman B 2016. Maternal serum prolactin and prediction of postpartum β-cell function and risk of prediabetes/diabetes. Diabetes Care 39 1250–1258. ( 10.2337/dc16-0043) [DOI] [PubMed] [Google Scholar]
- Rieck S & Kaestner KH 2010. Expansion of beta-cell mass in response to pregnancy. Trends in Endocrinology and Metabolism 21 151–158. ( 10.1016/j.tem.2009.11.001) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rukstalis JM & Habner JF 2009. Neurogenin3: a master regulator of pancreatic islet differentiation and regeneration. Islets 1 177–184. ( 10.4161/isl.1.3.9877) [DOI] [PubMed] [Google Scholar]
- Sheets TP, Park KE, Park CH, Swift SM, Powell A, Donovan DM & Telugu BP 2018. Targeted mutation of Ngn3 gene disrupts pancreatic endocrine cell development in pigs. Scientific Reports 8 3582. ( 10.1038/s41598-018-22050-0) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Snyder CS, Harrington AR, Kaushal S, Mose E, Lowy AM, Hoffman RM & Bouvet M 2013. A dual color, genetically engineered mouse model for multi-spectral imaging of the pancreatic microenvironment. Pancreas 42 952–958. ( 10.1097/MPA.0b013e31828643df) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Soares MJ 2004. The prolactin and growth hormone families: pregnancy-specific hormones/cytokines at the maternal-fetal interface. Reproductive Biology and Endocrinology 2 51. ( 10.1186/1477-7827-2-51) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Soares MJ, Konno T & Alam SMK 2007. The prolactin family: effectors of pregnancy-dependent adaptations. Trends in Endocrinology and Metabolism 18 114–121. ( 10.1016/j.tem.2007.02.005) [DOI] [PubMed] [Google Scholar]
- Sorenson RL & Brelje TC 2009. Prolactin receptors are critical to the adaptation of islets to pregnancy. Endocrinology 150 1566–1569. ( 10.1210/en.2008-1710) [DOI] [PubMed] [Google Scholar]
- Søstrup B, Gaarn LW, Nalla A, Billestrup N & Nielsen JH 2014. Co-ordinated regulation of neurogenin-3 expression in the maternal and fetal pancreas during pregnancy. Acta Obstetricia et Gynecologica Scandinavica 93 1190–1197. ( 10.1111/aogs.12495) [DOI] [PubMed] [Google Scholar]
- Spence JR, Lange AW, Lin SC, Kaestner KH, Lowy AM, Kim I, Whitsett JA & Wells JM 2009. Sox17 regulates organ lineage segregation of ventral foregut progenitor cells. Developmental Cell 17 62–74. ( 10.1016/j.devcel.2009.05.012) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stoffel M & Duncan SA 1997. The maturity-onset diabetes of the young (MODY1) transcription factor HNF4 alpha regulates expression of genes required for glucose transport and metabolism. PNAS 94 13209–13214. ( 10.1073/pnas.94.24.13209) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vambergue A & Fajardy I 2011. Consequences of gestational and pregestational diabetes on placental function and birth weight. World Journal of Diabetes 2 196–203. ( 10.4239/wjd.v2.i11.196) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vasvada RC, Garcia-Ocana A, Zawalich WS, Sorenson RL, Dann P, Syed M, Ogren L, Talamantes F & Stewart AF 2000. Targeted expression of placental lactogen in the beta cells of transgenic mice results in beta cell proliferation, islet mass augmentation, and hypoglycemia. Journal of Biological Chemistry 275 15399–15406. ( 10.1074/jbc.275.20.15399) [DOI] [PubMed] [Google Scholar]
- Wang S, Jensen JN, Seymour PA, Hsu W, Dor Y, Sander M, Magnuson MA, Serup P & Gu G 2009. Sustained Neuorg3 expression in hormone-expressing islet cells is required for endocrine maturation and function. PNAS 106 9715–9720. ( 10.1073/pnas.0904247106) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wicksteed B, Brissova M, Yan W, Opland DM, Plank JL, Reinert RB, Dickson LM, Tamarina NA, Philipson LH, Shostak A, et al. 2010. Conditional gene targeting in mouse pancreatic β-cells: analysis of ectopic cre transgene expression in the brain. Diabetes 59 3090–3098. ( 10.2337/db10-0624) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yamagata K, Furuta H, Oda N, Kaisaki PJ, Menzel S, Cox NJ, Fajans SS, Signorini S, Stoffel M & Bell GI 1996. Mutations in the hepatocyte nuclear factor-4 alpha gene in maturity-onset diabetes of the young (MODY1). Nature 384 458–460. ( 10.1038/384458a0) [DOI] [PubMed] [Google Scholar]
- Zhang C, Moriguchi T, Kajihara M, Esaki R, Harada A, Shimohata H, Oishi H, Hamada M, Morito N, Hasegawa K, et al. 2005. MafA is a key regulator of glucose-stimulated insulin secretion. Molecular and Cellular Biology 25 4969–4976. ( 10.1128/MCB.25.12.4969-4976.2005) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang H, Zhang J, Pope CF, Crawford LA, Vasavada RC, Jagasia SM & Gannon M 2010. Gestational diabetes mellitus resulting from impaired β-cell compensation in the absence of Foxm1, a novel downstream effector of placental lactogen . Diabetes 59 143–152. ( 10.2337/db09-0050) [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu Y & Zhang C 2016. Prevalence of gestational diabetes and risk of progression to type 2 diabetes: a global perspective. Current_Diabetes_Reports 16 7. ( 10.1007/s11892-015-0699-x) [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.





