Skip to main content
Elsevier - PMC COVID-19 Collection logoLink to Elsevier - PMC COVID-19 Collection
. 2020 May 5;181(5):1004–1015.e15. doi: 10.1016/j.cell.2020.04.031

Structural Basis for Potent Neutralization of Betacoronaviruses by Single-Domain Camelid Antibodies

Daniel Wrapp 1,9, Dorien De Vlieger 2,3,4,9, Kizzmekia S Corbett 5, Gretel M Torres 6, Nianshuang Wang 1, Wander Van Breedam 2,3, Kenny Roose 2,3, Loes van Schie 2,3; VIB-CMB COVID-19 Response Team, Markus Hoffmann 7, Stefan Pöhlmann 7,8, Barney S Graham 5, Nico Callewaert 2,3, Bert Schepens 2,3,4,∗, Xavier Saelens 2,3,4,∗∗, Jason S McLellan 1,10,∗∗∗
PMCID: PMC7199733  PMID: 32375025

Abstract

Coronaviruses make use of a large envelope protein called spike (S) to engage host cell receptors and catalyze membrane fusion. Because of the vital role that these S proteins play, they represent a vulnerable target for the development of therapeutics. Here, we describe the isolation of single-domain antibodies (VHHs) from a llama immunized with prefusion-stabilized coronavirus spikes. These VHHs neutralize MERS-CoV or SARS-CoV-1 S pseudotyped viruses, respectively. Crystal structures of these VHHs bound to their respective viral targets reveal two distinct epitopes, but both VHHs interfere with receptor binding. We also show cross-reactivity between the SARS-CoV-1 S-directed VHH and SARS-CoV-2 S and demonstrate that this cross-reactive VHH neutralizes SARS-CoV-2 S pseudotyped viruses as a bivalent human IgG Fc-fusion. These data provide a molecular basis for the neutralization of pathogenic betacoronaviruses by VHHs and suggest that these molecules may serve as useful therapeutics during coronavirus outbreaks.

Keywords: COVID-19, SARS, MERS, SARS-CoV-2, nanobody

Graphical Abstract

graphic file with name fx1_lrg.jpg

Highlights

  • •

    VHHs isolated from a llama immunized with prefusion-stabilized coronavirus spikes

  • •

    Structural characterization of VHHs reveals conserved mechanism of neutralization

  • •

    SARS-CoV-1 S-directed VHH cross-reacts with SARS-CoV-2 S

  • •

    Bivalent VHH neutralizes SARS-CoV-2 pseudoviruses


Using llamas immunized with prefusion-stabilized betacoronavirus spike proteins, Wrapp et al. identify neutralizing cross-reactive single-domain camelid antibodies, which may serve not only as useful reagents for researchers studying the viruses causing MERS, SARS, and COVID-19, but also potential therapeutic candidates. Crystal structures further reveal how these antibodies bind spike proteins to prevent virus entry into cells.

Introduction

Coronaviruses are enveloped, positive-sense RNA viruses that are divided into four genera (α, β, γ, and δ) and infect a wide variety of host organisms (Woo et al., 2009). There are at least seven coronaviruses that can cause disease in humans, and four of these viruses (HCoV-HKU1, HCoV-OC43, HCoV-NL63, and HCoV-229E) circulate seasonally throughout the global population, causing mild respiratory disease in most patients (Gaunt et al., 2010). The three remaining viruses, SARS-CoV-1, MERS-CoV, and SARS-CoV-2, are zoonotic pathogens that have caused epidemics or pandemics with severe and often fatal symptoms after emerging into the human population (Chan et al., 2020, Huang et al., 2020, Ksiazek et al., 2003, Lu et al., 2020, Zaki et al., 2012). For these highly pathogenic betacoronaviruses, prophylactic and therapeutic interventions are needed.

The surfaces of coronaviruses are decorated with a spike (S) glycoprotein, a large class I fusion protein (Bosch et al., 2003). The S protein forms a trimeric complex that can be functionally categorized into two distinct subunits, S1 and S2, that are separated by a protease cleavage site. The S1 subunit contains the receptor-binding domain (RBD), which interacts with a host-cell receptor protein to trigger membrane fusion. The S2 subunit contains the membrane fusion machinery, including the hydrophobic fusion peptide and the α-helical heptad repeats. The functional host cell receptors for SARS-CoV-1 and MERS-CoV are angiotensin converting enzyme 2 (ACE2) and dipeptidyl peptidase 4 (DPP4), respectively (Li et al., 2003, Raj et al., 2013). The interactions between these receptors and their respective RBDs have been thoroughly characterized, both structurally and biophysically (Li et al., 2005, Wang et al., 2013). Recently, it has been reported that SARS-CoV-2 S also makes use of ACE2 as a functional host-cell receptor, and several structures of this complex have already been reported (Hoffmann et al., 2020, Lan et al., 2020, Wan et al., 2020, Yan et al., 2020, Zhou et al., 2020).

Recent advances in cryoelectron microscopy (cryo-EM) have allowed researchers to determine high-resolution structures of the trimeric S protein ectodomains and understand how S functions as a macromolecular machine (Kirchdoerfer et al., 2016, Li et al., 2005, Walls et al., 2016, Wang et al., 2013). Initial cryo-EM characterization of the SARS-CoV-1 spike revealed that the RBDs adopted at least two distinct conformations. In the “up” conformation, the RBDs jut out away from the rest of S, such that they can easily engage ACE2 without steric clash. In the “down” conformation, the RBDs are tightly packed against the top of the S2 subunit, preventing binding by ACE2 (Gui et al., 2017). Subsequent experiments have corroborated this phenomenon and similar dynamics have been observed in MERS-CoV S, SARS-CoV-2 S, and in alphacoronavirus S proteins (Kirchdoerfer et al., 2018, Pallesen et al., 2017, Walls et al., 2020, Wrapp and McLellan, 2019, Wrapp et al., 2020, Yuan et al., 2017). Because of the relatively low abundance of particles that can be observed by cryo-EM with three RBDs in the up conformation, it is thought that this conformation may correspond to an energetically unstable state (Kirchdoerfer et al., 2018, Pallesen et al., 2017). These observations have led to the hypothesis that the CoV RBDs might act as a molecular ratchet: a receptor-binding event would trap the RBD in the less stable up conformation, leading to gradual destabilization of S1 until S2 is finally triggered to initiate membrane fusion. Recent experiments characterizing RBD-directed anti-SARS-CoV-1 antibodies that trap the SARS-CoV-1 RBD in the up conformation and lead to destabilization of the prefusion S have lent support to this hypothesis (Walls et al., 2019).

Numerous anti-SARS-CoV-1 RBD and anti-MERS-CoV RBD antibodies have been reported, and their mechanisms of neutralization can be attributed to the occlusion of the receptor-binding site and to trapping the RBD in the unstable up conformation, effectively acting as a receptor mimic that triggers a premature transition from the prefusion-to-postfusion conformation (Hwang et al., 2006, Walls et al., 2019, Wang et al., 2018, Wang et al., 2015). In addition to conventional antibodies, camelids also produce heavy-chain-only antibodies (HCAbs), which contain a single variable domain (VHH) instead of two variable domains (VH and VL) that make up the equivalent antigen-binding fragment (Fab) of conventional immunoglobulin G (IgG) antibodies (Hamers-Casterman et al., 1993). This single variable domain, in the absence of an effector domain, is referred to as a single-domain antibody, VHH, or Nanobody and typically can acquire affinities and specificities for antigens comparable to conventional antibodies. VHHs can easily be constructed into multivalent formats and they have higher thermal stability and chemostability than most antibodies (De Vlieger et al., 2018, Dumoulin et al., 2002, Govaert et al., 2012, Laursen et al., 2018, Rotman et al., 2015, van der Linden et al., 1999). VHHs are also known to be less susceptible to steric hindrances that might prevent the binding of larger conventional antibodies (Forsman et al., 2008). Their advantageous biophysical properties have led to the evaluation of several VHHs as therapeutics against common respiratory pathogens, such as respiratory syncytial virus (RSV) (Detalle et al., 2015, Rossey et al., 2017). The use of VHHs as biologics in the context of a respiratory infection is a particularly attractive application, because the highly stable VHHs can be nebulized and administered via an inhaler directly to the site of infection (Respaud et al., 2015). Moreover, because of their stability after prolonged storage, VHHs could be stockpiled as therapeutic treatment options in case of an epidemic. Although therapeutics against MERS-CoV and SARS-CoV-2 are sorely needed, the feasibility of using VHHs for this purpose has not yet been adequately explored. Several MERS-CoV S-directed VHHs have been reported as a result of camelid immunization, but their epitopes remain largely undefined, other than being classified as RBD-directed (Stalin Raj et al., 2018, Zhao et al., 2018).

Here, we report the isolation of two potently neutralizing VHHs directed against the SARS-CoV-1 and MERS-CoV RBDs, respectively. These VHHs were elicited in response to immunization of a llama with prefusion-stabilized SARS-CoV-1 and MERS-CoV S proteins. We solved the crystal structures of these two VHHs in complex with their respective viral epitopes, which suggested likely mechanisms of neutralization were occlusion of the receptor-binding interface and trapping of the RBDs in the up conformation. We also show that the SARS-CoV-1 RBD-directed VHH cross-reacts with the SARS-CoV-2 RBD and can block the receptor-binding interface. After engineering this VHH into a bivalent Fc-fusion, we show that this cross-reactive VHH can also neutralize SARS-CoV-2 S pseudoviruses. We further demonstrate that the VHH-Fc fusion can be produced at high yields in an industry-standard CHO cell system, suggesting that it merits further investigation as a potential therapeutic for the ongoing COVID-19 pandemic.

Results

Isolation of Betacoronavirus S-Directed VHHs

Our initial aim was to isolate VHHs that could potently neutralize MERS-CoV and SARS-CoV-1. Therefore, we sequentially immunized a llama subcutaneously twice with SARS-CoV-1 S protein, twice with MERS-CoV S protein, once again with SARS-CoV-1 S, and finally with both SARS-CoV-1 and MERS-CoV S protein (Figure S1 A). To obtain VHHs directed against these S proteins, two consecutive rounds of panning were performed by phage display using either SARS-CoV-1 S or MERS-CoV S proteins. Positive clones were sequenced, and multiple sequence alignment and phylogenetic analysis using the neighbor-joining method revealed that seven unique MERS-CoV S and five unique SARS-CoV-1 S VHHs were isolated (Figure S1B). These VHHs and an irrelevant control (RSV F-VHH, directed against the F protein of human respiratory syncytial virus) were subsequently expressed in Pichia pastoris and purified from the yeast medium (Rossey et al., 2017). The binding of the purified VHHs to prefusion-stabilized MERS-CoV S and SARS-CoV-1 S was confirmed by ELISA (Figure S1C). As expected, the irrelevant control had no detectable binding to MERS-CoV S and SARS-CoV-1 S. Four clones (MERS VHH-55, -12, -34, and -40), obtained after panning on MERS-CoV S protein, bound with high affinity to prefusion-stabilized MERS-CoV S, whereas the affinities of VHH-2, -20 and -15 were 100- to 1000-fold weaker. Of the five clones isolated after panning on SARS-CoV-1 S protein, three VHH clones (SARS VHH-72, -1, and -6) interacted strongly with prefusion stabilized SARS-CoV-1 S protein. We observed no cross-reactivity of MERS VHHs with SARS-CoV-1 S and vice versa (data not shown).

Figure S1.

Figure S1

CoV VHH Immunization and Panning, Related to Figure 1

(A) Schematic depicting the immunization strategy that was used to isolate both SARS-CoV-1 S and MERS-CoV S-directed VHHs from a single llama. The prefusion stabilized SARS-CoV-1 spike is shown in pink and the prefusion stabilized MERS-CoV spike is shown in tan.

(B) Phylogenetic tree of the isolated MERS-CoV and SARS-CoV S-directed VHHs, based on the neighbor joining method.

(C) Reactivity of MERS-CoV and SARS-CoV S-directed VHHs with the prefusion stabilized MERS-CoV S and SARS-CoV-1 S protein, respectively. A VHH against an irrelevant antigen (F-VHH) was included as a control.

VHHs Neutralize Coronavirus S Pseudotyped Viruses

To assess the antiviral activity of the MERS-CoV and SARS-CoV S-directed VHHs, we performed in vitro neutralization assays using MERS-CoV England1 S and SARS-CoV-1 Urbani S pseudotyped lentiviruses. The high-affinity MERS VHH-55, -12, -34, and -40 neutralized MERS-CoV S pseudotyped virus with IC50 values ranging from 0.014 to 2.9 μg/mL (0.9 nM to 193.3 nM), whereas the lower affinity MERS-CoV- or SARS-CoV-1-specific VHHs had no measurable inhibitory effect (Table S1). SARS VHH-6 and -44 neutralized lentiviruses pseudotyped with SARS-CoV-1 S with IC50 values of 0.14 (9 nM) and 5.5 μg/mL (355 nM), respectively. No binding was observed for SARS VHH-44 to prefusion-stabilized SARS-CoV-1 S protein in the ELISA assay. Sequence analysis revealed that the neutralizing MERS-CoV-specific VHHs -12, -40, and -55 have highly similar complementarity-determining regions (CDRs), indicating that they likely belong to the same clonal family and may bind to the same epitope (Figure S2 ). In contrast, the CDRs from the SARS-CoV S-specific VHHs -44 and -72 are very different.

Figure S2.

Figure S2

Sequence Alignment of Neutralizing SARS-CoV and MERS-CoV S-Directed VHHs, Related to Figure 1

Invariant residues are shown as black dots. The CDRs are shown in boxes and Kabat numbering is shown above.

Mapping Domain Specificity of Betacoronavirus S-Directed VHHs

To map the epitopes targeted by the VHHs, we tested binding to recombinant MERS-CoV S1, RBD, and N-terminal domain (NTD) and SARS-CoV-1 RBD and NTD by ELISA (Figure 1 A; Figure S3 ).The MERS-CoV S-specific VHHs strongly bound to MERS-CoV S1 and RBD in a concentration-dependent manner and failed to bind to the MERS-CoV NTD. Similarly, strong binding of SARS VHH-72 and VHH-6 to the SARS-CoV-1 RBD protein but not the SARS-CoV-1 NTD protein was observed. No binding of SARS VHH-44 to either the SARS-CoV-1 S or NTD protein was detected, leaving the domain that this VHH recognizes undetermined. These data demonstrate that SARS VHH-72, SARS VHH-6, and MERS VHH-55 target the RBDs. We measured the affinities of SARS VHH-72 and MERS VHH-55 by immobilizing recombinantly expressed VHH to a surface plasmon resonance (SPR) sensorchip and determined the binding kinetics for their respective RBDs. We found that both of these VHHs bound to their targets with high affinity. SARS VHH-72 bound to its target with an affinity of 1.2 nM and MERS VHH-55 bound to its target with an affinity of 79.2 pM, in part due to a very slow off-rate constant (k d = 8.2 x10−5 s−1) (Figure 1B).

Figure 1.

Figure 1

Epitope Determination and Biophysical Characterization of MERS VHH-55 and SARS VHH-72

(A) Reactivity of MERS-CoV and SARS-CoV RBD-directed VHHs against the MERS-CoV and SARS-CoV-1 RBD, respectively. A VHH against an irrelevant antigen (F-VHH) was included as a control. Datapoints represent the mean of three replicates and error bars represent the standard errors of the mean.

(B) SPR sensorgrams showing binding between the MERS-CoV RBD and MERS VHH-55 (left) and SARS-CoV-1 RBD and SARS VHH-72 (right). Binding curves are colored black, and fit of the data to a 1:1 binding model is colored red.

Figure S3.

Figure S3

Lack of Binding of MERS-CoV and SARS-CoV-Directed VHHs to Non-RBD Epitopes, Related to Figure 1

ELISA data showing binding of the MERS-CoV specific VHHs to the MERS-CoV S1 protein and absence of binding of the MERS-CoV and SARS-CoV specific VHHs against the MERS-CoV NTD and SARS-CoV-1 NTD, respectively. A VHH against an irrelevant antigen (F-VHH) was included as a control.

Structural Basis of VHH Interaction with RBDs

To investigate the molecular determinants that mediate potent neutralization and high-affinity binding by MERS VHH-55, we solved the crystal structure of MERS VHH-55 bound to the MERS-CoV RBD. Crystals grew in space group C2221 and diffracted X-rays to a resolution of 3.4 Å. After determining a molecular replacement solution and iterative building and refinement, our structure reached an Rwork/Rfree of 24.7%/27.8% (Table S2). The asymmetric unit of this crystal contained eight copies of the MERS VHH-55 + MERS-CoV RBD complex and had a solvent content of ~58%. The electron density allowed unambiguous definition of the interface between the RBD and VHH, with the three CDRs forming extensive binding contacts with the RBD, burying 716 Å2 of surface area by pinching the RBD between the CDR2 and CDR3. The CDR3 of MERS VHH-55 is looped over the DPP4-binding interface, occluding DPP4 from productively engaging the MERS-CoV RBD (Figures 2A and 2B).

Figure 2.

Figure 2

The Crystal Structure of MERS VHH-55 Bound to the MERS-CoV RBD

(A) MERS VHH-55 is shown as blue ribbons and the MERS-CoV RBD is shown as a tan-colored molecular surface. The DPP4 binding interface on the MERS-CoV RBD is colored red.

(B) The structure of DPP4 bound to the MERS-CoV RBD (PDB ID: 4L72) is aligned to the crystal structure of MERS VHH-55 bound to the MERS-CoV RBD. A single monomer of DPP4 is shown as a red, transparent molecular surface.

(C) A zoomed-in view of the panel from (A), with the MERS-CoV RBD now displayed as tan-colored ribbons. Residues that form interactions are shown as sticks, with nitrogen atoms colored dark blue and oxygen atoms colored red. Hydrogen-bonds and salt bridges between MERS VHH-55 and the MERS-CoV RBD are shown as black dots.

(D) The same view from (C) has been turned by approximately 90° to show additional contacts. Residues that form interactions are shown as sticks, with nitrogen atoms colored dark blue and oxygen atoms colored red. Hydrogen bonds and salt bridges between MERS VHH-55 and the MERS-CoV RBD are shown as black dots.

There are numerous contacts between the CDRs of MERS VHH-55 and the MERS-CoV RBD; most are confined to CDRs 2 and 3. A network of interactions from all three CDRs (Figures 2C and 2D) suggests that RBD residue Arg542 has a critical role in MERS VHH-55 binding. This arginine has previously been identified as one of the 12 conserved residues that are crucial for high-affinity DPP4 engagement (Figure S4 A) (Wang et al., 2013, Wang et al., 2014).

Figure S4.

Figure S4

MERS VHH-55 Binds to a Relatively Conserved Epitope on the MERS-CoV RBD, Related to Figure 2

(A) The crystal structure of MERS VHH-55 bound to the MERS-CoV RBD is shown with MERS VHH-55 in white ribbons and the MERS-CoV RBD as a multicolored molecular surface. More variable residues are shown in warm colors and more conserved residues are shown in cool colors according to the spectrum (bottom). Sequence alignments and variability mapping was performed using ConSurf.

(B) The crystal structure of MERS VHH-55 bound to the MERS-CoV RBD is shown as ribbons with MERS VHH-55 colored blue and the MERS-CoV RBD colored tan. Phe506 from the MERS-CoV RBD and Trp99 from MERS VHH-55, which are thought to form hydrophobic interactions with one another are shown as sticks surrounded by a transparent molecular surface.

(C) SPR sensorgram measuring the binding of MERS VHH-55 to the naturally occurring MERS-CoV RBD F506L variant. Binding curves are colored black and the fit of the data to a 1:1 binding model is colored red.

In addition to forming a salt bridge with Glu513 from the MERS-CoV RBD, Trp99 of the MERS VHH-55 CDR3 is positioned near a hydrophobic patch formed by Phe506 (Figure S4B). This residue exhibits natural sequence variation in several MERS-CoV strains, such that a Leu is occasionally observed at this position. To evaluate the extent to which this substitution impacts MERS VHH-55 binding, we generated a F506L substitution and measured binding by SPR (Figure S4C). This substitution resulted in a ~200-fold reduction in MERS VHH-55 binding affinity. Despite this substantial reduction, the affinity of MERS VHH-55 to MERS-CoV RBD F506L remained high, with a K D = 16.5 nM. Other than the variability that is observed at position 506 of the MERS-CoV RBD, the rest of the MERS VHH-55 epitope is highly conserved across the 863 strains that are curated in the MERS-CoV Virus Variation database (Figure S4A). Despite this predicted broad recognition of MERS-CoV strains, the average sequence identity of 24% between the MERS-CoV RBD and the RBDs from the seasonal coronaviruses HCoV-HKU1, HCoV-OC43, HCoV-229E, and HCoV-NL63 makes it unlikely that MERS VHH-55 would cross-react with any of these more distantly related S proteins.

We also sought to discover the molecular determinants of binding between SARS VHH-72 and the SARS-CoV-1 RBD by determining the crystal structure of this complex. Crystals grew in space group P3121 and diffracted X-rays to a resolution of 2.2 Å. We obtained a molecular replacement solution and refined the structure to an Rwork/Rfree of 20.3%/23.6% through iterative building and refinement (Table S2). Our structure reveals that CDRs 2 and 3 contribute to most of the 834 Å2 of buried surface area at the binding interface (Figure 3 A). This epitope does not, however, overlap with the ACE2 footprint on the SARS-CoV-1 RBD. Rather, ACE2 would clash with the CDR-distal framework of SARS VHH-72, as opposed to classical receptor blocking in which the CDRs would occupy the ACE2 binding interface (Figure 3B). ACE2 also carries an N-glycan modification at position Asn322 (Yan et al., 2020). When bound to the RBD, this N-glycan points into the space that is occupied by SARS VHH-72, forming an even larger clash (Figure 3C). SARS VHH-72 binds to the SARS-CoV-1 RBD through a hydrogen-bond network involving CDRs 2 and 3, in which backbone groups participate extensively (Figures 3D and 3E). This network probably accounts for the high-affinity binding that we observed for these two molecules.

Figure 3.

Figure 3

The Crystal Structure of SARS VHH-72 Bound to the SARS-CoV-1 RBD

(A) SARS VHH-72 is shown as dark blue ribbons and the SARS-CoV-1 RBD is shown as a pink-colored molecular surface. The ACE2 binding interface on the SARS-CoV-1 RBD is colored red.

(B) The structure of ACE2 bound to the SARS-CoV-1 RBD (PDB ID: 2AJF) is aligned to the crystal structure of SARS VHH-72 bound to the SARS-CoV-1 RBD. ACE2 is shown as a red, transparent molecular surface.

(C) A simulated N-linked glycan containing an energy-minimized trimannosyl core (derived from PDB ID: 1HD4) is modeled as red sticks, coming from Asn322 in ACE2. ACE2 is shown as a red molecular surface, the SARS-CoV-1 RBD is shown as pink ribbons, and SARS VHH-72 is shown as a dark blue, transparent molecular surface.

(D) A zoomed-in view of the panel from (A) is shown, with the SARS-CoV-1 RBD now displayed as pink-colored ribbons. Residues that form interactions are shown as sticks, with nitrogen atoms colored dark blue and oxygen atoms colored red. Hydrogen bonds and salt bridges between SARS VHH-72 and the SARS-CoV-1 RBD are shown as black dots.

(E) The same view from (D) has been turned by 60° to show additional contacts. Residues that form interactions are shown as sticks, with nitrogen atoms colored dark blue and oxygen atoms colored red. Interactions between SARS VHH-72 and the SARS-CoV-1 RBD are shown as black dots.

SARS VHH-72 Cross-Reacts with WIV1-CoV and SARS-CoV-2

Analysis of 10 available SARS-CoV-1 sequences revealed a high degree of conservation in the residues that make up the SARS VHH-72 epitope, prompting us to explore the breadth of SARS VHH-72 binding (Figure S5 A). WIV1-CoV is a betacoronavirus found in bats that is closely related to SARS-CoV-1 and also utilizes ACE2 as a host-cell receptor (Ge et al., 2013). Because of the relatively high degree of sequence conservation between SARS-CoV-1 and WIV1-CoV, we expressed the WIV1-CoV RBD and measured binding to SARS VHH-72 by SPR (Figure S5B). SARS VHH-72 exhibited high-affinity binding to the WIV1-CoV RBD (7.4 nM), demonstrating that it cross-reacts with these two closely related coronaviruses (Figure S5C).

Figure S5.

Figure S5

SARS VHH-72 Binds to a Broadly Conserved Epitope on the SARS-CoV-1 RBD, Related to Figure 3

(A) The crystal structure of SARS VHH-72 bound to the SARS-CoV-1 RBD is shown, with colors corresponding to those of Figure S4A.

(B) The crystal structure of SARS VHH-72 bound to the SARS-CoV-1 RBD is shown with SARS VHH-72 as dark blue ribbons and the RBD as a pink molecular surface. Amino acids that vary between SARS-CoV-1 and WIV1-CoV are colored teal.

(C) SPR sensorgram measuring the binding of SARS VHH-72 to the WIV1-CoV RBD. Binding curves are colored black and the fit of the data to a 1:1 binding model is colored red.

Based on the high degree of structural homology that has been reported between SARS-CoV-1 S and SARS-CoV-2 S (Walls et al., 2020, Wrapp et al., 2020), we also tested SARS VHH-72 for cross-reactivity against the SARS-CoV-2 RBD and subdomain 1 (SARS-CoV-2 RBD-SD1) by SPR (Figure 4 ). The equilibrium dissociation constant of SARS VHH-72 for the SARS-CoV-2 RBD-SD1 was ~39 nM, substantially higher than for the SARS-CoV-1 RBD. The weaker binding can primarily be attributed to an increase in the dissociation rate constant (Figure 4A). The only variant residue on the SARS-CoV-1 RBD that makes direct contact with SARS VHH-72 is Arg426, which is Asn439 in the SARS-CoV-2 RBD (Figure 3C). This mutation prevents the formation of a salt bridge with Asp61 from SARS VHH-72, which likely contributes to the increased dissociation rate constant. Because of an average sequence identity of only 25% between the SARS-CoV-1 RBD and the RBDs of the seasonal coronaviruses, we predict that SARS VHH-72 cross-reactivity is likely confined to the RBD from SARS-CoV-2 and closely related betacoronaviruses such as WIV1-CoV.

Figure 4.

Figure 4

SARS VHH-72 Cross-Reacts with SARS-CoV-2

(A) An SPR sensorgram measuring the binding of SARS VHH-72 to the SARS-CoV-2 RBD-SD1. Binding curves are colored black, and fit of the data to a 1:1 binding model is colored red.

(B) The crystal structure of SARS VHH-72 bound to the SARS-CoV-1 RBD is shown with SARS VHH-72 as dark blue ribbons and the RBD as a pink molecular surface. Amino acids that vary between SARS-CoV-1 and SARS-CoV-2 are colored green.

VHHs Disrupt RBD Dynamics and Receptor Binding

The RBDs of MERS-CoV S, SARS-CoV-1 S, and SARS-CoV-2 S undergo dynamic conformational rearrangements that alternately mask and present their receptor-binding interfaces and potential neutralizing epitopes to host molecules. By aligning the crystal structures of the MERS VHH-55 and SARS VHH-72 complexes to the cryo-EM structures of the MERS-CoV, SARS-CoV-1, and SARS-CoV-2 S proteins, we can begin to understand how these molecules might function in the context of these dynamic rearrangements. When the MERS-CoV RBDs are all in the down conformation or all in the up conformation, MERS VHH-55 would be able to bind all three of the protomers making up the functional spike trimer without forming any clashes. However, if a down protomer was bound by MERS VHH-55 and the neighboring protomer sampled the up conformation, this RBD would then be trapped in this state by the presence of the neighboring MERS VHH-55 molecule (Figure 5 A). This conformational trapping would be even more pronounced upon SARS VHH-72 binding to the SARS-CoV-1 S protein or the SARS-CoV-2 S protein. Because of the binding angle of SARS VHH-72, when a bound SARS-CoV-1 or SARS-CoV-2 RBD samples the down conformation, it would clash with the S2 fusion subunit, regardless of the conformations of the neighboring RBDs (Figures 5B and 5C). Therefore, once a single SARS VHH-72 binding event took place, the bound protomer would be trapped in the up conformation until either SARS VHH-72 was released or until the S protein was triggered to undergo the prefusion-to-postfusion transition. Based on the binding angles of MERS VHH-55 and SARS VHH-72, we can conclude that these molecules would likely disrupt the RBD dynamics in the context of a trimeric S protein by trapping the up conformation. Because this up conformation is unstable and leads to S protein triggering, it is possible that this conformational trapping may at least partially contribute to the neutralization mechanisms of these VHHs.

Figure 5.

Figure 5

Neutralizing Mechanisms of MERS VHH-55 and SARS VHH-72

(A) The MERS-CoV spike (PDB ID: 5W9H) is shown as a transparent molecular surface, with each monomer colored either white, gray, or tan. Each monomer is bound by MERS VHH-55, shown as blue ribbons. The clash between MERS VHH-55 bound to the white monomer and the neighboring tan RBD is highlighted by the red ellipse.

(B) The SARS-CoV-1 spike (PDB ID: 5X58) is shown as a transparent molecular surface, with each protomer colored either white, gray, or pink. Every monomer is bound by a copy of SARS VHH-72, shown as dark blue ribbons. The clashes between copies of SARS VHH-72 and the two neighboring spike monomers are highlighted by the red circle.

(C) The SARS-CoV-2 spike (PDB ID: 6VXX) is shown as a transparent molecular surface, with each protomer colored either white, gray, or green. Every monomer is bound by a copy of SARS VHH-72, shown as dark blue ribbons. The clashes between copies of SARS VHH-72 and the two neighboring spike monomers are highlighted by the red circle. The SARS-CoV-2 trimer appears smaller than SARS-CoV-1 S because of the absence of flexible NTD-distal loops, which could not be built during cryo-EM analysis.

(D) CoV VHHs prevent MERS-CoV RBD, SARS-CoV-1 RBD, and SARS-CoV-2 RBD-SD1 from interacting with their receptors. The results of the BLI-based receptor-blocking experiment are shown. The legend lists the immobilized RBDs and the VHHs or receptors that correspond to each curve.

To investigate the receptor-blocking ability of the VHHs, we performed a biolayer interferometry (BLI)-based assay in which the SARS-CoV-1, SARS-CoV-2, and MERS-CoV RBDs were immobilized to biosensor tips, dipped into VHHs, and then dipped into wells containing the recombinant, soluble host cell receptors. We found that when tips coated with the MERS-CoV RBD were dipped into MERS VHH55 before being dipped into DPP4, there was no increase in response that could be attributed to receptor binding. When tips coated with the MERS-CoV RBD were dipped into SARS VHH-72 and then DPP4, a robust response signal was observed, as expected. Similar results were observed when the analogous experiments were performed using the SARS-CoV-1 or SARS-CoV-2 RBDs, SARS VHH-72, and ACE2 (Figure 5D). These results are consistent with conclusions from our structural analysis that these VHHs can neutralize their respective viral targets by directly interfering with host cell receptor binding.

Bivalent SARS VHH-72 Neutralizes SARS-CoV-2 S Pseudoviruses

Despite the relatively high affinity determined by SPR of SARS VHH-72 for the SARS-CoV-2 RBD, we could only weakly detect the interaction by ELISA. Moreover, SARS VHH-72 weakly neutralized SARS-CoV-2 S vesicular stomatitis virus (VSV) pseudoviruses, possibly because of the high dissociation rate constant, although it readily neutralized SARS-CoV-1 VSV pseudotyped reporter viruses (Figures 6 A–6D). In an attempt to compensate for this rapid dissociation, we engineered two bivalent variants of SARS VHH-72. These included a tail-to-head fusion of two SARS VHH-72 molecules connected by a (GGGGS)3 linker (VHH-72-VHH-72) and a genetic fusion of SARS VHH-72 to the Fc domain of human IgG1 (VHH-72-Fc) (Figures S6 A–S6C). These bivalent SARS VHH-72 constructs bound to both prefusion SARS-CoV-1 S and SARS-CoV-2 RBD-SD1 as demonstrated by ELISA and by a dose-dependent reduction in the binding of SARS-CoV-2 RBD-SD1 to the ACE2 receptor on Vero E6 cells (Figures 6C–6D; Figures S6B and S6C). We also detected binding of both of these constructs to full-length SARS-CoV-1 S and SARS-CoV-2 S expressed on the surface of mammalian cells (Figures S6D and S6E). Supernatants of HEK293S cells transiently transfected with VHH-72-Fc exhibited neutralizing activity against both SARS-CoV-1 and SARS-CoV-2 S VSV pseudoviruses in the same assay that showed weak cross-reactive neutralization by monovalent SARS VHH-72 (Figures 6E and 6F). A BLI experiment measuring binding of VHH-72-Fc to immobilized SARS-CoV-2 RBD-SD1 further confirmed that bivalency was able to compensate for the high dissociation constant of the monomer (Figure 7 A). Furthermore, the cross-neutralizing VHH-72-Fc construct reached expression levels of ~300 mg/L in ExpiCHO cells (Figure 7B). Using VHH-72-Fc purified from ExpiCHO cells and a SARS-CoV-2 S pseudotyped VSV with a luciferase reporter, we evaluated the neutralization capacity of VHH-72-Fc and found that it neutralized pseudovirus with an IC50 of approximately 0.2 μg/mL (Figure 7C).

Figure 6.

Figure 6

SARS VHH-72 Bivalency Permits SARS-CoV-2 Pseudovirus Neutralization

(A and B) SARS-CoV-1 S (A) and SARS-CoV-2 S (B) VSV pseudoviruses were used to evaluate the neutralization capacity of SARS VHH-72 and SARS VHH-6. MERS VHH-55 and PBS were included as negative controls. Luciferase activity is reported (n = 3 ±SEM) in counts per second (c.p.s.). NI, cells were not infected.

(C and D) Binding of monovalent and bivalent VHHs was tested by ELISA against SARS-CoV-1 S (C) and SARS-CoV-2 RBD-SD1 (D). VHH-72-Fc refers to SARS VHH-72 fused to a human IgG1 Fc domain by a GS(GGGGS)2 linker. VHH-72-Fc (S) is the same Fc fusion with a GS, rather than a GS(GGGGS)2, linker. GBP is an irrelevant GFP-binding protein. VHH-72-VHH-72 refers to the tail-to-head construct with two SARS VHH-72 proteins connected by a (GGGGS)3 linker. VHH-23-VHH-23 refers to the two irrelevant VHHs linked via the same (GGGGS)3 linker.

(E and F) SARS-CoV-1 S (E) and SARS-CoV-2 S (F) pseudoviruses were used to evaluate the neutralization capacity of bivalent VHH-72-Fc. GBP and PBS were included as negative controls. NI, cells were not infected.

Figure S6.

Figure S6

Engineering a Functional Bivalent VHH Construct, Related to Figure 6

(A) Flow cytometry measuring the binding of the bivalent SARS VHH-72 tail-to-head fusion (VHH-72-VHH-72) to SARS-CoV-1 or SARS-CoV-2 S expressed on the cell surface. VHH-23-VHH-23, a bivalent tail-to-head fusion of an irrelevant nanobody, was included as a negative control.

(B) Binding of SARS-CoV-2 RBD-SD1 to Vero E6 cells is prevented by VHH-72-VHH-72 in a dose-dependent fashion. Binding of SARS-CoV-2 RBD-SD1 to Vero E6 cells was detected by flow cytometry in the presence of the indicated bivalent VHHs (n = 2 except VHH-72-VHH-72 and VHH-23-VHH-23 at 5 μg/mL, n = 5).

(C) Binding of SARS-CoV-2 RBD-SD1 to Vero E6 cells is prevented by bivalent VHH-72-Fc fusion proteins in a dose-dependent fashion. Binding of SARS-CoV-2 RBD-SD1-Fc to Vero E6 cells was detected by flow cytometry in the presence of the indicated constructs and amounts (n = 2 except no RBD, n = 4).

(D) Cell surface binding of SARS VHH-72 and SARS VHH-6 to SARS-CoV-1 S. 293S cells were transfected with a GFP expression plasmid together with a SARS-CoV-1 S expression plasmid. Binding of the indicated protein at the indicated concentration is expressed as the median fluorescent intensity (MFI), measured to detect the His-tagged MERS VHH-55 or SARS VHH-6 or SARS VHH-72 or the SARS VHH-72-Fc fusions, of the GFP positive cells divided by the MFI of the GFP negative cells.

(E) Cell surface binding of SARS VHH-72 to SARS-CoV-2. MFI was calculated using the same equation as Figure S6D.

Figure 7.

Figure 7

VHH-72-Fc Neutralizes SARS-CoV-2 S Pseudoviruses

(A) BLI sensorgram measuring apparent binding affinity of VHH-72-Fc to immobilized SARS-CoV-2 RBD-Fc. Binding curves are colored black, buffer-only blanks are colored gray, and the fit of the data to a 1:1 binding curve is colored red.

(B) Time course analysis of VHH-72-Fc expression in ExpiCHO cells. Cell culture supernatants of transiently transfected ExpiCHO cells were removed on days 3–7 after transfection (or until cell viability dropped below 75%), as indicated. Two control mAbs were included for comparison, along with the indicated amounts of purified GBP-Fc as a loading control.

(C) SARS-CoV-2 S pseudotyped VSV neutralization assay. Monolayers of Vero E6 cells were infected with pseudoviruses that had been pre-incubated with the mixtures indicated by the legend. The VHH-72-Fc used in this assay was purified after expression in ExpiCHO cells (n = 4). VHH-23-Fc is an irrelevant control VHH-Fc (n = 3). NI, cells were not infected. Luciferase activity is reported in counts per second (c.p.s.) ± SEM.

Discussion

Here, we report the isolation and characterization of two potently neutralizing single-domain antibodies from a llama immunized with prefusion-stabilized MERS-CoV and SARS-CoV-1 spikes. These VHHs bind to the spike RBDs with high affinity and are capable of neutralizing S pseudotyped viruses in vitro. To our knowledge, the isolation and characterization of SARS-CoV-1 S-directed VHHs have not been described before. Several MERS-CoV S-specific VHHs have been described, all of which have been directed against the RBD. Several of these VHHs have also been reported to block DPP4 binding, much like MERS VHH-55 (Stalin Raj et al., 2018, Zhao et al., 2018). By solving the crystal structures of these newly isolated VHHs in complex with their respective viral targets, we provide detailed insights into epitope binding and their mechanisms of neutralization.

A number of RBD-directed conventional antibodies that are capable of neutralizing SARS-CoV-1 or MERS-CoV have been described. The epitope of MERS VHH-55 overlaps with the epitopes of several of these MERS-CoV RBD-directed antibodies including C2, MCA1, m336, JC57-14, D12, 4C2, and MERS-27 (Chen et al., 2017, Li et al., 2015, Wang et al., 2015, Wang et al., 2018, Ying et al., 2015, Yu et al., 2015) (Figure S7 A). The epitope of SARS VHH-72 does not significantly overlap with the epitopes of any previously described antibodies other than that of the recently described CR3022, which can also bind to the RBDs of both SARS-CoV-1 and SARS-CoV-2 S (Hwang et al., 2006, Pak et al., 2009, Prabakaran et al., 2006, Walls et al., 2019, Yuan et al., 2020) (Figure S7B). However, unlike SARS VHH-72, CR3022 does not prevent the binding of ACE2 and it lacks neutralizing activity against SARS-CoV-2 (Tian et al., 2020, Yuan et al., 2020). This discrepancy in function, despite the partially overlapping epitope, is likely due to the different angles of approach that these two antibodies adopt (Figure S7C). Because SARS VHH-72 binds with a nanomolar K D to a portion of the SARS-CoV-1 S RBD that exhibits low sequence variation, as demonstrated by its cross-reactivity with the WIV1-CoV and SARS-CoV-2 RBDs, it may broadly bind S proteins from other SARS-CoV-like viruses. We show that by engineering a bivalent VHH-72-Fc construct, we can compensate for the relatively high off-rate constant of the monovalent SARS VHH-72. This bivalent molecule expresses well in transiently transfected ExpiCHO cells (~300 mg/L) and can neutralize SARS-CoV-2 S pseudoviruses in vitro. Future panning efforts using existing libraries and SARS-CoV-2 S may yield even more potent neutralizers.

Figure S7.

Figure S7

Comparison of the CoV VHH Epitopes with Known RBD-Directed Antibodies, Related to Figures 2 and 3

(A) The structure of MERS VHH-55 bound to the MERS-CoV RBD is shown with MERS VHH-55 as blue ribbons and the MERS-CoV RBD as a white molecular surface. Epitopes from previously reported crystal structures of the MERS-CoV RBD bound by RBD-directed antibodies are shown as colored patches on the MERS-CoV RBD surface. The LCA60 epitope is shown in yellow, the MERS S4 epitope is shown in green, the overlapping C2/MCA1/m336 epitopes are shown in red and the overlapping JC57-14/D12/4C2/MERS-27 epitopes are shown in purple.

(B) The structure of SARS VHH-72 bound to the SARS-CoV-1 RBD is shown with SARS VHH-72 as dark blue ribbons and the SARS-CoV-1 RBD as a white molecular surface. Epitopes from previously reported crystal structures of the SARS-CoV-1 RBD bound by RBD-directed antibodies are shown as colored patches on the SARS-CoV-1 RBD surface. The 80R epitope is shown in blue, the S230 epitope is shown in yellow, the CR3022 epitope is shown in purple and the overlapping m396/F26G19 epitopes are shown in red.

(C) The SARS-CoV-1 RBD is shown as a white molecular surface, ACE2 is shown as a transparent red molecular surface, SARS VHH-72 is shown as dark blue ribbons and CR3022 Fab is shown as purple ribbons.

Because of the inherent thermostability and chemostability of VHHs, they have been investigated as potential therapeutics against several diseases. HIV- and influenza-directed VHHs have been reported previously, and there are multiple RSV-directed VHHs that have been evaluated (Detalle et al., 2015, Ibañez et al., 2011, Koch et al., 2017, Rossey et al., 2017). The possibility of administering these molecules via a nebulized spray is particularly attractive in the case of respiratory pathogens because the VHHs could theoretically be inhaled directly to the site of infection in an effort to maximize bioavailability and function (Larios Mora et al., 2018). Because of the current lack of treatments for MERS, SARS, and COVID-19 and the devastating effects associated with pandemic coronavirus outbreaks, both prophylactic and therapeutic interventions are sorely needed. It is our hope that because of their favorable biophysical properties and their potent neutralization capacity, MERS VHH-55, SARS VHH-72, and VHH-72-Fc may serve as both useful reagents for researchers and as potential therapeutic candidates.

STAR★Methods

Key Resources Table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Anti-VSV-G antibody (I1, produced from CRL-2700 mouse hybridoma cells) ATCC Cat.# CRL-2700
RRID:CVCL_G654
Anti-foldon antibody Provided by Dr. Vicente Mas
Insituto de Salud Carlos III: National Centre for Microbiology
N/A
Purified anti-HA.11 Epitope Tag Antibody Biolegend Cat# MMS-101P
Mouse IgG HRP Linked Whole Ab GE Healthcare Cat# NXA931
Mouse anti Histidine Tag Bio-Rad Cat# MCA1396
Streptavidin-HRP BD Biosciences Cat#554066
Rabbit anti-camelid VHH HRP GenScript Cat# A01861-200
Alexa fluor 647 donkey anti mouse IgG Invitrogen Cat# A31571
Alexa fluor 633 goat anti human IgG Invitrogen Cat# A21091

Bacterial and Virus Strains

TG1 cells Immunosource Cat# 60502-2
Gerbu LQ#3000 Gerbu Biotechnik Cat# 3000-25
VSV∗ΔG-FLuc PMID: 21998709 N/A
SARS-CoV-1 S pseudotype VSV PMID: 32142651 https://doi.org/10.1016/j.cell.2020.02.052
SARS-CoV-2 S pseudotype VSV PMID: 32142651 https://doi.org/10.1016/j.cell.2020.02.052

Chemicals, Peptides, and Recombinant Proteins

Trimethylamine (TEA) solution Sigma-Aldrich Cat# 471283
Zeocin GIBCO Cat# R25001
MERS-CoV S-2P protein PMID: 28807998 N/A
SARS-CoV-1 S-2P protein PMID: 28807998 N/A
SARS VHH-72 protein This manuscript N/A
MERS VHH-55 protein This manuscript N/A
SARS-CoV-2 S-2P protein PMID: 32075877 N/A
DS-Cav1 protein PMID: 24179220 N/A
MERS-CoV RBD protein PMID: 23835475 N/A
MERS-CoV NTD protein PMID: 28807998 N/A
MERS-CoV S1 protein This manuscript N/A
SARS-CoV-1 RBD protein PMID: 32075877 N/A
SARS-CoV-1 NTD protein This manuscript N/A
WIV1-CoV RBD protein This manuscript N/A
SARS-CoV-2 RBD-SD1 protein PMID: 32075877 N/A
ACE2 protein PMID: 30356097 N/A
DPP4 protein PMID: 28807998 N/A
SARS-CoV-2 RBD Fc protein Sino Biological Cat# 40592-V05H
VHH-23 protein PMID: 31921179 N/A
Bovine serum Albumin Sigma-Aldrich Cat# A8327
Anti-Mouse IgG Fc Capture (AMC) Biosensors FortéBio Cat# 18-5090
Polyethylenimine, Linear, MW 25000, Transfection Grade (PEI 25K) Polysciences Cat# 23966-1
ExpiCHO™ Expression Medium GIBCO A2910001
FreeStyle™ 293 Expression Medium GIBCO Cat# 12338002
EX-CELL® 293 Serum-Free Medium Sigma-Aldrich Cat# 14571C
Kifunensin GlycoSyn Cat# FC-034
25 kDa linear polyethylenimine Polysciences Cat# 3966-2

Critical Commercial Assays

Dual-Luciferase® Reporter Assay System Promega Cat# E1910
TMB Substrate Reagent Set BD PharMingen Cat# 555214
pcDNA™3.3-TOPO® TA Cloning Kit Invitrogen Cat# K8300-01
NEBNext® dA-Tailing Module New England Biolabs Cat# E6053
ExpiFectamine™ CHO Transfection Kit GIBCO Cat# A29129
NucleoBond Xtra Midi kit Macherey-Nagel Cat# MN740410.100
FuGENE® HD Transfection Reagent Promega Cat# E2311

Deposited Data

Crystal structure of SARS-CoV-1 RBD + SARS VHH-72 This manuscript PDB ID: 6WAQ
Crystal structure of MERS-CoV RBD + MERS VHH-55 This manuscript PDB ID: 6WAR
SARS VHH-72 sequence This manuscript GenBank ID: MT350284
MERS VHH-55 sequence This manuscript GenBank ID: MT350283

Experimental Models: Cell Lines

Huh7.5 cells Provided by Dr. Deborah R. Taylor of the US FDA N/A
Freestyle 293F cells ThermoFisher Scientific Cat# R7007
Vero E6 cells ATCC Cat# CRL-1586
HEK293T cells ATCC Cat# CRL-3216
HEK293S cells PMID: 25182477 N/A
ExpiCHO-S ™ cells GIBCO Cat# A29127

Experimental Models: Organisms/Strains

Llama VIB Nanobody Core Chip No. 967000009804581
Pichia pastoris: strain GS115 Invitrogen Cat# C18100

Oligonucleotides

MP057 primer: 5′-TTATGCTTCCGGCTCGTATG-3′ This manuscript N/A
Primers for cloning the VHHs in the pKai61 vector:
5′GGCGGGTATCTCTCGAGAAAAGGCAGGTGCAGCTG
CAGGAGTCTGGG-3′
5′CTAACTAGTCTAGTGATGGTGATGGTGGTGGCTGGA
GACGGTGACCTGG-3′
This manuscript N/A
Primers for generation of bivalent VHH-constructs:
5′GGGGTATCTCTCGAGAAAAGGCAGGTGCAGCTGGTG
GAGTCTGGG-3′
5′AGACTCCTGCAGCTGCACCTGACTACCGCCGCCTCC
AGATCCACCTCCGCCACTACCGCCTCCGCCGCTGGAG
ACGGTGACCTGGG-3′
This manuscript N/A

Recombinant DNA

pCG1-SARS-2-S PMID: 32142651 N/A
pCG1-SARS-S PMID: 24023659 N/A
pKai61 vector PMID: 19671134 N/A
pαH expression plasmid Jason McLellan Laboratory N/A
pαH-SARS-CoV-1 S TM This manuscript N/A
pαH-SARS-CoV-2 S TM This manuscript N/A
pαH-SARS VHH-72 This manuscript N/A
pαH-MER VHH-55 This manuscript N/A
pαH-MERS-CoV RBD PMID: 24179220 N/A
pαH-SARS-CoV-1 RBD PMID: 32075877 N/A
pαH-WIV1-CoV RBD This manuscript N/A
pαH-SARS-CoV-2 RBD-SD1 PMID: 32075877 N/A
pαH-SARS-CoV-1 NTD This manuscript N/A
pαH-MERS-CoV NTD PMID: 28807998 N/A
pαH-MERS-CoV S1 This manuscript N/A
pαH-SARS-CoV-1 S-2P PMID: 28807998 N/A
pαH-MERS-CoV S-2P PMID: 28807998 N/A
pαH-SARS-CoV-2 S-2P PMID: 32075877 N/A
pαH-ACE2 PMID: 30356097 N/A
pαH-DPP4 PMID: 28807998 N/A
pHR′ CMV-Luc Barney Graham Laboratory N/A
CMV/R-MERS-CoV S Barney Graham Laboratory N/A
CMV/R-SARS-CoV-1 S Barney Graham Laboratory N/A

Software and Algorithms

Flowing Software http://flowingsoftware.btk.fi/ V2.5.1
Octet Data Analysis software FortéBio v11.1
GraphPad Prism Motulsky and Brown, 2006 V7.0.4
Biacore X100 Evaluation Software GE Healthcare V2.0.1
iMOSFLM Battye et al., 2011 https://www.mrc-lmb.cam.ac.uk/harry/imosflm/ver721/downloads.html
Aimless Evans and Murshudov, 2013 www.ccp4.ac.uk/download/
Phaser McCoy, 2007 www.ccp4.ac.uk/download/
COOT Emsley and Cowtan, 2004 http://bernhardcl.github.io/coot/
Phenix Adams et al., 2002, Afonine et al., 2018 https://www.phenix-online.org/
ISOLDE Croll, 2018 http://preview.cgl.ucsf.edu/chimerax/download.html
ChimeraX Goddard et al., 2018 https://www.rbvi.ucsf.edu/chimerax/

Other

Strep-Tactin Superflow resin IBA Lifesciences Cat# 2-1206-010
Pierce™ Protein A Agarose ThermoFisher Scientific Cat# 20334
Biacore X100 Sensorchip NTA GE Healthcare Cat# BR100407
HiLoad 16/600 Superdex75 GE Healthcare Cat# 28989333
Superose6 XK 16/70 GE Healthcare Cat# 90100042

Resource Availability

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Jason S. McLellan (jmclellan@austin.utexas.edu).

Materials Availability

Plasmids generated in this study will be made available on request by the Lead Contact with a completed Materials Transfer Agreement (MTA).

Data and Code Availability

The X-ray crystallographic data and atomic models have been deposited at the Protein Data Bank with accession codes PDB: 6WAQ (SARS-CoV-1 RBD bound by SARS VHH-72) and PDB: 6WAR (MERS-CoV RBD bound by MERS VHH-55). The sequences of MERS VHH-55 and SARS VHH-72 have been deposited in GenBank under accession numbers MT350283 and MT350284. A list of software used in this study can be found in the Key Resources Table.

Experimental Model and Subject Details

Cell Lines

FreeStyle293F cells (ThermoFisher Scientific) and HEK293-S cells (ThermoFisher Scientific) were cultured in FreeStyle293 expression media (Life Technologies), cultured at 37°C with 8% CO2 while shaking at 130 rpm. HEK293-T cells (ATCC) and Vero E6 cells (ATCC) were cultured at 37°C in the presence of 5% CO2 in DMEM supplemented with 10% heat-inactivated FBS, 1% penicillin, 1% streptomycin, 2 mM l-glutamine, non-essential amino acids (Invitrogen) and 1 mM sodium pyruvate. Huh7.5 cells (provided by Dr. Deborah R. Taylor) were cultured at 37°C with 8% CO2 in flasks with DMEM + 10% FBS. ExpiCHO-S cells (GIBCO) were cultured at 37°C with 8% CO2 while shaking at 130 rpm in ExpiCHO expression media (GIBCO). Cells lines were not tested for mycoplasma contamination nor authenticated.

Method Details

Llama immunization

Llama immunizations and subsequent VHH library generation were performed by VIB Nanobody Core as follows. A llama, negative for antibodies against MERS-CoV and SARS-CoV-1 S glycoprotein, was subcutaneously immunized with approximately 150 μg recombinant SARS-CoV-1 S-2P protein on days 0, 7, 28 and 150 μg recombinant MERS-CoV S-2P protein on days 14 and 21 and 150 μg of both MERS-CoV S-2P and SARS-CoV-1 S-2P protein on day 35 (Kirchdoerfer et al., 2018, Pallesen et al., 2017). The adjuvant used was Gerbu LQ#3000. Immunizations and handling of the llama were performed according to directive 2010/63/EU of the European parliament for the protection of animals used for scientific purposes and approved by the Ethical Committee for Animal Experiments of the Vrije Universiteit Brussel (permit No. 13-601-1). Blood was collected 5 days after the last immunization for the preparation of lymphocytes. Total RNA from the peripheral blood lymphocytes was extracted and used as template for the first strand cDNA synthesis with oligo dT primer. Using this cDNA, the VHH encoding sequences were amplified by PCR and cloned between the PstI and NotI sites of the phagemid vector pMECS. In the pMECS vector, the VHH encoding sequence is followed by a linker, HA and His6 tag (AAAYPYDVPDYGSHHHHHH). Electro-competent E.coli TG1 cells were transformed with the recombinant pMECS vector resulting in a VHH library of about 3 × 108 independent transformants. The resulting TG1 library stock was then infected with VCS M13 helper phages to obtain a library of VHH-presenting phages.

Isolation of MERS- and SARS-CoV VHH phages

Phages displaying MERS-CoV-specific VHHs were enriched after 2 rounds of biopanning on 20 μg of immobilized MERS-CoV S-2P protein in one well of a microtiter plate (type II, F96 Maxisorp, Nuc). For each panning round an uncoated well was used as a negative control. The wells were then washed 5 times with phosphate-buffered saline (PBS) + 0.05% Tween 20 and blocked with SEA BLOCK blocking buffer (Thermo Scientific) in the first panning round and 5% milk powder in PBS in the second panning round. About 1011 phages were added to the coated well and incubated for 1 h at room temperature. Non-specifically bound phages were removed by washing with PBS + 0.05% Tween 20 (10 times in the first panning round and 15 times in the second panning round). The retained phages were eluted with TEA-solution (14% trimethylamine (Sigma) pH 10) and subsequently neutralized with 1 M Tris-HCl pH 8. The collected phages were amplified in exponentially growing E.coli TG1 cells, infected with VCS M13 helper phages and subsequently purified using PEG 8,000/NaCl precipitation for the next round of selection. Enrichment after each panning round was determined by infecting TG1 cells with 10-fold serial dilutions of the collected phages after which the bacteria were plated on LB agar plates with 100 μg/mL− ampicillin and 1% glucose.

Phages displaying SARS-CoV-1 directed VHHs were enriched after 2 rounds of biopanning on 20 μg of SARS-CoV-1 S-2P protein captured with an anti-foldon antibody (generously provided by Dr. Vicente Mas) in one well of a microtiter plate (type II, F96 Maxisorp, Nuc). Before panning phages were first added to DS-Cav1 protein (McLellan et al., 2013) containing a C-terminal foldon domain, to deplete foldon specific phages. The unbound phages were next added to the coated well. Panning was performed as described above.

Periplasmic ELISA to select MERS- and SARS-CoV VHHs

After panning, 45 individual colonies of phage infected bacteria isolated after the first panning round on MERS-CoV S-2P or SARS-CoV-1 S-2P protein and 45 individual colonies isolated after the second panning round on MERS-CoV S-2P or SARS-CoV-1 S-2P protein were randomly selected for further analysis by ELISA for the presence of MERS-CoV and SARS-CoV-1 specific VHHs, respectively. The individual colonies were inoculated in 2 mL of terrific broth (TB) medium with 100 μg/mL ampicillin in 24-well deep well plates. After growing individual colonies for 5 h at 37°C, isopropyl β-D-1-thiogalactopyranoside (IPTG) (1 mM) was added to induce VHH expression during overnight incubation at 37°C. To prepare periplasmic extract, the bacterial cells were pelleted and resuspended in 250 μL TES buffer (0.2 M Tris-HCl pH 8, 0.5 mM EDTA, 0.5 M sucrose) and incubated at 4 °C for 30 min. Subsequently 350 μL water was added to induce an osmotic shock. After 1 h incubation at 4 °C followed by centrifugation, the periplasmic extract was collected.

VHH-containing periplasmic extracts were then tested for binding to either MERS-CoV S-2P or SARS-CoV-1 S-2P protein. Briefly, in the PE-ELISA screen after panning on MERS-CoV S-2P protein, wells of microtiter plates (type II, F96 Maxisorp, Nuc) were coated overnight at 37°C with 100 ng MERS-CoV S-2P (without foldon), MERS-CoV S-2P protein (with foldon) or as negative controls coated with SARS-CoV-1 S-2P protein (with foldon), HCoV-HKU1 S-2P (without foldon), DS-Cav1 (with foldon) or bovine serum albumin (BSA, Sigma-Aldrich). In the PE-ELISA screen after panning on SARS-CoV-1 S protein wells of microtiter plates (type II, F96 Maxisorp, Nuc) were coated with 100 ng SARS-CoV-1 S-2P protein (with foldon), SARS-CoV-1 S-2P protein captured with an anti-foldon antibody (with foldon) or as negative controls coated with MERS-CoV S-2P (without foldon), HCoV-HKU1 S-2P (without foldon), DS-Cav1 (with foldon) or bovine serum albumin (BSA, Sigma-Aldrich). The coated plates were blocked with 5% milk powder in PBS and 50 μL of the periplasmic extract was added to the wells. Bound VHHs were detected with anti-HA (1/2,000, MMS-101P Biolegend) mAb followed by horseradish peroxidase (HRP)-linked anti-mouse IgG (1/2,000, NXA931, GE Healthcare). Periplasmic fractions, for which the OD450 value of the antigen coated wells were at least two times higher than the OD450 value of the BSA coated wells, were considered to be specific for the coated antigen and selected for sequencing. The selected clones were grown in 3 mL of LB medium with 100 μg/mL ampicillin. The DNA of the selected colonies was isolated using the QIAprep Spin Miniprep kit (QIAGEN) and sequenced using the MP057 primer (5′-TTATGCTTCCGGCTCGTATG-3′).

VHH cloning into a Pichia pastoris expression vector

In order to express the MERS- and SARS-CoV VHHs in Pichia pastoris, the VHH encoding sequences were cloned in the pKai61 expression vector (described by Schoonooghe et al., 2009). In the vector, the VHH sequences contain a C-terminal 6x His-tag, are under the control of the methanol inducible AOX1 promotor and in frame with a modified version of the S.cerevisae α-mating factor prepro signal sequence. The vector contains a Zeocine resistance marker for selection in bacteria as well as in yeast cells. The VHH encoding sequences were amplified by PCR using the following forward and reverse primer (5′-GGCGGGTATCTCTCGAGAAAAGGCAGGTGCAGCTGCAGGAGTCTGGG-3′) and (5′- CTAACTAGTCTAGTGATGGTGATGGTGGTGGCTGGAGACGGTGACCTGG-3′) and cloned between the XhoI and SpeI sites in the pKai61 vector. The vectors were linearized by PmeI and transformed in the Pichia pastoris strain GS115 by electroporation at 1500 V using a Gene Pulser electroporator (Bio-Rad) (Lin-Cereghino et al., 2005). After transformation, the yeast cells were plated on YPD plates (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose and 2% (w/v) agar) supplemented with zeocin (100 μg/mL) for selection.

Generating bivalent VHHs for P. pastoris expression

To generate bivalent tandem tail-to-head VHH constructs, the VHH sequence was amplified by PCR using the following forward (5′- GGGGTATCTCTCGAGAAAAGGCAGGTGCAGCTGGTGGAGTCTGGG-3′) and reverse (5′- AGACTCCTGCAGCTGCACCTGACTACCGCCGCCTCCAGATCCACCTCCGCCACTACCGCCTCCGCCGCTGGAGACGGTGACCTGGG-3′) primers, thereby removing a PstI site from the beginning of the VHH coding sequence and adding a (GGGGS)3 linker and the start of the VHH coding sequence with a PstI site at the end of the sequence. After PCR, the fragment was cloned between the XhoI and SpeI sites in a SARS VHH-72 containing pKai61 vector, thereby generating a homo-bivalent construct. The vector containing this bivalent VHH was linearized and transformed in GS155 Pichia pastoris cells as outlined above.

Purification of MERS- and SARS-CoV VHHs from Pichia

The transformed Pichia pastoris clones were first expressed in 2 mL cultures. On day 1, 4 clones of each construct were inoculated in 2 mL of YPNG medium (2% pepton, 1% Bacto yeast extract, 1.34% YNB, 0.1 M potassium phosphate pH 6, 0.00004% biotin, 1% glycerol) with 100 μg/mL Zeocin (Life Technologies) and incubated while shaking at 28 °C for 24 h. The next day, the cells were pelleted by centrifugation and the medium was replaced by YPNM medium (2% pepton, 1% Bacto yeast extract, 1.34% YNB, 0.1 M potassium phosphate pH 6.0, 1% methanol) to induce VHH expression. Cultures were incubated at 28°C and 50 μL of 50% methanol was added at 16, 24 and 40 h. After 48 h, the yeast cells were pelleted and the supernatant was collected. The presence of soluble VHHs in the supernatants was verified using SDS-PAGE and subsequent Coomassie Blue staining. VHH-containing supernatants of the different clones for each construct were pooled and the VHHs were purified using HisPur™ Ni-NTA Spin Plates (88230, Thermo Scientific). Next, purified VHHs were concentrated on AcroPrep™ Advance 96-well filter plates for ultrafiltration 3 kDa cutoff (8033,Pall) and the imidazole-containing elution buffer was exchanged with PBS.

Production was scaled up (50 mL) for the VHHs with neutralizing capacity. Growth and methanol induction conditions and harvesting of medium were similar as mentioned above for the 2 mL cultures. The secreted VHHs in the medium were precipitated by ammonium sulfate (NH4)2SO4 precipitation (80% saturation) for 4 h at 4°C. The insoluble fraction was pelleted by centrifugation at 20,000 g and resuspended in 10 mL binding buffer (20 mM NaH2PO4 pH 7.5, 0.5M NaCl and 20 mM imidazole pH 7.4). The VHHs were purified from the solution using a 1 mL HisTrap HP column (GE Healthcare). To elute the bound VHHs a linear imidazole gradient starting from 20 mM and ending at 500 mM imidazole in binding buffer over a total volume of 20 mL was used. VHH containing fractions were pooled and concentrated and the elution buffer was exchanged with PBS with a Vivaspin column (5 kDa cutoff, GE Healthcare).

Enzyme-linked immunosorbent assay

Wells of microtiter plates (type II, F96 Maxisorp, Nuc) were coated overnight at 4°C, respectively, with 100 ng recombinant MERS-CoV S-2P protein (with foldon), SARS-CoV-1 S-2P protein (with foldon), MERS-CoV RBD, MERS-CoV NTD, MERS-CoV S1, SARS-CoV-1 RBD, SARS-CoV-1 NTD or Fc-tagged SARS-CoV-2 RBD-SD1. The coated plates were blocked with 5% milk powder in PBS. Dilution series of the VHHs were added to the wells. Binding was detected by incubating the plates sequentially with either mouse anti-Histidine Tag antibody (MCA1396, Abd Serotec) followed by horseradish peroxidase (HRP)-linked anti-mouse IgG (1/2000, NXA931, GE Healthcare) or Streptavidin-HRP (554066, BD Biosciences) or by an HRP-linked rabbit anti-camelid VHH monoclonal antibody (A01861-200, GenScript). After washing 50 μL of TMB substrate (Tetramethylbenzidine, BD OptETA) was added to the plates and the reaction was stopped by addition of 50 μL of 1 M H2SO4. The absorbance at 450 nM was measured with an iMark Microplate Absorbance Reader (Bio Rad). Curve fitting was performed using nonlinear regression (Graphpad 7.0).

CoV pseudovirus neutralization

Pseudovirus neutralization assay methods have been previously described (Pallesen et al., 2017, Wang et al., 2015). Briefly, pseudoviruses expressing spike genes for MERS-CoV England1 (GenBank ID: AFY13307) and SARS-CoV-1 Urbani (GenBank ID: AAP13441.1) were produced by co-transfection of plasmids encoding a luciferase reporter, lentivirus backbone, and spike genes in 293T cells (Wang et al., 2015). Serial dilutions of VHHs were mixed with pseudoviruses, incubated for 30 min at room temperature, and then added to previously-plated Huh7.5 cells. 72 h later, cells were lysed, and relative luciferase activity was measured. Percent neutralization was calculated considering uninfected cells as 100% neutralization and cells transduced with only pseudovirus as 0% neutralization. IC50 titers were determined based on sigmoidal nonlinear regression.

To generate replication-deficient VSV pseudotyped viruses, HEK293T cells, transfected with MERS-CoV S, SARS-CoV-1 S or SARS-CoV-2 S were inoculated with a replication deficient VSV vector containing eGFP and firefly luciferase expression cassettes. After a 1 h incubation at 37°C, inoculum was removed, cells were washed with PBS and incubated in media supplemented with an anti-VSV G mAb (ATCC) for 16 h. Pseudotyped particles were then harvested and clarified by centrifugation (Berger Rentsch and Zimmer, 2011, Hoffmann et al., 2020). For the VSV pseudotype neutralization experiments, the pseudoviruses were incubated for 30 min at 37°C with different dilutions of purified VHHs or with dilution series of culture supernatant of 293S cells that had been transfected with plasmids coding for SARS VHH-72 fused to human IgG1 Fc (VHH-72-Fc) or with GFP-binding protein (GBP: a VHH specific for GFP). The incubated pseudoviruses were subsequently added to confluent monolayers of Vero E6 cells. Sixteen h later, the transduction efficiency was quantified by measuring the firefly luciferase activity in cell lysates using the firefly luciferase substrate of the dual-luciferase reporter assay system (Promega) and a Glowmax plate luminometer (Promega).

Mammalian protein expression and purification

Mammalian expression plasmids encoding SARS VHH72, MERS VHH55, residues 367-589 of MERS-CoV S (England1 strain), residues 320-502 of SARS-CoV-1 S (Tor2 strain), residues 307-510 of WIV1-CoV S, residues 319-591 of SARS-CoV-2 S, residues 1-281 of SARS-CoV-1 S (Tor2 strain), residues 1-351 of MERS-CoV S (England1 strain), residues 1-751 of MERS-CoV S (England1 strain), residues 1-1190 of SARS-CoV-1 S (Tor2 strain) with K968P and V969P substitutions (SARS-CoV-1 S-2P), residues 1-1291 of MERS-CoV S (England1 strain) with V1060P and L1061P substitutions (MERS S-2P), residues 1-1208 of SARS-CoV-2 S with K986P and V987P substitutions (SARS-CoV-2 S-2P), residues 1-615 of ACE2 and residues 40-766 of DPP4 were transfected into FreeStyle293 cells using polyethylenimine (PEI). All of these plasmids contained N-terminal signal sequences to ensure secretion into the cell supernatant. Supernatants were harvested and constructs containing C-terminal HRV3C cleavage sites, 8x His-Tags and Twin-Strep-Tags (SARS VHH72, MERS VHH55, MERS-CoV S1, SARS-CoV-1 S-2P, MERS-CoV S-2P, SARS-CoV-2 S-2P, ACE2 and DPP4) were purified using Strep-Tactin resin (IBA). Constructs containing C-terminal HRV3C cleavage sites and Fc-tags (SARS-CoV-1 RBD, MERS-CoV RBD, WIV1-CoV RBD, SARS-CoV-2 RBD-SD1, SARS-CoV-1 NTD, MERS-CoV NTD) were purified using Protein A resin (Pierce). The SARS-CoV-1 RBD, MERS-CoV RBD, WIV1-CoV RBD, SARS-CoV-2 RBD-SD1, SARS VHH-72, MERS VHH-55, MERS-CoV NTD and SARS-CoV-1 NTD were then further purified using a Superdex 75 column (GE Healthcare) in 2 mM Tris pH 8.0, 200 mM NaCl and 0.02% NaN3. MERS-CoV S1, SARS-CoV-1 S-2P, MERS-CoV S-2P, ACE2 and DPP4 were further purified using a Superose 6 column (GE Healthcare) in 2 mM Tris pH 8.0, 200 mM NaCl and 0.02% NaN3.

HEK293S cells were transfected with VHH-72-Fc or VHH-72-Fc (S) encoding plasmids using PEI. Briefly, suspension-adapted and serum-free HEK293S cells were seeded at 3 × 106 cells/mL in Freestyle-293 medium (ThermoFisher Scientific). Next, 4.5 μg of pcDNA3.3-VHH72-Fc plasmid DNA was added to the cells and incubated on a shaking platform at 37°C and 8% CO2, for 5 min. Next, 9 μg of PEI was added to the cultures, and cells were further incubated for 5 h, after which an equal culture volume of Ex-Cell-293 (Sigma) was added to the cells. Transfections were incubated for 4 days, after which cells were pelleted (10’, 300 g) and supernatants were filtered before further use.

VHH-72-Fc was expressed in ExpiCHO cells (ThermoFisher Scientific), according to the manufacturer’s protocol. Briefly, a 25 mL culture of 6 x106 cells/mL, grown at 37°C and 8% CO2 was transfected with 20 μg of pcDNA3.3-VHH-72-Fc plasmid DNA using ExpiFectamine CHO reagent. One day after transfection, 150 μL of ExpiCHO enhancer and 4 mL of ExpiCHO feed was added to the cells, and cultures were further incubated at 32°C and 5% CO2. Cells were fed a second time 5 days post-transfection. Cultures were harvested as soon as cell viability dropped below 75%. For purification of the VHH-72-Fc, supernatants were loaded on a 5 mL MabSelect SuRe column (GE Healthcare). Unbound proteins were washed away with McIlvaine buffer pH 7.2, and bound proteins were eluted using McIlvaine buffer pH 3. Immediately after elution, protein-containing fractions were neutralized using a saturated Na3PO4 buffer. These neutralized fractions were then pooled, and loaded onto a HiPrep Desalting column for buffer exchange into storage buffer (25 mM L-Histidine, 125 mM NaCl).

Surface plasmon resonance

His-tagged SARS VHH-72 or MERS VHH-55 was immobilized to a single flow cell of an NTA sensorchip at a level of ~400 response units (RUs) per cycle using a Biacore X100 (GE Healthcare). The chip was doubly regenerated using 0.35 M EDTA and 0.1 M NaOH followed by 0.5 mM NiCl2. Three samples containing only running buffer, composed of 10 mM HEPES pH 8.0, 150 mM NaCl and 0.005% Tween 20, were injected over both ligand and reference flow cells, followed by either SARS-CoV-1 RBD, WIV1-CoV RBD, SARS-CoV-2 RBD-SD1 or MERS-CoV RBD serially diluted from 50-1.56 nM, with a replicate of the 3.1 nM concentration. The resulting data were double-reference subtracted and fit to a 1:1 binding model using the Biacore X100 Evaluation software.

Crystallization and data collection

Plasmids encoding for MERS VHH-55 and residues 367-589 of MERS-CoV S with a C-terminal HRV3C cleavage site and a monomeric human Fc tag were co-transfected into kifunensin-treated FreeStyle 293F cells, as described above. After purifying the cell supernatant with Protein A resin, the immobilized complex was treated with HRV3C protease and Endoglycosidase H to remove both tags and glycans. The complex was then purified using a Superdex 75 column in 2 mM Tris pH 8.0, 200 mM NaCl and 0.02% NaN3. The purified complex was then concentrated to 5.0 mg/mL and used to prepare hanging-drop crystallization trays. Crystals grown in 1.0 M Na/K phosphate pH 7.5 were soaked in mother liquor supplemented with 20% ethylene glycol and frozen in liquid nitrogen. Diffraction data were collected to a resolution of 3.40 Å at the SBC beamline 19-ID (APS, Argonne National Laboratory)

Plasmids encoding for SARS VHH-72 and residues 320-502 of SARS-CoV-1 S with a C-terminal HRV3C cleavage site and a monomeric human Fc tag were co-transfected into kifunensin-treated FreeStyle 293F cells, as described above. After purifying the cell supernatant with Protein A resin, the immobilized complex was treated with HRV3C protease and Endoglycosidase H to remove both tags and glycans. The processed complex was subjected to size-exclusion chromatography using a Superdex 75 column in 2 mM Tris pH 8.0, 200 mM NaCl and 0.02% NaN3. The purified complex was then concentrated to 10.0 mg/mL and used to prepare hanging-drop crystallization trays. Crystals grown in 0.1 M Tris pH 8.5, 0.2 M LiSO4, 0.1 M LiCl and 8% PEG 8000 were soaked in mother liquor supplemented with 20% glycerol and frozen in liquid nitrogen. Diffraction data were collected to a resolution of 2.20 Å at the SBC beamline 19-ID (APS, Argonne National Laboratory)

Structure determination

Diffraction data for both complexes were indexed and integrated using iMOSFLM before being scaled in AIMLESS (Battye et al., 2011, Evans and Murshudov, 2013). The SARS-CoV-1 RBD+SARS VHH-72 dataset was phased by molecular replacement in PhaserMR using coordinates from PDBs 2AJF and 5F1O as search ensembles (McCoy, 2007). The MERS-CoV RBD+MERS VHH-55 dataset was also phased by molecular replacement in PhaserMR using coordinates from PDBs 4L72 and 5F1O as search ensembles. The resulting molecular replacement solutions were iteratively rebuilt and refined using Coot, ISOLDE and Phenix (Adams et al., 2002, Croll, 2018, Emsley and Cowtan, 2004). The MERS-CoV+MERS VHH-55 structure was refined using NCS. Crystallographic software packages were curated by SBGrid (Morin et al., 2013).

Biolayer interferometry

Anti-human capture (AHC) tips (FortéBio) were soaked in running buffer composed of 10 mM HEPES pH 7.5, 150 mM NaCl, 3 mM EDTA, 0.005% Tween 20 and 1 mg/mL BSA for 20 min before being used to capture either Fc-tagged SARS-CoV-1 RBD, Fc-tagged SARS-CoV-2 RBD-SD1 or Fc-tagged MERS-CoV RBD to a level of 0.8 nm in an Octet RED96 (FortéBio). Tips were then dipped into either 100 nM MERS VHH-55 or 100 nM SARS VHH-72. Tips were next dipped into wells containing either 1 μM ACE2 or 100 nM DPP4 supplemented with the nanobody that the tip had already been dipped into to ensure continued saturation. Data were reference-subtracted and aligned to each other in Octet Data Analysis software v11.1 (FortéBio) based on a baseline measurement that was taken before being dipped into the final set of wells that contained either ACE2 or DPP4.

BLI measurements were also performed with VHH-72-Fc fusion produced in HEK293S cells. SARS-CoV-2 RBD with a mouse IgG1 Fc tag (Sino Biological) was immobilized to an anti-mouse IgG Fc capture (AMC) tip (FortéBio) to a response level of 0.5 nm. Supernatant of non-transfected and VHH-72-Fc transfected HEK293-S cells was applied in a three-fold dilution series in kinetics buffer. Binding was measured at 30°C, with baseline and dissociation measured in equal dilution of non-transformed HEK293S supernatant in kinetics buffer. Between analyses, biosensors were regenerated by three times 20 s exposure to regeneration buffer (10 mM glycine pH 1.7).

Flow cytometry

Binding of VHH-72-Fc, VHH-72-Fc (S) and monomeric and bivalent SARS VHH-72 to SARS-CoV-1 and SARS-CoV-2 S was analyzed by flow cytometry using cells transfected with a GFP expression plasmid combined with an expression plasmid for either SARS-CoV-1 or SARS-Cov-2 S. HEK293S culture media (1/20 diluted in PBS + 0.5%BSA) of VHH-72-Fc and VHH-72-Fc (S) transformants were incubated with transfected cells. Binding of the VHH-72-Fc and VHH-72-Fc (S) to cells was detected with an AF633 conjugated goat anti-human IgG antibody, whereas binding of monomeric and bivalent VHHs to SARS-CoV-1 or SARS-CoV-2 S was detected with a mouse anti-HisTag antibody and an AF647 conjugated donkey anti-mouse IgG antibody. Binding was calculated as the mean AF633 fluorescence intensity (MFI) of GFP expressing cells (GFP+) divided by the MFI of GFP negative cells (GFP-).

RBD competition assay on Vero E6 cells

SARS-CoV-2 RBD fused to murine IgG Fc (Sino Biological) at a final concentration of 0.4 μg/mL was incubated with a dilution series of tail-to-head bivalent VHHs or VHH-Fc fusions and incubated at room temperature for 20 min before an additional 10 min incubation on ice. Vero E6 cells grown at sub-confluency were detached by cell dissociation buffer (Sigma) and trypsin treatment. After washing once with PBS the cells were blocked with 1% BSA in PBS on ice. All remaining steps were also performed on ice. The mixtures containing RBD and tail-to-head bivalent VHHs or VHH-Fc fusions were added to the cells and incubated for one h. Subsequently, the cells were washed 3 times with PBS containing 0.5% BSA and stained with an AF647 conjugated donkey anti-mouse IgG antibody (Invitrogen) for 1 h. Following additional 3 washes with PBS containing 0.5% BSA, the cells were analyzed by flow cytometry using an BD LSRII flow cytometer (BD Biosciences).

Quantification and Statistical Analysis

Binding and neutralization assays were conducted with at least duplicate measurements and presented as the mean ± SEM of the indicated number of replicates. Details can be found in figure legends.

Acknowledgments

We thank members of the McLellan Laboratory for providing helpful comments on the manuscript. We would like to thank Dr. John Ludes-Meyers for assistance with cell transfection and protein production. This work was supported by a National Institutes of Health (NIH)/National Institute of Allergy and Infectious Disease (NIAID) grant R01-AI127521 (to J.S.M.) and in part by intramural NIAID funding (B.S.G.). Research was supported by funding from VIB, Ghent University GOA project to N.C. and X.S., FWO and VLAIO fellowships and research projects to various VIB-CMB COVID-19 response team members. We acknowledge the team of the VIB Nanobody Service Facility for their services. D.D.V. was supported by a FWOsb fellowship, W.V.B. by the FWO-SBO grant “GlycoDelete,” S.P. by BMBF (RAPID consortium, 01K11723D), and B.S. by FWO-EOS project VIREOS. We are deeply indebted to the VIB-CMB COVID-19 response team members, who volunteered to offer their expertise and agile work under conditions of almost complete lockdown and societal standstill. We thank the support staff of both VIB-IRC and VIB-CMB centers, the members of VIB Discovery Sciences units’ COVID-19 team for rapid and consistent support and input. Argonne is operated by UChicago Argonne, LLC, for the U.S. Department of Energy (DOE), Office of Biological and Environmental Research under Contract DE-AC02-06CH11357.

Author Contributions

Conceptualization, D.W., D.D.V., B.S.G., B.S., N.C., X.S., and J.S.M.; Investigation and Visualization, D.W., D.D.V., K.S.C., G.M.T., N.W., W.V.B., K.R., L.v.S., M.H., S.P., and B.S.; Writing - Original Draft, D.W. and D.D.V.; Writing – Reviewing & Editing, D.W., D.D.V., K.S.C., G.M.T., N.W., B.S.G., N.C., B.S., X.S., and J.S.M.; Supervision, B.S.G., N.C., B.S., X.S., and J.S.M.

Declaration of Interests

K.S.C., N.W., B.S.G., and J.S.M. are inventors on US patent application no. 62/412,703, entitled “Prefusion Coronavirus Spike Proteins and Their Use.” D.W., K.S.C., N.W., B.S.G., and J.S.M. are inventors on US patent application no. 62/972,886, entitled “2019-nCoV Vaccine.” D.W., D.D.V., B.S.G., B.S., X.S., and J.S.M. are inventors on US patent application no. 62/988,610, entitled “Coronavirus Binders.” D.W., L.v.S., N.C., B.S., X.S., and J.S.M. are inventors on US patent application no. 62/991,408, entitled “SARS-CoV-2 Virus Binders.”

Published: May 5, 2020; corrected online: May 28, 2020

Footnotes

Supplemental Information can be found online at https://doi.org/10.1016/j.cell.2020.04.031.

Supplemental Information

Document S1. Tables S1 and S2
mmc1.pdf (93.1KB, pdf)

References

  1. Adams P.D., Grosse-Kunstleve R.W., Hung L.W., Ioerger T.R., McCoy A.J., Moriarty N.W., Read R.J., Sacchettini J.C., Sauter N.K., Terwilliger T.C. PHENIX: building new software for automated crystallographic structure determination. Acta Crystallogr. D Biol. Crystallogr. 2002;58:1948–1954. doi: 10.1107/s0907444902016657. [DOI] [PubMed] [Google Scholar]
  2. Afonine P.V., Poon B.K., Read R.J., Sobolev O.V., Terwilliger T.C., Urzhumtsev A., Adams P.D. Real-space refinement in PHENIX for cryo-EM and crystallography. Acta Crystallogr D. Struct. Biol. 2018;74:531–544. doi: 10.1107/S2059798318006551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Battye T.G., Kontogiannis L., Johnson O., Powell H.R., Leslie A.G. iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM. Acta Crystallogr. D Biol. Crystallogr. 2011;67:271–281. doi: 10.1107/S0907444910048675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Berger Rentsch M., Zimmer G. A vesicular stomatitis virus replicon-based bioassay for the rapid and sensitive determination of multi-species type I interferon. PLoS ONE. 2011;6:e25858. doi: 10.1371/journal.pone.0025858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bosch B.J., van der Zee R., de Haan C.A., Rottier P.J. The coronavirus spike protein is a class I virus fusion protein: structural and functional characterization of the fusion core complex. J. Virol. 2003;77:8801–8811. doi: 10.1128/JVI.77.16.8801-8811.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chan J.F., Yuan S., Kok K.H., To K.K., Chu H., Yang J., Xing F., Liu J., Yip C.C., Poon R.W. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster. Lancet. 2020;395:514–523. doi: 10.1016/S0140-6736(20)30154-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen Z., Bao L., Chen C., Zou T., Xue Y., Li F., Lv Q., Gu S., Gao X., Cui S. Human Neutralizing Monoclonal Antibody Inhibition of Middle East Respiratory Syndrome Coronavirus Replication in the Common Marmoset. J. Infect. Dis. 2017;215:1807–1815. doi: 10.1093/infdis/jix209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Croll T.I. ISOLDE: a physically realistic environment for model building into low-resolution electron-density maps. Acta Crystallogr. D Struct. Biol. 2018;74:519–530. doi: 10.1107/S2059798318002425. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. De Vlieger D., Ballegeer M., Rossey I., Schepens B., Saelens X. Single-Domain Antibodies and Their Formatting to Combat Viral Infections. Antibodies (Basel) 2018;8:1. doi: 10.3390/antib8010001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Detalle L., Stohr T., Palomo C., Piedra P.A., Gilbert B.E., Mas V., Millar A., Power U.F., Stortelers C., Allosery K. Generation and Characterization of ALX-0171, a Potent Novel Therapeutic Nanobody for the Treatment of Respiratory Syncytial Virus Infection. Antimicrob. Agents Chemother. 2015;60:6–13. doi: 10.1128/AAC.01802-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dumoulin M., Conrath K., Van Meirhaeghe A., Meersman F., Heremans K., Frenken L.G., Muyldermans S., Wyns L., Matagne A. Single-domain antibody fragments with high conformational stability. Protein Sci. 2002;11:500–515. doi: 10.1110/ps.34602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Emsley P., Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 2004;60:2126–2132. doi: 10.1107/S0907444904019158. [DOI] [PubMed] [Google Scholar]
  13. Evans P.R., Murshudov G.N. How good are my data and what is the resolution? Acta Crystallogr. D Biol. Crystallogr. 2013;69:1204–1214. doi: 10.1107/S0907444913000061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Forsman A., Beirnaert E., Aasa-Chapman M.M., Hoorelbeke B., Hijazi K., Koh W., Tack V., Szynol A., Kelly C., McKnight A. Llama antibody fragments with cross-subtype human immunodeficiency virus type 1 (HIV-1)-neutralizing properties and high affinity for HIV-1 gp120. J. Virol. 2008;82:12069–12081. doi: 10.1128/JVI.01379-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gaunt E.R., Hardie A., Claas E.C., Simmonds P., Templeton K.E. Epidemiology and clinical presentations of the four human coronaviruses 229E, HKU1, NL63, and OC43 detected over 3 years using a novel multiplex real-time PCR method. J. Clin. Microbiol. 2010;48:2940–2947. doi: 10.1128/JCM.00636-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ge X.Y., Li J.L., Yang X.L., Chmura A.A., Zhu G., Epstein J.H., Mazet J.K., Hu B., Zhang W., Peng C. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature. 2013;503:535–538. doi: 10.1038/nature12711. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Goddard T.D., Huang C.C., Meng E.C., Pettersen E.F., Couch G.S., Morris J.H., Ferrin T.E. UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Sci. 2018;27:14–25. doi: 10.1002/pro.3235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Govaert J., Pellis M., Deschacht N., Vincke C., Conrath K., Muyldermans S., Saerens D. Dual beneficial effect of interloop disulfide bond for single domain antibody fragments. J. Biol. Chem. 2012;287:1970–1979. doi: 10.1074/jbc.M111.242818. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gui M., Song W., Zhou H., Xu J., Chen S., Xiang Y., Wang X. Cryo-electron microscopy structures of the SARS-CoV spike glycoprotein reveal a prerequisite conformational state for receptor binding. Cell Res. 2017;27:119–129. doi: 10.1038/cr.2016.152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hamers-Casterman C., Atarhouch T., Muyldermans S., Robinson G., Hamers C., Songa E.B., Bendahman N., Hamers R. Naturally occurring antibodies devoid of light chains. Nature. 1993;363:446–448. doi: 10.1038/363446a0. [DOI] [PubMed] [Google Scholar]
  21. Hoffmann M., Kleine-Weber H., Krüger N., Müller M., Drosten C., Pöhlmann S. The novel coronavirus 2019 (2019-nCoV) uses the SARS-coronavirus receptor ACE2 and the cellular protease TMPRSS2 for entry into target cells. bioRxiv. 2020 doi: 10.1101/2020.01.31.929042. [DOI] [Google Scholar]
  22. Huang C., Wang Y., Li X., Ren L., Zhao J., Hu Y., Zhang L., Fan G., Xu J., Gu X. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020;395:497–506. doi: 10.1016/S0140-6736(20)30183-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hwang W.C., Lin Y., Santelli E., Sui J., Jaroszewski L., Stec B., Farzan M., Marasco W.A., Liddington R.C. Structural basis of neutralization by a human anti-severe acute respiratory syndrome spike protein antibody, 80R. J. Biol. Chem. 2006;281:34610–34616. doi: 10.1074/jbc.M603275200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ibañez L.I., De Filette M., Hultberg A., Verrips T., Temperton N., Weiss R.A., Vandevelde W., Schepens B., Vanlandschoot P., Saelens X. Nanobodies with in vitro neutralizing activity protect mice against H5N1 influenza virus infection. J. Infect. Dis. 2011;203:1063–1072. doi: 10.1093/infdis/jiq168. [DOI] [PubMed] [Google Scholar]
  25. Kirchdoerfer R.N., Cottrell C.A., Wang N., Pallesen J., Yassine H.M., Turner H.L., Corbett K.S., Graham B.S., McLellan J.S., Ward A.B. Pre-fusion structure of a human coronavirus spike protein. Nature. 2016;531:118–121. doi: 10.1038/nature17200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kirchdoerfer R.N., Wang N., Pallesen J., Wrapp D., Turner H.L., Cottrell C.A., Corbett K.S., Graham B.S., McLellan J.S., Ward A.B. Stabilized coronavirus spikes are resistant to conformational changes induced by receptor recognition or proteolysis. Sci. Rep. 2018;8:15701. doi: 10.1038/s41598-018-34171-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Koch K., Kalusche S., Torres J.L., Stanfield R.L., Danquah W., Khazanehdari K., von Briesen H., Geertsma E.R., Wilson I.A., Wernery U. Selection of nanobodies with broad neutralizing potential against primary HIV-1 strains using soluble subtype C gp140 envelope trimers. Sci. Rep. 2017;7:8390. doi: 10.1038/s41598-017-08273-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Ksiazek T.G., Erdman D., Goldsmith C.S., Zaki S.R., Peret T., Emery S., Tong S., Urbani C., Comer J.A., Lim W., SARS Working Group A novel coronavirus associated with severe acute respiratory syndrome. N. Engl. J. Med. 2003;348:1953–1966. doi: 10.1056/NEJMoa030781. [DOI] [PubMed] [Google Scholar]
  29. Lan J., Ge J., Yu J., Shan S., Zhou H., Fan S., Zhang Q., Shi X., Wang Q., Zhang L., Wang X. Crystal structure of the 2019-nCoV spike receptor-binding domain bound with the ACE2 receptor. bioRxiv. 2020 doi: 10.1101/2020.02.19.956235. [DOI] [PubMed] [Google Scholar]
  30. Larios Mora A., Detalle L., Gallup J.M., Van Geelen A., Stohr T., Duprez L., Ackermann M.R. Delivery of ALX-0171 by inhalation greatly reduces respiratory syncytial virus disease in newborn lambs. MAbs. 2018;10:778–795. doi: 10.1080/19420862.2018.1470727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Laursen N.S., Friesen R.H.E., Zhu X., Jongeneelen M., Blokland S., Vermond J., van Eijgen A., Tang C., van Diepen H., Obmolova G. Universal protection against influenza infection by a multidomain antibody to influenza hemagglutinin. Science. 2018;362:598–602. doi: 10.1126/science.aaq0620. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Li W., Moore M.J., Vasilieva N., Sui J., Wong S.K., Berne M.A., Somasundaran M., Sullivan J.L., Luzuriaga K., Greenough T.C. Angiotensin-converting enzyme 2 is a functional receptor for the SARS coronavirus. Nature. 2003;426:450–454. doi: 10.1038/nature02145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Li F., Li W., Farzan M., Harrison S.C. Structure of SARS coronavirus spike receptor-binding domain complexed with receptor. Science. 2005;309:1864–1868. doi: 10.1126/science.1116480. [DOI] [PubMed] [Google Scholar]
  34. Li Y., Wan Y., Liu P., Zhao J., Lu G., Qi J., Wang Q., Lu X., Wu Y., Liu W. A humanized neutralizing antibody against MERS-CoV targeting the receptor-binding domain of the spike protein. Cell Res. 2015;25:1237–1249. doi: 10.1038/cr.2015.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lin-Cereghino J., Wong W.W., Xiong S., Giang W., Luong L.T., Vu J., Johnson S.D., Lin-Cereghino G.P. Condensed protocol for competent cell preparation and transformation of the methylotrophic yeast Pichia pastoris. Biotechniques. 2005;38 doi: 10.2144/05381BM04. 44, 46, 48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Lu R., Zhao X., Li J., Niu P., Yang B., Wu H., Wang W., Song H., Huang B., Zhu N. Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020;395:565–574. doi: 10.1016/S0140-6736(20)30251-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. McCoy A.J. Solving structures of protein complexes by molecular replacement with Phaser. Acta Crystallogr. D Biol. Crystallogr. 2007;63:32–41. doi: 10.1107/S0907444906045975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. McLellan J.S., Chen M., Joyce M.G., Sastry M., Stewart-Jones G.B., Yang Y., Zhang B., Chen L., Srivatsan S., Zheng A. Structure-based design of a fusion glycoprotein vaccine for respiratory syncytial virus. Science. 2013;342:592–598. doi: 10.1126/science.1243283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Morin A., Eisenbraun B., Key J., Sanschagrin P.C., Timony M.A., Ottaviano M., Sliz P. Collaboration gets the most out of software. eLife. 2013;2:e01456. doi: 10.7554/eLife.01456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Motulsky H.J., Brown R.E. Detecting outliers when fitting data with nonlinear regression - a new method based on robust nonlinear regression and the false discovery rate. BMC Bioinformatics. 2006;7:123. doi: 10.1186/1471-2105-7-123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Pak J.E., Sharon C., Satkunarajah M., Auperin T.C., Cameron C.M., Kelvin D.J., Seetharaman J., Cochrane A., Plummer F.A., Berry J.D., Rini J.M. Structural insights into immune recognition of the severe acute respiratory syndrome coronavirus S protein receptor binding domain. J. Mol. Biol. 2009;388:815–823. doi: 10.1016/j.jmb.2009.03.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Pallesen J., Wang N., Corbett K.S., Wrapp D., Kirchdoerfer R.N., Turner H.L., Cottrell C.A., Becker M.M., Wang L., Shi W. Immunogenicity and structures of a rationally designed prefusion MERS-CoV spike antigen. Proc. Natl. Acad. Sci. USA. 2017;114:E7348–E7357. doi: 10.1073/pnas.1707304114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Prabakaran P., Gan J., Feng Y., Zhu Z., Choudhry V., Xiao X., Ji X., Dimitrov D.S. Structure of severe acute respiratory syndrome coronavirus receptor-binding domain complexed with neutralizing antibody. J. Biol. Chem. 2006;281:15829–15836. doi: 10.1074/jbc.M600697200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Raj V.S., Mou H., Smits S.L., Dekkers D.H., Müller M.A., Dijkman R., Muth D., Demmers J.A., Zaki A., Fouchier R.A. Dipeptidyl peptidase 4 is a functional receptor for the emerging human coronavirus-EMC. Nature. 2013;495:251–254. doi: 10.1038/nature12005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Respaud R., Vecellio L., Diot P., Heuzé-Vourc’h N. Nebulization as a delivery method for mAbs in respiratory diseases. Expert Opin. Drug Deliv. 2015;12:1027–1039. doi: 10.1517/17425247.2015.999039. [DOI] [PubMed] [Google Scholar]
  46. Rossey I., Gilman M.S., Kabeche S.C., Sedeyn K., Wrapp D., Kanekiyo M., Chen M., Mas V., Spitaels J., Melero J.A. Potent single-domain antibodies that arrest respiratory syncytial virus fusion protein in its prefusion state. Nat. Commun. 2017;8:14158. doi: 10.1038/ncomms14158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Rotman M., Welling M.M., van den Boogaard M.L., Moursel L.G., van der Graaf L.M., van Buchem M.A., van der Maarel S.M., van der Weerd L. Fusion of hIgG1-Fc to 111In-anti-amyloid single domain antibody fragment VHH-pa2H prolongs blood residential time in APP/PS1 mice but does not increase brain uptake. Nucl. Med. Biol. 2015;42:695–702. doi: 10.1016/j.nucmedbio.2015.03.003. [DOI] [PubMed] [Google Scholar]
  48. Schoonooghe S., Kaigorodov V., Zawisza M., Dumolyn C., Haustraete J., Grooten J., Mertens N. Efficient production of human bivalent and trivalent anti-MUC1 Fab-scFv antibodies in Pichia pastoris. BMC Biotechnol. 2009;9:70. doi: 10.1186/1472-6750-9-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Stalin Raj V., Okba N.M.A., Gutierrez-Alvarez J., Drabek D., van Dieren B., Widagdo W., Lamers M.M., Widjaja I., Fernandez-Delgado R., Sola I. Chimeric camel/human heavy-chain antibodies protect against MERS-CoV infection. Sci Adv. 2018;4:eaas9667. doi: 10.1126/sciadv.aas9667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tian X., Li C., Huang A., Xia S., Lu S., Shi Z., Lu L., Jiang S., Yang Z., Wu Y., Ying T. Potent binding of 2019 novel coronavirus spike protein by a SARS coronavirus-specific human monoclonal antibody. Emerg. Microbes Infect. 2020;9:382–385. doi: 10.1080/22221751.2020.1729069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. van der Linden R.H., Frenken L.G., de Geus B., Harmsen M.M., Ruuls R.C., Stok W., de Ron L., Wilson S., Davis P., Verrips C.T. Comparison of physical chemical properties of llama VHH antibody fragments and mouse monoclonal antibodies. Biochim. Biophys. Acta. 1999;1431:37–46. doi: 10.1016/s0167-4838(99)00030-8. [DOI] [PubMed] [Google Scholar]
  52. Walls A.C., Tortorici M.A., Bosch B.J., Frenz B., Rottier P.J.M., DiMaio F., Rey F.A., Veesler D. Cryo-electron microscopy structure of a coronavirus spike glycoprotein trimer. Nature. 2016;531:114–117. doi: 10.1038/nature16988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Walls A.C., Xiong X., Park Y.J., Tortorici M.A., Snijder J., Quispe J., Cameroni E., Gopal R., Dai M., Lanzavecchia A. Unexpected Receptor Functional Mimicry Elucidates Activation of Coronavirus Fusion. Cell. 2019;176:1026–1039.15. doi: 10.1016/j.cell.2018.12.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Walls A.C., Park Y.J., Tortorici M.A., Wall A., McGuire A.T., Veesler D. Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell. 2020;181:281–292.e6. doi: 10.1016/j.cell.2020.02.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wan Y., Shang J., Graham R., Baric R.S., Li F. Receptor recognition by the novel coronavirus from Wuhan: An analysis based on decade-long structural studies of SARS coronavirus. J. Virol. 2020;94:e00127-20. doi: 10.1128/JVI.00127-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Wang N., Shi X., Jiang L., Zhang S., Wang D., Tong P., Guo D., Fu L., Cui Y., Liu X. Structure of MERS-CoV spike receptor-binding domain complexed with human receptor DPP4. Cell Res. 2013;23:986–993. doi: 10.1038/cr.2013.92. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Wang Q., Qi J., Yuan Y., Xuan Y., Han P., Wan Y., Ji W., Li Y., Wu Y., Wang J. Bat origins of MERS-CoV supported by bat coronavirus HKU4 usage of human receptor CD26. Cell Host Microbe. 2014;16:328–337. doi: 10.1016/j.chom.2014.08.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Wang L., Shi W., Joyce M.G., Modjarrad K., Zhang Y., Leung K., Lees C.R., Zhou T., Yassine H.M., Kanekiyo M. Evaluation of candidate vaccine approaches for MERS-CoV. Nat. Commun. 2015;6:7712. doi: 10.1038/ncomms8712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Wang L., Shi W., Chappell J.D., Joyce M.G., Zhang Y., Kanekiyo M., Becker M.M., van Doremalen N., Fischer R., Wang N. Importance of Neutralizing Monoclonal Antibodies Targeting Multiple Antigenic Sites on the Middle East Respiratory Syndrome Coronavirus Spike Glycoprotein To Avoid Neutralization Escape. J. Virol. 2018;92:e02002–e02017. doi: 10.1128/JVI.02002-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Woo P.C., Lau S.K., Huang Y., Yuen K.Y. Coronavirus diversity, phylogeny and interspecies jumping. Exp. Biol. Med. (Maywood) 2009;234:1117–1127. doi: 10.3181/0903-MR-94. [DOI] [PubMed] [Google Scholar]
  61. Wrapp D., McLellan J.S. The 3.1 A cryo-EM structure of the porcine epidemic diarrhea virus spike protein in the prefusion conformation. J Virol. 2019 doi: 10.1128/JVI.00923-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Wrapp D., Wang N., Corbett K.S., Goldsmith J.A., Hsieh C.L., Abiona O., Graham B.S., McLellan J.S. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science. 2020;367:1260–1263. doi: 10.1126/science.abb2507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Yan R., Zhang Y., Li Y., Xia L., Guo Y., Zhou Q. Structural basis for the recognition of the SARS-CoV-2 by full-length human ACE2. Science. 2020;367:1444–1448. doi: 10.1126/science.abb2762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Ying T., Prabakaran P., Du L., Shi W., Feng Y., Wang Y., Wang L., Li W., Jiang S., Dimitrov D.S., Zhou T. Junctional and allele-specific residues are critical for MERS-CoV neutralization by an exceptionally potent germline-like antibody. Nat. Commun. 2015;6:8223. doi: 10.1038/ncomms9223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Yu X., Zhang S., Jiang L., Cui Y., Li D., Wang D., Wang N., Fu L., Shi X., Li Z. Structural basis for the neutralization of MERS-CoV by a human monoclonal antibody MERS-27. Sci. Rep. 2015;5:13133. doi: 10.1038/srep13133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Yuan Y., Cao D., Zhang Y., Ma J., Qi J., Wang Q., Lu G., Wu Y., Yan J., Shi Y. Cryo-EM structures of MERS-CoV and SARS-CoV spike glycoproteins reveal the dynamic receptor binding domains. Nat. Commun. 2017;8:15092. doi: 10.1038/ncomms15092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Yuan M., Wu N.C., Zhu X., Lee C.D., So R.T.Y., Lv H., Mok C.K.P., Wilson I.A. A highly conserved cryptic epitope in the receptor-binding domains of SARS-CoV-2 and SARS-CoV. Science. 2020 doi: 10.1126/science.abb7269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Zaki A.M., van Boheemen S., Bestebroer T.M., Osterhaus A.D., Fouchier R.A. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N. Engl. J. Med. 2012;367:1814–1820. doi: 10.1056/NEJMoa1211721. [DOI] [PubMed] [Google Scholar]
  69. Zhao G., He L., Sun S., Qiu H., Tai W., Chen J., Li J., Chen Y., Guo Y., Wang Y. A Novel Nanobody Targeting Middle East Respiratory Syndrome Coronavirus (MERS-CoV) Receptor-Binding Domain Has Potent Cross-Neutralizing Activity and Protective Efficacy against MERS-CoV. J. Virol. 2018;92 doi: 10.1128/JVI.00837-18. e00837–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Zhou P., Yang X.L., Wang X.G., Hu B., Zhang L., Zhang W., Si H.R., Zhu Y., Li B., Huang C.L. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature. 2020;579:270–273. doi: 10.1038/s41586-020-2012-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Tables S1 and S2
mmc1.pdf (93.1KB, pdf)

Data Availability Statement

The X-ray crystallographic data and atomic models have been deposited at the Protein Data Bank with accession codes PDB: 6WAQ (SARS-CoV-1 RBD bound by SARS VHH-72) and PDB: 6WAR (MERS-CoV RBD bound by MERS VHH-55). The sequences of MERS VHH-55 and SARS VHH-72 have been deposited in GenBank under accession numbers MT350283 and MT350284. A list of software used in this study can be found in the Key Resources Table.


Articles from Cell are provided here courtesy of Elsevier

RESOURCES