Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2020 Apr 30;15(4):e0232357. doi: 10.1371/journal.pone.0232357

Hypoxia-related long noncoding RNAs are associated with varicocele-related male infertility

Nafiseh Sanei Ata-abadi 1, Seyed Javad Mowla 1,*, Fatemeh Aboutalebi 2, Kianoush Dormiani 2, Abbas Kiani-Esfahani 3, Marziyeh Tavalaee 4, Mohammad Hossein Nasr-Esfahani 4,5,*
Editor: Joël R Drevet6
PMCID: PMC7192471  PMID: 32353040

Abstract

One of the main molecular causes that contributes to varicocele-related male infertility is excess production of reactive oxygen species (ROS). It is believed that hypoxia is an important stimulator of ROS in this condition. Recently, the significant roles of long non-coding RNAs (lncRNAs) in hypoxia response have emerged. Despite the investigation of hypoxia, there is scant information about the role of hypoxia-responding lncRNAs in varicocele-related male infertility. In the present study, we deduced eight hypoxia-responding lncRNAs based on high-throughput RNA sequencing data from two Gene Expression Omnibus (GEO) datasets. We used qRT-PCR to assess the expression levels of some of these lncRNAs in 42 ejaculated spermatozoa samples from 25 infertile men with varicocele and 17 fertile men as controls. We identified significant increases in expression levels of hypoxia-related lncRNAs, MIR210HG and MLLT4-AS1 in ejaculated spermatozoa of infertile men with varicocele. These lncRNAs also showed significant positive correlations with ROS levels and meaningful negative correlations with sperm parameters (count and motility). Besides, in silico studies identified several hypoxia response elements (HREs) within selected lncRNAs promoters. Delineation of hypoxia-related lncRNAs in varicocele-related infertility provides a valuable insight into male infertility.

Introduction

Varicocele is defined as abnormal tortuosity, dilatation, and elongation of the pampiniform plexus veins in spermatic cord. Approximately 40% of infertile men are diagnosed with varicocele; thus, it is a leading cause of male infertility [1]. Varicocele is responsible for about 19%–41% of primary male infertility and approximately 80% of secondary male infertility. Oxidative stress, hypoxia, heat stress, back flow of metabolites, and hormonal disturbances are possible etiologies for varicocele mediated male infertility. However, the exact mechanism of varicocele related male infertility has not been elucidated [2]. Therefore, identification of biological markers related to this issue is crucial.

Recently, long non-coding RNAs (lncRNAs), which are non-protein coding RNAs above 200 nucleotides in length, are postulated to be ideal diagnostic biomarkers and therapeutic targets that serve important regulatory functions in many biological processes [3]. LncRNAs in human sperm were initially characterized by Sendler et al., who used RNA sequencing technique [4]. Although there are many lncRNAs in human sperm, their expressions and roles in varicocele-related male infertility remain to be determined [5]. Recently, Zhao et al., assessed the expression level and function of an oxidative stress-related lncRNA, named growth arrested DNA-damage inducible gene 7 (GADD7), in spermatozoa of individuals with varicocele. They demonstrated that this lncRNA markedly up-regulated in the varicocele group compared to the healthy control group. Furthermore, they indicated that GADD7 overexpression suppressed cell proliferation and induced apoptotic cell death in mouse spermatocyte-derived cell lines, GC-1 and GC-2. They believed that regulation of cell proliferation and apoptosis by this lncRNA resulted in reduction of sperm counts in individuals with varicocele [6].

Hypoxia is one of the most important mediators of varicocele-related male infertility. A wealth of independent studies have reported adverse effects of hypoxia on male infertility and its relationship with sperm count and motility. Emerging data suggest that intracellular hypoxia is the main source of oxidative stress in varicocele [7–10]. The main mediator of hypoxia is a family of transcription factors known as hypoxia inducible factors (HIFs). HIF is a heterodimer composed of two subunits, HIF-1α and HIF-1β. Under hypoxic conditions, this transcription factor regulates the expression of several hypoxic response genes [11]. In varicocele, hypoxia leads to an elevation in HIF-1α expression and subsequently vascular endothelial growth factor (VEGF), which ultimately regulates cellular response to hypoxia [12, 13]. The pivotal roles of lncRNAs in hypoxia-driven diseases have been recognized. LncRNAs respond to hypoxia via HIF-mediated direct or indirect interactions and are involved in regulation of hypoxic gene expression at the genomic, transcriptional, and post-transcriptional levels. In HIF-mediated direct regulation, lncRNA transcription is directly regulated by HIF through hypoxia response elements (HREs) within their promoters. Transcriptional activation of HOTAIR, MALAT1, H19, ANRIL, and NEAT1 are mediated through HRE under hypoxic conditions. Indirect transactivation of lncRNAs seems to be attained through HIF-1α mediated epigenetic mechanisms [14].

In the present study, we used previous high-throughput RNA sequencing data from the Gene Expression Omnibus (GEO) dataset to identify a set of lncRNAs that participate in the hypoxia response. Real-time qPCR analysis showed that some of these lncRNAs had significantly increased expression in ejaculated spermatozoa from infertile men with varicocele compared with spermatozoa from fertile men. We conducted an in silico study to predict the presence of HRE within their regulatory sequences. To the best of our knowledge, this is the first report that investigated hypoxia modulated lncRNAs in varicocele-related male infertility. Our finding may unveil novel diagnostic biomarkers and/or therapeutic targets for male infertility.

Materials and methods

Patients

This case-control study included of 25 individuals with grade II or III varicocele who referred to the Isfahan Fertility and Infertility Center (IFIC), Isfahan, Iran for infertility treatment and 17 healthy donors with normal semen parameters and no clinical presentation of varicocele who referred to the IFIC for family balancing. We excluded men with leucocytospermia, azoospermia, seminal sperm antibodies, testicular size discrepancy, fever within 90 days prior to seminal analysis, cancer, abnormal hormonal profiles, recurrent varicocele, grade I varicocele, urogenital infections, previous history of scrotal trauma or surgery, drug consumption, excessive alcohol, or occupational exposure. Informed written consents were obtained from all participants. The present study received the approval of the Institutional Review Board of Royan Institute (ID. No. IR.ACER.ROYAN.REC.1397.272).

Semen samples

Semen samples were collected after 3–5 days of sexual abstinence and allowed to liquefy at room temperature for 30 min. Semen analysis was performed on one portion of the samples according to World Health Organization [15] criteria for assessment of sperm concentration, morphology, motility and vitality. The remainder of the semen samples were washed twice in phosphate buffer saline (PBS; pH 7.4) and used for RNA extraction.

Assessment of reactive oxygen species (ROS) production using DCFH-DA probe

We assessed the ROS levels of the spermatozoa samples with a cell-permeable stain, 2', 7'-dichlorodihydrofluorescein diacetate (DCFH-DA; Sigma-Aldrich, MO, USA). DCFH-DA was added to the sperm suspension (1 × 106 sperm ml−1 in PBS) at a concentration of 0.5 μM, incubated at 37°C for 30 min and analyzed by a fluorescence detector-1 (FL-1) with a 530/30 nm band pass filter in a FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA, USA). CellQuest Pro and WinMDI 2.9 software were used for data analysis. Every test sample was normalized against an unstained control sample. Data were expressed as the percentage of fluorescent positive spermatozoa.

Long non-coding RNA (lncRNA) selection

Whole transcriptome RNA-sequencing data were retrieved from the GEO datasets, GSE76743 (Platform: GPL11154; Illumina HiSeq 2000) [16] and GSE70544 (Platform: GPL11154; Illumina HiSeq 2000) [17], to identify differentially expressed lncRNAs (DE lncRNAs) that respond to hypoxia in two different cell types including human umbilical vein endothelial cells (HUVECs) and human proximal tubular epithelial cells (PTECs), respectively. The processed data of each dataset was used to identify DE lncRNAs between hypoxia-treated samples and their controls with a p-value < 0.05. The overlapping DE lncRNAs between two datasets were determined using the Visual Basic for Applications (VBA) programming language.

RNA extraction and cDNA synthesis

Total RNA was isolated from sperm pellets using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s supplied instructions. The quality of extracted RNA was evaluated by agarose electrophoresis and its quantity determined by measuring absorbance at 260 nm using a NanoDrop spectrophotometer (Nanodrop 1000, Thermo Scientific, USA). Total RNA was treated with RNase-free DNaseI (Thermo Scientific, USA).Synthesis of first strand cDNA was performed using a PrimeScript II 1st Strand cDNA Synthesis Kit (TaKaRa, Japan).

Real-time qPCR

For real-time qPCR, cDNA templates were mixed with SYBR Premix Ex TaqII (TaKaRa, Japan) in a final volume of 10 μl. All reactions were carried out in triplicate using specific primers. The PCR experiment was performed during three steps with an initial denaturation at 95°C for 30 s and 40 cycles that consisted of a denaturation step at 95°C for 5 s, an annealing step at specific annealing temperature for 10 s, and an extension step for 30 s at 72°C. A Step One Plus Real-Time PCR thermal cycler (Applied Biosystems, USA) was utilized for performing real-time qPCR.

Real time specific primers for each of the lncRNAs were designed using Beacon designer 8.13 (Premier Biosoft, USA) and rechecked with Oligo 7.56 software (Molecular Biology Insights, USA) for secondary structures and target specificity. Designed primers are listed in Table 1. The expression levels of the lncRNAs were normalized by expression of the housekeeping gene, GAPDH. Relative expression was calculated using the ΔΔCt method [18, 19].

Table 1. Primer pairs used in this study.

Primer Sequence (5ˊ-3ˊ) Tm (˚C) GC%
F-MIR210HG GGACCTGCACCTGAGAAAG 55 57.9
R-MIR210HG CACAGTAAGTCGCCGTC 54 58.8
F-MLLT4-AS1 TTCACTGAACCTCAACTG 52 44.4
R-MLLT4-AS1 TGCAAACTCATTCTTCAAGAG 51 38.1
F-RP11-540A21.2 CCCACCCTCACTTCTAAATC 56 50
R-RP11-540A21.2 CTGAATCTCACGGACATCTTG 56 47.6
F-GAPDH CCACTCCTCCACCTTTGACG 60 60
R-GAPDH CCACCACCCTGTTGCTGTAG 62 60
Open in a new tab

F, forward primer; R, reverse primer; Tm, melting temperature.

In silico analysis of hypoxia responsive elements (HREs)

We used the Genomatix MatInspector database (http://www.genomatix.de) [20] to test the existence of putative HREs in the predicted promoter of selected hypoxia-related lncRNAs. MatInspector is a software tool that utilizes a large library of matrix descriptions for transcription factor binding sites to scans nucleotide sequences for matches. To achieve this end, MatInspector calculates a “matrix similarity score” which reaches 1 only if matches occur completely. Usually, a matrix similarity of 0.85 will imply a good match for most trials. Optimized length of promoters in this database is nearly 1,000 bp upstream of the first transcription start site (TSS) and 100 bp downstream of the last TSS [20]. Prediction of putative HREs in our study, was carried out with a matrix similarity of 0.85.

Statistical analysis

Data normality was evaluated using the Kolmogorov-Smirnov Z test. A standard two-tailed student’s t-test was used to compare the mean expression levels of our reference and target genes between the varicocele and control groups. Pearson’s coefficient was used for correlation assay in this study. The aforementioned statistical analyses were carried out using Graph Pad Prism (v6; GraphPad software) and SPSS 20 software (SPSS, Chicago, IL, USA). For all analyses, p-values less than 0.05 were considered to be statistically significant.

Results

Semen analysis

Table 2 lists the results of semen analyses of the varicocele and fertile groups. No differences were noted in the mean age and volume between two groups. The mean sperm count and percentage of sperm motility both significantly decreased. There was a significant increase in the percentage of abnormal sperm morphology in infertile men with varicocele compared to fertile men, which indicated impaired spermatogenesis in the varicocele group.

Table 2. Descriptive of semen parameters.

Parameters Healthy control (n = 17) Varicocele (n = 25) P-value
Age (years) 35.12 ± 1.286 32.80 ± 0.7874 0.1117
Volume (ml) 3.924 ± 0.3088 3.528 ± 0.2616 0.3368
Concentration (106/ml) 90.88 ± 6.741 40.16 ± 4.123 <0.0001
Motility (%) 60.00 ± 1.917 41.76 ± 2.650 <0.0001
Abnormal morphology (%) 96.24 ± 0.2353 97.40 ± 0.2582 0.0030
Open in a new tab

Reactive oxygen species (ROS) assessment

ROS levels were assessed in sperm of varicocele and fertile individuals using DCFH-DA staining. There was a significant elevation in the percentage of DCF positive sperm in infertile men with varicocele compared to fertile men, which indicated a high level of oxidative stress in the varicocele state (Fig 1A). We assessed the correlation between ROS levels with semen parameters. As indicated in Fig 1B and 1C, there were significant negative correlations between ROS levels with sperm count and motility.

Fig 1. Determination of reactive oxygen species (ROS) levels in the varicocele and control groups and its relationship with sperm count and motility.

Fig 1

Open in a new tab

(A) Reactive oxygen species (ROS) levels in the varicocele and control groups assessed by DCF-DA staining (****P<0.0001 using the unpaired t-test). ROS levels had a negative correlation with sperm count (B) and motility (C). Pearson’s coefficient was used for correlation assay.

Putative long non-coding RNAs (lncRNAs) associated with hypoxia

Since hypoxia is one of the inducers of ROS and a potential mechanism in varicocele-related male infertility, we hypothesized that the lncRNAs stimulated by hypoxia may have a relationship with varicocele. Therefore, we sought to identify if any of the lncRNAs related with hypoxia are also involved in varicocele-related male infertility. So we selected two GEO datasets, (GSE70544 and GSE76743) that have been identified hypoxia-related lncRNAs in the response to hypoxia induction in two different cell types; one of them (GSE76743) in HUVECs and the other (GSE70544) in PTECs. Then, we compared the results of two GEO datasets, (GSE70544 and GSE76743) and identified 18 lncRNAs that responded to hypoxia in both studies (S1–S3 Tables, Fig 2). These overlapping lncRNAs could potentially respond to hypoxia in other cell types such as testicular cells. We noted that 8 out of 18 lncRNAs showed one orientation, so that their expressions either concurrently increased or decreased following induction of hypoxia. LncRNAs MIR210HG, MLLT4-AS1, RP11-540A21.2, TPT1-AS1, and ADAMTS9-AS2 were up-regulated, whereas RP11-498C9.15, LINC00641, and RP11-84C13.1 were down-regulated. Finally, we selected three lncRNAs—MIR210HG (ENSG00000247095), MLLT4-AS1 (ENSG00000198221, AFDN-AS1), and RP11-540A21.2 (ENSG00000245522, LOC440028) for further analysis.

Fig 2. Heat maps of overlapping differentially expressed long non-coding RNA (lncRNA) responding to hypoxia in two Gene Expression Omnibus (GEO) datasets.

Fig 2

Open in a new tab

Significant differences in expression levels of hypoxia-responding long non-coding RNAs (lncRNAs) in infertile men with varicocele

In order to confirm the differential expression of hypoxia responding lncRNAs in varicocele, we evaluated the expression levels of three selected lncRNAs in spermatozoa of 26 infertile men with varicocele and 17 controls.

Real-time qPCR data analysis showed significant elevations in MIR210HG (P = 0.0307) and MLLT4-AS1 (P = 0.0061) expressions in sperm of infertile men with varicocele compared to the control group. RP11-540A21.2 was also up-regulated in varicocele patients; however, this up-regulation was not significant for our samples (P = 0.4111; Fig 3).

Fig 3. Long non-coding RNA (lncRNA) expressions in the varicocele and control groups.

Fig 3

Open in a new tab

Boxplots of the expression levels of lncRNAs MIR210HG, MLLT4-AS1, and RP11-540A21.2 in the ejaculated spermatozoa from the varicocele group compared to the control groups (P = 0.0307 for MIR210HG; P = 0.0061 for MLLT4-AS1; P = 0.4111 for RP11-540A21.2; two-tailed sample t-test; ns: not significant). Levels of expression were normalized relative to GAPDH.

Expression levels of hypoxia responding long non-coding RNAs (lncRNAs) showed significant correlations with reactive oxygen species (ROS) levels and sperm parameters

In order to confirm that the selected lncRNAs specifically participated in varicocele-related male infertility, we examined the correlation of their expression levels with sperm parameters and ROS levels. As expected, MIR210HG and MLLT4-AS1, but not RP11-540A21.2, showed meaningful negative correlations with sperm count and motility (Fig 4A and 4B) and positive correlations with ROS levels in our spermatozoa samples (Fig 4C).

Fig 4. Correlation analysis between the expression levels of long non-coding RNAs (lncRNAs) with sperm parameters and reactive oxygen species (ROS) levels.

Fig 4

Open in a new tab

(A) There are meaningful negative correlations between the expression levels of MIR210HG and MLLT4-AS1 with sperm count. (B) Expression levels of MIR210HG and MLLT4-AS1, but not RP11-540A21.2, show a significant negative correlation with sperm motility. (C) Significant positive correlation exist between the expression levels of MIR210HG and MLLT4-AS1, but not RP11-540A21.2, with reactive oxygen species (ROS) levels. Pearson’s coefficient correlation was used for correlation analysis.

Presence of hypoxia response elements (HRE) in the predicted promoters of hypoxic long non-coding RNAs (lncRNAs)

We scanned the area 1 kb upstream of the transcription start site of the hypoxia-related lncRNAs MIR210HG, MLLT4-AS1, and RP11-540A21.2 using the Genomatix MatInspector database for matches to HIF-1α binding matrices. This analysis revealed that one or more HREs were located in the predicted promoters of MIR210HG, MLLT4-AS1 (AFDN-AS1), and RP11-540A21.2 (LOC440028) (Fig 5). These data suggested a possibly direct regulation of these predicted hypoxia responding lncRNAs by the HIF-1 pathway.

Fig 5. Presence of hypoxia response elements (HREs) in the predicted promoters of long non-coding RNAs (lncRNAs).

Fig 5

Open in a new tab

All three lncRNAs harbored the hypoxia response elements (HRE) within their promoters that identified by the Genomatix MatInspector database. Genomatix optimized length for the promoters is nearly 1,000 bp upstream of the first TSS and 100 bp downstream of the last TSS. Green boxes indicated HREs in the predicted promoter sequences on both orientations (“+” or upper strand or 5'—>3՛; “–” or lower strand or 3'—>5՛). Black arrows represented transcription start sites (TSS). Three TSS on the MLLT4-AS1 (AFDN-AS1) promoter indicated three alternative transcripts identified by Genomatix MatInspector database.

Discussion

It is well accepted that varicocele can lead to impaired spermatogenesis and it is one of the most important cause of male infertility via induction of hyperthermia, oxidative stress, and hypoxia. There have been extensive efforts in identifying mechanisms of varicocele-related male infertility. However the exact molecular pathological process remains to be elucidated. Growing evidences indicate that lncRNAs are involved in regulation of hypoxia responses, one of the elements that contribute to varicocele-related male infertility [12–14].

In the present study, we sought to identify hypoxia response lncRNAs by reanalyzing two separate high throughput studies from GEO datasets (GSE70544 and GSE76743) [16, 17]. The results showed that several shared lncRNAs significantly responded to hypoxia in one orientation with simultaneous up-regulation or down-regulation. Finally, we selected three hypoxia-related lncRNAs (MIR210HG, MLLT4-AS1, and RP11-540A21.2) for experimental validation by real-time qPCR in spermatozoa of infertile men with varicocele and fertile men. Among these three lncRNAs, MIR210HG and MLLT4-AS1 significantly up-regulated in spermatozoa of infertile men with varicocele compared to spermatozoa from the normal fertile group. However RP11-540A21.2 expression did not show any significant difference between these two groups. The insignificant expression level of RP11-540A21.2 could be due to the higher expression variation of this lncRNA relative to others in spermatozoa, which might be solved with a larger sample size.

Interestingly, the relative expression levels of MIR210HG and MLLT4-AS1 had a positive correlation with ROS level, which showed potential role of hypoxia-related lncRNAs during high levels of ROS production in infertile men with varicocele. Moreover, the significant negative correlations of MIR210HG and MLLT4-AS1 with sperm count and motility reflected the relationship of these lncRNAs with sperm impairment in varicocele-related male infertility.

The transcription factor HIF-1, as a master regulator of O2 homeostasis, has an important role in regulation of hypoxia response genes. The HIF-1 binding sites across these selected lncRNAs were recognized using the Genomatix MatInspector database. Remarkably, for all three selected lncRNAs (MIR210HG, MLLT4-AS1, and RP11-540A21.2), HIF-1 occupancy was found within their predicted promoters. These results showed that HIF-1 might directly regulate transcription of these lncRNAs through HREs within their promoters.

As mature spermatozoa is considered to be transcriptionally silent, the RNA content of mature spermatozoa could be the residue of RNAs transcript during spermatogenesis. The confirmation of this claim is the fact that mRNAs seen in spermatozoa exist in human testis, too [21]. Therefore, potentially transcription elevation of selected lncRNAs through HIF-1 occurs in spermatogenesis stages in testis of infertile men with varicocele in response to hypoxia. However, further studies are needed to approve this hypothesis.

MIR210HG is the host gene of miR-210, a well-known hypoxia microRNA, induced by HIF-1α [17]. MIR210HG was validated in hypoxic HUVECs and human PTECs as hypoxia responding lncRNAs [16, 17]. In addition, this lncRNA is a proposed potential tumor biomarker for glioma [22], colorectal adenocarcinoma [23], osteosarcoma [24], and pancreatic cancer [25]. In the present study, we reported that MIR210HG can be a potential biomarker of varicocele-related male infertility.

MLLT4-AS1 was found to be down-regulated in gastric cancer and its lower expression was reported to be associated with advanced Tumor-Node-Metastasis stage and lymph node metastasis in this cancer [26]. MLLT4-AS1 was reported to be one of the top DE lncRNAs that expresses between the oral cavity and oropharyngeal squamous cell carcinoma (OSCC) tissues and healthy oral mucosa [27]. While a relationship between MIR210HG and hypoxia has been determined in previous studies [16, 17], this paper is the first study that revealed a relationship between MLLT4-AS1and hypoxia.

Although the role of RP11-540A21.2 is poorly understood, a handful of studies evaluated its expression and showed that it had a significant relationship with human head and neck squamous cell carcinoma [28] and primary aldosteronism [29]. In this study, the expression level of RP11-540A21.2 was elevated, but not statistically significant, between the varicocele and control groups.

In conclusion, we observed an association between the expression levels of hypoxia responding lncRNAs with varicocele-related male infertility and showed their expression levels have a significant correlation with ROS levels in this condition. Our study might help to improve our understanding of the mechanisms in varicocele-related male infertility and provide diagnostic biomarkers and therapeutics targets.

Supporting information

S1 Table. Differentially expressed long non-coding RNAs (DE lncRNAs) that responded to hypoxia in human umbilical vein endothelial cells (HUVECs) retrieved from the GSE76743 dataset.

(XLSX)

Click here for additional data file. (283.3KB, xlsx)
S2 Table. Differentially expressed (DE) protein coding transcripts and long non-coding RNAs (lncRNAs) that responded to hypoxia in proximal tubular epithelial cells (PTECs) retrieved from the GSE70544 dataset.

(XLSM)

Click here for additional data file. (132.4KB, xlsm)
S3 Table. Overlapping differentially expressed long non-coding RNAs (DE lncRNAs) between the GSE76743 and GSE70544 datasets.

The ensemble ID, chromosomal location, fold changes and P-values were presented for selected long non-coding RNAs (lncRNAs).

(XLSM)

Click here for additional data file. (10KB, xlsm)

Acknowledgments

We thank all sample donors and staff of the Isfahan Fertility and Infertility Center. We also thank our colleagues at Royan Institute in Isfahan, Iran.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study was partially funded by grants from Tarbiat Modares University and Royan Institute (Grant no. 96000239) in support of NSA for obtaining his PhD degree from Tarbiat Modares University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. In addition, the Isfahan Fertility and Infertility Center only helps for obtaining semen samples and had no finical contribution to this study. This center, did not play a role in the study design, data collection and analysis, decision to publish or preparation of the manuscript.

References

  • 1.Wang Y-J, Zhang R-Q, Lin Y-J, Zhang R-G, Zhang W-L. Relationship between varicocele and sperm DNA damage and the effect of varicocele repair: a meta-analysis. Reprod Biomed Online. 2012;25: 307–14. 10.1016/j.rbmo.2012.05.002 [DOI] [PubMed] [Google Scholar]
  • 2.Agarwal A, Hamada A, Esteves SC. Insight into oxidative stress in varicocele-associated male infertility: part 1. Nat Rev Urol. 2012;9: 678 10.1038/nrurol.2012.197 [DOI] [PubMed] [Google Scholar]
  • 3.Cabili MN, Trapnell C, Goff L, Koziol M, Tazon-Vega B, Regev A, et al. Integrative annotation of human large intergenic noncoding RNAs reveals global properties and specific subclasses. Genes Dev. 2011;25: 1915–27. 10.1101/gad.17446611 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sendler E, Johnson GD, Mao S, Goodrich RJ, Diamond MP, Hauser R, et al. Stability, delivery and functions of human sperm RNAs at fertilization. Nucleic Acids Res. 2013;41: 4104–17. 10.1093/nar/gkt132 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Luk AC-S, Chan W-Y, Rennert OM, Lee T-L. Long noncoding RNAs in spermatogenesis: insights from recent high-throughput transcriptome studies. Reproduction. 2014;147: R131–R41. 10.1530/REP-13-0594 [DOI] [PubMed] [Google Scholar]
  • 6.Zhao J, Li H, Deng H, Zhu L, Zhou B, Yang M, et al. LncRNA gadd7, increased in varicocele patients, suppresses cell proliferation and promotes cell apoptosis. Oncotarget. 2018;9: 5105 10.18632/oncotarget.23696 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Ghandehari‐Alavijeh R, Tavalaee M, Zohrabi D, Foroozan‐Broojeni S, Abbasi H, Nasr‐Esfahani MH. Hypoxia pathway has more impact than inflammation pathway on etiology of infertile men with varicocele. Andrologia. 2019;51: e13189 10.1111/and.13189 [DOI] [PubMed] [Google Scholar]
  • 8.Esfahani MHN, Tavalaee M. Origin and role of DNA damage in varicocele. Int J Fertil Steril. 2012;6: 141 [PMC free article] [PubMed] [Google Scholar]
  • 9.Verratti V, Berardinelli F, Di Giulio C, Bosco G, Cacchio M, Pellicciotta M, et al. Evidence that chronic hypoxia causes reversible impairment on male fertility. Asian J Androl. 2008;10: 602–6. 10.1111/j.1745-7262.2008.00346.x [DOI] [PubMed] [Google Scholar]
  • 10.Reyes JG, Farias JG, Henríquez-Olavarrieta S, Madrid E, Parraga M, Zepeda AB, et al. The hypoxic testicle: physiology and pathophysiology. Oxid Med Cell Longev. 2012;2012: 929285 10.1155/2012/929285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Semenza GL. Hypoxia-inducible factor 1: control of oxygen homeostasis in health and disease. Pediatr. 2001;49: 614. [DOI] [PubMed] [Google Scholar]
  • 12.Kilinc F, Kayaselçuk F, Aygun C, Guvel S, Egilmez T, Ozkardes H. Experimental varicocele induces hypoxia inducible factor-1α, vascular endothelial growth factor expression and angiogenesis in the rat testis. J Urol. 2004;172: 1188–91. 10.1097/01.ju.0000135455.97627.15 [DOI] [PubMed] [Google Scholar]
  • 13.Paick J, Park K, Kim S, Park J, Kim J, Kim M, et al. Increased expression of hypoxia-inducible factor-1α and connective tissue growth factor accompanied by fibrosis in the rat testis of varicocele. Actas Urol Esp. 2012;36: 282–8. 10.1016/j.acuro.2011.07.022 [DOI] [PubMed] [Google Scholar]
  • 14.Shih J-W, Kung H-J. Long non-coding RNA and tumor hypoxia: new players ushered toward an old arena. J Biomed Sci. 2017;24: 53 10.1186/s12929-017-0358-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.World Health Organization. World Health Organization Laboratory Manual for the Examination and Processing of Human Semen, 5st ed, Cambridge: Cambridge University Press; 2010 [Google Scholar]
  • 16.Voellenkle C, Garcia-Manteiga JM, Pedrotti S, Perfetti A, De Toma I, Da Silva D, et al. Implication of long noncoding RNAs in the endothelial cell response to hypoxia revealed by RNA-sequencing. Sci Rep. 2016;6: 24141 10.1038/srep24141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lin J, Zhang X, Xue C, Zhang H, Shashaty MG, Gosai SJ, et al. The long noncoding RNA landscape in hypoxic and inflammatory renal epithelial injury. Am J Physiol Renal Physiol. 2015;309: F901–F13. 10.1152/ajprenal.00290.2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.UK.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods. 2001;25: 402–8. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 19.Vaerman J, Saussoy P, Ingargiola I. Evaluation of real-time PCR data. J Biol Regul Homeost Agents. 2004;18: 212–4. [PubMed] [Google Scholar]
  • 20.Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, et al. MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics. 2005;21: 2933–42. 10.1093/bioinformatics/bti473 [DOI] [PubMed] [Google Scholar]
  • 21.Bansal SK, Gupta N, Sankhwar SN, Rajender S. Differential genes expression between fertile and infertile spermatozoa revealed by transcriptome analysis. PLoS One. 2015;10: e0127007 10.1371/journal.pone.0127007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Min W, Dai D, Wang J, Zhang D, Zhang Y, Han G, et al. Long noncoding RNA miR210HG as a potential biomarker for the diagnosis of glioma. PLoS One. 2016;11: e0160451 10.1371/journal.pone.0160451 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.He Z, Dang J, Song A, Cui X, Ma Z, Zhang Z. Identification of LINC01234 and MIR210HG as novel prognostic signature for colorectal adenocarcinoma. J Cell Physiol. 2019;234: 6769–77. 10.1002/jcp.27424 [DOI] [PubMed] [Google Scholar]
  • 24.Li J, Wu Q-M, Wang X-Q, Zhang C-Q. Long noncoding RNA miR210HG sponges miR-503 to facilitate osteosarcoma cell invasion and metastasis. DNA Cell Biol. 2017;36: 1117–25. 10.1089/dna.2017.3888 [DOI] [PubMed] [Google Scholar]
  • 25.Li D, Qian X, Xu P, Wang X, Li Z, Qian J, et al. Identification of lncRNAs and their functional network associated with chemoresistance in SW1990/GZ pancreatic cancer cells by RNA sequencing. DNA Cell Biol. 2018;37: 839–49. 10.1089/dna.2018.4312 [DOI] [PubMed] [Google Scholar]
  • 26.Lai Y, Xu P, Liu J, Li Q, Ren D, Zhang J, et al. Decreased expression of the long non-coding RNA MLLT4 antisense RNA 1 is a potential biomarker and an indicator of a poor prognosis for gastric cancer. Oncol Lett. 2017;14: 2629–34. 10.3892/ol.2017.6478 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Feng L, Houck JR, Lohavanichbutr P, Chen C. Transcriptome analysis reveals differentially expressed lncRNAs between oral squamous cell carcinoma and healthy oral mucosa. Oncotarget. 2017;8: 31521 10.18632/oncotarget.16358 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nohata N, Abba MC, Gutkind JS. Unraveling the oral cancer lncRNAome: Identification of novel lncRNAs associated with malignant progression and HPV infection. Oral Oncol. 2016;59: 58–66. 10.1016/j.oraloncology.2016.05.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Chu C, Zhao C, Zhang Z, Wang M, Zhang Z, Yang A, et al. Transcriptome analysis of primary aldosteronism in adrenal glands and controls. Int J Clin Exp Pathol. 2017;10: 10009–10018. [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Differentially expressed long non-coding RNAs (DE lncRNAs) that responded to hypoxia in human umbilical vein endothelial cells (HUVECs) retrieved from the GSE76743 dataset.

(XLSX)

Click here for additional data file. (283.3KB, xlsx)
S2 Table. Differentially expressed (DE) protein coding transcripts and long non-coding RNAs (lncRNAs) that responded to hypoxia in proximal tubular epithelial cells (PTECs) retrieved from the GSE70544 dataset.

(XLSM)

Click here for additional data file. (132.4KB, xlsm)
S3 Table. Overlapping differentially expressed long non-coding RNAs (DE lncRNAs) between the GSE76743 and GSE70544 datasets.

The ensemble ID, chromosomal location, fold changes and P-values were presented for selected long non-coding RNAs (lncRNAs).

(XLSM)

Click here for additional data file. (10KB, xlsm)

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES