Abstract
Background & Aims
We aimed to identify biomarkers that might be used to predict responses of patients with inflammatory bowel diseases (IBD) to vedolizumab therapy.
Methods
We obtained biopsies from inflamed colon of patients with IBD who began treatment with vedolizumab (n = 31) or tumor necrosis factor (TNF) antagonists (n = 20) and performed RNA-sequencing analyses. We compared gene expression patterns between patients who did and did not enter endoscopic remission (absence of ulcerations at month 6 for patients with Crohn’s disease or Mayo endoscopic subscore ≤1 at week 14 for patients with ulcerative colitis) and performed pathway analysis and cell deconvolution for training (n = 20) and validation (n = 11) datasets. Colon biopsies were also analyzed by immunohistochemistry. We validated a baseline gene expression pattern associated with endoscopic remission after vedolizumab therapy using 3 independent datasets (n = 66).
Results
We identified significant differences in expression levels of 44 genes between patients who entered remission after vedolizumab and those who did not; we found significant increases in leukocyte migration in colon tissues from patients who did not enter remission (P < .006). Deconvolution methods identified a significant enrichment of monocytes (P = .005), M1-macrophages (P = .05), and CD4+ T cells (P = .008) in colon tissues from patients who did not enter remission, whereas colon tissues from patients in remission had higher numbers of naïve B cells before treatment (P = .05). Baseline expression levels of PIWIL1, MAATS1, RGS13, and DCHS2 identified patients who did vs did not enter remission with 80% accuracy in the training set and 100% accuracy in validation dataset 1. We validated these findings in the 3 independent datasets by microarray, RNA sequencing and quantitative PCR analysis (P = .003). Expression levels of these 4 genes did not associate with response to anti-TNF agents. We confirmed the presence of proteins encoded by mRNAs using immunohistochemistry.
Conclusions
We identified 4 genes whose baseline expression levels in colon tissues of patients with IBD associate with endoscopic remission after vedolizumab, but not anti-TNF, treatment. We validated this signature in 4 independent datasets and also at the protein level. Studies of these genes might provide insights into the mechanisms of action of vedolizumab.
Keywords: Vedolizumab, Personalised Medicine, Precision Medicine, Endoscopic Remisison, IBD
Abbreviations: AUC, area under the curve; CD, Crohn’s disease; cDNA, complementary DNA; FDR, false discovery rate; GO, Gene Ontology; IBD, inflammatory bowel disease; IEC, intraepithelial cell; IL, interleukin; LR, likelihood ratio; MAdCAM-1, mucosal vascular addressin cell adhesion molecule 1; qPCR, quantitative real-time polymerase chain reaction; TNF, tumor necrosis factor; UC, ulcerative colitis
What You Need to Know.
Background
We aimed to identify biomarkers that might be used to predict response of patients with inflammatory bowel diseases (IBD) to vedolizumab therapy.
Findings
In colon tissues from patients with IBD, we identified 4 genes whose baseline expression levels were associated with remission, based on endoscopic features, after vedolizumab but not anti–tumor necrosis factor treatment. We validated this signature in 4 independent datasets and also at the protein level. Studies of these genes might provide insights into the mechanisms of action of vedolizumab.
Implications for patient care
Analysis of this gene expression patterns in colon tissues of patients with IBD might be used to identify those most likely to respond to vedolizumab therapy.
The landscape of inflammatory bowel disease (IBD) treatment has extensively changed over the past decade, with the advent of anti–tumor necrosis factor (TNF) agents, antiadhesion molecules, and anti-interleukin (IL) 12/23 compounds inducing and maintaining clinical and endoscopic remission.1 Nevertheless, primary nonresponse and secondary loss of response compromise the efficacy of the current available therapies. Hence, novel therapies are eagerly awaited,2 as well as predictive biomarkers, which can improve the likelihood of successful treatment.
Biomarkers predicting response to anti-TNF therapy are slowly emerging3, 4, 5, 6, 7 but need further validation before translation into clinical practice. In contrast, vedolizumab-specific biomarkers are even more limited, with studies focusing only on prediction of clinical response.8,9 As targets in IBD are evolving from clinical to endoscopic remission,10 biomarker development should focus on the prediction of endoscopic remission.
Vedolizumab, a humanized monoclonal antibody targeting the α4β7 integrin, has proven to be a safe and efficacious drug to induce and maintain clinical remission in patients with Crohn’s disease (CD) and ulcerative colitis (UC).1 By disturbing the interaction between mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) on the intestinal endothelial cells and α4β7 integrin, expressed on a variety of circulating leukocytes, vedolizumab is primarily a gut-focused drug. Although it has always been considered to interfere mainly with lymphocyte trafficking to the gut, a detailed characterization of its immunological mode of action recently pointed primarily toward its influence on the innate, rather than on the adaptive immune system.11
To identify the most suitable patients for vedolizumab therapy, we here studied colonic transcriptomic data of IBD patients initiating vedolizumab, performed pathway analysis and deconvolution, and searched for predictive markers of vedolizumab-specific endoscopic remission.
Materials and Methods
Patient Selection
This prospective study was carried out at the University Hospitals Leuven (Leuven, Belgium). Independent validation cohorts were recruited in the same center as well as in the IBD unit of the Hospital Clínic (Barcelona, Spain). Endoscopy-derived inflamed colonic biopsies were obtained from consecutive IBD patients initiating biologic therapy (vedolizumab, adalimumab, or infliximab). All patients had endoscopically proven active disease, and they all had to be naïve for the drug that was initiated at inclusion. Patients received vedolizumab 300 mg at baseline and weeks 2–6, with subsequent administration every 8 weeks. All CD patients received an additional infusion at week 10. In case of anti-TNF therapy, patients received infliximab (CT-P13) 5 mg/kg at baseline and week 2–6, with subsequent administration every 8 weeks. Adalimumab was administered 160 mg subcutaneously at baseline and 80 mg subcutaneously at week 2, with 40 mg subcutaneously every other week thereafter. To reduce the risk of including treatment failures secondary to immunogenicity (and not drug mechanistic failure) or non–drug-related responders, all anti-TNF treated patients had to have a good drug exposure, defined as a maintenance trough level or >3.0 μg/mL for infliximab and >5.0 μg/mL for adalimumab. Due the lack of agreement on the targeted threshold for vedolizumab, if any, we did not include an exposure requirement in the definition of (non)response for vedolizumab.
All included Belgian patients had given written consent to participate in the Institutional Review Board approved IBD Biobank of University Hospitals Leuven, Belgium (B322201213950/S53684). All included Spanish patients had given written consent after approval of the study by the Ethics Committee of the University Hospital Clínic Barcelona, Spain (2012/7956).
Biopsy Collection
All biopsies were taken at the most affected site, at the edge of the ulcerative surface. Biopsies were taken during endoscopy before the start of therapy, stored in RNALater buffer (Ambion, Austin, TX) and preserved at –80°C. RNA was subsequently extracted and sequenced (see Supplementary Methods). Additional biopsies were immediately fixed in formalin for up to 5 hours and then dehydrated, cleared, and paraffin-embedded for histological examination and immunohistochemistry.
Endoscopic Outcomes
Outcome was assessed objectively through ileocolonoscopy at a fixed time point. In CD patients, endoscopic remission was evaluated after 6 months, and defined as a complete absence of ulcerations, whereas in UC it was defined as a Mayo endoscopic subscore ≤1. Due to national reimbursement criteria, all UC patients were endoscopically assessed at week 8 (adalimumab) or week 14 (infliximab and vedolizumab).
Quantitative Real-Time Polymerase Chain Reaction
Gene expression of selected markers in inflamed colonic biopsies was studied through quantitative real-time polymerase chain reaction (qPCR) analysis. Complementary DNA (cDNA) was synthesized from 0.500 μg of total RNA using the RevertAid H Minus First Strand cDNA synthesis kit (Fermentas, St. Leon-Rot, Germany). The primers for the housekeeping β-actin gene were synthesized by Sigma-Genosys (Haverhill, United Kingdom) (Supplementary Table S1) and 10-μM stock solution was used to make the reaction mixture (5-μL SybrGreen, 0.2-μM forward and reverse primer, 2-μL cDNA sample, 2.8-μLRNAse-free H2O). All samples were run in duplo. Samples were analyzed with the Lightcycler 480 (Roche, Basel, Switzerland). The following amplification program was used: 5 minutes 95°C, 45 × (10 seconds 95°C, 15 seconds 60°C, 15 seconds 72°C), 5 seconds 95°C, 1 minute 60°C, 4°C.
To determine the expression of all other genes (PIWIL1, MAATS1, DCHS2, RGS13), validated target-specific primers were used for TaqMan (Thermofisher Scientific, Massachusetts) qPCR (Supplementary Table S2). A total reaction volume of 20 μL was made: 10-μL TaqMan fast advanced master mix, 1-μL TaqMan assay (containing both primers and probe), 2-μL cDNA sample, 7-μL RNAse-free H2O. Samples were analyzed with the Applied Biosystems 7500 Fast (Applied Biosystems, Foster City, CA). The following amplification program was used: 5 minutes 95°C, 40 × (3 seconds 95°C, 30 seconds 60°C), 4°C. Samples were analyzed using the comparative (ΔΔ) Ct method with normalization to the housekeeping gene β-actin.
Immunohistochemistry
To localize the corresponding proteins of the predictive panel in colonic mucosa, immunohistochemical stainings were performed on 5-μm-thick step slides prepared from paraffin-embedded endoscopy-derived inflamed colonic biopsies from IBD patients, taken before vedolizumab. Endogenous peroxidase activity was blocked in deparaffinated sections by incubating the slides for 20 minutes in a 0.3% solution of H2O2 in methanol. Epitope retrieval was performed by heating the slides for 30 minutes in Tris/EDTA buffer (pH 9) at 98°C. Specific protocols for each protein are summarized in Supplementary Table S3. All procedures were conducted automatically by the BOND MAX autostainer (Leica Microsystems Ltd, Heerbrugg, Switzerland). The BOND polymer refine Detection kit (Leica Microsystems Ltd) was used for visualization of bound primary antibody according to the manufacturer’s instructions. An IBD-experienced pathologist (G.D.H.) evaluated all stains. Microscopic images were acquired with Leica Application Suite V4.1.0. software using a Leica DFC290 HD camera (Leica Microsystems Ltd) mounted on a Leica DM2000 light-emitting diode bright field microscope.
Statistical Analysis
All machine learning based analyses were carried out using R version 3.5.0 (R Development Core Team, Vienna, Austria). Unlike conventional statistics, for machine learning purposes the initial vedolizumab dataset (n = 31 samples) was randomly partitioned into a training (two-thirds) and validation (one-third) set. Predictive modeling was performed using the randomGLM (RGLM) package, which shares the advantages of a random forest (excellent predictive accuracy, feature importance measures, out-of-bag estimates of accuracy) with those of a forward-selected generalized linear model (interpretability).12 Parameter choices were optimized according to the developers suggestions, with parameters nBags = 100, nFeaturesInBag = 5, nCandidateCovariates = 5. The identified signature was validated in several independent cohorts using ConsensusClusterPlus.13 qPCR expression results were used in binary logistic regression analysis, whereupon predicted probabilities were used to assess performance with receiver-operating characteristic analysis. A false discovery rate (FDR) correction was applied during differential gene expression and pathway analysis, to correct for multiple testing. A 2-tailed FDR-corrected P value <.25 was considered significant. For all other analysis, a 2-tailed nominal P value <.05 was considered significant.
Results
Patient Characteristics
Thirty-one patients with endoscopically active colonic inflammatory bowel disease (11 CD, 20 UC) with a median disease duration of 8.4 (interquartile range, 4.0–15.3) years were included before their first vedolizumab administration (Table 1). One-third (n = 10, 32.3%) received vedolizumab as first-line biological therapy. In UC, an endoscopic remission rate of 65.0% was observed after 14 weeks, whereas 54.5% of CD patients achieved endoscopic remission after 6 months. Endoscopic remitters and nonremitters did not significantly differ in baseline characteristics (P > .05). Baseline features of the validation cohorts are also reported in Table 1.
Table 1.
Clinical Characteristics of the Inception Cohort, Validation Cohort 2, and Validation Cohort 4
| Inception cohort discovery + validation 1 (n = 31) | Validation cohort 2 RNA sequencing (n = 16) | Validation cohort 4 qPCR (n = 37) | |
|---|---|---|---|
| Diagnosis | |||
| Ulcerative colitis | 20 (64.5) | 7 (43.8) | 30 (81.1) |
| Crohn’s disease | 11 (35.5) | 9 (56.3) | 7 (18.9) |
| Women | 17 (54.8) | 7 (43.8) | 25 (67.6) |
| Age, y | 45.3 (29.6–56.3) | 44.2 (26.0–55.8) | 38.2 (31.0–48.0) |
| Disease duration, y | 8.4 (4.0–15.3) | 3.7 (1.6–20.7) | 6.9 (1.7–11.7) |
| Disease locationa | |||
| L1 | 0 (0) | 0 (0) | 0 (0) |
| L2 | 2 (18.2) | 4 (44.4) | 3 (42.9) |
| L3 | 9 (81.8) | 5 (56.6) | 4 (57.1) |
| L4 modifier | 2 (18.2) | 2 (22.2) | 0 (0) |
| E1 | 3 (15.0) | 1 (14.3) | 8 (26.7) |
| E2 | 10 (50.0) | 2 (28.6) | 9 (30.0) |
| E3 | 7 (35.0) | 4 (57.1) | 13 (43.3) |
| Disease behaviora | |||
| B1 | 6 (54.5) | 4 (44.4) | 6 (85.7) |
| B2 | 3 (27.3) | 2 (22.2) | 0 (0.0) |
| B3 | 2 (18.2) | 3 (33.3) | 1 (14.3) |
| Perianal involvement | 5 (45.5) | 2 (22.2) | 2 (28.6) |
| Steroid use during induction | |||
| Topical | 10 (32.3) | 5 (31.3) | 15 (40.1) |
| Systemic | 8 (25.8) | 6 (37.5) | 7 (16.2) |
| Previous anti-TNF exposure | |||
| Naïve | 10 (32.3) | 4 (25.0) | 26 (70.3) |
| Exposed | 21 (67.7) | 12 (75.0) | 13 (29.7) |
| C-reactive protein, mg/L | 2.0 (0.9–6.7) | 3.8 (1.4–7.2) | 1.8 (0.7–6.0) |
| Endoscopic remission | |||
| Yes | 19 (61.3) | 5 (31.1) | 14 (37.8) |
| No | 12 (38.7) | 11 (68.9) | 23 (62.2) |
Values are n (%) or median (interquartile range).
qPCR, quantitative real-time polymerase chain reaction; TNF, tumor necrosis factor.
Montreal classification.30
Additionally, colonic biopsies from 20 actively inflamed patients (6 CD, 14 UC) initiating anti-TNF therapy, of whom 17 (90.0%) were entirely anti-TNF naïve, were collected. None of them had been exposed to vedolizumab before (Supplementary Table S4).
Differential Gene Expression and Deconvolution
Within the inflamed colonic biopsies before vedolizumab, 186 genes were differentially expressed between remitters and nonremitters at a nominal P < .005 level (Supplementary Table S5). Among them, only 44 genes remained significantly different after applying a conservative 0.25-FDR threshold of significance. However, just 5 reached the stringent 0.05-FDR cutoff threshold of significance: KRT23, TMEM35, DCHS2, CLDN8, and IFI6 (Figure 1). None of them was differentially expressed between CD and UC samples (P > .05). Genes previously linked to anti-TNF nonresponsiveness, were not differentially expressed between vedolizumab responders and nonresponders: OSM (P = .76), IL13RA2 (P = .54), and TREM1 (P = .46). Similarly, no significant differential expression was observed in MAdCAM-1 (P = .59), integrin α4 subunit ITGA4 (P = .97), or integrin β7 subunit ITGB7 (P = .99).
Figure 1.
Top 5 differentially expressed genes. Visual representation of the top differentially expressed genes in mucosal biopsies of patients responding and not responding to vedolizumab. FDR, false discovery rate–corrected P value; logFC, log fold change. Top 5 differentially expressed genes: (A) KRT23, (B) TMEM35, (C) DCHS2, (D) CLDN8, and (E) IFI6.
Pathway analysis on the 186 differentially expressed genes using ingenuity pathway analysis revealed rather unspecific top canonical pathways (granulocyte adhesion and diapedesis [P = 9.4 × 10–5] and role of cytokines in mediating communication between immune cells [P = 1.1 × 10–3]). Similarly, a more focused gene enrichment analysis using gene set enrichment analysis, looking at Gene Ontology (GO) gene sets covering leukocyte migration and cell adhesion confirmed the GO leukocyte migration gene set, among many other trafficking and adhesion gene sets, indeed significantly enriched in nonremitters (P = .006) (Supplementary Table S6, Supplementary Figure S1). Predicted upstream regulators in vedolizumab nonremitters included TNF (P = 2.2 × 10–10), nuclear factor kappa B (P = 4.6 × 10–9), and interleukin 1β (P = 1.8 × 10–8). Deconvolution methods showed a significant enrichment of effector memory CD4+T cells (P = .008), monocytes (P = .005), M1 macrophages (P = .05), and regulatory T cells (P = .05) in nonremitters before vedolizumab initiation. In contrast, naïve B cells were significantly enriched in colonic biopsies of remitters (P = .03) (Figure 2).
Supplementary Figure S1.
Gene set enrichment analysis enrichment of the Gene Ontology (GO) leukocyte migration gene set in the colonic transcriptomic dataset. The bar-code plot indicates the position of the genes on the expression data rank, sorted by its association with vedolizumab-induced endoscopic remission (P < .001).
Figure 2.
Cellular deconvolution. Visual representation of the enrichment scores for the individual cells types identified being differentially represented between vedolizumab (A) nonremitters and (B) remitters, according to deconvolution techniques on the baseline transcriptome.31 T regs, regulatory T cells; T em, effector memory cells.
A 4-Gene Based Model Predicting Endoscopic Outcome to Vedolizumab Therapy
The initial dataset containing 31 inflamed colonic IBD biopsies, was randomly split into discovery (n = 20) and validation (n = 11) sets. Within the dataset of all 44 differentially expressed genes (at the 0.25-FDR level), we identified a 4-gene signature predicting endoscopic remission to vedolizumab using randomized general linear regression. A model containing RGS13, DCHS2, MAATS1, and PIWIL1 expression could accurately (accuracy 80.0%) predict endoscopic remission in the discovery cohort. Similarly, the same model could accurately differentiate vedolizumab remitters from nonremitters in validation cohort 1 (3 nonremitters, 8 remitters) (Table 2). Importantly, RGS13, DCHS2, MAATS1, and PIWIL1 expression was not significantly different between anti-TNF naïve and anti-TNF–exposed patients (Ps = .96, .96, .99, and .98, respectively) (Supplementary Table S7).
Table 2.
Accuracy of the 4-Gene Signature in Vedolizumab and Anti-TNF–Treated Patients
| Discovery dataset RNA-seq (n = 20; 9 NR, 11 R) | Validation dataset 1 RNA-seq (n = 11; 3 NR, 8 R) | Validation dataset 2 RNA-seq (n = 16; 11 NR, 5 R) | Validation dataset 3 Microarray (n = 13; 9 NR, 4 R) | Anti-TNF dataset RNA-seq (n = 20; NR 12, R 8) | |
|---|---|---|---|---|---|
| Accuracy, % | 80.0 | 100.0 | 81.3 | 76.9 | 55.0 |
| Sensitivity, % | 81.8 | 100.0 | 66.7 | 100.0 | 75.0 |
| Specificity, % | 77.8 | 100.0 | 90.0 | 70.0 | 41.7 |
| Positive predictive value, % | 81.8 | 100.0 | 80.0 | 50.0 | 46.2 |
| Negative predictive value, % | 77.8 | 100.0 | 81.8 | 100.0 | 71.4 |
| Positive likelihood ratio | 3.7 | ∞ | 6.67 | 3.3 | 1.3 |
| Negative likelihood ratio | 0.2 | 0 | 0.3 | 0 | 0.6 |
NR, nonresponder; R, responder; RNA-seq, RNA sequencing; TNF, tumor necrosis factor.
Subsequently, we recruited another 16 consecutive patients initiating vedolizumab (validation cohort 2) (Table 1), in whom we could accurately predict remission (accuracy 81.3%) through unsupervised consensus clustering based on the expression of the 4 identified genes (Table 2). Combining validation cohort 1 and 2 together (14 nonresponders, 13 responders) ultimately resulted in an 88.9% accuracy (positive likelihood ratio [LR+] 11.1 and negative likelihood ratio [LR–] 0.15). All 4 genes were significantly upregulated in remitters, with PIWIL1 not at all expressed in any of the nonremitters (Supplementary Figure S2). In contrast, the 4-gene signature was not accurate to predict response in inflamed ileal biopsies (accuracy 50.0%). Furthermore, the expression of these genes did not correlate with mucosal TNF/IL6 or C-reactive protein, suggesting that they do simply not reflect the inflammatory burden.
Supplementary Figure S2.
Differential expression of the 4 genes in the predictive panel. Visual representation of the differential gene expression in mucosal biopsies of patients responding and not responding to vedolizumab therapy of the 4 genes included in the predictive panel. FDR P value, false discovery rate corrected P value; logFC, log fold change. Differential expression of the 4 genes in the predictive panel: (A) PIWIL1, (B) MAATS1, (C) RGS13, and (D) DCHS2.
Validation of the 4-Gene Model in a Publicly Available Dataset From the GEMINI Long-Term Extension Program
Publicly available transcriptomic data in vedolizumab treated patients are limited.14 Therefore, we could validate our signature only in a small independent cohort of 13 UC patients (validation cohort 3), treated during the GEMINI long-term extension program (GSE73661). Those patients received vedolizumab according to the standard dosing (weeks 0, 2, and 6), and were endoscopically assessed at week 14. In this historic cohort, the 4-gene panel could accurately identify those patients who would not benefit from vedolizumab therapy (LR– 0.0, overall accuracy 76.9%) (Table 2).
The combination of validation cohorts 1, 2, and 3 did confirm a predictive accuracy >80.0% in both CD and UC patients separately.
Validation of the 4-Gene Model in an Independent Cohort Using qPCR
This 4-gene panel was tested in an additional Belgian-Spanish cohort using qPCR (30 UC, 7 CD) (Table 1), accurately differentiating remitters from nonremitters with an area under the curve (AUC) of 78.6% (95% confidence interval, 63.8–93.3%; P = .003) (Figure 3). In contrast, the predictive accuracy of the individual genes was clearly lower: PIWIL1 AUC 69.6% (P = .05), MAATS1 AUC 61.2% (P = .20), RGS13 AUC 49.0% (P = .69), and DCHS2 AUC 50.4% (P = .80).
Figure 3.
Receiver-operating characteristic statistics predicting vedolizumab-induced endoscopic remission based on the colonic 4-gene predictive panel in an independent Belgian-Spanish validation cohort. AUC, area under the curve.
A Vedolizumab-Specific Signature
To confirm the vedolizumab specificity of this panel, its predictive accuracy was tested in a cohort of 20 patients initiating anti-TNF therapy. In contrast to vedolizumab, this signature could not predict endoscopic outcome in anti-TNF–treated patients (accuracy 55.0%, LR+ 1.3, LR– 0.6) (Table 2).
Immunohistochemistry
PIWIL1 expression could not at all be observed in regenerating epithelium (Supplementary Figure S3), whereas it was clearly expressed in goblet cells and to some extent in stromal cells in inflamed tissue (Figure 4A). In contrast, MAATS1 was predominantly identified in endothelial cells and only weakly in epithelium and smooth muscle cells (Figure 4B). Likewise, DCHS2 was found in endothelial cells (Figure 4C). Finally, RGS13 was expressed solely in the epithelial barrier, cytoplasmic just above the cell nucleus (Figure 4D).
Supplementary Figure S3.
Immunohistochemical PIWIL1 staining in regenerating colonic epithelium (original magnification ×50).
Figure 4.
(A) Immunohistochemical PIWIL1 staining in inflamed inflammatory bowel disease (IBD) colon (original magnification [OM] ×100). (B) Immunohistochemical MAATS1 staining in inflamed IBD colon (OM ×100). (C) Immunohistochemical DCHS2 staining in inflamed IBD colon (OM ×200). (D) Immunohistochemical RGS13 staining in inflamed IBD colon (OM ×200).
Discussion
Despite the therapeutic success of emerging drugs in IBD,1,2 endoscopic remission rates are still not exceeding 30%. Besides a better patient selection and individualized dosing schemes using population pharmacokinetic-pharmacodynamic modeling,15 therapy outcomes could be further improved using predictive biomarkers. In this study, we identified and validated a 4-gene colonic expression panel predicting endoscopic success of vedolizumab therapy specifically.
Very little is known about the role of the 4 identified genes, PIWIL1, MAATS1, RGS13, and DCHS2 in IBD, and even in normal colonic mucosa to a larger extent. Based on our results, they do not reflect the mucosal inflammatory burden. Piwi-like protein 1 (PIWIL1) encodes a member of the PIWI subfamily of Argonaute proteins.16 PIWI proteins and PIWI-interacting RNAs participate in many vital biological processes, including cell proliferation, migration, survival, and inflammation.17,18 Hence, their involvement in wound healing and tissue regeneration does not come as a surprise.17 Although its highest expression is observed in germline tissue, PIWIL1 has been reported along the gastrointestinal tract.19 Existing studies mainly focused on the aberrant expression of PIWIL1 in tumors,18 but the biological role of PIWIL1 in IBD has never been elucidated. As PIWIL1 is upregulated in vedolizumab remitters, it may suggest that those patients have an a priori higher likelihood of stem cell renewal/survival, as compared with nonresponders. PIWIL1 immunohistochemistry on the other hand pointed toward the contribution of goblet cells, which are fully differentiated and hence not expected to represent a more proliferative state. Whether PIWIL1 affects goblet cell function is currently unknown, and how this is linked to vedolizumab efficacy in particular cannot be answered based on the current study.
In contrast, MAATS1 (or C3orf15) and DCHS2 (or Cadherin J) were mainly found on endothelial cells, which could suggest that both may interfere with diapedesis and cell migration, key processes in the mode of action of vedolizumab. Overall, MAATS1 is predominantly expressed in the fallopian tube and testis, but expression along the gastrointestinal tract has been reported.19 However, MAATS1 function is entirely unknown so far. In contrast, DCHS2 is implicated in cell adhesion, considered an unconventional cadherin, and mainly expressed in the reproductive system, the gastrointestinal tract and the brain.19,20
Finally, RGS13 was mainly observed in our staining in the epithelial barrier. Apart from its abundant expression in innate and adaptive immune cells, it is indeed expressed throughout the digestive system.19 Interestingly, RGS13 expression impacts CD4+ T cell migration through the RGS13-induced unresponsiveness to CXCL12, despite high levels of its receptor CXCR4 on T cells.21 As CXCL12 and CXCR4 are upregulated and constitutively expressed by intraepithelial cells (IECs) in patients with active IBD, a positive feedback loop has been suggested: increased expression and secretion of CXCL12 by IECs result in an accumulation of CXCR4+ monocytes and T cells,22,23 which on their turn contribute to additional CXCL12 expression by IECs.22 But, increased RGS13 expression results in impaired CXCL12 responsiveness, implying less leukocyte trafficking. Additionally, CXCL12 itself improves the adhesion of α4β7+ cells to MadCAM-1 by increasing the α4β7 affinity, without affecting the subcellular distribution of α4β7.24 Whether this also affects vedolizumab efficacy remains unknown.
The reduced a priori leukocyte trafficking in vedolizumab endoscopic remitters, for instance also reflected by an increased RGS13 expression in the 4-gene model, was also observed in our unsupervised transcriptome-wide analysis. This raises the question whether many more escape mechanisms exist to maintain leukocyte trafficking and subsequent intestinal inflammation in nonremitters, regardless of α4β7 blocking. Using deconvolution techniques, we identified an enrichment of proinflammatory M1 macrophages (M1ϕ) in nonresponders, before vedolizumab. In contrast to nonclassical monocytes essential for intestinal wound healing mediated by M2ϕ (which are blocked by vedolizumab therapy),25 classical monocytes can still migrate via the αLβ2-ICAM1 pathway, differentiate in proinflammatory M1ϕ and maintain intestinal inflammation.26 Vedolizumab may also affect the innate immune system, as described by Zeissig et al.11 They demonstrated a switch from an M1ϕ to a M2ϕ environment, but only in vedolizumab clinical responders. Our data now demonstrate that endoscopic nonremitters have an a priori abundance of M1ϕ already, together with an increased proportion of monocytes and effector memory CD4+T cells as compared with remitters. As vedolizumab is not able to reduce the abundance of effector memory CD4+T cells,11 the additional abundance of regulatory T cells in nonresponders is not able to dampen the proinflammatory environment, despite vedolizumab therapy.
Finally, we observed a significant baseline enrichment of naïve B cells in vedolizumab endoscopic remitters. The data by Zeissig et al11 also pointed toward the B cell compartment, as B cell receptor signaling was significant downregulated upon vedolizumab exposure. However, the role of the complex B cell biology in IBD pathogenesis is very poorly understood,27 and mainly disregarded after the failure of the anti-CD20 rituximab in randomized trial in UC,28 which obviously acts differently than vedolizumab. Why we observe a significant enrichment of naïve B cells in vedolizumab endoscopic remitters cannot be fully answered based on our findings, and raises the question whether a vedolizumab induced depletion of this cell population is key to its therapeutic success. Indeed, recent data on a small cohort of HIV-infected IBD patients demonstrated that vedolizumab therapy importantly reduced naïve B cells in intestinal mucosa,29 preventing subsequent priming by dendritic cells, who are surveying the mucosal barrier for invading pathogens.
Although we demonstrated the vedolizumab specificity of this 4-gene panel as compared with anti-TNF treated patients, the predictive accuracy in ustekinumab- or tofacitinib-treated patients is currently unknown. Furthermore, the rather limited sample size in this pilot project warrants caution. However, the validation in several independent, heterogeneous datasets suggests its true clinical and biological relevance. Finally, the enrichment scores derived through xCell deconvolution techniques raise novel hypotheses, but the need further microscopic or flow cytometric validation as the enrichment scores cannot be interpreted as proportions.
In conclusion, we identified and validated a 4-gene vedolizumab specific signature predicting therapeutic success in IBD, highlighting novel pathways previously unrecognized in vedolizumab efficacy. Additionally, our transcriptome wide unbiased analysis of inflamed colonic biopsies before vedolizumab therapy suggested an a priori increased leukocyte trafficking in endoscopic nonremitters, and provided novel insights in the vedolizumab mode of action, including the involvement of B cell compartment in vedolizumab response.
Acknowledgments
These data have been presented as an oral presentation at the 14th European Crohn’s and Colitis Organization Congress 2019 (Copenhagen, Denmark), 50th Digestive Disease Week 2019 (San Diego, CA), and 31st Belgian Week of Gastroenterology (Antwerp, Belgium). The authors were awarded with the Y-ECCO Congress abstract award during the 14th European Crohn’s and Colitis Organization Congress 2019 (Copenhagen, Denmark).
Footnotes
Conflicts of interest These authors disclose the following: Bram Verstockt received financial support for research from Pfizer; lecture fees from AbbVie, Ferring Pharmaceuticals, Janssen, R-biopharm and Takeda; consultancy fees from Janssen and Sandoz. Gert Van Assche received financial support for research from Abbott and Ferring Pharmaceuticals; lecture fees from Janssen, MSD and Abbott; consultancy fees from PDL BioPharma, UCB Pharma, Sanofi-Aventis, Abbott, Abbvie, Ferring, Novartis, Biogen Idec, Janssen Biologics, NovoNordisk, Zealand Pharma A/S, Millenium/Takeda, Shire, Novartis and Bristol Mayer Squibb. Gert De Hertogh received fees for his activities as central pathology reader in clinical trials from Centocor, Takeda and Genentech. Séverine Vermeire received financial support for research from MSD, Abbvie, Janssen, Takeda and Pfizer; lecture fees from Abbott, Abbvie, Merck Sharpe & Dohme, Ferring Pharmaceuticals, Pfizer, Takeda, Galapagos/Gilead and UCB Pharma; consultancy fees from Pfizer, Ferring Pharmaceuticals, Shire Pharmaceuticals Group, Merck Sharpe & Dohme, Abbvie, Takeda, Prodigest, Celgene, Galapagos, Gilead, Arena Pharmaceuticals, Genentech/Roche, Abivax, and AstraZeneca Pharmaceuticals. Azucena Salas received research grants from Roche, Genentech, Boehringer Ingelheim and Abbvie; lecture fees from Roche, Boehringer Ingelheim and Pfizer, and consultancy fees from Genentech and GSK. Marc Ferrante reports financial support for research: Janssen, Pfizer, Takeda, Consultancy: Abbvie, Boehringer-Ingelheim, Celltrion, Ferring, Janssen, Lilly, Mitsubishi Tanabe, MSD, Pfizer, Takeda; Speakers fee: Abbvie, Amgen, Biogen, Boehringer-Ingelheim, Chiesi, Falk, Ferring, Janssen, Lamepro, Mitsubishi Tanabe, MSD, Pfizer, Takeda, Tramedico, Tillotts, and Zeria. The remaining authors disclose no conflicts. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclose.
Funding Bram Verstockt and Kaline Arnauts are doctoral fellows and Séverine Vermeire and Marc Ferrante are Senior Clinical Investigators of the Research Foundation Flanders. Bram Verstockt has received research grants from the Belgium Week of Gastroenterology, the Belgian IBD Research and Development group, and the IBD Patient’s Association Flanders, and additional support from the Flemish association for Gastroenterology. Part of this research has been funded by the European Crohn’s and Colitis Organization Research Grant and by the Belgian IBD Research and Development group Research Grant, both awarded to Bram Verstockt. This work was also partially supported by an Advanced European Research Council Grant (ERC-2015-AdG) (to Séverine Vermeire). This work was additionally funded by a research grant from Takeda. The funders did not have any role in the study design, data collection, data analysis, interpretation or writing of the report.
Note: To access the supplementary material accompanying this article, visit the online version of Clinical Gastroenterology and Hepatology at www.cghjournal.org, and at https://doi.org/10.1016/j.cgh.2019.08.030.
Supplementary Methods
Isolation of RNA
Total RNA from inflamed biopsies was extracted using the AllPrep DNA/RNA Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, after tissue lysis using the FastPrep Lysing Matrix D tubes (MP Biomedicals, Brussels, Belgium) with RLT lysis buffer (Qiagen, Hilden, Germany). For the Barcelona validation cohort, RNA was extracted using the RNEasy Mini Kit (Qiagen, Hilden, Germany). The integrity and quantity of all RNA was assessed with a 2100 Bioanalyzer (Agilent, Waldbronn, Germany) and a Nanodrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). Extracted RNA was stored at –80°C until further processing.
RNA Sequencing
Next-generation 50 base pair single-end sequencing was performed using the Illumina HiSeq 4000NGS, after library preparation using the TruSeq Stranded messenger RNA protocol (Illumina, San Diego, CA) according to the manufacturer’s instructions. Raw RNA-sequencing data were aligned to the reference genome using Hisat2 version 2.1.0, absolute counts generated using HTSeq, where after counts were normalized, protein-coding genes selected according the Ensemble hg 19 reference build, and differential gene expression assessed using the DESeq2 package. RNA-sequencing data have been deposited in the ArrayExpress database at EMBL-EBI (www.ebi.ac.uk/arrayexpress) under accession number E-MTAB-7845. Pathway analysis was performed using the Gene Set Enrichment Analysis software (Broad Institute, Massachusetts Institute of Technology, and Regents of the University of California),1 and Ingenuity Pathway Analysis (Aarhus, Denmark). Cell deconvolution was performed using the xCell online tool, which harmonized 1822 pure human cell type transcriptomes allowing the distinction of 64 immune and stromal cell types.2
Ethical Approval
All included Belgian patients had given written consent to participate in the Institutional Review Board approved IBD Biobank of University Hospitals Leuven, Belgium (B322201213950/S53684). All included Spanish patients had given written consent after approval of this study by the Ethics Committee of the University Hospital Clínic Barcelona, Spain (2012/7956).
Acknowledgements
The authors would like to thank Vera Ballet, Eline Vandeput, Helene Blevi, Willem-Jan Wollants, Sophie Organe, Nooshin Ardeshir Davani, and Tamara Coopmans for an excellent job in maintaining the Biobank database; and Vanessa Brys, Jens Van Bouwel, Wim Meert, Alvaro Cortes Calabuig, and Wouter Bossuyt (Genomics Core Facility, University Hospitals Leuven, Belgium) for the technical assistance with the RNA-sequencing library preparation and sequencing; and Eef Allegaert and Kathleen Van den Eynde for their technical assistance with the immunohistochemical stainings (Translational Cell and Tissue Research KU Leuven). Finally, the authors would like to thank Dr Rachael Bashford-Rogers (Wellcome Trust Center for Human Genetics, University of Oxford, United Kingdom) for her critical revision on the B cell section.
This work is patented by KU Leuven Research & Development, GB1906543.2.
Transcript Profiling
RNA-sequencing data have been deposited in the ArrayExpress database at EMBL-EBI (www.ebi.ac.uk/arrayexpress) under accession number E-MTAB-7845.
Supplementary Table S1.
Details of the Forward and Reverse Primers Used for the Beta Actin qPCR Analysis, Including the amplicon Length, Melt Temperature, 5′-3′ Sequence, and NCBI Accession Number
| Primer | Amplicon length | Temperature (°C) | Sequence (5′-3′) | Gene | Accession number | Reference |
|---|---|---|---|---|---|---|
| Forward | 108 | 59.9 | ACAATGTGGCCGAGGACTTT | Beta actin | NM_001101.3 | Own design primer BLAST3 |
| Reverse | 59.7 | TGGGGTGGCTTTTAGGATGG |
qPCR, quantitative real-time polymerase chain reaction.
Supplementary Table S2.
Details of Target-Specific TaqMan Primers
| Gene | Target-specific primer | Company |
|---|---|---|
| PIWIL1 | Hs01041737_m1 | Thermo Fisher Scientific |
| MAATS1 | Hs00398573_m1 | Thermo Fisher Scientific |
| DCHS2 | Hs03006670_m1 | Thermo Fisher Scientific |
| RGS13 | Hs00243182_m1 | Thermo Fisher Scientific |
Supplementary Table S3.
Overview Primary Antibodies Immunohistochemistry
| Protein | Dilution primary antibody | Primary Ab | Incubation details primary Ab |
|---|---|---|---|
| PIWIL1 | 1:2000 | Rabbit polyclonal anti-PIWIL1 Ab – HPA018798 (Sigma-Aldrich) | 30 min at RT |
| MAATS1 | 1:800 | Mouse monoclonal anti-MAATS1/C3orf15 Ab – MA5-26540 (Invitrogen) | 30 min at RT |
| DCHS2 | 1:400 | Rabbit polyclonal anti-DCHS2 Ab – HPA064159 (Sigma-Aldrich) | 30 min at RT |
| RGS13 | 1:200 | Rabbit polyclonal anti-RGS13 Ab – HPA044952 (Sigma-Aldrich) | 30 min at RT |
Ab, antibody; RT, room temperature
Supplementary Table S4.
Clinical Features of the Anti-TNF–Treated Cohort
| Diagnosis | |
| Ulcerative colitis | 12 (60.0) |
| Crohn’s disease | 8 (40.0) |
| Therapy | |
| Adalimumab | 12 (60.0) |
| Infliximab | 8 (40.0) |
| Women | 12 (60.0) |
| Age, y | 33.7 (21.6–48.0) |
| Disease duration, y | 1.4 (0.2–4.8) |
| Disease locationa | |
| L1 | 0 (0.0) |
| L2 | 1 (16.7) |
| L3 | 5 (83.3) |
| L4 modifier | 1 (16.7) |
| E1 | 0 (0.0) |
| E2 | 11 (83.3) |
| E3 | 3 (21.4) |
| Disease behaviora | |
| B1 | 3 (50.0) |
| B2 | 3 (50.0) |
| B3 | 0 (0.0) |
| Perianal involvement | 1 (16.7) |
| Steroid use during induction | |
| Topical | 3 (15.0) |
| Systemic | 7 (35.0) |
| Immunomodulators during induction | 1 (5.0) |
| C-reactive protein, mg/L | 5.1 (1.4–14.2) |
| Endoscopic remission | |
| Yes | 8 (40.0) |
| No | 12 (60.0) |
Values are n (%) or median (interquartile range).
TNF, tumor necrosis factor.
Montreal classification.4
Supplementary Table S5.
All Differentially Expressed Genes at the Nominal Significance P < .005 Level
| Gene | Base mean | log2FoldChange | Nominal P value | FDR-Adjusted P value |
|---|---|---|---|---|
| KRT23 | 16.7180859 | –2.0242052 | 1.09 × 10–8 | .000168888 |
| TMEM35 | 22.0073144 | 1.02387191 | 5.24 × 10–7 | .004044778 |
| DCHS2 | 14.2168032 | 1.56822472 | 2.75 × 10–6 | .014128976 |
| CLDN8 | 90.0608422 | 4.39610438 | 4.96 × 10–6 | .019127255 |
| IFI6 | 334.629287 | –0.7472599 | 6.36 × 10–6 | .019615927 |
| APOBEC3A | 70.4624261 | –1.6813582 | 2.93 × 10–5 | .075378873 |
| PCOLCE2 | 7.46167868 | 2.22476748 | 3.85 × 10–5 | .084915322 |
| CXCL6 | 367.065443 | –1.8601495 | 5.42 × 10–5 | .096168704 |
| P2RX2 | 3.98803679 | 2.33736209 | 5.61 × 10–5 | .096168704 |
| HEPHL1 | 7.19784773 | –2.7120633 | 6.93 × 10–5 | .106875332 |
| GZMB | 179.696681 | –1.235948 | .000105257 | .126064653 |
| CCL3 | 110.886222 | –1.370798 | .000106858 | .126064653 |
| DCBLD1 | 335.800147 | –0.4339657 | .000109094 | .126064653 |
| IL18RAP | 88.2525652 | –0.9455257 | .000114389 | .126064653 |
| IL32 | 1239.13865 | –0.516138 | .000191042 | .196506067 |
| RGS13 | 26.713778 | 1.00558131 | .000209322 | .196608037 |
| C16orf89 | 27.4676645 | 0.79870715 | .000216627 | .196608037 |
| RASGRP4 | 66.4823444 | –0.8669479 | .000229439 | .196667853 |
| GLRA2 | 12.8801446 | 2.03544389 | .000259165 | .207049407 |
| NCF2 | 451.245388 | –0.8127664 | .000276283 | .207049407 |
| PPP1R3C | 50.4672113 | 0.77759178 | .000281809 | .207049407 |
| PTGER1 | 5.95195593 | –1.8184337 | .000319712 | .209795607 |
| AFF3 | 85.7959497 | 0.72082547 | .000327476 | .209795607 |
| SERPINA9 | 5.57881637 | 3.07311416 | .000328424 | .209795607 |
| ITPRIPL2 | 719.964066 | –0.3225183 | .000339937 | .209795607 |
| SHC1 | 1492.18376 | –0.2762233 | .000370729 | .212595281 |
| MAATS1 | 16.8498269 | 1.35939925 | .000393874 | .212595281 |
| PRF1 | 175.562754 | –0.7783421 | .000408969 | .212595281 |
| RIPK2 | 223.222424 | –0.4889622 | .000415642 | .212595281 |
| C7 | 206.902141 | 1.13251488 | .000431099 | .212595281 |
| VASN | 134.723245 | –0.9239671 | .000469609 | .212595281 |
| LILRB2 | 378.028889 | –1.0345434 | .00050092 | .212595281 |
| OCA2 | 5.77409323 | 1.79797243 | .00050103 | .212595281 |
| GDF6 | 5.72769633 | 1.73964914 | .000509621 | .212595281 |
| HMG20A | 436.390639 | 0.2244065 | .000515674 | .212595281 |
| ARRB2 | 608.61371 | –0.4538602 | .000518642 | .212595281 |
| MMP1 | 3428.22966 | –2.0023607 | .000527115 | .212595281 |
| IFNG | 39.9970933 | –1.7218582 | .00053709 | .212595281 |
| C21orf88 | 75.0439577 | 2.48943313 | .000537379 | .212595281 |
| CEBPB | 427.693647 | –0.8978266 | .000657776 | .24482901 |
| CSF2 | 22.9106571 | –1.7392829 | .000659524 | .24482901 |
| ZNF587B | 108.09995 | 0.32214911 | .000668663 | .24482901 |
| PIWIL1 | 1.67138853 | 3.85503952 | .000682457 | .24482901 |
| EVA1B | 59.2723597 | –0.9274526 | .000698197 | .24482901 |
| SLC13A2 | 65.2167772 | 1.48745286 | .000751791 | .254142023 |
| HSD11B1 | 70.3742699 | –1.0479977 | .000783544 | .254142023 |
| SHISA3 | 12.4227235 | 1.4228452 | .000796262 | .254142023 |
| NTRK3 | 10.7751902 | 1.20335112 | .00079719 | .254142023 |
| S100A3 | 32.1489835 | –1.1512714 | .000810185 | .254142023 |
| NPTX2 | 112.143113 | –1.7394179 | .000823586 | .254142023 |
| CMIP | 1060.93813 | –0.2499559 | .000847772 | .256475996 |
| WBSCR27 | 13.6274888 | 1.30468994 | .000930061 | .275959815 |
| APOL1 | 3402.48609 | –0.8000499 | .000968958 | .282076494 |
| LILRA5 | 142.345939 | –1.2109718 | .001013086 | .289461169 |
| TENM2 | 4.01279765 | 2.20373098 | .001039446 | .29159288 |
| TBC1D1 | 837.906313 | –0.2292631 | .00112296 | .299758073 |
| KCNH2 | 74.3991527 | 0.64204441 | .001154201 | .299758073 |
| HSPA12B | 77.7690355 | –0.7681986 | .001154923 | .299758073 |
| PFKFB4 | 177.110178 | –0.634147 | .001188816 | .299758073 |
| SOX18 | 75.6968692 | –1.0378603 | .001217785 | .299758073 |
| FCGR2A | 590.678255 | –1.0078412 | .001242733 | .299758073 |
| OSCAR | 51.8112129 | –0.6944374 | .00124279 | .299758073 |
| RP11-812E19.9 | 21.3315831 | –1.08004 | .001243239 | .299758073 |
| MMP3 | 4282.89856 | –1.863898 | .001298899 | .299758073 |
| ADNP2 | 329.918377 | 0.19372723 | .001305613 | .299758073 |
| PDPN | 555.884207 | –0.9337707 | .001322834 | .299758073 |
| PTAFR | 604.274834 | –0.6096574 | .001323439 | .299758073 |
| PLAU | 1885.1355 | –1.0021618 | .001329836 | .299758073 |
| MMP14 | 2445.67364 | –0.5253513 | .001344761 | .299758073 |
| HCAR2 | 118.63972 | –1.6680141 | .001360294 | .299758073 |
| FFAR2 | 158.960936 | –1.2633905 | .001379404 | .299758073 |
| SLC43A2 | 499.956189 | –0.4968154 | .001422941 | .301417508 |
| GNAI1 | 286.287253 | –0.3617917 | .001436971 | .301417508 |
| GBP5 | 1201.6973 | –1.0456035 | .001458182 | .301417508 |
| KRTAP13-2 | 7.31385049 | 4.80719515 | .001478671 | .301417508 |
| ZNF525 | 93.3827561 | 0.44302787 | .001579396 | .301417508 |
| CLGN | 10.7331527 | 1.03788853 | .001585583 | .301417508 |
| WARS | 7144.39929 | –0.8301275 | .001626954 | .301417508 |
| PXDN | 1131.81879 | –0.6205878 | .001628192 | .301417508 |
| NRCAM | 80.9563399 | –1.1639303 | .001639771 | .301417508 |
| TBX2 | 211.98147 | –0.5767591 | .00165562 | .301417508 |
| CCR1 | 328.757107 | –0.7665532 | .001700304 | .301417508 |
| GPRASP1 | 96.6515105 | 0.43756646 | .001703022 | .301417508 |
| TIMM10 | 242.756012 | 0.41371367 | .001710192 | .301417508 |
| FCN3 | 84.2750831 | –1.407743 | .001752829 | .301417508 |
| DRAXIN | 3.8240981 | –1.4868304 | .001762212 | .301417508 |
| RAB31 | 1034.09613 | –0.5151868 | .001763017 | .301417508 |
| IL7R | 1452.38809 | –0.626916 | .001778229 | .301417508 |
| FAM26F | 223.730022 | –0.9277878 | .00179398 | .301417508 |
| CA1 | 2884.81851 | 2.07665726 | .001794694 | .301417508 |
| PRELP | 149.260382 | 1.06887891 | .001826146 | .301417508 |
| RGS3 | 603.119819 | –0.313215 | .001894436 | .301417508 |
| GSDMC | 13.6827704 | –1.3250678 | .001897953 | .301417508 |
| TYMP | 1464.76898 | –0.6961674 | .001937775 | .301417508 |
| MYO1F | 606.425133 | –0.5323932 | .001947213 | .301417508 |
| EDN1 | 151.13679 | –0.4851836 | .00195317 | .301417508 |
| MT2A | 754.065 | –0.8008857 | .001957318 | .301417508 |
| CD300C | 38.6480185 | –0.6878881 | .001965729 | .301417508 |
| CNTN1 | 34.8207164 | 1.20250742 | .001979141 | .301417508 |
| SLC9A9 | 151.514629 | 0.39011774 | .00198252 | .301417508 |
| APOL2 | 1380.80307 | –0.618163 | .001991339 | .301417508 |
| GLT1D1 | 30.5540448 | –1.3354594 | .001992649 | .301417508 |
| KIAA2022 | 8.39545959 | 1.11065981 | .002032918 | .303055283 |
| KANK4 | 11.9996694 | 1.24284523 | .002050125 | .303055283 |
| EMR2 | 368.717865 | –0.8265429 | .002062402 | .303055283 |
| CHMP4C | 264.861881 | 0.5013719 | .00211717 | .307508524 |
| CXXC4 | 27.2122769 | 0.52250071 | .002132569 | .307508524 |
| PDGFB | 178.670281 | –0.6208979 | .002153947 | .307715287 |
| PRKCDBP | 113.367496 | –0.7947516 | .002195238 | .310736989 |
| HCAR3 | 166.644571 | –1.7971432 | .002252748 | .312805681 |
| MEFV | 69.9932486 | –1.0795521 | .002255787 | .312805681 |
| ITIH1 | 3.76511485 | 1.80120388 | .002270674 | .312805681 |
| ZNF180 | 96.8109938 | 0.28440763 | .00232086 | .31688978 |
| ACSL1 | 769.356769 | –0.6292047 | .002375655 | .321526177 |
| SERPINH1 | 1448.64285 | –0.4357825 | .002401686 | .322222743 |
| KCNJ15 | 74.2169719 | –1.3884412 | .00247467 | .329152443 |
| FPR2 | 152.266592 | –1.5619318 | .002610446 | .343491034 |
| PML | 856.765038 | –0.4504262 | .002626997 | .343491034 |
| CRIP3 | 9.85846253 | 1.13141354 | .002653799 | .344079565 |
| PAK3 | 14.2995118 | 0.87116381 | .002741388 | .352095927 |
| S100A8 | 516.102614 | –1.4489693 | .002761268 | .352095927 |
| AGTRAP | 303.595404 | –0.3661557 | .002851262 | .357943211 |
| NRBF2 | 254.204633 | –0.2179738 | .00285909 | .357943211 |
| LCN8 | 2.66174082 | 4.5263242 | .002886973 | .357943211 |
| LCP2 | 700.802206 | –0.5292133 | .002903855 | .357943211 |
| CD97 | 1624.92009 | –0.2937652 | .002923122 | .357943211 |
| RNF149 | 966.868431 | –0.3855569 | .003016884 | .359954883 |
| FAM20C | 554.457254 | –0.7291105 | .003027376 | .359954883 |
| IL6 | 137.460364 | –1.8728125 | .003039422 | .359954883 |
| MAMDC2 | 77.1436418 | 1.077587 | .00304496 | .359954883 |
| FRMD5 | 42.4566262 | –0.5517891 | .003056199 | .359954883 |
| PRSS23 | 1269.57438 | –0.518664 | .003105654 | .36300863 |
| ADAMTS2 | 404.668272 | –0.8236445 | .003170801 | .363452743 |
| CXCR2 | 198.069766 | –1.5049112 | .003175255 | .363452743 |
| CGNL1 | 107.06744 | 0.55456682 | .003210693 | .363452743 |
| SLC26A7 | 7.97938116 | 1.15536571 | .003215226 | .363452743 |
| MAPK4 | 8.79019065 | 1.59986179 | .003274881 | .363452743 |
| GPR68 | 145.288283 | –0.6319797 | .003320694 | .363452743 |
| CCDC85B | 70.387112 | –1.0722359 | .003334462 | .363452743 |
| TFB2M | 208.454153 | 0.30508172 | .003341185 | .363452743 |
| FPR3 | 538.077495 | –0.4912119 | .003355985 | .363452743 |
| IL10 | 27.9763111 | –0.748586 | .00336366 | .363452743 |
| GZMH | 45.6742582 | –0.9784585 | .003368575 | .363452743 |
| TWIST1 | 22.0625386 | –1.1686077 | .003429279 | .367432956 |
| KYNU | 313.530786 | –0.8871439 | .003465275 | .368729158 |
| P2RY6 | 118.969069 | –0.6825427 | .003508725 | .370795351 |
| DUOXA1 | 41.7844729 | 1.16498649 | .003605027 | .375315993 |
| THNSL1 | 71.4019298 | 0.48108439 | .003614439 | .375315993 |
| GAS1 | 52.0746488 | –1.3020567 | .003624479 | .375315993 |
| AJAP1 | 22.6129557 | –0.9033464 | .003684437 | .376071973 |
| TARBP1 | 393.023524 | 0.27379753 | .003688553 | .376071973 |
| ECEL1 | 6.27832952 | –1.744911 | .003711289 | .376071973 |
| TRPM5 | 25.125889 | 0.86827164 | .003729277 | .376071973 |
| TAP1 | 4573.54696 | –0.4324256 | .003804006 | .381116896 |
| XIRP1 | 5.95863417 | –1.9154595 | .003852525 | .381611932 |
| SPON2 | 436.782172 | –0.6820999 | .003868974 | .381611932 |
| RND3 | 742.304639 | –0.3040314 | .003883147 | .381611932 |
| PI15 | 236.012309 | –1.6421623 | .003944315 | .383224026 |
| GBP1 | 2082.25661 | –0.688434 | .003961081 | .383224026 |
| CDC25B | 1152.1294 | –0.4573937 | .003974065 | .383224026 |
| COL19A1 | 14.0999984 | 1.16153197 | .004058959 | .383658079 |
| UCN2 | 15.8223209 | –1.7066439 | .004067746 | .383658079 |
| KIAA1199 | 892.903884 | –1.4640356 | .004114575 | .383658079 |
| FAM65C | 246.664958 | –0.805228 | .004122964 | .383658079 |
| TNFAIP6 | 103.975943 | –1.2385583 | .004124454 | .383658079 |
| SPI1 | 442.202474 | –0.6064343 | .004127762 | .383658079 |
| IL22 | 12.1184065 | –1.5552835 | .004226837 | .39051419 |
| LOX | 233.733809 | –0.500771 | .00427652 | .392752577 |
| CLEC4E | 72.0366822 | –1.0876011 | .004314872 | .392778101 |
| HSD3B2 | 9.88903122 | 2.61567965 | .004327713 | .392778101 |
| HAL | 17.0775854 | –1.1779315 | .004384927 | .395643489 |
| GAPT | 86.1978148 | 0.5772995 | .004463871 | .396779869 |
| SNAP29 | 538.224499 | –0.2050471 | .004487674 | .396779869 |
| SEC22A | 156.855161 | 0.21470733 | .004515121 | .396779869 |
| SPHK1 | 149.208726 | –0.8540513 | .004534048 | .396779869 |
| FCGR3A | 666.452688 | –0.8194133 | .004563509 | .396779869 |
| CENPF | 452.425366 | 0.36369156 | .004563724 | .396779869 |
| KLF10 | 769.779455 | –0.3019486 | .004608633 | .396779869 |
| TWIST2 | 6.12323293 | –1.2439755 | .004640758 | .396779869 |
| CYP27C1 | 11.7654784 | 0.87578612 | .004652416 | .396779869 |
| TMEM132A | 295.03094 | –0.7747564 | .004654686 | .396779869 |
| CEBPD | 375.693399 | –0.8544119 | .004682067 | .396920927 |
| TNFAIP3 | 1311.60335 | –0.5350924 | .004740862 | .398333069 |
| TMEM255A | 37.6285225 | 0.84079489 | .004750359 | .398333069 |
| FHL1 | 1126.47582 | 0.52699071 | .004880715 | .407051615 |
| MNDA | 354.070638 | –0.9214579 | .004912218 | .40747638 |
Supplementary Table S6.
Gene Set Enrichment Analysis Results Focused on the Leukocyte Migration and Cell Adhesion Gene Ontology Gene Sets, Derived From the MSigDB
| GO gene set | Nominal P value | FDR corrected P value |
|---|---|---|
| Leukocyte migration | .006 | .017 |
| Leukocyte adhesion to vascular endothelial cells | .032 | .090 |
| Cellular extravasation | .038 | .060 |
| Leukocyte cell adhesion | .089 | .098 |
| Integrin-mediated signaling pathway | .117 | .145 |
| Integrin binding | .171 | .166 |
| Cell adhesion molecule binding | .201 | .221 |
| Cell substrate adhesion | .232 | .208 |
All gene sets are enriched in the nonresponder group.
FDR, false discovery rate; GO, Gene Ontology; TNF, tumor necrosis factor.
Supplementary Table S7.
Differential Gene Expression Between anti-TNF–Naïve and Anti-TNF–Exposed Vedolizumab Patients
| Gene | Nominal P value | FDR-Corrected P value | Log2 fold change |
|---|---|---|---|
| RGS13 | .13 | .96 | 0.32 |
| DCHS2 | .13 | .96 | 0.40 |
| MAATS1 | .62 | .99 | 0.22 |
| PIWIL1 | .18 | .98 | 1.77 |
FDR, false discovery rate; TNF, tumor necrosis factor.
References
- 1.Verstockt B., Ferrante M., Vermeire S., Van Assche G. New treatment options for inflammatory bowel diseases. J Gastroenterol. 2018;53:585–590. doi: 10.1007/s00535-018-1449-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sabino J., Verstockt B., Vermeire S., Ferrante M. New biologics and small molecules in inflammatory bowel disease. An update. Therap Adv Gastroenterol. 2019;12 doi: 10.1177/1756284819853208. 1756284819853208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.West N.R., Hegazy A.N., Owens B.M.J. Oncostatin M drives intestinal inflammation and predicts response to tumor necrosis factor-neutralizing therapy in patients with inflammatory bowel disease. Nat Med. 2017;23:579–589. doi: 10.1038/nm.4307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Gaujoux R., Starosvetsky E., Maimon N. Cell-centred meta-analysis reveals baseline predictors of anti-TNFalpha non-response in biopsy and blood of patients with IBD. Gut. 2019;68:604–614. doi: 10.1136/gutjnl-2017-315494. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Verstockt B., Verstockt S., Blevi H. TREM-1, the ideal predictive biomarker for endoscopic healing in anti-TNF-treated Crohn's disease patients? Gut. 2019;68:1531–1533. doi: 10.1136/gutjnl-2018-316845. [DOI] [PubMed] [Google Scholar]
- 6.Verstockt B., Verstockt S., Dehairs J. Low TREM1 expression in whole blood predicts anti-TNF response in inflammatory bowel disease. EBioMedicine. 2019;40:733–742. doi: 10.1016/j.ebiom.2019.01.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Verstockt B., Verstockt S., Creyns B. Mucosal IL13RA2 expression predicts nonresponse to anti-TNF therapy in Crohn's disease. Aliment Pharmacol Ther. 2019;49:572–581. doi: 10.1111/apt.15126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Boden E.K., Shows D.M., Chiorean M.V., Lord J.D. Identification of candidate biomarkers associated with response to vedolizumab in inflammatory bowel disease. Dig Dis Sci. 2018;63:2419–2429. doi: 10.1007/s10620-018-4924-8. [DOI] [PubMed] [Google Scholar]
- 9.Soendergaard C., Seidelin J.B., Steenholdt C., Nielsen O.H. Putative biomarkers of vedolizumab resistance and underlying inflammatory pathways involved in IBD. BMJ Open Gastroenterol. 2018;5 doi: 10.1136/bmjgast-2018-000208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Peyrin-Biroulet L., Sandborn W., Sands B.E. Selecting Therapeutic Targets in Inflammatory Bowel Disease (STRIDE): Determining Therapeutic Goals for Treat-to-Target. Am J Gastroenterol. 2015;110:1324–1338. doi: 10.1038/ajg.2015.233. [DOI] [PubMed] [Google Scholar]
- 11.Zeissig S., Rosati E., Dowds C.M. Vedolizumab is associated with changes in innate rather than adaptive immunity in patients with inflammatory bowel disease. Gut. 2019;68:25–39. doi: 10.1136/gutjnl-2018-316023. [DOI] [PubMed] [Google Scholar]
- 12.Song L., Langfelder P., Horvath S. Random generalized linear model: a highly accurate and interpretable ensemble predictor. BMC Bioinformatics. 2013;14:5. doi: 10.1186/1471-2105-14-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Wilkerson M.D., Hayes D.N. ConsensusClusterPlus: a class discovery tool with confidence assessments and item tracking. Bioinformatics. 2010;26:1572–1573. doi: 10.1093/bioinformatics/btq170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Arijs I., De Hertogh G., Lemmens B. Effect of vedolizumab (anti-alpha4beta7-integrin) therapy on histological healing and mucosal gene expression in patients with UC. Gut. 2018;67:43–52. doi: 10.1136/gutjnl-2016-312293. [DOI] [PubMed] [Google Scholar]
- 15.Passot C., Pouw M.F., Mulleman D. Therapeutic Drug Monitoring of Biopharmaceuticals May Benefit From Pharmacokinetic and Pharmacokinetic-Pharmacodynamic Modeling. Ther Drug Monit. 2017;39:322–326. doi: 10.1097/FTD.0000000000000389. [DOI] [PubMed] [Google Scholar]
- 16.Sasaki T., Shiohama A., Minoshima S., Shimizu N. Identification of eight members of the Argonaute family in the human genome. Genomics. 2003;82:323–330. doi: 10.1016/s0888-7543(03)00129-0. [DOI] [PubMed] [Google Scholar]
- 17.Ponnusamy M., Yan K.W., Liu C.Y., Li P.F., Wang K. PIWI family emerging as a decisive factor of cell fate: An overview. Eur J Cell Biol. 2017;96:746–757. doi: 10.1016/j.ejcb.2017.09.004. [DOI] [PubMed] [Google Scholar]
- 18.Ng K.W., Anerson C., Marshall E.A. Piwi-interacting RNAs in cancer: emerging functions and clinical utility. Mol Cancer. 2016;15:5. doi: 10.1186/s12943-016-0491-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Uhlén M., Fagerberg L., Hallström B.M. Proteomics. Tissue-based map of the human proteome. Science. 2015;347:1260419. doi: 10.1126/science.1260419. [DOI] [PubMed] [Google Scholar]
- 20.An C.H., Je E.M., Yoo N.J., Lee S.H. Frameshift mutations of cadherin genes DCHS2, CDH10 and CDH24 genes in gastric and colorectal cancers with high microsatellite instability. Pathol Oncol Res. 2015;21:181–185. doi: 10.1007/s12253-014-9804-8. [DOI] [PubMed] [Google Scholar]
- 21.Lippert E., Yowe D.L., Gonzalo J.A. Role of regulator of G protein signaling 16 in inflammation-induced T lymphocyte migration and activation. J Immunol. 2003;171:1542–1555. doi: 10.4049/jimmunol.171.3.1542. [DOI] [PubMed] [Google Scholar]
- 22.Dotan I., Werner L., Vigodman S. CXCL12 is a constitutive and inflammatory chemokine in the intestinal immune system. Inflamm Bowel Dis. 2010;16:583–592. doi: 10.1002/ibd.21106. [DOI] [PubMed] [Google Scholar]
- 23.Sánchez-Martín L., Estecha A., Samaniego R., Sánchez-Ramón S., Vega M.A., Sánchez-Mateos P. The chemokine CXCL12 regulates monocyte-macrophage differentiation and RUNX3 expression. Blood. 2011;117:88–97. doi: 10.1182/blood-2009-12-258186. [DOI] [PubMed] [Google Scholar]
- 24.Sun H., Liu J., Zheng Y., Pan Y., Zhang K., Chen J. Distinct chemokine signaling regulates integrin ligand specificity to dictate tissue-specific lymphocyte homing. Dev Cell. 2014;30:61–70. doi: 10.1016/j.devcel.2014.05.002. [DOI] [PubMed] [Google Scholar]
- 25.Schleier L., Wiendl M., Binder M.T. OP008 α4β7 Integrin-dependent gut homing of non-classical monocytes is essential for intestinal wound healing mediated by M2 macrophages. J Crohn’s Colitis. 2018;12(Supplement_1):S005–S007. [Google Scholar]
- 26.Schittenhelm L., Hilkens C.M., Morrison V.L. beta2 Integrins As Regulators of Dendritic Cell, Monocyte, and Macrophage Function. Front Immunol. 2017;8:1866. doi: 10.3389/fimmu.2017.01866. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Uzzan M., Colombel J.F., Cerutti A., Treton X., Mehandru S. B Cell-Activating Factor (BAFF)-Targeted B Cell Therapies in Inflammatory Bowel Diseases. Dig Dis Sci. 2016;61:3407–3424. doi: 10.1007/s10620-016-4317-9. [DOI] [PubMed] [Google Scholar]
- 28.Leiper K., Martin K., Ellis A. Randomised placebo-controlled trial of rituximab (anti-CD20) in active ulcerative colitis. Gut. 2011;60:1520–1526. doi: 10.1136/gut.2010.225482. [DOI] [PubMed] [Google Scholar]
- 29.Uzzan M., Tokuyama M., Rosenstein A.K. Anti-alpha4beta7 therapy targets lymphoid aggregates in the gastrointestinal tract of HIV-1-infected individuals. Sci Transl Med. 2018;10 doi: 10.1126/scitranslmed.aau4711. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Silverberg M.S., Satsangi J., Ahmad T. Toward an integrated clinical, molecular and serological classification of inflammatory bowel disease: report of a Working Party of the 2005 Montreal World Congress of Gastroenterology. Can J Gastroenterol. 2005;19(Suppl A):5A–36A. doi: 10.1155/2005/269076. [DOI] [PubMed] [Google Scholar]
- 31.Aran D., Hu Z., Butte A.J. xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol. 2017;18:220. doi: 10.1186/s13059-017-1349-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
References
- 1.Mootha V.K., Lindgren C.M., Eriksson K.F. PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet. 2003;34:267–273. doi: 10.1038/ng1180. [DOI] [PubMed] [Google Scholar]
- 2.Aran D., Hu Z., Butte A.J. xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol. 2017;18:220. doi: 10.1186/s13059-017-1349-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ye J., Coulouris G., Zaretskaya, Cutcutache I., Rozen S., Madden T.L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13:134. doi: 10.1186/1471-2105-13-134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Silverberg M.S., Satsangi J., Ahmad T. Toward an integrated clinical, molecular and serological classification of inflammatory bowel disease: report of a Working Party of the 2005 Montreal World Congress of Gastroenterology. Can J Gastroenterol. 2005;19(Suppl A):5A–36A. doi: 10.1155/2005/269076. [DOI] [PubMed] [Google Scholar]