Skip to main content
Toxicological Sciences logoLink to Toxicological Sciences
. 2020 Apr 6;175(1):113–125. doi: 10.1093/toxsci/kfaa030

Skeletal Toxicity of Coplanar Polychlorinated Biphenyl Congener 126 in the Rat Is Aryl Hydrocarbon Receptor Dependent

Ashlee E Williams k1, James Watt k1, Larry W Robertson k2, Gopi Gadupudi k2, Michele L Osborn k3, Michael J Soares k4, Khursheed Iqbal k4, Kim B Pedersen k1, Kartik Shankar k5, Shana Littleton k1, Cole Maimone k1, Nazmin A Eti k2, Larry J Suva k6, Martin J J Ronis k1,k1,✉
PMCID: PMC7197949  PMID: 32119087

Abstract

Epidemiological evidence links polychlorinated biphenyls (PCBs) to skeletal toxicity, however mechanisms whereby PCBs affect bone are poorly studied. In this study, coplanar PCB 126 (5 μmol/kg) or corn oil vehicle was administered to N = 5 and 6 male and female, wild type (WT) or AhR −/− rats via intraperitoneal injection. Animals were sacrificed after 4 weeks. Bone length was measured; bone morphology was assessed by microcomputed tomography and dynamic histomorphometry. Reduced bone length was the only genotype-specific effect and only observed in males (p < .05). WT rats exposed to PCB 126 had reduced serum calcium, and smaller bones with reduced tibial length, cortical area, and medullary area relative to vehicle controls (p < .05). Reduced bone formation rate observed in dynamic histomorphometry was consistent with inhibition of endosteal and periosteal bone growth. The effects of PCB 126 were abolished in AhR −/− rats. Gene expression in bone marrow and shaft were assessed by RNA sequencing. Approximately 75% of the PCB-regulated genes appeared AhR dependent with 89 genes significantly (p < .05) regulated by both PCB 126 and knockout of the AhR gene. Novel targets significantly induced by PCB 126 included Indian hedgehog (Ihh) and connective tissue growth factor (Ctgf/Ccn2), which regulate chondrocyte proliferation and differentiation in the bone growth plate and cell-matrix interactions. These data suggest the toxic effects of PCB 126 on bone are mediated by AhR, which has direct effects on the growth plate and indirect actions related to endocrine disruption. These studies clarify important mechanisms underlying skeletal toxicity of dioxin-like PCBs and highlight potential therapeutic targets.

Keywords: aryl hydrocarbon receptor (AhR), PCB 126, bone growth, Indian hedgehog

INTRODUCTION

Polychlorinated biphenyls (PCBs) are ubiquitous mixtures of lipid soluble organic organochlorine pollutants that are resistant to degradation and which bioaccumulate up the food chain. PCBs were used widely in electrical equipment like capacitors and transformers, and as a class, consist of 209 congeners existing in coplanar or noncoplanar conformations depending on the number and distribution of chlorine atoms around the phenyl rings (Tanabe, 1988). In 1979, the U.S. Environmental Protection Agency banned the use of PCBs over concerns regarding toxicity. However, PCBs still remain in the environment (Faroon and Ruiz, 2016) and persistent organochlorine pollutants such as PCBs, dioxins and dibenzofurans (PCDDs and PCDFs) continue to adversely affect human health (Pavuk et al., 2014). There is epidemiological evidence linking organochlorine pollutant exposure to skeletal toxicity. Significantly decreased bone density and increased fracture rates have been reported in Swedish and Inuit cohorts with high dietary intake of persistent organochlorine pollutants including PCBs via consumption of fish and marine mammals (Alveblom et al., 2003; Downie and Fenge, 2003; Glynn et al., 2001). However, mechanisms whereby organochlorine pollutants affect bone are poorly understood.

Bone is the major structural and supportive connective tissue of the body. In addition, the skeleton serves as a reservoir for minerals, especially calcium (Ca) and phosphate (Peacock, 2010). Maintenance of circulating Ca levels within a narrow range requires tight regulation of intestinal and kidney transport and the release of the ion from the mineral matrix of bone (during hypocalcemia), or its sequestration into the matrix (during hypercalcemia). Factors both endogenous (eg, hormones, such as parathyroid hormone [PTH] and vitamin D3) and exogenous (eg, toxicants) can modify the balance of bone formation and resorption indirectly by affecting Ca homeostasis and directly via effects on bone cell differentiation (Goltzman et al., 2018; Peacock, 2010). We have previously published data suggesting that exposure to the highly persistent coplanar congener PCB 126 (3,3′,4, 4′,5-pentachlorobiphenyl) results in skeletal toxicity in male rats as a result of both endocrine disruption of the PTH-vitamin D3-Ca axis and the growth hormone (GH)-insulin-like growth factor 1 (IGF-1) axis and via direct inhibition of osteoblastogenic differentiation of bone marrow-derived mesenchymal stem cells (Ronis et al., 2020).

The aryl hydrocarbon receptor (AhR, dioxin-receptor) is a member of the basic helix-loop-helix-(bHLH) superfamily of transcription factors, which are associated with cellular responses to environmental stimuli, such as xenobiotic and oxygen levels. AhR is a ligand-activated transcription factor, and when bound to a ligand such as dioxin (2,3,7,8-tetrachloro-dibenzodioxin, TCDD), it activates the transcription of numerous genes, including drug metabolizing enzyme cytochrome P450 family 1 (Larigot et al., 2018). Coplanar PCBs, such as PCB 126, have been suggested to structurally resemble dioxin and to act primarily via AhR signaling (Tanabe, 1988). However, the role of the AhR in skeletal biology and AhR-dependent and -independent skeletal targets of coplanar PCBs and other dioxin-like organochlorine pollutants remain the subject of active investigation (Fader et al., 2018; Ronis et al., 2020). Moreover, there appear to be significant sex and species differences in AhR signaling (Boverhof et al., 2006; Girer et al., 2019; Harrill et al., 2013; Kovalova et al., 2017; Wejheden et al., 2010). Previously described bone phenotypes following exposure to AhR ligands in rats and mice appear to differ significantly (Fader et al., 2018; Ronis et al., 2020). The objective of this study was to determine the effect of coplanar PCB 126 exposure on the bones of growing male and female rats. The hypothesis that PCB 126 acts via the AhR was tested by comparison of effects of PCB 126 exposure on serum Ca, bone phenotypes and bone gene expression profile in wild type (WT) and AhR knockout rats.

MATERIALS AND METHODS

Animal experiments

All protocols and procedures were approved by Institutional Animal Care and Use Committee of the University of Kansas Medical Center. The Ahr null rat model was generated using CRISPR/Cas9-mediated disruption of the AHR bHLH DNA-binding domain. Ahr mutant rats are available at the Rat Resource & Research Center (RRRC No. 831; strain name SD-Ahrem1Soar; University of Missouri, Columbia, Missouri; www.rrrc.us, last accessed March 11, 2020). At approximately 4 weeks of age WT and Ahr null male and female Holtzman Sprague Dawley rats had body weights ranging from 70 to 130 g. Rats were fed a standard rodent diet (Teklad No. 8604, Envigo, Indianapolis, Indiana) and had free access to food and water. Both WT (n = 28) and Ahr null (n = 25) male and female rats were injected with a single ip dose of corn oil vehicle (5 ml/kg body weight) or PCB 126 in corn oil (5 mmol/kg body weight). The PCB dose was chosen based on previous studies (Gadupudi et al., 2016; Ronis et al., 2020). There was a total of 8 groups: 4 groups of male rats (n = 24) and 4 groups of female rats (n = 23): (1) WT rats treated with vehicle, (2) WT rats treated with PCB 126, (3) Ahr null rats treated with vehicle, and (4) Ahr null rats treated with PCB 126. Twenty-one and 25 days after treatment, all rats were injected sc with 25 mg/kg calcein to label bone for pulse chase dynamic histomorphometric analysis of bone growth. All rats were euthanized using carbon-dioxide asphyxiation followed by thoracotomy 28 days following PCB 126 administration.

Blood collection and serum analysis

Whole blood samples from the hearts were collected into S-Monovette tubes designed for harvesting serum, after euthanasia. The blood was allowed to clot in the tubes and the serum fractions were separated by centrifugation at 1500 × g for 10 min at 4°C. The serum samples were aliquoted and frozen at −80°C until further analysis. The measurements of serum calcium and phosphorous were performed by Comparative Clinical Pathology Services LLC (CPath, Missouri).

Bone morphology

Tibial bone length was measured at sacrifice using calipers. The microarchitecture of trabecular bone was assessed by microCT at the LSU Vet School and verified in a replicate scan at Texas A&M using ex vivo fixed tibia as described previously (Bouxsein et al., 2010; Sebastian et al., 2008; Suva et al., 2008). All microCT analyses were consistent with current guidelines for the assessment of bone microstructure in rodents using microcomputed tomography (Bouxsein et al., 2010). Formalin-fixed tibia was imaged using a MicroCT 40 (Scanco Medical AG, Bassersdorf, Switzerland) using a 16-μm isotropic voxel size in all dimensions. Semiautomated contouring was used to select a region of interest extending 3.2 mm proximal to the distal femoral metaphysis, but excluding the cortex and subcortical bone, composed of 250 adjacent slices. Three-dimensional reconstructions were created by stacking the regions of interest from each 2-dimensional slice and then applying a gray-scale threshold and Gaussian noise filter as described (Suva et al., 2008), using a consistent and predetermined threshold (300) with all data acquired at 55-kVp, 145-mA, and 275-ms integration time. Fractional bone volume (bone volume/tissue volume; BV/TV) and architectural properties of trabecular bone, trabecular thickness (Tb.Th.), trabecular separation (Tb.Sp.), trabecular number (Tb.N.), and connectivity density (Conn.D., mm3), were calculated using previously published methods. Whereas BV/TV represents a measure of overall trabecular density, Tb.Th, Tb.Sp., and Tb.N. provide more specific information with regards to the properties of the trabeculae. Conn.D. represents a measure of the degree to which trabecular bone networks interact and is a better measure of bone quality. For cortical bone assessment, microCT slices were segmented into bone and marrow regions by applying a visually chosen, fixed threshold for all samples after smoothing the image with a 3-dimensional Gaussian low-pass filter (σ =  0.8, support = 1.0) to remove noise, and a fixed threshold. Cortical geometry was assessed in a 1.5-mm-long region centered at the femoral midshaft. The outer contour of the bone was found automatically using the built-in Scanco contouring tool. Total area (TA) was calculated by counting all voxels within the contour, bone area (BA) was calculated by counting all voxels that were segmented as bone, and marrow area was calculated as TA—BA. This calculation was performed on all 40 slices using the average for the final calculation. The outer and inner perimeter of the cortical midshaft was determined by a 3-dimensional triangulation of the bone surface of the 40 slices, and cortical thickness (Ct.Th.) and other cortical parameters were determined as described. Parameters assessed included total cross-sectional area, cortical area, Ct.Th., medullary area (Me.Ar.), periosteal perimeter, and endocortical perimeter. Dynamic histomorphometry measures were carried out on sections visualized for the calcein labels by fluorescent microscopy (Watt et al., 2018).

mRNA-Seq analysis

Global gene expression profiles in bone marrow and shaft samples were assessed via directional RNA sequencing (RNA-Seq). Total mRNA was isolated from the tibial bone marrow and shaft of vehicle and PCB 126-treated WT and AhR −/− female rats using the recently described improved room temperature RNAlater procedure from our laboratory (Pedersen et al., 2019). mRNA was isolated from bone marrow of N = 3 WT controls, N = 3 PCB 126-treated WT rats, and N = 3 PCB 126-treated AhR −/− rats. In addition, mRNA was isolated from 1 tibial shaft from each treatment group. RNA quality was confirmed spectrophotometrically. Poly-A RNA was isolated from 5 μg of total RNA using Dynabeads mRNA-Direct kit (Invitrogen, Carlsbad, California) and procedures described previously (Pedersen et al., 2019). Briefly, poly-A RNA was captured by addition of 100 μl of Oligo-(dt)25 Dynabeads in 150 μl of lysis buffer. The mixture was incubated on a rotary shaker for 20 min at room temperature. mRNA-bead complexes were washed twice with 100 μl of wash buffer A (10 mM Tris-HCl, pH 7.5, 0.15 M LiCl, 1 mM EDTA, 0.1% LiDS), followed by 2 washes (100 μl each) with wash buffer B (10 mM Tris-HCl, pH 7.5, 0.15 M LiCl, 1 mM EDTA). RNA was eluted from the beads in 11 μl of nuclease-free water by heating to 65°°C for 5 min.

RNA-Seq library construction was carried out using NEB-Next reagents (New England Biolabs, Ipswich, Massachusetts). First- and second-strand complementary DNA (cDNA) synthesis, end-filling using Klenow fragment, and dA-tailing were carried out using manufacturer’s recommendations. Ligation with Illumina’s paired-end adapters for multiplexed sequencing was performed with 1 μl of T4 DNA ligase, 0.3 μM of annealed adapters, in a 50 μl reaction volume for 30 min at room temperature. Ligated products were separated using a high-resolution 2% agarose gel, and products around 200 bp (±50 bp) were excised and purified using Qiagen gel extraction kit (Qiagen, Valencia, California). Size-selected cDNA libraries were amplified using indexed primers. PCR was carried out for 12–14 cycles using 29 μl of template, 1 μl of forward and reverse primers (25 μM), and 1 U Phusion high-fidelity DNA polymerase (New England Biolabs). PCR products were purified using Qiaquick PCR purification columns (Qiagen) and eluted in 30 μl final volume. A small aliquot (approximately 1 μl) was evaluated using DNA1K chip (Experion, Bio-Rad, Hercules, California) to confirm the absence of primer-dimers and other spurious products. Quantification of the RNA-Seq libraries was done via Qubit dsDNA HS Assay kit (Biotium, Fremont, California). Sequencing of libraries was carried out using Illumina sequencing. Data analysis was carried out using the both publically available and in-house scripts for read filtering, trimming, alignment (Tophat2). Aligned reads were quantitated and annotated in SeqMonk (Shankar et al., 2015) and differentially expressed genes between groups were identified as described in the Statistical Analysis section. Corrections for multiple testing were performed using the false discovery rate method. Gene Ontology (GO) analysis of gene lists was conducted as enrichment analysis (Panther Overrepresentation test) from the Gene Ontology Consortium webpage, www.geneontology.com, last accessed March 11, 2020 (Ashburner et al., 2000; The Gene Ontology Consortium, 2017). In addition, Ingenuity Pathway analysis (Qiagen, Redwood City, California) was conducted for genes regulated by PCB 126 and where changes in expression after PCB 126 treatment were prevented in AhR −/− animals. Complete gene expression data sets have been submitted in SRA (ID PRJNA593994) and a list of differentially expressed genes are also presented in Supplementary File 1). To test if any genes regulated by PCB exposure might be independent of AhR signaling we tested post hoc ANOVA whether the PCB regulation in WT rats (mPCB.wt—mOil.wt, where m is the average expression measured in log2 CPM values) is the same as the PCB regulation comparing WT and Ahr KO rats (mPCB.wt-mPCB.Ahr KO), ie, whether (mPCB.wt-mOil.wt)—(mPCB.wt-mPCB.Ahr KO) = 0, or equivalently whether mPCB.Ahr KO = mOil.wt. Genes for which this test was significant (p < .05) without correction for multiple comparisons are listed in Supplementary File 2.

Quantitative RT-PCR

The concentration of gene transcripts in bone shaft RNA was determined with Power SYBR Green RNA-to-Ct 1-STEP Kit (Applied Biosystems) using a LightCycler 480 II system (Roche). The genes analyzed with the corresponding forward and reverse primers are shown in Table 1. Concentration of mRNA transcripts in liver was determined as follows: Total RNAs were isolated from rat hepatic tissue (10–20 mg) using the RNeasy Plus Mini kit from Qiagen, Inc (Germantown, Maryland). Absorbance of the isolated RNA was determined at 230, 260, and 280 nm. The purity ratios (A260/A280 and A260/230) of RNA samples were between 1.8 and 2.0. cDNAs were synthesized from total RNAs with a high-capacity cDNA reverse transcription kit from Applied Biosystems, Inc (Foster City, California). Real-time quantitative PCR measurements of individual cDNAs (template concentration was 10 ng) were performed using a SYBR Green Master Mix kit supplied by Applied Biosystems, Inc. The gene-specific primers for liver were hypoxanthine phosphoribosyltransferase-1 (Hprt1), forward 5′-TCAAGCAGTACAGCCCCAA-3′ and reverse 5′-GCCTGTATCCAACACTTCGAG-3′; CYP2C11, forward primer 5′-GTCCAACACCTCTCCCAA TC-3′; and reverse 5′-AAGGGCTTCATGCCCAAATAC-3′, and CYP3A2, forward 5′-TGGGACCATCTCCATCCACA-3′; and reverse 5′-TCAAAGGACGAGGACATGGTTA-3′. These primers were synthesized by Integrated DNA Technologies, Inc. (Coralville, Iowa). The program for the amplification reaction was started at 95°C for 10 min followed by 40 cycles of 2-step PCR cycle at 95°C for 15 s and 60°C for 1 min using an Eppendorf RealPlex2 Mastercycler (Hamburg, Germany). Every sample was measured in duplicate, and every single plate had a melting curve to identify any primer dimers. The reference gene hypoxanthine-guanine Hprt1 was used to normalize the transcript levels of all the genes. The mean of control group was used to normalize the expression level of individual genes in different PCB 126-exposed groups. The standard curve-based method was used to quantify the final relative transcript levels for each gene.

Table 1.

Primers Used for Real-time RT-PCR

Gene Name Start of FWD/REV Forward Sequence Reverse Sequence
Aryl hydrocarbon receptor repressor (AhRR) 634/875 TGCTGACACAGACAATACCGT TGCAAAACAAGGAGAGCCGA
Beta-actin (Actb) 431/515 AGATGACCCAGATCATGTTTGAGA CCAGAGGCATACAGGGACAAC
Ccn2 751/851 CCCTAGCTGCCTACCGACTG CTTAGAACAGGCGCTCCACT
Cytochrome P450 family 1 subfamily A member 1 (Cyp1a1) 693/916 TGGCAGACGTTATGACCACG TGTGGCCCTTCTCAAATGTCC
Cygb 538/661 ACTTTAAGATTCTCTCTGGGGTC GCGGTCACATGGCTGTAGAT
Ihh 536/678 CATGACCCAGCGCTGCAAG CGCGGCCCTCATAGTGTAAA
Gpnmb 375/494 GGCCTTGGTGGGTTCCAATA GCCAGCTCCAAATCACTTCTG
Statistical analysis

Data are presented as mean ± SEM. Statistical significance was determined by 2-way ANOVA followed by Student-Newman-Keuls post hoc analysis except for liver mRNA expression where statistical significance was determined by 2-way ANOVA followed by Tukey-Kramer post hoc analysis. Analyses were performed at alpha = 0.05 using SigmaPlot version 11.0 (Systat Software, San Jose, California), Microsoft Excel (2016) or GraphPad Prism and significance (p < .05) is reported as such.

RESULTS

Effects of PCB 126 and AhR Genotype on Serum Calcium and Male-specific Hepatic Expression of Cytochrome P450s

In a previous study in male rats, we observed endocrine disruption including hypocalcemia and disrupted calcium homeostasis, associated with suppression of intestinal calcium transporters, and dysregulation of the GH-IGF-1 axis as indicated by significant reductions in serum IGF-1 and hepatic expression of mRNAs encoding male GH-pattern dependent cytochrome P450 enzymes CYP2C11 and CYP3A2 after treatment with PCB 126 (Ronis et al., 2020). A similar decrease in serum calcium was observed in WT male rats in this study (p = .053) and which was prevented by knockout of the AhR (Figure 1). A similar pattern of changes in mean serum calcium values was observed in WT and AhR −/− female rats but did not reach statistical significance. In addition, expression of CYP2C11 mRNA in WT male liver was also suppressed (p < .05) by PCB 126 treatment in this study but unaffected in AhR −/− males (relative expression—WT males: 1.00 +/− 0.08 vs WT PCB 126 males: 0.07 +/− 0.08; AhR −/− males: 0.95 +/− 0.03; AhR −/− PCB 126 males: 0.95 +/− 0.1). Similar suppression by PCB 126 treatment in WT males but not AhR −/− males was also observed for expression of hepatic CYP3A2 mRNA (relative expression—WT males: 1.00 +/− 0.1 vs WT PCB 126 males: 0.45 +/− 0.4; AhR −/− males: 0.7 +/− 0.08; AhR −/− PCB 126 males: 0.8 +/− 0.06) (p < .05). Neither of these male-specific cytochrome P40s was expressed significantly in female livers.

Figure 1.

Figure 1.

PCB 126 treatment results in hypocalcemia in WT male rats which is reversed in AhR −/− rats. Data are mean ± SEM, 2-way ANOVA followed by Student-Newman-Keuls post hoc analysis in each sex, n = 4–6/group.

Effects of PCB 126 and AhR Genotype on Tibial Length

We previously observed reduced longitudinal length of tibial bones of male rats exposed to PCB 126 coincident with disruption of the GH-IGF-1 axis (Ronis et al., 2020). In this study, PCB 126 treatment similarly reduced male bone length by 8% (p < .05) (Figure 2). Vehicle-treated AhR −/− male rats also had shorter bones than vehicle-treated WT males (p < .05). However, PCB 126 treatment of AhR −/− male rats did not result in any reduction in bone length relative to the vehicle-treated group. Bone length in WT female rats was shorter than that in male WT rats (p < .05). Effects of PCB 126 and AhR −/− genotype on mean bone length in female rats followed a similar pattern to males with PCB treatment reducing tibial length (p < .05) in WT rats and no significant effect in AhR −/− rats but in this case genotype x treatment interaction did not reach statistical significance.

Figure 2.

Figure 2.

PCB 126 treatment reduces the length of long bones in an AhR-dependent fashion. Data are mean ± SEM values for left tibial length, means with different letters are statistically significant (p < .05) by 2-way ANOVA followed by Student-Newman-Keuls post hoc analysis in each sex, n = 4–6/group, a > b; a > c; c > b; and x > y. Male bone length > female bone length p < .05 a > x by t test.

Effects of PCB 126 and AhR Genotype on Bone Morphology

Figure 3 includes representative 3D images of trabecular and cortical bone from vehicle and PCB 126-treated female WT and AhR −/− rats. Figures 4 and 5 show quantitation of microCT data from the trabecular and cortical compartments, respectively. PCB 126 treatment had no significant effect on trabecular BV/TV in WT or AhR −/− rats of either sex. However, there appeared to be a significant increase in Tb.Th. (p < .05) in WT males which was not observed in PCB 126-treated AhR −/− males (Figure 4). A similar trend was observed in female mice (p = .06). No significant effects of PCB 126 or genotype were observed on Tb.N, Tb.Sp., or Conn.D. density. Analysis of the cortical compartment in WT male and female rats exposed to PCB 126 revealed them to have smaller bones than controls (Figure 5). Cortical BA, TA, and medullary area (MA) were all reduced (p < .05). Because TA was reduced more than BA there was a small increase in BA/TA (p < .05). The effects of PCB 126 on cortical bone size were lost in both sexes of AhR −/− rats. Cortical bone mineral density (Cort. TMD) was slightly elevated in male WT rats after PCB 126 treatment (p < .05) and there was also a trend to increase Ct.Th. in PCB 126-treated WT males (p = .06). No effect of PCB 126 treatment was observed on these parameters in AhR −/− rats or in females (Figure 5). Dynamic histomorphometric analysis of calcein labeled female tibial bones revealed reduced mean bone formation rate in the WT group after PCB 126 treatment and no effect of PCB 126 in the AhR −/− group, treatment x genotype interaction p = .09 (Figure 6). PCB 126 treatment also resulted in an overall decrease in mineralized surface (p < .05) but had no effect on mineral apposition rate (Figure 6).

Figure 3.

Figure 3.

Representative microCT scans of female rat trabecular and cortical bone from WT and AhR −/− rats after vehicle (oil) or PCB 126 treatment.

Figure 4.

Figure 4.

Effects of PCB 126 treatment on tibial trabecular bone morphology in male and female WT and AhR −/− rats: microCT quantitation. Bone volume/tissue volume (BV/TV); Tb.Th.; Data are mean ± SEM. Means with different letters are statistically significant (p < .05) by 2-way ANOVA followed by Student-Newman-Keuls post hoc analysis in each sex, a < b, n = 4–6/group.

Figure 5.

Figure 5.

Effects of PCB 126 treatment on tibial cortical bone morphology in male and female WT and AhR −/− rats: microCT quantitation. BA; TA; BA/TA; Cort. TMD; medullary area (Me.Ar.); Crt.Th. Data are mean ± SEM. Means with different letters are statistically significant (p < .05) by 2-way ANOVA followed by Student-Newman-Keuls post hoc analysis in each sex, n = 4–6/group, a < b; x < y. Male > female; p < .05 a > x; b > y by t test.

Figure 6.

Figure 6.

Dynamic histomorphometric analysis of PCB 126 treatment effects on tibial parameters in female WT and AhR −/− rats. Data are mean ± SEM. Two-way ANOVA followed by Student-Newman-Keuls post hoc analysis, n = 4–6/group.

mRNA-Seq Analysis of Bone Marrow and Shaft

mRNA-Seq analysis of bone marrow from the female revealed a total of 254 genes regulated by exposure to PCB 126 relative to mRNA expression in WT controls. One hundred and twenty-five genes were downregulated and 129 upregulated (Supplementary File 1). When compared with gene expression in marrow of PCB 126-treated AhR −/− mice, an 80% concordance was observed between PCB- and AhR-regulated genes (Figure 7). Fifty-three marrow genes (20%) appeared to be regulated by PCB 126 independent of AhR expression (Supplementary File 2). Comparison of gene expression patterns regulated by PCB 126 in bone marrow and bone shaft revealed approximately 50% concordance in expression, the majority of which were upregulated (Figure 8). Of the PCB-regulated genes in WT femur marrow, 89 were highly regulated and statistically significantly different comparing vehicle and PCB 129 groups (p < .05) and in addition also had significantly different levels of expression (p < .05) in PCB-treated WT femur marrow versus PCB-treated AhR −/− marrow (Supplementary File 3). Many of the additional genes regulated by PCB 126 listed in Supplementary File 1 demonstrated a concordance between PCB- and AhR-mediated responses but did not achieve statistical significance by both criteria. Fifty genes were upregulated > 2-fold and 10 genes downregulated 2-fold. An additional 29 genes were significantly regulated under both criteria but were regulated < 2-fold. Gene Ontology and Ingenuity Pathway analyses indicated that the PCB-regulated genes clustered in the following pathways: xenobiotic and organic cyclic compound regulation; defense responses; cytokine regulation; protein phosphorylation and phosphate metabolism; calcium binding; cell junctions and projections; and extracellular matrix genes (Figure 7). Upregulated xenobiotic-regulated genes included well-known AhR targets in bone and other tissues. These included CYP1A1, CYP1B1, AhRR, CYP2D1, NAPQ1, and AldH3a (Larigot et al., 2018). Upregulated genes with known functions in bone cells included TRPV1, a peripheral cannabinoid receptor previously shown to stimulate increased bone formation (Rossi et al., 2019); Stab1, previously shown to upregulate osteoclastogenesis (Kim et al., 2019); CCl22, a chemokine previously shown to be anti-inflammatory in bone (Araujo-Pires et al., 2015); NTRK2, a nerve growth factor receptor previously shown to be involved in regulation of bone mass (Camerino et al., 2016); Has2, upregulation of which has previously been linked to decreased RANKL production and inhibition of osteoclastogenesis (Nakao et al., 2019) and Gdf15, which is involved in mechanical stimulation of osteoblastogenesis (Symmank et al., 2019). Interestingly other PCB 126 upregulated AhR-dependent genes comprised several involved in cell-matrix interactions and the bone growth plate including Ihh (Indian hedgehog), which plays a key role in regulation of chondrocyte differentiation and growth plate morphology (Karsenty et al., 2009; Kobayashi et al., 2005; Tsang et al., 2014); Ctgf (CCN2, connective tissue growth factor), which regulates extracellular matrix remodeling (Honda et al., 2019); Capri13, a member of a protein family known to be associated with cytoskeletal organization and calcium binding (Oftadeh et al., 2015); Crlf1, which is known to be upregulated by bone morphogenetic protein 2 in differentiating chondroblasts/osteoblasts and Anaxa8, an osteoclast marker known to be matrix stimulated (Clancy et al., 2003). Other matrix-associated genes were downregulated by PCB 126 treatment. These included Scube3. The SCUBE family of proteins has been implicated in regulation of Ihh signaling (Lin et al., 2015; Wu et al., 2004). Additional downregulated matrix genes were PAPPA2, which has been associated with IGF-1 stimulated collagen and cartilage formation (Chen et al., 2019), Eln (elastin), and Fbn2 (fibrillin 2), which encodes a matrix niche protein associated with growth factor and mechanosensing (Sengle and Sakai, 2015). A number of other PCB 126 up- and downregulated genes have known roles in B and T cell differentiation and are known to be AhR-regulated targets of immune toxicity (Esser, 2016). These included CDH17, Dhh, and PACAP (Funakoshi et al., 2015; Hegde et al., 2008; Xu et al., 2016). Interestingly no significant changes in expression were observed in genes associated with marrow adiposity including PPARγ, AP2, Cepba, or FABP4.

Figure 7.

Figure 7.

PCB-regulated and AhR-dependent gene expression in female rat femur bone marrow as determined by RNA-Seq. Data are derived from mRNA extracted from n = 3 WT control; WT-PCB 126- and AhR −/− PCB 126-treated bones. The panels show the genes for which the effects of PCB 126 in WT rats are statistically significant and involved in enriched GO pathways. The magnitude of the PCB effects is depicted on a scale of Δ log2 CPM (Count per million) values. The PCB effects in WT animals (blue bars) are compared with the difference in expression for PCB-treated WT rats versus PCB AhR −/− (red bars). The right side of the panels show enriched physiological pathways that the genes participate in.

Figure 8.

Figure 8.

Comparison of PCB 126-regulated genes in n = 3 female rat femur bone marrow and n = 1 shaft as determined by RNA-Seq. Shown are genes that are significantly upregulated by PCB (PCB vs oil in WT rats) in femur (right panel) or significantly downregulated (left panel). The magnitude of the PCB effect is depicted on a scale of Δ log2 CPM (Count per million) values. The blue bars illustrate the PCB effect in the femur marrow. The red bars show the PCB effect in the femur shaft comparing 1 femur shaft from a PCB-treated WT rat to 1 femur shaft from an oil vehicle-treated WT rat.

Real-time RT-PCR Confirmation of mRNA Expression

We confirmed mRNA-Seq data on expression of a variety of genes in bone shaft and marrow by real-time RT-PCR (Figure 9). Both Cyp1a1 and Ihh mRNAs were confirmed to be highly upregulated in an AhR-dependent fashion in both shaft (Figure 9A) and marrow (Figure 9B). In addition, we confirmed AhR-dependent upregulation of AhRR mRNA in the bone shaft and Ccn2 mRNA in the marrow. We also examined expression of osteoactivin (Glycoprotein Non-Melanoma Protein B, Gpnmb) mRNA in bone marrow. This gene which has previously been shown to be highly upregulated by TCDD treatment in mouse bone (Fader et al., 2018) did appear to be reduced somewhat in AhR −/− marrow compared with WT marrow but was unaffected by PCB 126 treatment (Figure 9B). Expression of cytoglobin (Cygb) mRNA in bone was not significantly affected by PCB 126 or AhR ablation (data not shown).

Figure 9.

Figure 9.

Real-time RT-PCR verification of AhR-dependent PCB 126-induced changes in relative mRNA expression in femur marrow and shaft from female rats. Abbreviations: Cyp1a1, cytochrome P450 1A1; AhRR, aryl hydrocarbon receptor repressor; Ihh, Indian hedgehog; Opn, osteopontin; Ccn2, connective tissue growth factor; Gpnmb, osteoactivin. Data are mean ± SEM. Means with * are statistically significant between vehicle- and PCB-treated WT and between PCB-treated WT and PCB-treated AhR −/− by 2-way ANOVA followed by Student-Newman-Keuls post hoc analysis, n = 6/group. *p < .05; **p < .005; ***p < .0005.

Real-time RT-PCR mRNA Expression of Gpnmb in Rat Liver

Because Gpnmb is also highly expressed in liver and is a secreted protein we also measured Gpnmb mRNA expression in liver. In contrast to bone, PCB 126 treatment significantly induced Gpnmb mRNA in liver of both WT male and female rats, an effect abolished in the AhR −/− groups (p < .05) (Figure 10).

Figure 10.

Figure 10.

Relative expression of Gpnmb mRNA in liver of WT and AhR −/− male and female rats. Data are mean ± SEM. Statistical difference by 2-way ANOVA followed by Tukey-Kramer post hoc test (*p < .05), n = 4–6/group.

DISCUSSION

Epidemiological studies have found reduced bone density and increased fracture risk in populations with a high intake of persistent dioxin-like organochlorine pollutants (Alveblom et al., 2003; Downie and Fenge, 2003; Glynn et al., 2001). Our results suggest that exposure to PCB 126 results in such skeletal toxicity primarily via activation of signaling via the AhR. Consistent with results from previous studies including those from our laboratory (Alvarez-Lloret et al., 2009; Lind et al., 2000a,b; Ronis et al., 2020), WT rats exposed to PCB 126 had reduced tibia bone length and smaller cortical TA and medullary area relative to vehicle controls (p < .05). Similar results have been reported in rats exposed to the potent AhR ligand TCDD (Jämsä et al., 2001). The effects of PCB 126 exposure on bone morphology and gene expression were absent in AhR −/− rats.

PCB 126 was a minor component of the Aroclor commercial mixtures produced in the United States (Frame et al., 1996). However, due to its persistence and resistance to metabolic breakdown, PCB 126 is routinely found in human adipose, human breast milk (Hansen, 1999, Supplementary Appendix Tables 12 and 13), and tissues from ocean mammals. Iwata et al. (2004) found that PCB 126 contributed the most TEQ among the PCBs, PCDDs, and PCDFs, accounting for 37%–59% of the total TEQ in the livers of Baikal seals. So whereas PCB 126 is a minor component of PCBs measured in environmental matrices, it is a major contributor to the toxicity of persistent organochlorine pollutant mixtures. It is very difficult to compare the tissue levels of PCB 126 in this study to those of TCDD in the study of Jämsä et al. (2001), because that paper does not give any information/methods descriptions on how the TCDD was extracted or quantified, or how the tissues were dried. Only levels of TCDD are presented as ng/g dry weight with no further information. Assuming that TCDD was not lost in the drying process, the TCDD liver levels measured by Jämsä are very low, falling between 0.5 and 537 ng/g dry weight. Rignall et al. (2013) found that the half-life of PCB 126 in mouse liver was approximately 25 days. Baring redistribution differences, one could assume that this would hold for other tissues. However, the lipid content of tissues, and the presence of CYP1A2 which will bind PCB 126 avidly, would affect the distribution. So for the 28 day time frame of this study, one could assume that the liver concentrations would be half of the initial peak produced by a single ip injection of 5 mmol/kg at the termination of the experiment.

Based on our previous data (Ronis et al., 2020), a portion of skeletal toxicity produced by PCB 126 exposure appears to be mediated via systemic disruption of calcium homeostasis associated with suppression of vitamin D-regulated calcium transporters in the intestine and decreases in serum IGF-1 associated with dysregulation of the GH-IGF-1 axis. Data from this study confirm both reductions in serum calcium concentrations and suppression of GH-dependent, male-specific cytochrome P450 expression accompanied by reduced longitudinal bone growth which we previously reported in male rats after PCB 126 exposure. These endocrine disrupting effects of PC B 126 were prevented by AhR ablation. Similar skeletal toxicity accompanied by impaired longitudinal bone growth associated in part with endocrine disruption of the Ca-PTH-Vitamin D and GH-IGF-1 axis have been reported for other environmental pollutants such as lead (Ronis et al., 2001) and to partially underlie alcohol-induced osteopenia (Badger et al., 1993; Mercer et al., 2012; Ronis, 2011, 2018).

The effects of PCB 126 on bone morphology are consistent with suppression of endosteal and periosteal bone formation. We have previously reported AhR-dependent inhibition of osteoblast differentiation from bone marrow-derived mesenchymal stem cells ex vivo (Ronis et al., 2020). Our current gene expression data suggest that PCB 126 also dysregulates bone cell-matrix interactions and growth plate function in an AhR-dependent fashion in the rat. Ihh which appears to be a major AhR-dependent PCB 126 target is critical for the regulation of chondrocyte differentiation and growth plate morphology. A complex negative feedback loop between Ihh- and PTH-related hormone controls normal endochondral ossification in long bones (Karsenty et al., 2009; Tsang et al., 2014). Overexpression of Ihh after PCB 126 exposure would result in significant effects on these signaling pathways. Interestingly, Ihh was previously identified as an AhR-target in intestinal epithelial cells (Park et al., 2016) and another AhR ligand benzo(a)pyrene has previously been shown to dysregulate chondroblastogenesis in vitro (Kung et al., 2012). Another potential mediator of PCB 126 skeletal toxicity is CYP1A1 which was also highly induced in bone in an AhR-dependent manner. This enzyme has previously been implicated in TCDD-induced skeletal toxicity in mice (Iqbal et al., 2013).

Surprisingly, our data on skeletal effects of PCB 126 in rats are somewhat different from a recent report examining the dose-responsive effects of TCDD on bone in C57BL/6 mice (Fader et al., 2018). That study reported a dose-dependent increase in trabecular bone BV/TV and mineral density, accompanied by reductions in bone marrow adiposity (Fader et al., 2018). Although BV/TV did not reach statistical significance in this study, we did observe increased Tb.Th. and have previously observed significantly increased tibial trabecular BV/TV and Tb.Th. in male rats exposed to PCB 126 (Ronis et al., 2020) However, the major effects of PCB 126 observed in the current and our previous study were on cortical bone, bone size and length (Ronis et al., 2020), Fader et al. report no effects of TCDD on bone size or any cortical parameters. The bone morphological effects of TCDD in the mouse were ascribed to increased osteoblastogenesis, inhibited osteoclast function and reduced mesenchymal stem cell differentiation into adipocytes and was suggested to be mediated via TCDD-mediated induction of the osteoactivin (Gpnmb) gene in bone (Fader et al., 2018). However, there are also substantial species differences between AhR signaling. AhR-mediated gene expression profiles in rat and mouse hepatocytes differ substantially (Boverhof et al., 2006; Forgacs et al., 2013; Kovalova et al., 2017) and similar differences may occur in AhR signaling in bone cells. We measured Gpnmb mRNA expression in bone marrow and liver from the rats. Although mean expression was reduced in bone marrow of AhR −/− rats, this gene appears not to be a PCB 126 target in rat bone (Figure 9). In contrast, Gpnmb mRNA was induced in an AhR-dependent fashion by PCB 126 treatment in both WT male and female livers (Figure 10). Because Gpnmb is a secreted protein, it is possible that induction of hepatic Gpnmb contributes to the bone phenotype in WT rats after PCB 126 treatment. Part of the species difference in bone phenotypes may be related to the relative potency of PCB 126 versus TCDD for the AhR. PCB 126 has a TCDD Equivalency Factor of 0.1 (Gadupudi et al., 2016).

In conclusion, our data demonstrate that skeletal toxicity occurs in rats following exposure to the coplanar PCB congener PCB 126. These effects appear to be mediated in part indirectly via AhR-mediated endocrine disruption, and also involve direct AhR-mediated effects on growth plate function, bone cell-matrix interactions and bone formation. The data suggest that AhR activation plays a key role in skeletal toxicity found in human populations exposed to persistent organochlorine pollutants. However, further studies are required to understand species differences in AhR-associated skeletal regulation.

SUPPLEMENTARY DATA

Supplementary data are available at Toxicological Sciences online.

FUNDING

National Institute of Environmental Health Sciences (P42 ES013661 to L.W.R); National Institute on Alcohol Abuse and Alcoholism (R37 AA018282 to M.J.R.). The National Institute of General Medicine (R25 GM12189) funded LSUHSC-New Orleans Post baccalaureate Research Education Program (PREP) in Biomedical Sciences, the Iowa Superfund Training Core (R01 ES029280 to M.J.S., R21 ES028957 to K.I.).

DECLARATION OF CONFLICTING INTERESTS

The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

AUTHOR CONTRIBUTIONS

Project lead and planning: M.J.J.R., L.W.R.; Experimental work: A.E.W., J.W., L.W.R., G.G., M.L.O., J.S., K.I., K.P., S.L., C.M.; Data Analysis: A.E.W., J.W., L.S.S., M.J.J.R. Manuscript writing and editing: A.E.W., J.W., L.W.R., G.G., M.L.O., M.J.S., K.I., K.P., S.L., C.M., L.J.S., M.J.J.R.

Supplementary Material

kfaa030_Supplementary_Data

REFERENCES

  1. Alvarez-Lloret P., Lind P. M., Nyberg I., Örberg J., Rodríguez-Navarro A. B. (2009). Effects of 3,3′,4,4′,5-pentachlorobiphenyl (PCB126) on vertebral bone mineralization and on thyroxin and vitamin D levels in Sprague-Dawley rats. Toxicol. Lett. 187, 63–68. [DOI] [PubMed] [Google Scholar]
  2. Alveblom A. K., Rylander L., Johnell O., Hagmar L. (2003). Incidence of hospitalized osteoporotic fractures in cohorts with high dietary intake of persistent organochlorine compounds. Int. Arch. Occup. Environ. Health 76, 246–248. [DOI] [PubMed] [Google Scholar]
  3. Araujo-Pires A. C., Vieira A. E., Francisconi C. F., Biguetti C. C., Glowacki A., Yoshizawa S., Campanelli A. P., Trombone A. P. F., Sfeir C. S., Little S. R., et al. (2015). IL4/CCL22/CCR4 axis controls regulatory T-cell migration that suppresses inflammatory bone loss in murine experimental periodontitis. J. Bone Miner. Res. 30, 412–422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ashburner M., Ball C. A., Blake J. A., Botstein D., Butler H., Cherry J. M., Davis A. P., Dolinski K., Dwight S. S., Eppig J. T., et al. (2000). Gene Ontology: Tool for the unification of biology. Nat. Genet. 25, 25–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Badger T. M., Ronis M. J. J., Lumpkin C. K., Shahare M., Irby D., Huang J., Valenine C., Mercado C., Thomas P. E., Ingelman-Sundberg M., et al. (1993). Effects of chronic ethanol on growth hormone secretion and hepatic P450 isozymes of the rat. J. Pharmacol. Exp. Ther. 264, 438–447. [PubMed] [Google Scholar]
  6. Bouxsein M. L., Boyd S. K., Christiansen B. A., Guldberg R. E., Jepsen K. J., Müller R. (2010). Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. J. Bone Min. Res.25, 1468–1486. [DOI] [PubMed] [Google Scholar]
  7. Boverhof D. R., Burgoon L. D., Tashiro C., Sharratt B., Chittim B., Harkema J. R., Mendrick D. L., Zacharewski T. R. (2006). Comparative toxicogenomic analysis of the hepatotoxic effects of TCDD in Sprague Dawley rats and C57BL/6 mice. Toxicol. Sci. 94, 398–416. [DOI] [PubMed] [Google Scholar]
  8. Camerino C., Conte E., Cannone M., Caloiero R., Fonzino A., Tricarico D. (2016). Nerve growth factor, brain-derived neurotrophic factor and osteocalcin gene relationship in energy regulation, bone homeostasis and reproductive organs analyzed by mRNA quantitative evaluation and linear correlation analysis. Front. Physiol. 7, 456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen Y., Li L., Wang E., Zhang L., Zhao Q. (2019). Abnormal expression of Pappa2 gene may indirectly affect mouse hip development through the IGF signaling pathway. Endocrine. 65, 440–450. [DOI] [PubMed] [Google Scholar]
  10. Clancy B. M., Johnson J. D., Lambert A. J., Rezvankhah S., Wong A., Resmini C., Feldman J. L., Leppanen S., Pittman D. D. (2003). A gene expression profile for endochondral bone formation: Oligonucleotide microarrays establish novel connections between known genes and BMP-2-induced bone formation in mouse quadriceps. Bone 33, 46–63. [DOI] [PubMed] [Google Scholar]
  11. Downie D. L., Fenge T. (eds). (2003). Inuit Circumpolar Conference. Northern Lights Against POPs: Combating Toxic Threats in the Arctic. Montreal, Canada, McGill-Queen’s University Press, p. 11. [Google Scholar]
  12. Esser C. (2016). The aryl hydrocarbon receptor in immunity: Tools and potential. Methods Mol. Biol. 1371, 239–257. [DOI] [PubMed] [Google Scholar]
  13. Fader K. A., Nault R., Raehtz S., McCabe L. R., Zacharewski T. R. (2018). 2,3,7,8-Tetrachlorodibenzo-p-dioxin dose-dependently increases bone mass and decreases marrow adiposity in juvenile mice. Toxicol. Appl. Pharmacol. 348, 85–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Faroon O., Ruiz P. (2016). Polychlorinated biphenyls: New evidence from the last decade. Toxicol. Ind. Health 32, 1825–1847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Forgacs A. L., Dere E., Angrish M. M., Zacharewski T. R. (2013). Comparative Analysis of Temporal and Dose-Dependent TCDD-Elicited Gene Expression in Human, Mouse, and Rat Primary Hepatocytes. Toxicol. Sci.133, 54–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Frame G. M., Cochran J. W., Bøwadt S. S. (1996). Recent developments in the high-resolution gas chromatography of polychlorinated biphenyls. J. High Res. Chromatogr. 19, 657–668. [DOI] [PubMed] [Google Scholar]
  17. Funakoshi S., Shimizu T., Numata O., Ato M., Melchers F., Ohnishi K. (2015). BILL-cadherin/cadherin-17 contributes to the survival of memory B cells. PLoS One 22, e0117566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gadupudi G. S., Klaren W. D., Olivier A. K., Klingelhutz A. J., Robertson L. W. (2016). PCB126-induced disruption in gluconeogenesis and fatty acid oxidation precedes fatty liver in male rats. Toxicol. Sci. 149, 98–110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Girer N. G., Carter D., Bhattarai N., Mustafa M., Denner L., Porter C., Elferink C. J. (2019). Inducible loss of the aryl hydrocarbon receptor activates perigonadal white fat respiration and brown fat thermogenesis via fibroblast growth factor 21. Int. J. Mol. Sci. 20, 950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Glynn A. W., Glynn A. W., Michaëlsson K., Lind P. M., Wolk A., Aune M., Atuma S., Darnerud P. O., Mallmin H. (2001). Organochlorines and bone mineral density in Swedish men from the general population. Osteoporos. Int. 11, 1036–1042. [DOI] [PubMed] [Google Scholar]
  21. Goltzman D., Mannstadt M., Marcocci C. (2018). Physiology of the calcium-parathyroid hormone-vitamin D axis. Front. Horm. Res. 50, 1–13. [DOI] [PubMed] [Google Scholar]
  22. Hansen L. G. (1999). The Ortho Side of PCBs Occurrence and Disposition. Kluwer Academic Publishers, Boston, MA.
  23. Harrill J. A., Hukkanen R. R., Lawson M., Martin G., Gilger B., Soldatow V., Lecluyse E. L., Budinsky R. A., Rowlands J. C., Thomas R. S. (2013). Knockout of the aryl hydrocarbon receptor results in distinct hepatic and renal phenotypes in rats and mice. Toxicol. Appl. Pharmacol. 272, 503–518. [DOI] [PubMed] [Google Scholar]
  24. Hegde G. V., Peterson K. J., Emanuel K., Mittal A. K., Joshi A. D., Dickinson J. D., Kollessery G. J., Bociek R. G., Bierman P., Vose J. M., et al. (2008). Hedgehog-induced survival of B-cell chronic lymphocytic leukemia cells in a stromal cell microenvironment: A potential new therapeutic target. Mol. Cancer Res. 6, 1928–1936. [DOI] [PubMed] [Google Scholar]
  25. Honda M., Hariya R., Matsumoto M., Aizawa M. (2019). Acceleration of osteogenesis via stimulation of angiogenesis by combination with scaffold and connective tissue growth factor. Materials (Basel) 12, pii: E2066, 2068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Iqbal J., Sun L., Cao J., Yuen T., Lu P., Bab I., Leu N. A., Srinivasan S., Wagage S., Hunter C. A., et al. (2013). Smoke carcinogens cause bone loss through the aryl hydrocarbon receptor and induction of Cyp1 enzymes. Proc. Natl. Acad. Sci. U.S.A. 110, 11115–11120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Iwata H., Watanabe M., Okajima Y., Tanabe S., Amano M., Miyazaki N., Petrov E. A. (2004). Toxicokinetics of PCDD, PCDF, and coplanar PCB congeners in Baikal seals, Pusa sibirica: Age-related accumulation, maternal transfer, and hepatic sequestration. Environ. Sci. Technol. 38, 3505–3513. [DOI] [PubMed] [Google Scholar]
  28. Jämsä T., Viluksela M., Tuomisto J., Tuomisto J., Juha T. (2001). Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin on bone in two rat strains with different aryl hydrocarbon receptor structures. J. Bone Miner. Res. 16, 1812–1820. [DOI] [PubMed] [Google Scholar]
  29. Karsenty G., Kronenberg H. M., Settembre C. (2009). Genetic control of bone formation. Annu. Rev. Cell Dev. Biol. 25, 629–648. [DOI] [PubMed] [Google Scholar]
  30. Kim S. Y., Lee E. H., Park S. Y., Choi H., Koh J. T., Park E. K., Kim I. S., Kim J. E. (2019). Ablation of stabilin-1 enhances bone-resorbing activity in osteoclasts in vitro. Calcif. Tissue Int. 105, 205–214. [DOI] [PubMed] [Google Scholar]
  31. Kobayashi T., Soegiarto D. W., Yang Y., Lanske B., Schipani E., McMahon A. P., Kronenberg H. M. (2005). Indian hedgehog stimulates periarticular chondrocyte differentiation to regulate growth plate length independently of PTHrP. J. Clin. Invest. 5, 1734–1742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kovalova N., Nault R., Crawford R., Zacharewski T. R., Kaminski N. E. (2017). Comparative analysis of TCDD-induced AhR-mediated gene expression in human, mouse and rat primary B cells. Toxicol. Appl. Pharmacol. 316, 95–106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Kung M. H., Yukata K., O'Keefe R. J., Zuscik M. J. (2012). Aryl hydrocarbon receptor-mediated impairment of chondrogenesis and fracture healing by cigarette smoke and benzo(a)pyrene. J. Cell. Physiol. 227, 1062–1070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Larigot L., Juricek L., Dairou J., Coumoul X. (2018). AhR signaling pathways and regulatory functions. Biochim. Open 7, 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lin Y. C., Roffler S. R., Yan Y. T., Yang R. B. (2015). Disruption of Scube2 impairs endochondral bone formation. J. Bone Miner. Res. 30, 1255–1267. [DOI] [PubMed] [Google Scholar]
  36. Lind P. M., Larsson S., Johansson S., Melhus H., Wikström M., Lindhe Ö., Orberg J. (2000a). Bone tissue composition, dimensions and strength in female rats given an increased dietary level of vitamin A or exposed to 3,3′,4,4′,5-pentachlorobiphenyl (PCB126) alone or in combination with vitamin C. Toxicology. 151, 11–23. [DOI] [PubMed] [Google Scholar]
  37. Lind P.M., Larsson S., Oxlund H., Hakansson H., Nyberg K., Eklund T., Orberg J. (2000b). Change of bone tissue composition and impaired bone strength in rats exposed to 3,3′,4,4′,5-pentachlorobiphenyl (PCB126). Toxicology. 150, 41–51. [DOI] [PubMed] [Google Scholar]
  38. Mercer K., Wynne R. A., Lazarenko O. P., Lumpkin C. K., Hogue W. R., Suva L., Chen J.-R., Mason A. Z., Badger T. M., Ronis M. J. J. (2012). Vitamin D supplementation protects against bone loss associated with chronic alcohol administration in the female rat. J. Pharmacol. Exp. Ther. 343, 401–412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Nakao Y., Hikiji H., Okinaga T., Takeuchi J., Habu M., Yoshiga D., Yoshioka I., Nishihara T., Ariyoshi W. (2019). Accumulation of hyaluronic acid in stromal cells modulates osteoclast formation by regulation of receptor activator of nuclear factor kappa-B ligand expression. Biochem. Biophys. Res. Commun. 512, 537–543. [DOI] [PubMed] [Google Scholar]
  40. Oftadeh R., Perez-Viloria M., Villa-Camacho J. C., Vaziri A., Nazarian A. (2015). Biomechanics and mechanobiology of trabecular bone: A review. J. Biomech. Eng. 137, doi:10.1115/1.4029176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Park J. H., Choi A. J., Kim S. J., Cheong S. W., Jeong S. Y. (2016). AhR activation by 6-formylindolo[3,2-b]carbazole and 2,3,7,8-tetrachlorodibenzo-p-dioxin inhibit the development of mouse intestinal epithelial cells. Environ. Toxicol. Pharmacol. 43, 44–53. [DOI] [PubMed] [Google Scholar]
  42. Pavuk M., Olson J. R., Sjödin A., Wolff P., Turner W. E., Shelton C., Dutton N. D., Bartell S., and Anniston Environmental Health Research Consortium. (2014). Serum concentrations of polychlorinated biphenyls (PCBs) in participants of the Anniston Community Health Survey. Sci. Total Environ. 473–474, 286–297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Peacock M. (2010). Calcium metabolism in health and disease. Clin. J. Am. Soc. Nephrol. 5, S23–30. [DOI] [PubMed] [Google Scholar]
  44. Pedersen K. B., Williams A., Watt J., Ronis M. J. (2019). Improved method for isolating high-quality RNA from mouse bone with RNAlater at room temperature. Bone Rep. 31, 100211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Rignall B., Grote K., Gavrilov A., Weimer M., Kopp-Schneider A., Krause E., Appel K. E., Buchmann A., Robertson L. W., Lehmler H. J., et al. (2013). Biological and tumor-promoting effects of dioxin-like and non-dioxin-like polychlorinated biphenyls in mouse liver after single or combined treatment. Toxicol. Sci. 133, 29–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Ronis M. (2018). Alcohol overuse: Cutting to the bone. Res. Outreach 105, 48–52. [Google Scholar]
  47. Ronis M. J., Watt J., Pulliam C. F., Williams A., Alund A., Pedersen K., Gadupudi G. S., Robertson L. W. (2020). Skeletal toxicity resulting from exposure of growing male rats to coplanar PCB126 is associated with disruption of calcium homeostasis and the GH-IGF-1 axis and direct effects on bone formation. Arch. Toxicol. 94, 389–399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Ronis M. J. J., Aronson J., Gao G. G., Hogue W., Skinner R. A., Badger T. M., Lumpkin C. K., Jr. (2001). Skeletal effects of developmental lead exposure in rats. Toxicol. Sci. 62, 321–329. [DOI] [PubMed] [Google Scholar]
  49. Ronis M. J. J., Mercer K., Chen J.-R. (2011). Effects of nutrition and alcohol consumption on bone loss. Curr. Osteoporos. Rep. 9, 53–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rossi F., Tortora C., Punz F., Bellini G., Argenziana M., Di Paola A., Torella M., Perrotta S. (2019). The endocannabinoid/endovanilloid system in bone: From osteoporosis to osteosarcoma. Int. J. Mol. Sci. 20, pii: E1919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Sebastian E. M., Suva L. J., Friedman P. A. (2008). Differential effects of intermittent PTH(1–34) and PTH(7–34) on bone microarchitecture and aortic calcification in experimental renal failure. Bone. 43, 1022–1030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sengle G., Sakai L.Y. (2015). The fibrillin microfibril scaffold: A niche for growth factors and mechanosensation? Matrix Biol. 47, 3–12. [DOI] [PubMed] [Google Scholar]
  53. Shankar K., Kang P., Zhong Y., Borengasser S. J., Wingfield C., Saben J., Gomez-Acevedo H., Thakali K. M. (2015). Transcriptomic and epigenomic landscapes during cell fusion in BeWo trophoblast cells. Placenta. 36, 1342–1351. [DOI] [PubMed] [Google Scholar]
  54. Suva L. J., Hartman E., Dilley J. D., Russell S., Akel N. S., Skinner R. A., Hogue W. R., Budde U., Varughese K. I., Kanaji T., et al. (2008). Platelet dysfunction and a high bone mass phenotype in a murine model of platelet-type von Willebrand disease. Am. J. Pathol. 172, 430–439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Symmank J., Zimmermann S., Goldschmitt J., Schiegnitz E., Wolf M., Wehrbein H., Jacobs C. (2019). Mechanically-induced GDF15 secretion by periodontal ligament fibroblasts regulates osteogenic transcription. Sci. Rep. 9, 11516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Tanabe S. (1988). PCB problems in the future: Foresight from current knowledge. Environ. Pollut. 50, 5–28. [DOI] [PubMed] [Google Scholar]
  57. The Gene Ontology Consortium. (2017). Expansion of the Gene Ontology knowledgebase and resources. Nucleic Acids Res. 45, D331–338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Tsang K. Y., Tsang S. W., Chan D., Cheah K. S. E. (2014). The chondrocytic journey in endosteal bone growth and skeletal dysplasia. Birth Defects Res. C 102, 52–73. [DOI] [PubMed] [Google Scholar]
  59. Watt J., Alund A. W., Pulliam C. F., Mercer K. E., Suva L. J., Chen J.-R., Ronis M. J. J. (2018). NOX4 deletion in male mice exacerbates the effect of ethanol on trabecular bone and osteoblastogenesis. J. Pharmacol. Exp. Ther. 366, 46–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Wejheden C., Brunnberg S., Larsson S., Lind P. M., Andersson G., Hanberg A. (2010). Transgenic mice with a constitutively active aryl hydrocarbon receptor display a gender-specific bone phenotype. Toxicol. Sci. 114, 48–58. [DOI] [PubMed] [Google Scholar]
  61. Wu B. T., Su Y. H., Tsai M. T., Wasserman S. M., Topper J. N., Yang R. B. (2004). A novel secreted, cell-surface glycoprotein containing multiple epidermal growth factor-like repeats and one CUB domain is highly expressed in primary osteoblasts and bones. J. Biol. Chem. 279, 37485–37490. [DOI] [PubMed] [Google Scholar]
  62. Xu Z., Ohtaki H., Watanabe J., Miyamoto K., Murai N., Sasaki S., Matsumoto M., Hashimoto H., Hiraizumi Y., Numazawa S., et al. (2016). Pituitary adenylate cyclase-activating polypeptide (PACAP) contributes to the proliferation of hematopoietic progenitor cells in murine bone marrow via PACAP-specific receptor. Sci. Rep. 6, 22373. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

kfaa030_Supplementary_Data

Articles from Toxicological Sciences are provided here courtesy of Oxford University Press

RESOURCES