Skip to main content
PLOS One logoLink to PLOS One
. 2020 May 4;15(5):e0231944. doi: 10.1371/journal.pone.0231944

Mechanisms of thrombin-Induced myometrial contractions: Potential targets of progesterone

Fumitomo Nishimura 1, Haruta Mogami 1,*, Kaori Moriuchi 1, Yoshitsugu Chigusa 1, Masaki Mandai 1, Eiji Kondoh 1
Editor: Tamas Zakar2
PMCID: PMC7197857  PMID: 32365105

Abstract

Intrauterine bleeding during pregnancy is a major risk factor for preterm birth. Thrombin, the most abundant coagulation factor in blood, is associated with uterine myometrial contraction. Here, we investigated the molecular mechanism and signaling of thrombin-induced myometrial contraction. First, histologic studies of placental abruption, as a representative intrauterine bleeding, revealed that thrombin was expressed within the infiltrating hemorrhage and that thrombin receptor (protease-activated receptor 1, PAR1) was highly expressed in myometrial cells surrounding the hemorrhage. Treatment of human myometrial cells with thrombin resulted in augmented contraction via PAR1. Thrombin-induced signaling to myosin was then mediated by activation of myosin light chain kinase- and Rho-induced phosphorylation of myosin light chain-2. In addition, thrombin increased prostaglandin-endoperoxidase synthase-2 (PTGS2 or COX2) mRNA and prostaglandin E2 and F2α synthesis in human myometrial cells. Thrombin significantly increased the mRNA level of interleukine-1β, whereas it decreased the expressions of prostaglandin EP3 and F2α receptors. Progesterone partially blocked thrombin-induced myometrial contractions, which was accompanied by suppression of the thrombin-induced increase of PTGS2 and IL1B mRNA expressions as well as suppression of PAR1 expression. Collectively, thrombin induces myometrial contractions by two mechanisms, including direct activation of myosin and indirect increases in prostaglandin synthesis. The results suggest a therapeutic potential of progesterone for preterm labor complicated by intrauterine bleeding.

Introduction

Intrauterine or vaginal bleeding is a risk factor for preterm birth [1]. Subchorionic hematoma in the first and second trimester doubles the preterm birth rate [2, 3], and decidual or uterine hemorrhage is a strong risk for preterm premature rupture of membranes (pPROM) [4]. In addition, placental abruption, which causes massive intrauterine bleeding in the decidual space, causes strong uterine contraction [5]. Onset of placental abruption itself is closely associated with first trimester bleeding [2, 3, 6].

Thrombin is a serine proteinase that is most abundantly contained in blood [7]. In addition to blood coagulation, thrombin plays a significant role in preterm birth [8]. Patients with preterm labor have increased plasma [9] and amniotic fluid [10] thrombin–antithrombin complex levels compared with normal pregnant women. Risk of pPROM is increased by thrombin [11]. Previously, we showed that thrombin activity was increased in human amnion tissues from women with preterm birth, and thrombin increased (i) expression and activity of matrix metalloproteinases (MMPs) and (ii) prostaglandin (PG) synthesis in primary amnion mesenchymal cells [12]. Moreover, intra-uterine injection of thrombin in pregnant mice caused preterm birth [12]. Other studies have shown that thrombin induces myometrial contractions in rats [13, 14]. The thrombin–antithrombin complex gradually rises during normal pregnancy, reaching maximum in the 3rd stage of labor [15, 16]. Therefore, dysregulation of thrombin activity has the potential to cause a premature onset of labor, leading to preterm birth.

Myosin II is the primary motor protein in muscle [17]. Myosin comprises heavy and light chains. Cellular myosin II is activated by phosphorylation of its regulatory light chain (MLC) at Ser19, which allows myosin II to interact with actin, assembling an actomyosin complex and initiation of contraction [17]. Two groups of enzymes control MLC phosphorylation. One consists of kinases that phosphorylate MLC (MLC kinase, MLCK, and Rho-associated protein kinase, ROCK), promoting activity, and the other is a phosphatase that dephosphorylates MLC, inhibiting activity [18].Throughout pregnancy, uterine quiescence is maintained by progesterone [19]. Progesterone has been used for the prevention and treatment of preterm labor, and clinical evidence of its effectiveness is accumulating [20–24]. However, the effect of progesterone on preterm labor caused by intrauterine bleeding is unclear.

In this study, we investigated the molecular mechanisms of thrombin-induced uterine smooth muscle contraction using primary human myometrial smooth muscle cells. We also tested the hypothesis that progesterone may ameliorate thrombin-induced myometrial contraction.

Materials and methods

Immunofluorescence of human pregnant uterus

Myometrium was obtained from two cases of placental abruption at 1) 25 weeks and 5 days and 2) 33 weeks and 4 days with written informed consent. Hysterectomy was performed due to uncontrollable massive uterine bleeding with disseminated intravascular coagulopathy (DIC). Myometrium was fixed in 10% formaldehyde, and then paraffin embedded. Antigen retrieval was performed by incubation with proteinase K (P8107S, New England Biolab, working concentration, 0.6 units/mL) for 10 min at 37°C. Sections were then preincubated with 10% normal goat serum (50062Z, Life Technologies) with 0.3% Triton X-100 for 30 min at room temperature. Subsequently, tissue sections were incubated with primary antibodies in PBS with 1% BSA and 0.3% Triton X-100 at 4°C overnight. Primary antibodies used and concentration were as follows: thrombin (coagulation factor II, Novus Biologicals, NBP1-58268, Research Resource Identifier (RRID): AB_11023777, 1:100) and PAR1 (N2-11, Novus Biologicals, NBP1-71770, RRID: AB_11027203, 1:100). Thereafter, sections were incubated with Alexa Fluor 488 (Goat anti-Mouse IgG, A11001, RRID: AB_2534069, Invitrogen, 1:500 dilution) or 594-conjugated secondary antibodies (Goat anti-Rabbit IgG, A11012, Invitrogen, RRID: AB_2534079, 1:500 dilution) in 10% normal goat serum for 1 h at room temperature. Slides were mounted with Prolong Gold Antifade Reagent with DAPI (P36935, Molecular Probes). Images were taken by Leica TCX-SP8 confocal microscopy.

Isolation and culture of human myometrial cells

Human myometrial smooth cells were isolated as previously described [25]. Briefly, ~8 g of myometrial tissue was obtained from non-pregnant premenopausal women undergoing hysterectomy. Indications for hysterectomy were leiomyoma or endometriosis. To test the contraction of pregnant myometrial cells, myometrial tissues from the uterine fundus were obtained from a rare case of cesarean hysterectomy due to pregnancy complicated by cervical cancer stage Ib1 (S1 Fig). The tissue was minced into fragments and agitated in 60 mL of minimum essential medium eagle (MEM) containing 80 mg of collagenase B (11088807001, Roche), 40 mg of DNase I (11284932001, Roche), and 1.5 mL of 1 M HEPES for 2 h at 37°C. Tissue was then filtered through mesh to remove non-dispersed tissue fragments. The filtrate was centrifuged at 1000 g for 10 min to pellet the dispersed cells. Cells were resuspended in DMEM/F-12 that contained fetal bovine serum (10%, v/v) and antibiotic-antimycotic solution (1%, v/v). Cells were plated at a density of 0.5–1.0 × 105 cells/cm2 and incubated under 20% O2 and 5% CO2 at 37°C. All experiments were repeated at least three times.

A time-lapse movie of thrombin-treated myometrial cells was as follows: myometrial cells were seeded on a plastic dish. On the 6th day of culture, cells were treated with 4 U/mL of thrombin or PBS. Images were acquired every minute for a period of 120 min using a live-cell imaging system (Olympus IX71N microscope with DP71 camera). Images were assembled into one frame, and a 12-s movie (×600 accelerated) using Mac Preview and iMovie (Apple) was produced and uploaded to Zenodo (https://doi.org/10.5281/zenodo.3240679).

All tissues were obtained in accordance with the Kyoto University Graduate School and Faculty of Medicine, Kyoto University Hospital Ethics Committee after obtaining written patient consent (G1149). The institute’s Ethics Committee specifically approved this study.

Collagen lattice assay

Primary human myometrial cells (21 × 105 cells) were suspended in collagen type I mixture: 14 mL of Cellmatrix TypeI-A (0.3%, Nitta Gelatin), 1.75 mL of 10 × MEM (M0275, Sigma), and 1.75 mL of 0.08N NaOH with 200 mM HEPES. Final concentration in 6-well plates was 15 × 104 cells per well. The mixture was then placed in 6-well dishes (2 mL/well), and incubated at 37°C for 30 min. After confirming that the gel was completely solidified, 2 mL of DMEM/F12 growth medium was overlaid. Plates were incubated for 4 to 6 days. On the day of experiments, cells in collagen gels were pretreated with the following reagents for 1 h: 100 nM PAR1 selective antagonist SCH79797 (No.1592 Tocris), 1 μM ROCK inhibitor Y-27632 (10005583, Cayman Chemical), 10 μM MLCK inhibitor, ML-7 (11801, Cayman Chemical), 10 μM of indomethacin (I-7378, Sigma), or 1 μM of progesterone (28921–64, Nacalai-tesque). After pretreatment, collagen gels were gently detached from the bottom of the well using tips of plastic pipettes, and then 2 U/mL of thrombin (T7009, Sigma) was added. Images were captured at indicated times (ChemiDoc, Biorad). When pretreatment was unnecessary, 2 U/mL of thrombin or 10 μM of PAR1 activating peptide TFLLR-NH2 (1464, TOCRIS) was added after detachment of gels from the well. Each experiment was performed in triplicate, and repeated at least three times. The gel area was calculated by Image J software. Briefly, the outside of a gel was manually traced by the “Polygon selection” tool and the area was calculated by the “Measure” tool. The relative pixel area was shown in mean ± standard deviation (SD).

Immunocytochemistry

Myometrial cells were grown in 8-well chamber slides. After thrombin treatment (2 U/mL, 30 min), cells were fixed in 4% paraformaldehyde for 10 min. Slides were incubated with 10% normal goat serum for 30 min, and treated with primary antibodies overnight at 4°C as follows: PAR1 (N2-11, Novus Biologicals, NBP1-71770, RRID: AB_11027203, 1:100) and Phospho-Myosin Light Chain 2 (Ser19, Cell Signaling, #3671, RRID: AB_330248, 1:100). After incubation with secondary antibody (Goat anti-Rabbit IgG, Alexa Fluor 488, Invitrogen, A11008, A11008, RRID: AB_143165, 1:500 dilution) or (Goat anti-Mouse IgG, Alexa Fluor 594, RRID: AB_2534073, Invitrogen, 1:500 dilution), slides were mounted with Prolong Gold DAPI. Images were taken by Leica TCS-SP8 confocal microscopy, and generated by Image J software.

Immunoblots

Primary human myometrial cells were treated with 2 U/mL of thrombin for 30 min or the indicated time with or without pretreatment of SCH79797 (100 nM) or Y27632 (10 μM) for 1 h. Cells were lysed in RIPA buffer containing protease inhibitor cocktail (Complete Mini, Roche) and phosphatase inhibitor cocktail (PhosSTOP, Roche). The samples were centrifuged at 10,000 g for 20 min and the supernatant were used for immunoblots. Protein concentration was assayed by Pierce BCA Protein Assay Kit (23225, Thermo Scientific) according to the manufacturer’s instruction. Twenty micrograms of protein were applied to polyacrylamide gels, separated by electrophoresis, and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% bovine serum albumin (BSA) for 1 h at room temperature. A membrane was incubated with primary antibodies overnight at 4°C as follows: Phospho-Myosin Light Chain 2 (Ser19, Cell Signaling, #3671, RRID: AB_330248, 1:1000), myosin light chain 2 (D18E2, Cell Signaling, #8505, RRID: AB_2728760, 1:1000), Phospho-MYPT1 (Thr696, Cell Signaling, #5163, RRID: AB_10691830, 1:1000), Phospho-MYPT1 (Thr853, Cell Signaling, #4563, RRID: AB_1031185, 1:1000) MYPT1 (D6C1, Cell Signaling, #8574, RRID: AB_10998518, 1:1000) or anti-beta actin (Abcam, ab8227, 1:2000). All of the first antibodies were diluted in 5 mL of 5% BSA/Tris Buffered Saline with Tween 20 (TBST). Thereafter, blots were incubated with secondary antibody (Goat Anti-Rabbit IgG-HRP Conjugate, #170–6515, RRID: AB_11125142, Biorad, 1:10000 in 10 mL of 5% BSA/TBST) at room temperature for 1 h. The signal was detected by chemiluminescence (Pierce ECL Plus Western Blotting Substrate, #32132, Thermo Scientific).

Quantitative real-time Polymerase Chain Reaction (PCR)

At confluency, primary human myometrial cells were treated with the indicated dose of thrombin, IL-1β (0.1 ng/mL, 201-LB, R&D Systems), PGE2 (0.1 or 1 μM, 29334–21, Nacalai-tesque), and PGF2α (P0424, Sigma) for 24 h or the indicated time. If pretreatment was necessary, cells were treated with 10 μM of indomethacin or 1 µM progesterone for 1 h.

Quantitative RT-PCR was used to determine the relative levels of gene expression [26]. Primer sequences are shown in Table 1. Gene expression was normalized to that of GAPDH which was invariant in these cells. To analyze progesterone receptor expressions, mRNA levels of total progesterone receptor (total PgR) and progesterone receptor isoform-B (PgR-B) were quantified in ng/μL of cDNA using the standard curve method (Applied Biosystems). The mRNA abundance of progesterone receptor isoform-A (PgR-A) was calculated by subtracting the abundance of PgR-B mRNA from that of total PgR mRNA.

Table 1. Primer sequences used for quantitative RT-PCR.

GAPDH 5'- GGAGTCAACGGATTTGGTCGTA -3' 5'- CAACAATATCCACTTTACCAGAGTTA -3'
PTGS2 5'- GCTCAACACCGGAATTTTTGA -3' 5'- TCGAAGGAAGGGAATGTTATTCA -3'
GJA1 5'- ACTGGCGACAGAAACAATTCTTC -3' 5'- TTCTGCACTGTAATTAGCCCAGTT -3'
OXTR 5'- GCTGCAACCCCTGGATCTAC -3' 5'- GGAAGCGCTGCACGAGTT -3'
PTGER1 5'- CAGCCACTTCTAAGCACAACCA -3' 5'- GAATGGCTTTTTATTCCCAAAGG -3'
PTGER3 5'- GACGGCATTCAGCTTATGG -3' 5'- TGATGTCTGATTGAAGATCATTTTCA -3'
PTGFR 5'- GAGCGGCTCCGTCTTCTG -3' 5'- GGAGATAAAAGCCAACCACTCAA -3'
IL1B 5'- TCCTGCGTGTTGAAAGATGATAA -3' 5'- TTGGGTAATTTTTGGGATCTACACT -3'
PgR (total) 5'- CGGACACCTTGCCTGAAGTT -3' 5'- CAGGGCCGAGGGAAGAGTAG -3'
PgR-B 5'- GATAAAGGAGCCGCGTGTCA -3' 5'- GAGTACTCACAAGTCCGGCACTT -3'

ELISA

Prostaglandin E2 and F2a concentration in the condition media was assayed by Parameter Prostaglandin E2 Assay (KGE004B, R&D Systems) and PGF2α ELISA kit (ADI-900-069, Enzo Life Sciences) according to the manufacturer’s instruction.

Statistical analysis

Values were expressed as means ± SD. Data were analyzed by one-way analysis of variance (ANOVA) followed by the Student-Newman-Keuls test, unless otherwise indicated. p-values less than 0.05 were regarded as statistically significant.

Results

Thrombin receptor, protease-activated receptor 1 (PAR1), is expressed in human myometrium

Expression of thrombin receptor PAR1 [7] was investigated in human myometrium. As expected, PAR1 was localized to the plasma membrane of myometrial smooth muscle cells in uterine tissue from uncomplicated pregnancy (Fig 1A) and from non-pregnant women (Fig 1B). In pregnancy, PAR1 was also strongly expressed in the decidua of human fetal membranes (Fig 1C), as previously reported [12]. Thrombin was not expressed in normal pregnant myometrium (S1 Fig). Two representative cases of placental abruption are shown in Fig 1D–1G. Placental abruption caused exudation of blood into the myometrium near the site of placental attachment (Fig 1D and 1F). Thrombin was released in this bleeding site (Fig 1E and 1G). Although not observed in the center of the hemorrhage, PAR1 was expressed in myometrial cells peripheral to the bleeding site (Fig 1E and 1G). These findings suggest that uterine contraction induced by intrauterine bleeding may involve hemorrhage-derived thrombin-myometrial PAR1 interactions.

Fig 1. Thrombin receptor, protease-activated receptor 1 (PAR1), is expressed in human myometrium.

Fig 1

(A-C) Immunofluorescence of PAR1 (green) in myometrium from a pregnant woman (A), non-pregnant woman (B), and fetal membrane (C). Nuclei were stained with DAPI (blue). Am, amnion, Cho, chorion, Deci, decidua. (D-G) Localization of hemorrhage, thrombin, and PAR1 in placental abruption at 25 weeks of gestation (D and E), and 33 weeks gestation (F and G) resulting in disseminated intravascular coagulopathy and uterine bleeding requiring hysterectomy for hemostasis. (D and F) Hematoxylin and eosin staining of the myometrium adjacent to the placenta. Note that hemorrhage infiltrated the myometrium. Bars, 50 μm. (E and G) Immunofluorescence of PAR1 (green), thrombin (red), and DAPI (blue) at the same location of (A). Bars, 50 μm.

Thrombin increased contraction of primary human myometrial cells through PAR1

Having established PAR1 expression in myometrium and its potential relationship with uterine hemorrhage, the effect of thrombin on contraction of myometrium was quantified using collagen lattice assays and primary human myometrial cells from non-pregnant uteri.

Thrombin significantly increased the contraction of myometrial cells embedded in collagen gels from 5 min (Fig 2A). The relative pixel area with treatment of thrombin was 0.73 ± 0.02, 0.62 ± 0.02, 0.55 ± 0.03, and 0.43 ± 0.01 at 5, 15, 30, and 60 min, respectively, whereas that of PBS control was 0.90 ± 0.02, 0.82 ± 0.02, 0.78 ± 0.01, and 0.64 ± 0.04, respectively (p = 0.0006, 0.0001, 0.0001, 0.0011, respectively). Similarly, thrombin induced the contraction of myometrial cells from a pregnant uterus (S2 Fig). Through time-lapse live imaging, myometrial contraction was observed in thrombin-treated cells (left panel) compared with static cells treated with PBS (right panel) (S1 Movie. https://doi.org/10.5281/zenodo.3240679).

Fig 2.

Fig 2

Thrombin increased contraction of primary human myometrial cells through PAR1. (A and B) (Left images) Representative images of collagen lattice assay of human myometrial cells at 30 min treated with PBS (Ctl) and thrombin (A) or PAR1 activating peptide, TFLLR (B). (Right graphs) Quantification of myometrial contractions in collagen lattice assays (n = 3). **, p < 0.01 at each time point. (C) Collagen lattice assay of myometrial cells at 30 min with 2 U/mL of thrombin (Thr) pretreated with or without 100 nM PAR1 selective inhibitor (SCH79797, PAR1-i) for 1 h (n = 3). Representative image (upper panel) and quantification of gel areas (lower graph). The experiments were repeated three times. *, p < 0.05, and **, p < 0.01.

To support a role for PAR1 in this process, PAR1 activating peptide (PAR1 AP, TFLLR) also induced time-dependent contraction of myometrial cells (Fig 2B). The relative pixel area with treatment of TFLLR was 0.74 ± 0.02, 0.58 ± 0.01, 0.57 ± 0.01, 0.57 ± 0.02, and 0.57 ± 0.02 at 5, 20, 30, 45, and 60 min, respectively, whereas that of PBS was 0.92 ± 0.03, 0.91 ± 0.04, 0.91 ± 0.03, 0.90 ± 0.02, and 0.89 ± 0.02, respectively (p = 0.0001, 0.001, 0.0001, 0.0001, and 0.0001, respectively). Further, PAR1 inhibitor, SCH79797, significantly inhibited thrombin-induced contractions of myometrial cells (Fig 2C). Thrombin treatment significantly decreased the relative pixel area compared to the control (0.68 ± 0.02 vs. 0.85 ± 0.02; p = 0.0001), whereas pretreatment with SCH79797 completely blocked the contraction effect of thrombin compared to thrombin alone (0.87 ± 0.01, p = 0.0001). SCH79797 alone inhibited the spontaneous contraction of myometrial cells-embedded gel (0.98 ± 0.01) compared to PBS control (p = 0.0001). These data indicate that thrombin-induced myometrial contractions are mediated via PAR1.

Thrombin activated actin–myosin interaction by signaling phosphorylation of myosin light chain-2 (MLC2)

Activation of myosin is a key step in the actin–myosin interaction leading to myometrial contraction, and phosphorylation of serine 19 site of myosin regulatory light chain (MLC) activates myosin II protein [18]. Immunofluorescence of primary human myometrial cells revealed that PAR1 was ubiquitously expressed throughout the cell (Fig 3A). Treatment with thrombin increased phosphorylation of MLC2 significantly at 60 min (Fig 3A), and expression of MLC2 co-localized with PAR1 (Fig 3A merge). Immunoblot analysis revealed that thrombin increased phosphorylation of MLC2 at 5 min, which was sustained after 60 min (Fig 3B). Thereafter, dephosphorylation was initiated at 120 min (Fig 3B). PAR1 inhibitor completely blocked thrombin-induced phosphorylation of MLC2 (Fig 3C). The data suggest that thrombin binds to PAR1, resulting in activation of myosin through phosphorylation of MLC2 and contraction of myometrium.

Fig 3. Thrombin activates acto-myosin interaction by phosphorylation of myosin light chain-2 (MLC2).

Fig 3

(A) Immunocytochemistry of PAR1 (red) and phosphorylated MLC2 (Ser19, green) in human myometrial cells. (B, C) Immunoblots of phosphorylated MLC2 (p-MLC2), total MLC2, and β-actin of myometrial cells. Myometrial cells were treated with thrombin (2 U/mL) as a function of time (B), or pretreated with 100 nM PAR1 inhibitor (SCH79797) for 1 h, and then treated with 2 U/mL of thrombin for 30 min (C). The experiments were repeated three times.

Thrombin activates myosin by MLCK and ROCK

Next, we investigated the mechanisms by which thrombin activates the myosin motor protein. We first tested if the myosin light chain kinase (MLCK) inhibitor ML-7 altered smooth muscle cell contraction. In collagen lattice assays, ML-7 inhibited thrombin-induced myometrial cell contraction (Fig 4A). The relative pixel area with treatment of thrombin was decreased to 0.69 ± 0.03 compared to that of PBS (0.90 ± 0.01, p = 0.0001), whereas pretreatment with ML-7 blocked the contraction of thrombin (0.86 ± 0.03, p = 0.0001). ML-7 alone inhibited the spontaneous contraction of gel (0.97 ± 0.01) compared to PBS control (p = 0.0487). We next tested Rho-associated protein kinase (ROCK) inhibitor, Y-27632. Y-27632 partially inhibited the thrombin-induced contraction of myometrial cells (Fig 4B). Treatment of thrombin decreased the area of gel to 0.59 ± 0.01 compared to that of PBS (0.93 ± 0.05, p = 0.0001), whereas pretreatment with Y27632 partially blocked the contraction induced by thrombin (0.71 ± 0.01, p = 0.0068). Y27632 alone inhibited the spontaneous contraction of gel (1.06 ± 0.03) compared to PBS control (p = 0.0001). Further, Y-27632 inhibited thrombin-induced phosphorylation of MLC2 (Fig 4C). These data suggest that thrombin activates two kinases, MLCK and ROCK, and that both kinases phosphorylate MLC2.

Fig 4. Thrombin activates myosin by MLCK and ROCK.

Fig 4

(A, B) Collagen lattice assay with MLCK and ROCK inhibitors. Myometrial cells were pretreated with (A) 10 μM MLCK inhibitor ML7, or (B) 1 μM of Rho-kinase inhibitor Y-27632 for 1 h, and treated with 2 U/mL of thrombin for 30 min. Representative image (left panels) and quantification of gel areas (right graphs). n = 3 in each group. (C) Immunoblots of phosphorylated MLC2 (p-MLC2), MLC2, and β-actin of myometrial cells. (D) Immunoblots of phosphorylated MYPT1 (Thr696 and Thr853), MYPT1, and β-actin of myometrial cells. Myometrial cells were treated with 2 U/mL of thrombin as indicated time. **, p < 0.01. The experiments were repeated three times.

We next tested whether thrombin-induced increases in MLC2 phosphorylation may involve decreased myosin phosphatase activity. Myosin phosphatase dephosphorylates MLC and inhibits activation of acto-myosin [27]. MYPT1, the targeting subunit of myosin phosphatase, has two different activating and inhibitory phosphorylation sites. Phosphorylation of MYPT1 at sites Thr696 and Thr853 results in inhibition of myosin phosphatase and thereby increased MLC2 phosphorylation [28]. Thrombin, however, did not phosphorylate MYPT1 at these sites (Fig 4D), suggesting that thrombin-induced contractions are initiated through MLCK-induced activation of MLC2 phosphorylation but not inhibition of myosin phosphatase.

Thrombin increased PTGS2 and PGF2α in myometrial cells

We next assessed the effect of thrombin on prostaglandin (PG) synthesis in myometrial cells. 1 U/mL of thrombin increased prostaglandin-endoperoxidase 2 (PTGS2 or cyclooxygenase 2) mRNA 8-fold at 24 h with 10-fold increases using 4 U/mL of thrombin (Fig 5A). Thrombin increased PTGS2 mRNA synthesis as early as 4 h, reaching plateau levels between 12 and 24 h (Fig 5B). PGF2α in the media of thrombin-treated myometrial cells increased dose- and time-dependently (Fig 5C and 5D). PGE2 in the media was also increased by thrombin, although the degree of increase was less than that for PGF2α (Fig 5E and 5F). Indomethacin, a PTGS2 inhibitor, partially blocked thrombin-induced myometrial contraction (Fig 5G and 5H). The relative pixel area with treatment of thrombin was decreased to 0.75 ± 0.05 compared to that of PBS (0.96 ± 0.03, p = 0.0001), whereas pretreatment with indomethacin blocked the contraction of gel by thrombin (0.87 ± 0.01, p = 0.0020). Indomethacin alone inhibited the spontaneous contraction of myometrial cells-embedded gel (1.11 ± 0.02) compared to PBS control (p = 0.0283). The data suggest that thrombin-induced contractions are mediated not only through direct thrombin-PAR1-MLC2 activation, but also by prostaglandin synthesis. The latter may lead to prolonged tonic contractions associated with placental abruption or massive subchorionic hematoma.

Fig 5. Effect of thrombin on PTGS2 mRNA expression and prostaglandin synthesis in myometrial cells.

Fig 5

(A, B) Thrombin-induced increases of PTGS2 mRNA at 24 h with different doses of thrombin (A), or 2 U/mL of thrombin as a function of time (B). (C-F) Thrombin-induced increases of PGF2α (C, D) and PGE2 (E, F) in the media of thrombin-treated cells. Dose-dependent changes at 24 h (C and E) and time course with 2 U/mL of thrombin (D, F). (G and H) Collagen lattice assay of myometrial cells at 30 min with 2 U/mL of thrombin, pretreated with 10 μM indomethacin for 4 h. (G) Representative image and (H) quantification of gel areas. n = 3 in each group. *, p < 0.05, and **, p < 0.01. The experiments were repeated three times.

We next assessed the effect of thrombin on the expression of other contraction-associated proteins. Gene expression of prostaglandin E2 and F2α receptors (PTGER1, PTGER3, and PTGFR), oxytocin receptor (OXTR), and the gap junction protein connexin 43 (GJA1) were also analyzed (Fig 6A). Expression of GJA1, OXTR, and PTGER1 mRNA was not altered by thrombin whereas mRNA levels of PTGER3 and PTGFR were decreased (Fig 6A). Interestingly, mRNA expression of the inflammatory cytokine, IL-1β, was upregulated by thrombin (Fig 6A). Treatment of myometrial cells with IL-1β robustly increased PTGS2 mRNA. PGE2, but not PGF2α, increased IL1B mRNA (Fig 6D). This suggests that PGE2 is increased by positive feedback through IL-1β (Fig 6F). Both thrombin and IL-1β decreased PTGER3 mRNA (Fig 6A and 6B), and pretreatment of indomethacin alleviated the decrease of PTGER3 mRNA (Fig 6C). In addition, both PGE2 and PGF2α decreased PTGER3 mRNA (Fig 6D and 6E). Collectively, the thrombin-induced decrease of PTGER3 mRNA was mediated by PGE2 and PGF2α through IL-1β (Fig 6F). In contrast, IL-1β did not change PTGFR mRNA (Fig 6B), and indomethacin did not recover the decrease of PTGFR mRNA by thrombin treatment (Fig 6C). Moreover, neither PGE2 nor PGF2α regulate PTGFR mRNA (Fig 6D and 6E). These findings suggest that the thrombin-induced decrease of PTGFR mRNA might be regulated by molecules other than prostaglandins.

Fig 6. Effect of thrombin on contraction-associated proteins in myometrial cells.

Fig 6

(A) IL1B, GJA1, OXTR, PTGER1, PTGER3, and PTGFR mRNA gene expression in thrombin (2 U/mL)-treated myometrial cells at 24 h. n = 3 in each group. (B) Gene expressions of myometrial cells with treatment of 0.1 ng/mL of IL-1β at 24 h. (C) mRNA expressions of PTGER and PTGFR with treatment of thrombin or IL-1β, pretreated with indomethacin. (D) Gene expressions of myometrial cells with treatment of 0.1 μM of PGE2 (D) or 0.1 μM of PGF2α (E) at 24 h. n = 3. *, p < 0.05, and **, p < 0.01. (F) Scheme of regulation of contraction associated proteins by thrombin. The experiments were repeated three times.

Progesterone inhibited thrombin-induced myometrial contraction

Finally, to test the therapeutic potential of progesterone for thrombin-induced myometrial contraction, we used collagen lattice assays (Fig 7A). Progesterone partially blocked thrombin-induced myometrial contractions at two physiologic concentrations (1 µM, Fig 6A and 0.1 μM, S1 Fig). Under pretreatment with 1 μM of progesterone, the relative pixel area by thrombin treatment was decreased to 0.74 ± 0.03 compared to that of PBS (0.93 ± 0.01, p = 0.0001), whereas pretreatment with progesterone partially blocked the contraction by thrombin (0.84 ± 0.02, p = 0.0010). Progesterone alone relaxed the myometrial cells (1.02 ± 0.01) compared to PBS control (p = 0.0030). In addition, progesterone treatment resulted in inhibition of thrombin-induced increases of PTGS2 and IL1B mRNA (Fig 7B). mRNA level of thrombin receptor, PAR1 gene, (F2R) was not changed by thrombin treatment, but expression of F2R mRNA was decreased by progesterone, notwithstanding the presence of thrombin (Fig 7B). Collectively, the results indicate that progesterone partially alleviated thrombin-induced myometrial contractions.

Fig 7. Effect of progesterone (P4) on thrombin-induced myometrial cell contractions.

Fig 7

(A) Collagen lattice assay of myometrial cells at 30 min with 2 U/mL of thrombin (Thr) pretreated with 1 μM progesterone (P4) for 1 h. Representative image (upper panel) and quantification of gel areas (lower graph). (B) Inhibition of thrombin-induced increases of PTGS2, IL1B, and F2R mRNA by P4. Myometrial cells were pretreated with 1 μM of P4 for 1 h, and then treated with 2 U/mL of thrombin. (C) Gene expressions of progesterone receptor-A and–B (PgR-A and PgR-B) with 24 h treatment of 1 U/mL of thrombin, 10 nM of PGE2, and 10 nM of PGF2α (upper graphs) and PgR-A to PgR-B ratio (lower graphs). n = 3 in each group. *, p < 0.05, and **, p < 0.01. The experiments were repeated three times.

Progesterone receptors (PRs) control progesterone responsiveness. Human PR has two major isoforms. PR-B is the full-length progesterone receptor and PR-A is the truncated form of PR-B [29]. PR-B principally mediates relaxatory actions of progesterone, whereas PR-A inhibits the transcriptional activity of PR-B. Therefore, the PR-A to PR-B ratio regulates the transcriptional activity of progesterone. The effect of thrombin on the mRNA expression of progesterone receptors (PgR-A and PgR-B) was analyzed in primary myometrial cells. The abundance of total PR (PgR-A plus PgR-B) was decreased by thrombin (Fig 7C). The PgR-B mRNA level was particularly significantly decreased by thrombin (Fig 7C). Consequently, the PgR-A to PgR-B ratio was not changed by thrombin (Fig 7C). In contrast, treatment of PGE2 or PGF2α did not change PgR-A and PgR-B mRNA levels, and the PgR-A / PgR-B ratio was not changed (Fig 7C). Therefore, the suppressed transcription of PR seems to be mediated by molecules other than prostaglandins. These data suggest that thrombin also strengthens myometrial contraction by reducing the expression of total abundance of progesterone receptors, although it was not regulated by prostaglandins.

Discussion

It is empirically known that intrauterine bleeding such as decidual hemorrhage (subchorionic hematoma) or placental abruption causes uterine contraction, which sometimes leads to preterm birth. We previously showed that thrombin injection into pregnant mice caused preterm birth, suggesting a pathological role of thrombin in vivo [12]. Here, we further clarified the molecular mechanisms by which thrombin stimulates uterine contraction, and the potential of progesterone to antagonize thrombin.

In this study, we utilized uterus tissue from non-pregnant women because uterus tissue from pregnant women is rarely available in our facility. We tested the contraction of myometrial cells from a rare case of cesarean hysterectomy and found that the contraction of myometrial cells from pregnant uterus was similar to that from non-pregnant uterus. In addition, thrombin receptor PAR1 was expressed in both pregnant and non-pregnant myometrium (Fig 1). Previously, O’Sullivan et al. showed that thrombin and PAR1 activating peptide exerted a stimulatory effect on uterine contractions in both pregnant and non-pregnant myometrial tissues [30]. They also confirmed that there was no significant difference in sensitivity to thrombin between pregnant and non-pregnant myometrium. Therefore, our data obtained from non-pregnant myometrium provide valid insight into the mechanisms of preterm birth induced by intrauterine bleeding.

PAR1 was highly expressed in human pregnant myometrium, and thrombin and PAR1 activating peptide induced significant myometrial contraction, as previously reported [13, 14, 30]. PAR1 was originally identified as the thrombin receptor on platelets, and activation of PAR1 signaling stimulates platelet aggregation [31]. Thereafter, PAR1 activity was found to be associated with the hemostasis and thrombosis of platelets, vascular tone and permeability in the endothelium, and contraction and atherosclerosis of vascular smooth muscle cells [7, 32]. PAR1 is also involved in inflammation and tumor metastasis. O’Brien et al. showed that PAR1 (F2R) was expressed in both pregnant and non-pregnant myometrium, which is compatible with our data from immunofluorescence; they also showed that expression is higher during pregnancy compared to non-pregnancy [33]. Interestingly, PAR1 expression increased 9-fold during labor in human myometrium compared to the state of not in labor, indicating that the sensitivity to thrombin is increased during labor. The increased expression of PAR1 would contribute to stronger myometrial contraction during labor and puerperium.

Our data showed that the human uterus possesses a mechanism to sense abnormal intrauterine bleeding, and once bleeding occurs in emergency situations such as placental abruption, traumatic hemorrhage, or threatened abortion, myometrium contractions are initiated to expel the conceptus and protect the mother. PAR1 signal is then passed to myosin light chain via two kinases: MLCK and ROCK. Activation of G protein-coupled receptor, PAR1, by thrombin increases intracellular free Ca2+ [13]. Ca2+ binds to calmodulin, and the Ca2+-calmodulin complex associates with the catalytic subunit of MLCK, which phosphorylates serine at position 19 on the regulatory light chain of MLC2 [17]. In contrast, upon activation of G-protein coupled receptor PAR1, Rho proteins are translocated to the cell membrane where guanine nucleotide exchange factors (Rho-GEFs) promote exchange of GDP to GTP of Rho. GTP-bound “turned-on” Rho proteins activate ROCK, which also phosphorylates the regulatory light chain of MLC2 [34]. In addition to direct activation of the actomyosin complex, we found that thrombin also increased expression of PTGS2 mRNA thereby releasing PGE2 and PGF2α from myometrial cells. This mechanism is similar to that in fetal membranes in which thrombin increases PTGS2 mRNA and PGE2 synthesis of amnion in vitro and in vivo [12]. Hence, thrombin-stimulated prostaglandin synthesis of myometrium strengthens myometrial contractions in an autocrine fashion.

In human pregnancy, the placenta is the source of high progesterone concentrations at the maternal–fetal interface. Interruption of this communication may be highly localized in the case of placental separation/abruption and not reflected in maternal blood. Here, we showed that progesterone inhibited thrombin-induced PTGS2, IL1B, and F2R mRNA. All of these suppressions of prostaglandin synthesis, inflammatory cytokines, and expression of thrombin receptor would contribute to antagonizing myometrial contractions by thrombin. It is possible, therefore, that progesterone may serve a therapeutic potential in cases of premature uterine contractions caused by decidual hemorrhage. Relaxation of the myometrium may restore blood flow to the fetus and facilitate prolongation of pregnancy. We emphasize, however, that our experiments were conducted in vitro in the absence of blood vessels and a rich capillary bed. Thus, more research is warranted regarding the safety and efficacy of progesterone for intrauterine bleeding before it can be recommended.

Progesterone receptors regulate the contraction of the human uterus during pregnancy, and PR-A and PR-B expression is altered in myometrium in labor, increasing the ratio of the PR-A to PR-B level [35–37]. In our study, thrombin decreased the total expression of progesterone receptor, although the PgR-A to PgR-B mRNA ratio was not changed, and prostaglandins did not regulate the downregulation of PRs. Madsen et al. showed that the PgR-A / PgR-B mRNA ratio was increased by PGE2 and PGF2α in an immortal pregnant human myometrial cell line [35]. However, they also showed that the PgR-A / PgR-B mRNA ratio tended to return to the basal level when prostaglandin concentrations increased. We utilized a comparably high dose of prostaglandins (10 nM) in our experiments, so this might be why the PgR-A to PgR-B mRNA ratio was not altered in our study. In addition to the direct effect of myometrial contraction, thrombin further strengthens contractions by reducing the progesterone responsiveness caused by the downregulation of progesterone receptor expression. Further study is necessary to investigate the regulation of progesterone receptors by thrombin.

The ultimate purpose of this study is to provide basic information regarding the mechanisms of preterm labor and poor pregnancy outcomes of women with intrauterine bleeding (decidual hemorrhage). Here, we found that progesterone was useful for blockade of thrombin-induced contraction. This finding suggests the potency of progesterone in subchorionic hematoma of the first and second trimester to prevent preterm birth and spontaneous abortion, especially if the extraordinarily high levels of progesterone at the placental–myometrial interface are disrupted by bleeding.

Thrombin–antithrombin complex (TAT) levels increases during normal pregnancy [38]. The mean TAT level is 1.9 μg/L in non-pregnant women regardless of menstrual cycle phase, but increases to 16.0 ± 2.8 μg/L in the 2nd trimester, 21.5 ± 11.9 μg/L at term, and 28.6 ± 12.8 μg/L in the 2nd stage of labor [15]. In addition, TAT further increases in the 3rd stage of labor upon separation of the placenta [15, 16]. This is due to the release of thromboplastic substances at the site of placental separation. It seems that released thrombin from the placenta-attached site to the uterus facilitates the contraction of myometrium (uterine involution), which prevents massive hemorrhage at parturition. Therefore, the abnormal increase of thrombin mid-trimester is a pathological process that leads to preterm birth, whereas the increase in maternal circulating thrombin in the 3rd stage of labor and parturition plays a role in the physiological contraction of myometrium.

Recently, it has been suggested that thrombin may be produced from fetal membrane not only from intrauterine bleeding but also by bacterial infection [39]. This finding is consistent with our previous data in which the protease activity of thrombin was significantly increased in amnion from women with preterm birth without intrauterine bleeding [12]. Therefore, inhibition of thrombin signaling pathways has potential to treat labor that is not associated with intrauterine bleeding.

Conclusions

Thrombin induces myometrial contractions through both direct (PAR1-mediated myosin activation) and indirect (PTGS2-mediated increases in prostaglandin synthesis) mechanisms. The therapeutic potential of progesterone was suggested for preterm labor complicated by intrauterine bleeding that is not life-threatening.

Supporting information

S1 Fig. Expression of protease-activated receptor 1 (PAR1) and thrombin (F2) in human pregnant myometrium.

(TIF)

S2 Fig. Thrombin increased contraction of primary human myometrial cells from pregnant uterus.

(TIF)

S3 Fig. Original uncropped and unadjusted images of immunoblots of Fig 3B.

(TIF)

S4 Fig. Original uncropped and unadjusted images of immunoblots of Figs 3C and 4C.

(TIF)

S5 Fig. Original uncropped and unadjusted images of immunoblots of Fig 4D.

(TIF)

S1 Movie. Time-lapse live imaging of thrombin-treated myometrium.

Available at https://doi.org/10.5281/zenodo.3240679.

(TXT)

Acknowledgments

We thank Professor R. Ann Word (University of Texas, Southwestern Medical Center, Department of Obstetrics and Gynecology) for critical comments on this manuscript. We thank Ms. Mizuho Ohshima and Ms. Ayako Yoshida for technical assistance, and Ms. Iku Sugiyama and Ms. Akiko Abe for editorial assistance. We also thank the shared resource cores in the Medical Research Support Center for confocal microscopy at Kyoto University Graduate School of Medicine.

Data Availability

All relevant data are within the manuscript and its Supporting Information files, and Supplementary Video 1 is uploaded to Zenodo (https://doi.org/10.5281/zenodo.3240679).

Funding Statement

The authors received no specific funding for this work.

References

  • 1.Maso G, D'Ottavio G, De Seta F, Sartore A, Piccoli M, Mandruzzato G. First-trimester intrauterine hematoma and outcome of pregnancy. Obstetrics and gynecology. 2005;105(2):339–44. 10.1097/01.AOG.0000152000.71369.bd . [DOI] [PubMed] [Google Scholar]
  • 2.Nagy S, Bush M, Stone J, Lapinski RH, Gardo S. Clinical significance of subchorionic and retroplacental hematomas detected in the first trimester of pregnancy. Obstetrics and gynecology. 2003;102(1):94–100. 10.1016/s0029-7844(03)00403-4 . [DOI] [PubMed] [Google Scholar]
  • 3.Tuuli MG, Norman SM, Odibo AO, Macones GA, Cahill AG. Perinatal outcomes in women with subchorionic hematoma: a systematic review and meta-analysis. Obstetrics and gynecology. 2011;117(5):1205–12. 10.1097/AOG.0b013e31821568de . [DOI] [PubMed] [Google Scholar]
  • 4.Harger JH, Hsing AW, Tuomala RE, Gibbs RS, Mead PB, Eschenbach DA, et al. Risk factors for preterm premature rupture of fetal membranes: a multicenter case-control study. Am J Obstet Gynecol. 1990;163(1 Pt 1):130–7. Epub 1990/07/01. 10.1016/s0002-9378(11)90686-3 . [DOI] [PubMed] [Google Scholar]
  • 5.Oyelese Y, Ananth CV. Placental abruption. Obstetrics and gynecology. 2006;108(4):1005–16. 10.1097/01.AOG.0000239439.04364.9a . [DOI] [PubMed] [Google Scholar]
  • 6.Norman SM, Odibo AO, Macones GA, Dicke JM, Crane JP, Cahill AG. Ultrasound-detected subchorionic hemorrhage and the obstetric implications. Obstetrics and gynecology. 2010;116(2 Pt 1):311–5. 10.1097/AOG.0b013e3181e90170 . [DOI] [PubMed] [Google Scholar]
  • 7.Coughlin SR. Thrombin signalling and protease-activated receptors. Nature. 2000;407(6801):258–64. Epub 2000/09/23. 10.1038/35025229 . [DOI] [PubMed] [Google Scholar]
  • 8.Konishi I. Precision Medicine in Gynecology and Obstetrics: Springer; 2017. [Google Scholar]
  • 9.Chaiworapongsa T, Espinoza J, Yoshimatsu J, Kim YM, Bujold E, Edwin S, et al. Activation of coagulation system in preterm labor and preterm premature rupture of membranes. J Matern Fetal Neonatal Med. 2002;11(6):368–73. 10.1080/jmf.11.6.368.373 . [DOI] [PubMed] [Google Scholar]
  • 10.Erez O, Romer R, Vaisbuch E, Chaiworapongsa T, Kusanovic JP, Mazaki-Tovi S, et al. Changes in amniotic fluid concentration of thrombin-antithrombin III complexes in patients with preterm labor: evidence of an increased thrombin generation. J Matern Fetal Neonatal Med. 2009;22(11):971–82. Epub 2009/11/11. 10.3109/14767050902994762 [pii] 10.3109/14767050902994762. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Rosen T, Kuczynski E, O'Neill LM, Funai EF, Lockwood CJ. Plasma levels of thrombin-antithrombin complexes predict preterm premature rupture of the fetal membranes. J Matern Fetal Med. 2001;10(5):297–300. 10.1080/714904361 . [DOI] [PubMed] [Google Scholar]
  • 12.Mogami H, Keller PW, Shi H, Word RA. Effect of thrombin on human amnion mesenchymal cells, mouse fetal membranes, and preterm birth. The Journal of biological chemistry. 2014;289(19):13295–307. 10.1074/jbc.M114.550541 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Elovitz MA, Ascher-Landsberg J, Saunders T, Phillippe M. The mechanisms underlying the stimulatory effects of thrombin on myometrial smooth muscle. American journal of obstetrics and gynecology. 2000;183(3):674–81. 10.1067/mob.2000.106751 . [DOI] [PubMed] [Google Scholar]
  • 14.Elovitz MA, Saunders T, Ascher-Landsberg J, Phillippe M. Effects of thrombin on myometrial contractions in vitro and in vivo. American journal of obstetrics and gynecology. 2000;183(4):799–804. 10.1067/mob.2000.108897 . [DOI] [PubMed] [Google Scholar]
  • 15.Uszynski M. Generation of thrombin in blood plasma of non-pregnant and pregnant women studied through concentration of thrombin-antithrombin III complexes. European journal of obstetrics, gynecology, and reproductive biology. 1997;75(2):127–31. 10.1016/s0301-2115(97)00101-2 . [DOI] [PubMed] [Google Scholar]
  • 16.Yoshimura T, Ito M, Nakamura T, Okamura H. The influence of labor on thrombotic and fibrinolytic systems. European journal of obstetrics, gynecology, and reproductive biology. 1992;44(3):195–9. 10.1016/0028-2243(92)90098-j . [DOI] [PubMed] [Google Scholar]
  • 17.Somlyo AP, Somlyo AV. Signal transduction and regulation in smooth muscle. Nature. 1994;372(6503):231–6. 10.1038/372231a0 . [DOI] [PubMed] [Google Scholar]
  • 18.Somlyo AP, Somlyo AV. Ca2+ sensitivity of smooth muscle and nonmuscle myosin II: modulated by G proteins, kinases, and myosin phosphatase. Physiological reviews. 2003;83(4):1325–58. 10.1152/physrev.00023.2003 . [DOI] [PubMed] [Google Scholar]
  • 19.Renthal NE, Williams KC, Mendelson CR. MicroRNAs—mediators of myometrial contractility during pregnancy and labour. Nat Rev Endocrinol. 2013;9(7):391–401. 10.1038/nrendo.2013.96 . [DOI] [PubMed] [Google Scholar]
  • 20.Borna S, Sahabi N. Progesterone for maintenance tocolytic therapy after threatened preterm labour: a randomised controlled trial. The Australian & New Zealand journal of obstetrics & gynaecology. 2008;48(1):58–63. 10.1111/j.1479-828X.2007.00803.x . [DOI] [PubMed] [Google Scholar]
  • 21.da Fonseca EB, Bittar RE, Carvalho MH, Zugaib M. Prophylactic administration of progesterone by vaginal suppository to reduce the incidence of spontaneous preterm birth in women at increased risk: a randomized placebo-controlled double-blind study. American journal of obstetrics and gynecology. 2003;188(2):419–24. 10.1067/mob.2003.41 . [DOI] [PubMed] [Google Scholar]
  • 22.Meis PJ, Klebanoff M, Thom E, Dombrowski MP, Sibai B, Moawad AH, et al. Prevention of recurrent preterm delivery by 17 alpha-hydroxyprogesterone caproate. The New England journal of medicine. 2003;348(24):2379–85. 10.1056/NEJMoa035140 . [DOI] [PubMed] [Google Scholar]
  • 23.Norman JE, Marlow N, Messow CM, Shennan A, Bennett PR, Thornton S, et al. Vaginal progesterone prophylaxis for preterm birth (the OPPTIMUM study): a multicentre, randomised, double-blind trial. Lancet. 2016;387(10033):2106–16. 10.1016/S0140-6736(16)00350-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.O'Brien JM, Adair CD, Lewis DF, Hall DR, Defranco EA, Fusey S, et al. Progesterone vaginal gel for the reduction of recurrent preterm birth: primary results from a randomized, double-blind, placebo-controlled trial. Ultrasound in obstetrics & gynecology: the official journal of the International Society of Ultrasound in Obstetrics and Gynecology. 2007;30(5):687–96. 10.1002/uog.5158 . [DOI] [PubMed] [Google Scholar]
  • 25.Casey ML, MacDonald PC, Mitchell MD, Snyder JM. Maintenance and characterization of human myometrial smooth muscle cells in monolayer culture. In vitro. 1984;20(5):396–403. 10.1007/bf02619585 . [DOI] [PubMed] [Google Scholar]
  • 26.Wieslander CK, Marinis SI, Drewes PG, Keller PW, Acevedo JF, Word RA. Regulation of elastolytic proteases in the mouse vagina during pregnancy, parturition, and puerperium. Biology of reproduction. 2008;78(3):521–8. 10.1095/biolreprod.107.063024 . [DOI] [PubMed] [Google Scholar]
  • 27.Matsumura F, Hartshorne DJ. Myosin phosphatase target subunit: Many roles in cell function. Biochemical and biophysical research communications. 2008;369(1):149–56. 10.1016/j.bbrc.2007.12.090 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Matsumura F. Regulation of myosin II during cytokinesis in higher eukaryotes. Trends in cell biology. 2005;15(7):371–7. 10.1016/j.tcb.2005.05.004 . [DOI] [PubMed] [Google Scholar]
  • 29.Jacobsen BM, Horwitz KB. Progesterone receptors, their isoforms and progesterone regulated transcription. Molecular and cellular endocrinology. 2012;357(1–2):18–29. 10.1016/j.mce.2011.09.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.O'Sullivan CJ, Allen NM, O'Loughlin AJ, Friel AM, Morrison JJ. Thrombin and PAR1-activating peptide: effects on human uterine contractility in vitro. American journal of obstetrics and gynecology. 2004;190(4):1098–105. 10.1016/j.ajog.2003.09.050 . [DOI] [PubMed] [Google Scholar]
  • 31.Vu TK, Hung DT, Wheaton VI, Coughlin SR. Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell. 1991;64(6):1057–68. 10.1016/0092-8674(91)90261-v . [DOI] [PubMed] [Google Scholar]
  • 32.Willis Fox O, Preston RJS. Molecular basis of protease-activated receptor 1 signaling diversity. Journal of thrombosis and haemostasis: JTH. 2020;18(1):6–16. 10.1111/jth.14643 . [DOI] [PubMed] [Google Scholar]
  • 33.O'Brien M, Morrison JJ, Smith TJ. Expression of prothrombin and protease activated receptors in human myometrium during pregnancy and labor. Biology of reproduction. 2008;78(1):20–6. 10.1095/biolreprod.107.062182 . [DOI] [PubMed] [Google Scholar]
  • 34.Puetz S, Lubomirov LT, Pfitzer G. Regulation of smooth muscle contraction by small GTPases. Physiology. 2009;24:342–56. 10.1152/physiol.00023.2009 . [DOI] [PubMed] [Google Scholar]
  • 35.Madsen G, Zakar T, Ku CY, Sanborn BM, Smith R, Mesiano S. Prostaglandins differentially modulate progesterone receptor-A and -B expression in human myometrial cells: evidence for prostaglandin-induced functional progesterone withdrawal. The Journal of clinical endocrinology and metabolism. 2004;89(2):1010–3. 10.1210/jc.2003-031037 . [DOI] [PubMed] [Google Scholar]
  • 36.Merlino AA, Welsh TN, Tan H, Yi LJ, Cannon V, Mercer BM, et al. Nuclear progesterone receptors in the human pregnancy myometrium: evidence that parturition involves functional progesterone withdrawal mediated by increased expression of progesterone receptor-A. The Journal of clinical endocrinology and metabolism. 2007;92(5):1927–33. 10.1210/jc.2007-0077 . [DOI] [PubMed] [Google Scholar]
  • 37.Mesiano S, Chan EC, Fitter JT, Kwek K, Yeo G, Smith R. Progesterone withdrawal and estrogen activation in human parturition are coordinated by progesterone receptor A expression in the myometrium. The Journal of clinical endocrinology and metabolism. 2002;87(6):2924–30. 10.1210/jcem.87.6.8609 . [DOI] [PubMed] [Google Scholar]
  • 38.Elovitz MA, Baron J, Phillippe M. The role of thrombin in preterm parturition. American journal of obstetrics and gynecology. 2001;185(5):1059–63. 10.1067/mob.2001.117638 . [DOI] [PubMed] [Google Scholar]
  • 39.Feng L, Allen TK, Marinello WP, Murtha AP. Infection-induced thrombin production: a potential novel mechanism for preterm premature rupture of membranes (PPROM). American journal of obstetrics and gynecology. 2018;219(1):101 e1–e12. 10.1016/j.ajog.2018.04.014 . [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Tamas Zakar

14 Oct 2019

PONE-D-19-21553

Mechanisms of Thrombin-Induced Myometrial Contractions: Potential Targets of Progesterone

PLOS ONE

Dear Dr. Mogami,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

The reviewers agree that the manuscript tackles an important and under-researched topic. The most critical issues to be addressed for possible publication are clarification of the number of biological vs. technical replicates presented and included in the statistical analyses and also to make available all data that form the basis of the manuscript. A minimum of 3 (three) biological replicates is mandatory in all experiments. The conclusions and interpretations should be revised to take into account the comments put forward by the expert reviewers. The Authors should seriously consider to add experiments along the suggestions by Reviewer 2. ​

We would appreciate receiving your revised manuscript by Nov 28 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Tamas Zakar

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed:

https://link.springer.com/book/10.1007%2F978-981-10-2489-4

The text that needs to be addressed is in the Introduction section.

In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed. "

3. Thank you for including your ethics statement: All human myometrial tissues were obtained in accordance with the ethics committee of the Graduate School of Medicine, Kyoto University after written consent (G1149).

Please amend your current ethics statement to include the full name of the ethics committee/institutional review board(s) that approved your specific study.

Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

5.  We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: IS THE MANUSCRIPT TECHNICALLY SOUND, AND DO THE DATA SUPPORT THE CONCLUSIONS?

The manuscript follows a logical approach of using the collagen lattice assay to measure contractility induced in primary myometrial cells following treatment with thrombin. The extent of contraction is quantitated by measuring the area of lattice using Image J software.

Figure 1 demonstrates that both thrombin and its receptor, PAR1, are present in pregnant and non-pregnant human myometrium.

Figure 2 demonstrates that thrombin induces contraction of primary myometrial cells, and that activation of PAR1, by means of the activating peptide, also induces contraction. Furthermore, the PAR1 inhibitor, SCH79797, inhibited the vast majority (but not all) of the thrombin-induced contraction.

Curiously, page 9 line 7 indicates that the primary myometrial cells utilised to generate the data in Figure 2 were derived from non-pregnant myometrium, rather than pregnant myometrium. Is this correct or should this say

Figure 3 demonstrates that thrombin induces MLC-ser19 phosphorylation, and that this phosphorylation is inhibited by the PAR1 inhibitor. Densitometric

Figure 4 provides evidence that thrombin-induced contraction of primary myometrial cells is mediated by myosin light chain kinase and ROCK, as evidenced by the MLCK inhibitor (ML-7) and the ROCK inhibitor (Y-27632) both partially inhibiting thrombin-induced MLC-ser19 phosphorylation. Additionally, Panel D demonstrates that thrombin does not promote myometrial contraction by inhibiting (phosphorylating) the regulatory subunit of myosin phosphatase, MYPT1.

Figure 5 demonstrates that thrombin-induced contraction of primary myometrial cells is associated with (i) significantly upregulated expression of PTGS2 (COX2) after 4 h, (ii) significantly increased production of PGF2 alpha after 4 h, with maximum levels observed after 24 h, (iii) significantly upregulated expression of IL1B, (iv) significantly down-regulated expression of both PTGER3 (EP3) and PTGFR (FP), and (v) no change in expression of GJA1 (CX43), OXTR or PTGER1 (EP1). Additionally, panels E and F demonstrate that indomethacin partially inhibits the thrombin-induced contraction, demonstrating that thrombin-induced contraction is in-part indirect via stimulating prostaglandin production.

Figure 6 demonstrates that thrombin-induced contraction of primary myometrial cells is partially inhibited by pre-treating the cells with progesterone (P4) or medroxyprogesterone acetate (MPA).

The conclusions drawn are appropriate for the data, however, questions remain as to the whether the data is comprised of technical replicates or biological replicates.

HAS THE STATISTICAL ANALYSIS BEEN PERFORMED APPROPRIATELY AND RIGOROUSLY?

Further explanation is required as to what is being considered a replicate. For instance, the Figure 2 legend says “n=3 in each group. Experiment was repeated with cells from another preparation with identical results”. This reads as though the study was performed with 3 technical replicates (ie myocytes from 1 woman plated across multiple wells and then the treatment applied to 3 of those wells), and then repeated in only one other woman. If so, this would mean that only n=2 biological replicates have been examined (with 3 technical replicates for each biological replicate). The minimum requirement is n=3 biological replicates, so if n=3 biological replicates have indeed been performed, this needs to be explained clearly in the materials and methods.

HAVE THE AUTHORS MADE ALL DATA UNDERLYING THE FINDINGS IN THEIR MANUSCRIPT FULLY AVAILABLE?

Uncropped versions of the western blots have been made available in the supplementary data, however, only it appears that data may only be available for n=1 biological replicate. Additionally, all the biological replicates for the collagen lattice assays (minimum required is n=3) do not appear to be available.

IS THE MANUSCRIPT PRESENTED IN AN INTELLIGIBLE FASHION AND WRITTEN IN STANDARD ENGLISH?

English quality is quite good, however, there are some minor grammatical errors that should be addressed. Some of these issues are outlined below, but additional proof-reading is required with attention to the correct placement of commas.

Requested changes and corrections:

Introduction:

1. There is no detail provided in relation to the Image J measurement. Although this is a standard

Materials and Methods:

2. Page 5, line 23: “and then added thrombin” should be “and then thrombin was added”

3. Correct SI unit for litre is ‘L’, not ‘l’. Apply throughout entire manuscript, including figures.

4. There is no detail provided in relation to the Image J measurement. Although this is a standard assay, additional information as to how the Image J analysis was performed would be welcomed to explain the result. For instance, in most graphs showing the results of the collagen assays, the mean relative pixel area is not 1.0, which indicates that the collagen discs did not occupy 100% of the area measured. Presumably the area measured was the size of the well? Such information should be conveyed as it affects the interpretation of the results (i.e. the extent of thrombin-induced contraction is not a percentage of the pixel area of the untreated control).

5. It should be possible to fully understand the experiments conducted and the results obtained without having to refer to the figures. As such, in the materials and methods, please provide the concentrations of treatments in-text (for example, page 5, line 21).

6. Page 5, line 21: provide O2 and CO2 percentages.

7. There is no mention of protein quantitation method and no details provided for SDS-PAGE, such as the amount of protein loaded per lane (supplementary figures indicate that 20 ug per lane was loaded, however, this information should be provided in-text in the methods). Type of membrane used for western blotting not indicated (PVDF or nitrocellulose?).

8. Antibody dilutions are provided, however, this does not provide any indication of the quantity of antibody used, as different antibodies come at different dilutions. While it is common practice to merely report antibody dilutions, the authors are encouraged to additionally report the actual final antibody concentration utilised (i.e. 0.1 ug/mL in 20 mL of TBST). Not essential but encouraged.

Results:

9. In the results, the collagen lattice assays graphs convey the reduction in relative pixel area, however, nowhere in the manuscript are the actual quantitated values provided. For each of the collagen lattice assay graphs, please report the mean pixel area (with +/- SD) for the different treatments in-text with the results. Additionally, the figure legends indicate that “*, p < 0.05, and **, p <0.01”, however, please provide the p-values in-text during the results. For example: Thrombin treatment significantly decreased relative pixel area compared to control (0.95 +/- 0.02 versus 0.6 +/- 0.03; p=0.03).

10. In the legend for Figure 5, Section C states “2U/ml of thrombin for 12 h”, however, the X-axis of panel C (which displays the effect of thrombin on PGF2 alpha levels) appears to show thrombin treatments at 1 and 2 U/mL.

11. Page 8, line 23-24: “Although not observed in the center of hemorrhage, PAR1 was expressed in myometrial cells peripheral to the bleeding site”. FYI: This is an interesting observation that leaves me curious as to why that may be.

12. Page11, line 10: ‘media of thrombin-treated…’ instead of ‘media by thrombin-treated…’

13. Number of replicates are not adequately identified throughout the results, either in -text or in the figure legends. For example, the legends for Figures 3 and 4 do not indicate how many biological replicates were performed for the western blots (i.e. was only 1 western blot performed for 1 woman/biological replicate, or was the blotting performed for primary myocytes isolated from n=3 different women?) or immunocytochemistry.

14. Page21, Figure 2 legend: Please replace “identical results” with “consistent results”, as it is impossible that identical results were observed across replicates.

General:

15. The throughout the entire manuscript and figures, authors are encouraged to use the correct protein names; i.e. Prostaglandin-Endoperoxide Synthase 2 (gene name: ‘PTGS2’), rather than cyclooxygenase (‘COX2’), with gene names in all-caps and non-italicised.

16. The throughout the entire manuscript and figures, the authors are encouraged to use the correct gene names (presented in app-caps and italicised). COX2 = PTGS2, CX43 = GJA1, EP1 = PTGER1, EP3 = PTGER3, FP = PTGFR. Refer to genecards.org.

17. Grammar: Use ‘protease-activated receptor 1’, not ‘protease-activated receptor-1’.

18. ‘PAR-1’ and ‘PAR1’ used interchangeably. Additionally, ‘protease-activated receptor 1 is firdst used in the abstract and the abbreviation (PAR1) is provided. In-text, however, the PAR1 abbreviation is used without providing the full name (page 5, line 2).

19. Page 14, line 12: what is meant by “activity”? This is vague and needs clarification.

20. Page 14, line 13-15: “Therefore, inhibition of thrombin signaling pathways has potential to treat preterm labor associated “without” intrauterine bleeding.”. Please correct this sentence: “Therefore, inhibition of thrombin signaling pathways has potential to treat labor that is not associated with intrauterine bleeding”.

Comments:

The primary myometrial cells utilised were isolated from myometrium obtained from non-pregnant premenopausal women. The manuscript would benefit from authors commencing the Discussion by justifying their case for not using pregnant myometrium and provide a brief argument as to why findings gleaned from nonpregnant primary uterine myocytes still provide valid insight into the mechanisms underpinning premature birth.

There is no mention of existing literature that examines the role/regulation of thrombin in normal labour. Ie. What happens to thrombin levels during normal labour? These studies should be briefly mentioned as existing evidence indicates that thrombin activity rises during normal, uncomplicated labour, suggesting that thrombin activity is a normal component labour. Additionally, this has implications for the author’s claim that (page 3, line 20) “Collectively, these data suggest that thrombin is a pathogenic factor in initiation of preterm birth”, which suggests a causative role in preterm birth. It is possible that thrombin activity in indeed causative of premature labour, as supported by thrombin by inducing PTB in mice, but it is also possible that thrombin activity rises as a result of the woman being in labour, whether the labour is at term or preterm. As such, the manuscript would benefit by highlighting that the key underlying issue is that dysregulation of thrombin activity has the potential to cause the premature onset of labour, leading to preterm birth.

There is no discussion on how expression of the genes encoding thrombin (F2) and PAR1 (F2R) are regulated in the myometrium. The manuscript would benefit from discussing what is known about F2 (primarily) and F2R (secondly) expression in the myometrium (and other tissues), and how dysregulation of expression of these genes could be causal to preterm birth.

The authors suggest a potential clinical role for progesterone in inhibiting preterm labour complicated by intrauterine bleeding, based on the ability of progesterone to partially inhibit thrombin-induced myometrial contraction. Existing literature indicates that the relaxatory effects of progesterone are mediated by PR-B, but also that prostaglandins increase the PR-A/PR-B ratio. Given that the authors present data indicating that thrombin induces production of prostaglandins, the manuscript would be benefit from discussing how thombin-induced prostaglandin production may affect the PR-A/PR-B ratio, and how this may affect the clinical usefulness of progesterone therapy.

I’m not sure whether it is an artefact of the production of the draft version of the manuscript, but the figures appear to be low resolution. There is extensive pixilation. Hopefully the final version will have figures of greater clarity.

Overall, this study presents some interesting findings that, if true, will make a valuable contribution to advancing our understanding of the mechanisms contributing to the syndrome of preterm birth. However, at this stage, there appears to be insufficient biological replicates, with the results instead based on the statistical analysis of technical replicates (if this reviewer’s interpretation of the data is incorrect, then could the authors please provide some clarity). If the findings persist following the incorporation of additional biological replicates, the study will make a valuable contribution to the field.

Reviewer #2: This interesting paper explores the ability of thrombin, released most often during intrauterine hemorrhage, on its ability to stimulate other mediators (IL-1beta, prostaglandins, COX-2) via the PAR-1 receptor and MLCK intracellular pathways and the ability of progesterone to block these

The writing of the manuscript, techniques, data analysis and figures are very good. I found just one typo in the MS ('as' should be replaced with 'at' in one figure legend).

My major recommendation though is that the there are uncompleted experiments that will improve the information shared and conclusions reached. These begin by noting that thrombin increased COX-2 expression and PGF2alpha output, but that expression of the FP receptor decreased. The authors did not address this important observation. I am quite certain the increased PGF2a produced cause the down regulation of its receptor, FP. Although PGE2 was not assayed, I'm also certain that thrombin increased it, too, and its higher concentrations led to the down regulation of the EP3 receptor noted in the figures. Again, this was not addressed very well by the authors.

I am suggesting that the authors perform a few more simple experiments to address these interesting observations in order to explain their results better. One of the questions that derives, is does thrombin stimulate a decrease in the expression of EP3 and FP directly or is this due to increased prostaglandins that down regulate their receptors. Thus if indomethacin or a COX-2 specific inhibitor is co-administered with thrombin, what is the outcome with the PG receptors? I would suggest that in this case, there is no down-regulation of EP3 or FP. If true, then administration of PGE2 or PGF2a and assessing expression of EP3 and FP should confirm that PGs down regulate their receptor expression. I propose that thrombin increases IL-1b and that IL-1b increases expression of EP3 and FP as well as COX-2. The reason that thrombin stimulates contractions is that the action of PGE2 and PGF2a is not lost (due to large down regulation of their receptors) because IL1b is stimulating their up-regulation. Hence they are present enough to respond to their agonists and effect contraction.

However, it is noted from the data that thrombin administration also increases IL-1b. But IL-1b on its own can stimulate COX-2 expression and it increases the expression of FP (see Mol Hum Reprod. 2015 Jul;21(7):603-14.). These should be confirmed in these cells. If true then the question derives how can thrombin stimulate myometrial contraction if it leads to the down regulation of FP or EP3 as shown by the limited data presented? In this case, stimulate cells with IL-1b in the absence or presence of indomethacin or a COX-2 inhibitor. I suspect there will be a large increase in EP3 and FP expression when COX-2 is inhibited, and less or even a decrease in expression when COX-2 activity is intact.

Finally, one begins to wonder where the action of progesterone or MPA is at. Is it directed at inhibiting COX-2 action directly, or is it directed at inhibiting expression of IL-1beta or even directed at PAR-1 expression? I strongly suggest to the investigators and to the Editor to include these important experiments in this manuscript to explain more completely the relationships hinted at by the data that is presented.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 May 4;15(5):e0231944. doi: 10.1371/journal.pone.0231944.r002

Author response to Decision Letter 0


25 Feb 2020

Response to the editor and reviewers

PONE-D-19-21553

Mechanisms of Thrombin-Induced Myometrial Contractions: Potential Targets of Progesterone

PLOS ONE

Dear Dr. Mogami,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

The reviewers agree that the manuscript tackles an important and under-researched topic. The most critical issues to be addressed for possible publication are clarification of the number of biological vs. technical replicates presented and included in the statistical analyses and also to make available all data that form the basis of the manuscript. A minimum of 3 (three) biological replicates is mandatory in all experiments. The conclusions and interpretations should be revised to take into account the comments put forward by the expert reviewers. The Authors should seriously consider to add experiments along the suggestions by Reviewer 2.

Tamas Zakar

Academic Editor

PLOS ONE

Dear Dr. Zakar,

Thank you very much for your response in regard to our submitted manuscript, “Mechanisms of thrombin-induced myometrial contractions: Potential targets of progesterone” (PONE-D-19-21553). We are most grateful to you and the expert reviewers for the very valuable and constructive comments and suggestions. We have revised the manuscript accordingly and are confident that it has been much improved. We would like to resubmit it for publication in your esteemed journal. Below, please find our detailed responses to each of the comments.

All of the experiments were repeated at least three times to meet the biological replicates requirements, and the results were regenerated and shown in the Figures of Replicated Experiments. Although progesterone clearly blocked thrombin-induced myometrial contraction, we were unable to obtain consistent results in our MPA experiments. As such, we removed the MPA data from our manuscript (Fig. 6C and 6D). We are confident that natural progesterone (P4) has a protective effect against thrombin-induced myometrial contraction.

The additional experiments suggested by Reviewer 2 were performed and added to the revised manuscript. We made all of the data available in the manuscript and Supporting information files.

Our responses are written in blue. All revisions in the manuscript are also written in blue.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

>>> Thank you for bringing this to our attention. We have revised our manuscript to follow PLOS ONE’s style requirements. The file naming has also been corrected.

2. We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed:

https://link.springer.com/book/10.1007%2F978-981-10-2489-4

The text that needs to be addressed is in the Introduction section.

In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed. "

>>> We cited the book “Precision Medicine in Gynecology and Obstetrics” in the references. This book contains our review article on thrombin and preterm birth. The sentence was modified in the revised manuscript in order to avoid duplication.

(Revised manuscript, lines 30-31)

3. Thank you for including your ethics statement: All human myometrial tissues were obtained in accordance with the ethics committee of the Graduate School of Medicine, Kyoto University after written consent (G1149).

Please amend your current ethics statement to include the full name of the ethics committee/institutional review board(s) that approved your specific study.

Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

>>> The full name of the ethics committee of our facility is “Kyoto University Graduate School and Faculty of Medicine, Kyoto University Hospital Ethics Committee.” This information was added to the revised Materials and Methods section.

(Revised manuscript, lines 102-103)

4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

>>> Original uncropped and unadjusted images of immunoblots were added to the Supporting information files of the revised manuscript.

5. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

>>> Thank you for noting this. We included all supplementary data in the Supporting information files of the revised manuscript. An immunofluorescent image of PAR1 expression in a non-pregnant uterus was also added to revised Fig. 1B.

6. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

>>> We included captions for the Supporting information files at the end of our revised manuscript. The Supplementary movie is available in the public repository Zenodo. The method was moved to the revised Materials and Methods section.

Reviewer #1: IS THE MANUSCRIPT TECHNICALLY SOUND, AND DO THE DATA SUPPORT THE CONCLUSIONS?

The manuscript follows a logical approach of using the collagen lattice assay to measure contractility induced in primary myometrial cells following treatment with thrombin. The extent of contraction is quantitated by measuring the area of lattice using Image J software.

Figure 1 demonstrates that both thrombin and its receptor, PAR1, are present in pregnant and non-pregnant human myometrium.

Figure 2 demonstrates that thrombin induces contraction of primary myometrial cells, and that activation of PAR1, by means of the activating peptide, also induces contraction. Furthermore, the PAR1 inhibitor, SCH79797, inhibited the vast majority (but not all) of the thrombin-induced contraction.

7. Curiously, page 9 line 7 indicates that the primary myometrial cells utilised to generate the data in Figure 2 were derived from non-pregnant myometrium, rather than pregnant myometrium. Is this correct or should this say.

>>> Thank you for these valuable comments. In our facility, cases of hysterectomy during pregnancy are rare, and sampling of myometrial strips at cesarean incisions is not performed for fear of increasing bleeding. Therefore, we do not have pregnant myometrial tissues readily available. Luckily, we had a rare case of hysterectomy due to cervical cancer Ib1 in pregnancy during this revision period (34 weeks of gestation), with permission of the Ethics Committee of Kyoto University Hospital. We performed a contraction assay and similar contraction by thrombin was reproduced as in non-pregnant myometrium (Fig. S2A). PTGS2 mRNA was also increased by thrombin in pregnant myometrium (Fig. S2B). These findings suggest that the use of non-pregnant myometrial cells is justified for studying myometrial contraction. We are planning to use pregnant myometrium in future experiments.

Figure 3 demonstrates that thrombin induces MLC-ser19 phosphorylation, and that this phosphorylation is inhibited by the PAR1 inhibitor. Densitometric

Figure 4 provides evidence that thrombin-induced contraction of primary myometrial cells is mediated by myosin light chain kinase and ROCK, as evidenced by the MLCK inhibitor (ML-7) and the ROCK inhibitor (Y-27632) both partially inhibiting thrombin-induced MLC-ser19 phosphorylation. Additionally, Panel D demonstrates that thrombin does not promote myometrial contraction by inhibiting (phosphorylating) the regulatory subunit of myosin phosphatase, MYPT1.

Figure 5 demonstrates that thrombin-induced contraction of primary myometrial cells is associated with (i) significantly upregulated expression of PTGS2 (COX2) after 4 h, (ii) significantly increased production of PGF2 alpha after 4 h, with maximum levels observed after 24 h, (iii) significantly upregulated expression of IL1B, (iv) significantly down-regulated expression of both PTGER3 (EP3) and PTGFR (FP), and (v) no change in expression of GJA1 (CX43), OXTR or PTGER1 (EP1). Additionally, panels E and F demonstrate that indomethacin partially inhibits the thrombin-induced contraction, demonstrating that thrombin-induced contraction is in-part indirect via stimulating prostaglandin production.

Figure 6 demonstrates that thrombin-induced contraction of primary myometrial cells is partially inhibited by pre-treating the cells with progesterone (P4) or medroxyprogesterone acetate (MPA).

The conclusions drawn are appropriate for the data, however, questions remain as to the whether the data is comprised of technical replicates or biological replicates.

HAS THE STATISTICAL ANALYSIS BEEN PERFORMED APPROPRIATELY AND RIGOROUSLY?

8. Further explanation is required as to what is being considered a replicate. For instance, the Figure 2 legend says “n=3 in each group. Experiment was repeated with cells from another preparation with identical results”. This reads as though the study was performed with 3 technical replicates (ie myocytes from 1 woman plated across multiple wells and then the treatment applied to 3 of those wells), and then repeated in only one other woman. If so, this would mean that only n=2 biological replicates have been examined (with 3 technical replicates for each biological replicate). The minimum requirement is n=3 biological replicates, so if n=3 biological replicates have indeed been performed, this needs to be explained clearly in the materials and methods.

>>> Thank you for your valuable comments. All of the experiments were repeated at least three times. Each experiment of the collagen lattice assay, qPCR, and ELISA was performed in triplicate. These replicated data are shown in the Figures of Replicated Experiments in the Supporting information files.

HAVE THE AUTHORS MADE ALL DATA UNDERLYING THE FINDINGS IN THEIR MANUSCRIPT FULLY AVAILABLE?

9. Uncropped versions of the western blots have been made available in the supplementary data, however, only it appears that data may only be available for n=1 biological replicate. Additionally, all the biological replicates for the collagen lattice assays (minimum required is n=3) do not appear to be available.

>>> As mentioned above, immunoblots were repeated three times. Representative blots are shown in figures, and the other replicated data are available in the Figures of Replicated Experiments. Collagen lattice assay was also repeated at least three times.

IS THE MANUSCRIPT PRESENTED IN AN INTELLIGIBLE FASHION AND WRITTEN IN STANDARD ENGLISH?

10. English quality is quite good, however, there are some minor grammatical errors that should be addressed. Some of these issues are outlined below, but additional proof-reading is required with attention to the correct placement of commas.

>>> Thank you for your useful comment. The revised manuscript was sent to a professional native English-speaking scientific proofreader.

Requested changes and corrections:

Introduction:

11. There is no detail provided in relation to the Image J measurement. Although this is a standard.

>>> The gel area was calculated by Image J software. The outside of a gel was manually traced by the “Polygon selection” tool and the area was calculated by the “Measure” tool. The unit of analyzed area was reflected as pixels. An example of the calculation procedure is shown below. This explanation was added to the Materials and Methods section of the revised manuscript.

(Revised manuscript, lines 122-125)

Materials and Methods:

12. Page 5, line 23: “and then added thrombin” should be “and then thrombin was added”

>>> The sentence was revised as per your suggestion.

(Revised manuscript, line 118)

13. Correct SI unit for litre is ‘L’, not ‘l’. Apply throughout entire manuscript, including figures.

>>> Thank you for this useful comment. This correction was made throughout the revised manuscript.

14. There is no detail provided in relation to the Image J measurement. Although this is a standard assay, additional information as to how the Image J analysis was performed would be welcomed to explain the result. For instance, in most graphs showing the results of the collagen assays, the mean relative pixel area is not 1.0, which indicates that the collagen discs did not occupy 100% of the area measured. Presumably the area measured was the size of the well? Such information should be conveyed as it affects the interpretation of the results (i.e. the extent of thrombin-induced contraction is not a percentage of the pixel area of the untreated control).

>>> Thank you for this useful comment. As mentioned above, the outside of each gel was manually traced by the “Polygon selection” tool of Image J and the area was analyzed by the “Measure” tool. The unit of area was reflected as pixels so the area of control is not necessarily 1.0. The area was not compared to the well size.

15. It should be possible to fully understand the experiments conducted and the results obtained without having to refer to the figures. As such, in the materials and methods, please provide the concentrations of treatments in-text (for example, page 5, line 21).

>>> Thank you for this valuable comment. Detailed methods such as the concentration of reagents and treatment time are described for collagen lattice assay, immunoblots, and qPCR in the Material and Methods section.

16. Page 5, line 21: provide O2 and CO2 percentages.

>>> The cell culture incubation condition of oxygen (20%) and CO2 (5%) was added to the revised manuscript.

(Revised manuscript, lines 93-94)

17. There is no mention of protein quantitation method and no details provided for SDS-PAGE, such as the amount of protein loaded per lane (supplementary figures indicate that 20 ug per lane was loaded, however, this information should be provided in-text in the methods). Type of membrane used for western blotting not indicated (PVDF or nitrocellulose?).

>>> The detailed procedure of immunoblotting was described in the “Immunoblots” section. BCA assay was utilized to protein quantification. Twenty micrograms of protein were loaded in each lane. A PVDF membrane was used because the molecular weight of MLC was comparably small (approximately 20 kDa).

(Revised manuscript, lines 144-148)

18. Antibody dilutions are provided, however, this does not provide any indication of the quantity of antibody used, as different antibodies come at different dilutions. While it is common practice to merely report antibody dilutions, the authors are encouraged to additionally report the actual final antibody concentration utilised (i.e. 0.1 ug/mL in 20 mL of TBST). Not essential but encouraged.

>>> The exact antibody concentration was not available in the datasheet from Cell Signaling and Abcam so we described the dilution of antibody only (1:1000). All of the first antibodies were diluted into 5 mL of 5% BSA/TBST. The second antibody was diluted to 10 mL of 5% BSA/TBST. This information was added to the revised Immunoblots section.

(Revised manuscript, lines 150-159)

Results:

19. In the results, the collagen lattice assays graphs convey the reduction in relative pixel area, however, nowhere in the manuscript are the actual quantitated values provided. For each of the collagen lattice assay graphs, please report the mean pixel area (with +/- SD) for the different treatments in-text with the results. Additionally, the figure legends indicate that “*, p < 0.05, and **, p <0.01”, however, please provide the p-values in-text during the results. For example: Thrombin treatment significantly decreased relative pixel area compared to control (0.95 +/- 0.02 versus 0.6 +/- 0.03; p=0.03).

>>> We appreciate this useful comment. The mean pixels and SD in collagen lattice assay were described in the Results section. A p value was also added to the manuscript.

20. In the legend for Figure 5, Section C states “2U/ml of thrombin for 12 h”, however, the X-axis of panel C (which displays the effect of thrombin on PGF2 alpha levels) appears to show thrombin treatments at 1 and 2 U/mL.

>>> Thank you for pointing out this error. The legend for Figure 5 was corrected in the revised manuscript. New data on PGE2 concentration by thrombin treatment was also added.

21. Page 8, line 23-24: “Although not observed in the center of hemorrhage, PAR1 was expressed in myometrial cells peripheral to the bleeding site”. FYI: This is an interesting observation that leaves me curious as to why that may be.

>>> Microscopically, the structure of the myometrial tissue in the center of the bleeding site was devastated, probably due to protease activity and pressures resulting from hemorrhage. In contrast, the myometrial tissue peripheral to the bleeding site was intact. This is why PAR1 was expressed at the intact myometrium, peripheral to the bleeding site.

(Revised manuscript, lines 196-197)

22. Page11, line 10: ‘media of thrombin-treated…’ instead of ‘media by thrombin-treated…’

>>> The sentence was changed as per your useful suggestion. Thank you.

23. Number of replicates are not adequately identified throughout the results, either in -text or in the figure legends. For example, the legends for Figures 3 and 4 do not indicate how many biological replicates were performed for the western blots (i.e. was only 1 western blot performed for 1 woman/biological replicate, or was the blotting performed for primary myocytes isolated from n=3 different women?) or immunocytochemistry.

>>> All of the experiments were repeated three times and the data are shown in the Figures of Replicated Experiments. In the replicates, the primary myometrial cells were derived from the uteruses of three different women. The figure legends were thoroughly revised.

24. Page21, Figure 2 legend: Please replace “identical results” with “consistent results”, as it is impossible that identical results were observed across replicates.

>>> The Figure legends were thoroughly revised. We removed “identical results.” Consistent results were obtained and shown in the Figures of Replicated Experiments of the revised manuscript.

General:

25. The throughout the entire manuscript and figures, authors are encouraged to use the correct protein names; i.e. Prostaglandin-Endoperoxide Synthase 2 (gene name: ‘PTGS2’), rather than cyclooxygenase (‘COX2’), with gene names in all-caps and non-italicised.

>>> Thank you for your suggestion. The Gene name COX2 was changed to PTGS2 throughout the revised manuscript and figures.

26. The throughout the entire manuscript and figures, the authors are encouraged to use the correct gene names (presented in app-caps and italicised). COX2 = PTGS2, CX43 = GJA1, EP1 = PTGER1, EP3 = PTGER3, FP = PTGFR. Refer to genecards.org.

>>> We appreciate this useful suggestion. All of the gene names were changed to the correct names.

27. Grammar: Use ‘protease-activated receptor 1’, not ‘protease-activated receptor-1’.

>>> “Protease activated receptor-1” was changed to “protease-activated receptor 1” throughout the revised manuscript. Thank you.

28. ‘PAR-1’ and ‘PAR1’ used interchangeably. Additionally, ‘protease-activated receptor 1 is firdst used in the abstract and the abbreviation (PAR1) is provided. In-text, however, the PAR1 abbreviation is used without providing the full name (page 5, line 2).

>>> We removed the hyphen from “PAR-1”, and all the words were corrected to “PAR1” throughout the revised manuscript.

29. Page 14, line 12: what is meant by “activity”? This is vague and needs clarification.

>>> Thank you for this useful comment. The protease activity of thrombin was increased by an increase in the amnion of preterm labor (Figure below, Mogami et al. JBC 2014). We changed this to “protease activity of thrombin” in the revised manuscript.

(Revised manuscript, line 429)

30. Page 14, line 13-15: “Therefore, inhibition of thrombin signaling pathways has potential to treat preterm labor associated “without” intrauterine bleeding.”. Please correct this sentence: “Therefore, inhibition of thrombin signaling pathways has potential to treat labor that is not associated with intrauterine bleeding”.

>>> Thank you for this useful comment. We revised the last sentence as per your suggestion.

(Revised manuscript, lines 431-432)

Comments:

31. The primary myometrial cells utilised were isolated from myometrium obtained from non-pregnant premenopausal women. The manuscript would benefit from authors commencing the Discussion by justifying their case for not using pregnant myometrium and provide a brief argument as to why findings gleaned from nonpregnant primary uterine myocytes still provide valid insight into the mechanisms underpinning premature birth.

>>> Thank you for this valuable comment. Ideally, the experiments should be performed using pregnant uterus. As added in the revised Materials and Methods section, however, hysterectomies in pregnant women are very rare in our facility, and we do not obtain myometrial strips during cesarean births. Fortunately, we were able to obtain myometrial tissue from a rare case of cesarean hysterectomy due to a pregnancy complicated by early stage Ib1 cervical cancer. We isolated myometrial cells from the pregnant uterine corpus and observed that contraction of the myometrial cells was similar to those from non-pregnant uterus (Fig. S2). In addition, thrombin receptor PAR1 was expressed in both pregnant and non-pregnant myometrium (Fig. 1). O'Sullivan et al. showed that thrombin and PAR1 activating peptide exerted a stimulatory effect on uterine contraction in both pregnant and non-pregnant myometrial tissues (O'Sullivan CJ, 2004). They also reported that there was no significant difference in sensitivity to thrombin between pregnant and non-pregnant myometrium. Therefore, as the reviewer suggested, we believe that our data obtained from non-pregnant myometrium still provide valid insight into the mechanisms of preterm birth induced by intrauterine bleeding.

(The data on pregnant myometrium was added to the revised manuscript and Fig. S2.)

(Revised manuscript, lines 83-86 and lines 342-352)

32. There is no mention of existing literature that examines the role/regulation of thrombin in normal labour. Ie. What happens to thrombin levels during normal labour? These studies should be briefly mentioned as existing evidence indicates that thrombin activity rises during normal, uncomplicated labour, suggesting that thrombin activity is a normal component labour. Additionally, this has implications for the author’s claim that (page 3, line 20) “Collectively, these data suggest that thrombin is a pathogenic factor in initiation of preterm birth”, which suggests a causative role in preterm birth. It is possible that thrombin activity in indeed causative of premature labour, as supported by thrombin by inducing PTB in mice, but it is also possible that thrombin activity rises as a result of the woman being in labour, whether the labour is at term or preterm. As such, the manuscript would benefit by highlighting that the key underlying issue is that dysregulation of thrombin activity has the potential to cause the premature onset of labour, leading to preterm birth.

>>> Thank you for these valuable comments. As the reviewer suggested, thrombin-antithrombin complex (TAT) levels increased during normal pregnancy [1]. The mean TAT level is 1.9 ± 0.3 μg/L in non-pregnant women regardless of menstrual cycle phase, but increases to 16.0 ± 2.8 μg/L in the 2nd trimester, 21.5 ± 11.9 μg/L at term, and 28.6 ± 12.8 μg/L in the 2nd stage of labor [2]. In addition, TAT further increases in the 3rd stage of labor upon separation of the placenta [2, 3]. This is due to the release of thromboplastic substances at the site of placental separation. It seems that released thrombin from the placenta-attached site to the uterus facilitates the contraction of myometrium (uterine involution), and prevents massive hemorrhage at parturition. Therefore, the abnormal increase of thrombin mid-trimester is a pathological process that leads to preterm birth whereas the increase of maternal circulating thrombin at the 3rd stage of labor and parturition is a physiological process. These physiological roles of thrombin during normal labor were included in the manuscript.

(Revised manuscript, lines 39-42).

33. There is no discussion on how expression of the genes encoding thrombin (F2) and PAR1 (F2R) are regulated in the myometrium. The manuscript would benefit from discussing what is known about F2 (primarily) and F2R (secondly) expression in the myometrium (and other tissues), and how dysregulation of expression of these genes could be causal to preterm birth.

>>> Thrombin is almost exclusively synthesized in the liver (https://www.ncbi.nlm.nih.gov/gene/2147), and we confirmed that pregnant myometrium did not express thrombin (F2) in immunofluorescence (Fig. S1). An explanation of PAR1 was added to the Discussion section of the revised manuscript.

O’Brien et al. showed that PAR1 (F2R) was expressed in both pregnant and non-pregnant myometrium, which is compatible with our data from immunofluorescence (Fig. 1 and 3); they also showed that expression is higher during pregnancy compared to non-pregnancy [4]. Further, they demonstrated that PAR1 expression increased 9-fold during labor in human myometrium compared to the state of not in labor, indicating that the sensitivity to thrombin is increased during labor. In addition to the physiological increase in thrombin, increased expression of PAR1 would contribute to stronger contractions during labor and puerperium. This description was added to the revised Discussion section.

(Revised manuscript, lines 416-426).

34. The authors suggest a potential clinical role for progesterone in inhibiting preterm labour complicated by intrauterine bleeding, based on the ability of progesterone to partially inhibit thrombin-induced myometrial contraction. Existing literature indicates that the relaxatory effects of progesterone are mediated by PR-B, but also that prostaglandins increase the PR-A/PR-B ratio. Given that the authors present data indicating that thrombin induces production of prostaglandins, the manuscript would be benefit from discussing how thombin-induced prostaglandin production may affect the PR-A/PR-B ratio, and how this may affect the clinical usefulness of progesterone therapy.

>>> Thank you for this useful comment. As you mentioned, progesterone receptors are key molecules to regulate the contraction of myometrium during pregnancy. The PR-A/PR-B ratio increased in myometrium during labor, which inhibits the action of progesterone and leads to successful delivery [5, 6]. We added experiments examining how thrombin and prostaglandins regulate the mRNA expressions of progesterone receptors (PgR-A and PgR-B). Thrombin tended to decrease PgR-A and PgR-B mRNA levels so that the total abundance of PgRs was decreased. Consequently, the PgR-A/PgR-B ratio was not changed by thrombin. Previously, Madsen G et al. showed that PGE2 and PGF2α increased PR-B expression and the PR-A/PR-B ratio was increased by comparably lower doses of prostaglandins [7]. We tested this, but neither PGE2 nor PGF2α regulated PgR-A and PgR-B mRNA. The reason for this difference between Madsen et al.’s results and ours is unclear, but Madsen et al. also showed that the PgR-A/PgR-B mRNA ratio tended to return to the basal level when prostaglandin concentrations increased. We used a comparably high dose of prostaglandins (10 nM) in our experiments, so this might be a reason why the PgR-A to PgR-B mRNA ratio was not altered in our study. Although the PgR-A/PgR-B ratio was not regulated, thrombin strengthens myometrial contractions by reducing the progesterone responsiveness caused by downregulation of progesterone receptor expression. Further study is necessary for clarifying the precise regulation of PR by thrombin.

(Revised manuscript, lines 320-333, and 395-408)

35. I’m not sure whether it is an artefact of the production of the draft version of the manuscript, but the figures appear to be low resolution. There is extensive pixilation. Hopefully the final version will have figures of greater clarity.

>>> The original figures are high-resolution. The publisher instructed us to submit figures as PDF, and the converted PDFs on the publisher’s web site appear low resolution. We are confident that the final version will be clearer.

Overall, this study presents some interesting findings that, if true, will make a valuable contribution to advancing our understanding of the mechanisms contributing to the syndrome of preterm birth. However, at this stage, there appears to be insufficient biological replicates, with the results instead based on the statistical analysis of technical replicates (if this reviewer’s interpretation of the data is incorrect, then could the authors please provide some clarity). If the findings persist following the incorporation of additional biological replicates, the study will make a valuable contribution to the field.

Reviewer #2: This interesting paper explores the ability of thrombin, released most often during intrauterine hemorrhage, on its ability to stimulate other mediators (IL-1beta, prostaglandins, COX-2) via the PAR-1 receptor and MLCK intracellular pathways and the ability of progesterone to block these.

The writing of the manuscript, techniques, data analysis and figures are very good. I found just one typo in the MS (‘as’ should be replaced with ‘at’ in one figure legend).

My major recommendation though is that the there are uncompleted experiments that will improve the information shared and conclusions reached. These begin by noting that thrombin increased COX-2 expression and PGF2alpha output, but that expression of the FP receptor decreased. The authors did not address this important observation. I am quite certain the increased PGF2a produced cause the down regulation of its receptor, FP. Although PGE2 was not assayed, I’m also certain that thrombin increased it, too, and its higher concentrations led to the down regulation of the EP3 receptor noted in the figures. Again, this was not addressed very well by the authors.

35. I am suggesting that the authors perform a few more simple experiments to address these interesting observations in order to explain their results better. One of the questions that derives, is does thrombin stimulate a decrease in the expression of EP3 and FP directly or is this due to increased prostaglandins that down regulate their receptors. Thus if indomethacin or a COX-2 specific inhibitor is co-administered with thrombin, what is the outcome with the PG receptors? I would suggest that in this case, there is no down-regulation of EP3 or FP. If true, then administration of PGE2 or PGF2a and assessing expression of EP3 and FP should confirm that PGs down regulate their receptor expression. I propose that thrombin increases IL-1b and that IL-1b increases expression of EP3 and FP as well as COX-2. The reason that thrombin stimulates contractions is that the action of PGE2 and PGF2a is not lost (due to large down regulation of their receptors) because IL1b is stimulating their up-regulation. Hence they are present enough to respond to their agonists and effect contraction.

>>> Thank you very much for these valuable suggestions. We assayed the PGE2 concentration in the conditioned media of thrombin-treated myometrial cells. As you expected, thrombin increased PGE2 dose- and time-dependently (Fig. 5E and 5F). This is a very important finding.

In order to investigate the mechanism of how the expression of EP3 and FP was decreased and PTGS2 increased, we performed additional experiments: 1) IL-1β treatment of myometrial cells, 2) Thrombin with pretreatment of indomethacin, and 3) PGE2 and PGF2α treatment. From these experiments, we concluded that:

1) IL-1β increased PTGS2 mRNA, so the increase of PGE2 and PGF2α was mediated by thrombin-induced IL-1β (Fig. 6B). In addition, PGE2, but not PGF2α, increased IL1B mRNA (Fig. 6D). This suggests that PGE2 is increased by positive feedback through IL-1β (Fig. 6F).

2) Thrombin and IL-1β decreased PTGER3 mRNA, and pretreatment of indomethacin recovered the decrease in PTGER3 mRNA by thrombin and IL-1β (Fig. 6C). In addition, both PGE2 and PGF2α decreased PTGER3 mRNA (Fig. 6D and 6E). These findings suggest that the thrombin-induced decrease of PTGER3 mRNA was mediated by PGE2 and PGF2α via IL-1β (Fig. 6F).

3) In contrast, IL-1β did not decrease PTGFR mRNA (Fig. 6B), and indomethacin did not recover the decrease in PTGFR mRNA by thrombin (Fig. 6C). In addition, neither PGE2 nor PGF2α changed PTGFR mRNA (Fig. 6D and 6E). These findings suggest that the thrombin-induced decrease of PTGFR mRNA was not regulated by PGE2 or PGF2α, but by another unknown pathway (Fig. 6F).

We summarized the relationship of thrombin, IL-1β, prostaglandins, and the regulation of prostaglandin receptors in Fig. 6F. The data were added to the Results section of the revised manuscript.

(Revised manuscript, lines 294-304).

36. However, it is noted from the data that thrombin administration also increases IL-1b. But IL-1b on its own can stimulate COX-2 expression and it increases the expression of FP (see Mol Hum Reprod. 2015 Jul;21(7):603-14.). These should be confirmed in these cells. If true then the question derives how can thrombin stimulate myometrial contraction if it leads to the down regulation of FP or EP3 as shown by the limited data presented? In this case, stimulate cells with IL-1b in the absence or presence of indomethacin or a COX-2 inhibitor. I suspect there will be a large increase in EP3 and FP expression when COX-2 is inhibited, and less or even a decrease in expression when COX-2 activity is intact.

>>> Thank you for your useful comments. As you suggested, IL-1β robustly increased PTGS2 mRNA (Fig 6B), and IL-1β decreased PTGER3 mRNA but it did not regulate PTGFR mRNA expression (Fig. 6B and figures below).

Pretreatment of indomethacin partially alleviated the decrease in PTGER3 mRNA by IL-1β (Fig. 6C). Therefore, we propose that a decrease in EP3 receptor by thrombin is mediated by prostaglandins through IL-1β, whereas regulation of FP receptor is by another pathway. The physiological meaning for why thrombin can keep stimulating contraction of myometrium while suppressing the expressions of prostaglandin receptors is unclear. The elucidation of the precise mechanism of how thrombin downregulates prostaglandin receptors is our next area of study.

37. Finally, one begins to wonder where the action of progesterone or MPA is at. Is it directed at inhibiting COX-2 action directly, or is it directed at inhibiting expression of IL-1beta or even directed at PAR-1 expression? I strongly suggest to the investigators and to the Editor to include these important experiments in this manuscript to explain more completely the relationships hinted at by the data that is presented.

>>> Thank you very much for this valuable comment. We added an experiment involving thrombin with pretreatment of 1 μM progesterone. The increase in IL1B mRNA was suppressed by pretreatment of 1 μM of progesterone (Fig. 7B). Thrombin receptor PAR1 (F2R) was not regulated by thrombin, but progesterone repressed the F2R mRNA expression (Fig. 7B). Therefore, as Reviewer 2 commented, the function of progesterone was mediated by 1) suppression of PTGS2 mRNA expression, 2) suppression of IL-1β, and 3) decrease in F2R mRNA expression, even without thrombin treatment. All of these changes by progesterone contribute to the relaxation of myometrium. Data and discussion were added to the revised manuscript.

(Revised manuscript, lines 316-318)

References

1. Elovitz MA, Baron J, Phillippe M. The role of thrombin in preterm parturition. American journal of obstetrics and gynecology. 2001;185(5):1059-63. doi: 10.1067/mob.2001.117638. PubMed PMID: 11717633.

2. Uszynski M. Generation of thrombin in blood plasma of non-pregnant and pregnant women studied through concentration of thrombin-antithrombin III complexes. European journal of obstetrics, gynecology, and reproductive biology. 1997;75(2):127-31. doi: 10.1016/s0301-2115(97)00101-2. PubMed PMID: 9447363.

3. Yoshimura T, Ito M, Nakamura T, Okamura H. The influence of labor on thrombotic and fibrinolytic systems. European journal of obstetrics, gynecology, and reproductive biology. 1992;44(3):195-9. doi: 10.1016/0028-2243(92)90098-j. PubMed PMID: 1535054.

4. O'Brien M, Morrison JJ, Smith TJ. Expression of prothrombin and protease activated receptors in human myometrium during pregnancy and labor. Biology of reproduction. 2008;78(1):20-6. doi: 10.1095/biolreprod.107.062182. PubMed PMID: 17901076.

5. Merlino AA, Welsh TN, Tan H, Yi LJ, Cannon V, Mercer BM, et al. Nuclear progesterone receptors in the human pregnancy myometrium: evidence that parturition involves functional progesterone withdrawal mediated by increased expression of progesterone receptor-A. The Journal of clinical endocrinology and metabolism. 2007;92(5):1927-33. doi: 10.1210/jc.2007-0077. PubMed PMID: 17341556.

6. Mesiano S, Chan EC, Fitter JT, Kwek K, Yeo G, Smith R. Progesterone withdrawal and estrogen activation in human parturition are coordinated by progesterone receptor A expression in the myometrium. The Journal of clinical endocrinology and metabolism. 2002;87(6):2924-30. doi: 10.1210/jcem.87.6.8609. PubMed PMID: 12050275.

7. Madsen G, Zakar T, Ku CY, Sanborn BM, Smith R, Mesiano S. Prostaglandins differentially modulate progesterone receptor-A and -B expression in human myometrial cells: evidence for prostaglandin-induced functional progesterone withdrawal. The Journal of clinical endocrinology and metabolism. 2004;89(2):1010-3. doi: 10.1210/jc.2003-031037. PubMed PMID: 14764828.

Attachment

Submitted filename: Fig 7B of Replicated Exp.tif

Decision Letter 1

Tamas Zakar

6 Apr 2020

Mechanisms of thrombin-Induced myometrial contractions: Potential targets of progesterone

PONE-D-19-21553R1

Dear Dr. Mogami,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Tamas Zakar

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Thank you to the authors, who have answered or addressed all of the questions and feedback I raised. The edits have significantly clarified the manuscript and the additional data have increased its significance. The article will make a valuable contribution to the field. There are still some minor typographical inconsistencies (see below), however, I expect that these will be corrected during publication and proofing.

Minor issues:

• Line 417: '1.9' appears twice.

• Some inconsistency with the way the PG names are written, i.e. PGF2αlpha (symbol) vs PGF2α vs PGF2 α (symbol), and there’s also one instance of F2a instead of F2α (symbol). There’s also some inconsistency with PGE2.

Reviewer #2: Thank you for addressing our questions and suggestions so thoroughly. I especially appreciate the performance of extra experiments as suggested.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: David M Olson

Acceptance letter

Tamas Zakar

17 Apr 2020

PONE-D-19-21553R1

Mechanisms of thrombin-Induced myometrial contractions: Potential targets of progesterone

Dear Dr. Mogami:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr Tamas Zakar

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Expression of protease-activated receptor 1 (PAR1) and thrombin (F2) in human pregnant myometrium.

    (TIF)

    S2 Fig. Thrombin increased contraction of primary human myometrial cells from pregnant uterus.

    (TIF)

    S3 Fig. Original uncropped and unadjusted images of immunoblots of Fig 3B.

    (TIF)

    S4 Fig. Original uncropped and unadjusted images of immunoblots of Figs 3C and 4C.

    (TIF)

    S5 Fig. Original uncropped and unadjusted images of immunoblots of Fig 4D.

    (TIF)

    S1 Movie. Time-lapse live imaging of thrombin-treated myometrium.

    Available at https://doi.org/10.5281/zenodo.3240679.

    (TXT)

    Attachment

    Submitted filename: Fig 7B of Replicated Exp.tif

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files, and Supplementary Video 1 is uploaded to Zenodo (https://doi.org/10.5281/zenodo.3240679).


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES