Skip to main content
PLOS One logoLink to PLOS One
. 2020 May 6;15(5):e0222256. doi: 10.1371/journal.pone.0222256

Immediate early gene kakusei potentially plays a role in the daily foraging of honey bees

Asem Surindro Singh 1,2,*, Machathoibi Chanu Takhellambam 3, Pamela Cappelletti 4, Marco Feligioni 4
Editor: James C Nieh5
PMCID: PMC7202604  PMID: 32374761

Abstract

kakusei is a non-coding RNA that is overexpressed in foraging bee brain. This study describes a possible role of the IEG kakusei during the daily foraging of honey bees. kakusei was found to be transiently upregulated within two hours during rewarded foraging. Interestingly, during unrewarded foraging the gene was also found to be up-regulated, but immediately lowered when food was not rewarded. Moreover, the kakusei overexpression was diminished within a very short time when the time schedule of feeding was changed. This indicates the potential role of kakusei on the motivation of learned reward foraging. These results provide evidence for a dynamic role of kakusei during for aging of bees, and eventually its possible involvement in learning and memory. Thus the kakusei gene could be used as search tool in finding distinct molecular pathways that mediate diverse behavioral components of foraging.

Introduction

Social behavior of honey bee foraging has been an attractive field of research. Further exploration of the dynamics of honey bee foraging at the molecular and cellular level could help in uncovering the complex mechanisms of social behavior. Honey bee foraging comprises several behavioral components including learning, memory, social interaction and communication. In 1973 the Austrian ethologist Karl Ritter von Frisch (Austrian ethologist) was honored with Nobel Prize in Physiology or Medicine for his investigations of sensory perceptions in honey bees [1]. He translated the meaning of the bee waggle dance into a particular movement of the honey bee that looks like the form of figure eight, and revealed that foraging bees of the same colony share information with the help of this dance [2–4]. Bee foraging has gained enormous attention, since it offers the opportunity to elucidate the complexity of behavioral mechanisms involved in accomplishing the foraging task. Thanks to the efforts of many researchers, today we have a substantial amount of knowledge on this subject. However, understanding of the context of molecular and cellular mechanisms underlying foraging tasks is still poor.

During foraging, bees fly back and forth several times during the day between the hive and the food location, collecting nectar/pollen and bringing it to the hive for their colony. Foraging involves highly systematic and dynamic behavioral capacities that include long distance navigation using the sun as compass, evaluation of food quality, learning and memorizing flower cues, sense of colour, and social communication/interaction for coordination in collecting nectar, pollen, and water [2,5,6]. For decades the outdoor experiments have been routinely performed by feeding bees on pollen or sucrose solution placed in a specific place in order to mimic the natural foraging environment in close proximity. Using this experimental setup, we attempted to identify foraging regulatory genes in the European honey bee species Apis mellifera while the bees were performing their daily routine foraging. For this, the immediate early genes (IEGs) were the ultimate targets to examine, as they are well known as neural markers.

IEGs are rapidly induced by a large number of stimuli, and alterations of their expression are considered as part of the general neuronal response to natural stimuli as interpreted by normal synaptic activity [7]. The products of IEGs can activate downstream targets that typically function as part of a network of constitutively expressed proteins [7]. IEGs are also known to be the first activated genes that link cellular membrane events to the nucleus [8], and the gene expression changes are required for the late neuronal response which relates to the process of learning and memory formation [9] and which is a part of everyday brain functions [10]. In addition, depending on the type of the stimuli, the IEG-encoded proteins can be individually regulated in different parts of the brain [8,11], indicating that the same or different IEGs can, regulate different functions when expressed in different parts of the brain.

In our recent work, we have demonstrated involvement of two IEGs i.e., early growth response 1 (egr-1) and, nuclear hormone receptor 38 (hr38) and their corresponding partner genes such as ecdysone receptor (ecr), dopamine/ecdysteroid receptor (dopecr), dopamine decarboxylase (ddc) and dopamine receptor 2 (dopr2) during the daily foraging of bees [12]. Other papers have reported on the involvement of egr-1 in the transition from nursing to foraging bees [13] and the role of hr38 in caste and labor division [14], while the other genes were shown to have acted as egr-1 downstream genes involved in ecdysteroid and dopamine signaling with a role in the processing of courtship memory [15] in Drosophila and in olfactory learning and memory [16] in honey bees, respectively. The IEG c-jun (also known as jun-related antigen, jra in fruit fly) and egr-1 have been used as neuronal markers for the identification in honey bees of specific brain regions involved in the time memory as well as in innate and learned behaviours [17,18,19]. Interestingly, while most of the above mentioned genes are already well known through various research studies, a recently discovered insect IEG kakusei, a noncoding RNA, has been found to have function in the patterning of neuronal activity in the foraging bees [20,21,22]. Expression of kakusei was detected during ice-induced seizures in bees awakening from anesthesia, and its expression was prominent in the Kenyon cells of the mushroom bodies [20,21,22]. Since kakusei was found as neural marker, we were interested to extend the work on this gene in our experimental design.

The present study represents further investigation of immediate early genes (IEG) that could play a role during the daily foraging of honey bees, and is a continuous work of our previous report by Singh et al [12]. We selected two potential IEGs kakusei and c-jun, and four other orthologous genes that have been reported to be involved in cognitive process in vertebrates: extracellular signal-related kinase (rk7), glutamate receptor (GluR), 5-hydroxy tryptamine (serotonin) receptor 2 alpha (5-HT2α) and dopamine receptor 1 (Dop1). Among the six genes tested, we observed only for the kakusei gene with a transient and prolonged upregulation during reward foraging and a short period of overexpression during unrewarded foraging. These findings demonstrate a potential role for kakusei during reward foraging and in learning of food reward foraging.

Materials and methods

Foraging experiment and sample collection

Honey bees were purchased from the local bee keepers, Bangalore, Karnataka, India. The bee colonies were kept inside the bee house located within the institute campus, National Centre for Biological Sciences (NCBS), TIFR, Bangalore, India. And one of the most common honey bee species Apis Mellifera was used in this experiment. Therefore, no endangered or threatened species or locations were involved in this study. The behavioral tests were performed by using an outdoor flight cage (length = 12m, height = 5m, width = 2.5m) located within the NCBS campus, Bangalore, India. The Apis mellifera colonies were kept within the outdoor flight case and bees were fed with pollen and 1 M sugar solution placed on a green and yellow plastic plate respectively. The distance of feeders was 10m from the beehive with a 1.5m gap between the two feeders. The feeding time was from 14.00 to 17.00 hrs every day. Sample collection was started after the foraging bees had visited feeders for several days. For the gene expression profiling, nectar foragers were collected and the gene expression analysis was carried out with those samples. The procedures were same as previously described [12] and the same samples have been reused in this study.

Collection procedure and sample grouping

Collection during foraging

The first arriving foragers were caught at the feeder plate before presenting the sugar solution on the feeder (0min group) and the caught bees were immediately flash frozen in liquid nitrogen for further gene expression analysis. Soon after the first collection, sugar solution was presented and the first arriving foragers were marked by paint markers. The marked bees were collected at a series of time points with 15 min intervals up to 2 hrs (15min, 30min, 45min, 60min, 75min, 90min, 105min, and 120min groups), then flash frozen immediately in liquid nitrogen. We caught paint-marked foragers as soon as they landed over the plate and before they start drinking the sugar solution at those set times during their repeated trips. The paint mark on bees was done using Uni POSCA Paint Markers (Uni Mitsubishi Pencil, UK). In one day we collected about 24 bees, 1–2 bees for each time point starting from 14.00 hours until 16.00 hours and continued in following days until we obtained 5 bees at each time point.

Collection before and after foraging

Pre-foraging bees were paint-marked while foraging and collected in the morning (09.00 hrs) of the next day in the hive before they started foraging; whereas post-foraging bees were caught in the hive in the evening (18.00 hrs) after the bees finished foraging, on the same day that the bees were paint marked. We took gentle care during the collection procedure in order that the foraging bees were not disturbed and to avoid inducing stress phenomena; thereby the interactions between the collector and the bees were considered minimal [23,24,25]. The caught bees were immediately flash frozen in liquid nitrogen.

Collection without food reward

This category included only the foraging bees collected at the empty feeder plate at different time points. The foragers were marked at 0min upon their arrival at the empty feeder and 0min samples were collected. After the collection of 0min samples, 1 M sucrose solution was presented to let the bees continue coming and the collection continued for one hour with samples at 15min, 30min, 45min and 60min. While the unmarked bees were drinking, the marked bees were caught as soon as they landed on the feeder plate; it was made sure that those bees had not touched the sucrose solution. About 2 bees were collected in each day of collection and the collection started at 14.00 hrs. The bees were immediately flash frozen in liquid nitrogen as soon as they were caught.

Collection at different feeding time

Here the procedure is same with that of (1). The only difference was that the feeder was presented at 11.00 hrs instead of the normal feeding time 14.00 hours, and the collection also started from the same time and continued for 1 hr with samples at 0min, 15min, 30min, 45min and 60min.

Brain dissection, RNA and cDNA preparation, and qPCR

The frozen bees were lyophilized at -50°C with vacuum at 0.420 mBar for 20min, using a Freeze Zone® PlusTM 4.5 liter cascade Freeze Dry System (Labconco Corporation, Kanas City). Brain dissection was performed in a glass chamber containing 100% ethanol placed on a dry ice platform. The whole brain from each bee was dissected and placed into a micro centrifuge tube separately, and 500 μl Trizol (Trizol® Reagent, ambion RNA, life technology) was added. The brain was homogenized, RNA was extracted, and cDNA was prepared from that RNA, using the kits supplied by Invitrogen (Thermo Fisher Scientific) following the manufacturer's protocols. The cDNA from each brain was subjected to qPCR using a 7900HT Fast Real Time PCR System (Applied Biosystem, Singapore) in a 10μl reaction volume containing oligonucleotide primers (Sigma Aldrich) specific to target genes and SYBR Green (KAPA Syber® FAST PCR Master Mix (2X) ABI Prism®). The qPCR cycles followed Applied Biosystem protocol and the Rp49 gene was used as endogenous control [26] in each qPCR run and analysis. The details of the target genes and the oligonucleotide primers are provided in Table 1.

Table 1. Details of primers used for quantifying the target genes.

Gene Name NCBI Gene ID Chromosome No. & location Oligonucleotide primer sequence 5′ - 3′ Amplicon size
Kakusei 100049563 LG2 Fow—TGGGTAGGGTTGGTAAGGGAA 91 bp
NC_007071.3 Rev—ACACGAAACCATCCTGCCAC
Erk7 408917 LG4 Fow—ACCCGGTCCGAAGAAGAAAT 67 bp
NC_007080.3 Rev—CAGGCCAAAAGTCTGAGAATCA
c-Jun 726289 LG9 Fow—CCCTTCAGCAATTTAACCTTATC 78 bp
NC_007078.3 Rev—CGTGGCGGCATCCAAA
GluR 411220 LG7 Fow—GGGATCGCCTCATATACCCA 71 bp
NC_007076.3 Rev—GAGCGAACCAAAGGCTGTTT
5-HT2α 411323 LG9 Fow—GTCTCCAGCTCGATCACGGT 126 bp
NC_007078.3 Rev—GGGTATGTAGAAGGCGATCAGAGA
Rp49 406099 LG11 Fow—CAGTTGGCAACATATGACGAG 124 bp
NC_007080.3 Rev—AAAGAGAAACTGGCGTAAACC
Dop1 406111 LG15 Fow—ACAGAATTCCGAGAAGCGTTCA 79 bp
NC_007084.3 Rev–ATTCGCTAGTCGACGGTTCATTT

LG: Linkage Group

Statistical analysis of qPCR

We calculated relative gene expression level using the relative standard curve method with the help of SDS 2.4 software provided with the 7900HT Fast Real system. The standard deviation was calculated following Applied Biosystem’s ‘Guide to performing relative quantification of gene expression using real-time quantitative PCR’. The fold change was determined relative to time t0, and the statistical significance was tested using one-way ANOVA with Turkey- Kramer post-hoc multiple comparison test; the analysis was carried out with the help of GraphPad InStat software [27]. Normal distribution of each group compared was tested using the D'Agostino & Pearson omnibus normality test. In order to check the differences among the independent experiments, the two-way ANOVA program of GraphPad Prism was also employed (GraphPad Software Inc. www.graphpad.com).

Results

In this study, only the immediate early gene kakusei showed a remarkable transient upregulation during the course of food reward foraging. The other five genes erk7, c-jun, glur, 5-ht2α, dop1 showed no statistically significant differences (S1 Fig).

Expression profile of kakusei during food reward foraging

The expression of kakusei was measured at eleven time points, BF (pre/before foraging), 0min, 15min, 30min, 45min, 60min, 75min, 90min, 105min, 120min and AF (post/after foraging). In order to check the consistency of the results, three experiments were performed using independent samples collected from two different bee colonies over three months. The experiment 1 and 2 were from colony 1 and experiment 3 was from colony 2. Each of the three experiments demonstrated transient increases of kakusei level during the continuous food reward foraging over the collection time of two hours. The results are summarized in Fig 1 (S1 Table).

Fig 1. Expression changes of the IEG kakusei during daily foraging of bees.

Fig 1

Data are shown as fold changes of kakusei expression level at different time points with respect to t0 (mean value was set to 1 at this time point). The blue, red and green bar graphs represent three independent experiments (experiment 1, experiment 2 and experiment 3 respectively) with each bar representing the kakusei expression level at each time point. Graphs at the left (Experiment series A) represent kakusei level from t0 (14.00 hrs) to t120 (16.00 hrs). Graphs at the right represent kakusei level at the start of foraging (SF/t0: 14.00 hrs) and before-foraging (BF: 09.00 hrs) or after foraging (AF: 18.00 hrs). Each time point has sample size of n = 5. For statistics one-way ANOVA with Turkey- Kramer post-hog multiple comparison test were performed and number of asterisk symbol represents * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

We observed an increase of kakusei expression from 0min (start of foraging, 14.00 hrs) to 15min (P = <0.0001) and from 15min to 30min (P = <0.0001) (Fig 1 Exp 1A). While the increase held at about 30min (P30m-45m = not significant) and a decrease was apparent from 45min, there was a sustained increased in expression of kakusei further down along the time series until 120min during the reward foraging as compared to the level at 0min (Fig 1 Exp 1A and S1 Table). A similar pattern was also observed in the subsequent two experiments with independent samples (Fig 1 Exp 2A/3A and S1 Table). The kakusei level was also significantly higher (P = <0.0001) at the start of foraging (0min) when compared to the level at pre foraging (09.00 hrs) or post foraging (18.00 hrs), while there was no significant difference between the before and after foraging samples (Fig 1 Exp 1B). This observation was further validated by two further independent experiments (Fig 1 Exp 2B & 3B). We then examined whether kakusei overexpression pattern was statistically different among the three independent results. We found significantly different overexpression of kakusei among the three independent experiments (P = 0.0001). The difference in kakusei levels between Exp-1/Exp-3 vs Exp-2 (P = 0.0001) was much higher than Exp-1 vs Exp-3 (P = 0.044). This difference might be due to age differences among the group of bees in Exp-1A/1B, Exp-2A/2B and Exp-3A/3B as we did not maintain the age of foraging bees during sample collection. The graphical results of the analysis are presented in Fig 2A. Similarly, in the case of the start/pre/post foraging groups, among the three independent experiments, we observed difference between Exp-2 vs Exp-1/-3 (P = 0.0001) and no difference between Exp-1 and Exp-3 (Fig 2B).

Fig 2.

Fig 2

Comparison of three independent experiments during two hours of foraging (A) and before/after foraging (B), and expression changes of IEG kakusei with unrewarded (C) and different foraging time (D). A&B: The three independent experiments shown in Fig 1 were examined for interaction using two-way ANOVA. The bars represent mean kakusei expression in each experiment and the dots represent the mean level of kakusei at various time points. The blue, red and green color bars/dots represent experiment 1, experiment 2 and experiment 3 respectively. C&D: The kakusei expression profile is presented as fold changes with respect to t0 (mean value was set as 1 at this time point) and each green bar graphs represents kakusei levels at each time point. Fig 2C and 2D represent data for unrewarded and time-shifted foraging respectively. Each time point has sample size of n = 5. For statistics one-way ANOVA with Turkey- Kramer post-hog multiple comparison test were performed. The number of asterisk symbol represents * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

Expression changes of kakusei during unrewarded foraging

In order to confirm whether the kakusei upregulation was solely due to the food reward, we presented the empty plate at the usual feeding time 14.00 hrs and the bees were collected without feeding following the procedure described in the methods section. Interestingly, kakusei expression from the whole bee brains showed upregulation at 15min (P = 0.0011; Fig 2C), indicating a potential effect on kakusei of the learned motivation of food reward. However, the value no longer increased after 15min (P15m-30m/P30m-45m/P45m-60m = not significant) and the level dropped by 45min (P0m-45m = not significant) (Fig 2C and S2 Table) indicating that a food reward is required in order to sustain kakusei upregulation. This result suggests that kakusei is involved in learning of food reward during foraging.

Testing for time-dependent food reward foraging effect on kakusei expression

To further examine whether the kakusei expression depends on the time of feeding, the sucrose solution was presented at 11.00 hrs, three hours ahead of the usual feeding time instead of 14.00 hrs (it may be recalled that the bees were fed every day at 14.00 hrs in the previous experiments). As before the marked bees were collected over a period of 1 hour, at 0min, 15min, 30min, 45min and 60min, as described in method section. A similar pattern of overexpression of kakusei was observed as in the previous experiment of food reward foraging in which the collection began at 14:00 hrs. The increase continued from 0min to 15min (P = <0.0001) and 15 min to 30min (P = 0.0195), and then showed no further increase (P30m-45m/P45m-60m = not significant) (Fig 2D and S2 Table). This further reveals that kakusei role is independent of feeding time during the day, but responds to the reward of food during foraging.

Discussion

The importance of using immediate early genes as tool for finding molecular and cellular mechanisms underlying neuronal network and behaviors in honey bees has been well emphasized in the recent studies [11,12,28,29]. Keeping this idea as central, this study extends our recent report [12] on the search for immediate early genes (IEGs) that could be used as research tool for finding the molecular and cellular mechanisms underlying social behavior using foraging of honey bees as model system. As the foraging of bees consists of systematically well organized social behaviors that include learning, memory, social interaction and communication etc; honey bee foraging has been extensively studied in various research objectives in connection to social behavior [2,5,6]. Noting that honey bees learn food sources, identify the food location, memorize the place, interact and communicate among the foragers, as can be clearly observed during the time of their daily foraging; it is a promising approach to find the genes whose expression is increased upon foraging and to examine their roles in these behavioral routines. In the present study the possible function of the newly discovered insect IEG kakusei is presented, suggesting its role during the foraging of bees. A possible function of the gene in learning of food reward during foraging had also been observed.

kakusei is an insect immediate early gene recently identified by Kubo and his group in the seizure induced bees by cold or CO2 treatment, and is transcribed into a non-coding neuronal RNA [20]. They found that the transcript was prominently increased in the small-type Kenyon cells of the dancers and foraging bee brains, suggesting involvement of the gene in foraging behavior. However, its involvement during the course of foraging had never been studied before. This is the first report on transient overexpression of kakusei during foraging. We have further examined the possible role of the gene before and after foraging. After food reward kakusei was immediately overexpressed over a short period of time from 15 to ca. 45 to 60 min, and then started decreasing. Interestingly, without food reward, there was a short time overexpression at 15min and no further increase of the gene level. This indicates that food reward is essential for the increase and sustaining of higher kakusei levels during foraging, and suggests a possible role of kakusei in learning and memorizing of food reward during foraging. The possibility of kakusei involvement in learning and memory was previously indicated in the earlier report by Kiya et al., 2007 [20] as they reported overrepresentation of kakusei among the re-orienting Kenyon cells of bees assumed to be foragers. This is in line with the notion that re-orientation flight was the mechanism of flight behavior that was practiced by those bees for memorizing the hive location, thus indicating a role of kakusei in the information integration during foraging flight, which is an essential part for dance communication [20]. We suspect that the kakusei gene might also be involved in social interaction and communication among the foraging bees, linking through different molecular pathways as these behaviors were clearly observed among the foragers over the two hours of foraging. Future research on this direction will be able to give a valid comment with evidence on it. Moreover, the suggestive evidence of the present study on the role of kakusei in learning needs to be rigorously tested further, using other experiments such as proboscis extension reflex (PER), in order to draw a conclusive answer which will be carried out in our further research. Our recent study by Singh et al., 2018 [12] had demonstrated involvement of two IEGs, egr-1and hr38, and downstream genes such as ecr, dopecr, ddc, and dopr2 during daily foraging. Moreover, the role of egr-1 and hr38 in learning of food reward during foraging and memory processing was also suggested. Therefore, coordination of kakusei and the two IEGs egr-1 and hr38 during foraging behavior and learning and memory of food reward during foraging is highly assumable that would be tested in our future works. Since kakusei is a non coding gene, this study also clearly supports the dynamic role of non-coding genes in daily routine behavior.

On the other hand, earlier studies on songbird (Zebra finch) showed profound involvement of egr-1 gene in learning and memory [30]. In the egr-1 transgenic cricket (Gryllus bimaculatus), behaviorally relevant neural circuits was also visualized at cellular resolution [31]. In rodent system, several studies had revealed Egr-1 roles in synaptic plasticity and memory formation in a variety of memory systems including amygdala-dependent memory consolidation processes [32]. Moreover, the functions of hr38 in neural activity in Bombyx mori (silkmoth) and Drosophila melanogaster (fruit fly) and in honey bees were also revealed [14,33]. It is highly promising to do further research with egr-1, hr38 and kakusei using honeybees as model system for further understanding on learning and memory and the finding on honeybees will be useful across animal kingdom.

Conclusion

Previous reports have already indicated involvement of immediate early genes could be used as neural marker and their association in social behaviors such as learning and memory or memory processing. Subsequently, the importance of using immediate early genes as tool for finding molecular and cellular basis of these behaviors in honey bees had been thoroughly discussed [11,12,28,29]. Our recent report by Singh et al., has provided further evidence that the two IEGs egr-1 and hr38 are immediately and transiently expressed during honey bee foraging and further that they are involved in learning and memory processing [12]. The present finding on the recently discovered IEG kakusei is an addition to the circle, thus increasing the number of IEGs in elucidating molecular and cellular signaling underlying social behaviors, using honey bee foraging as model system. In addition to the available reports from different studies, further studies on how the three IEGs egr-1, hr38 and kakusei coordinate in completing the foraging task via their specific role in the learning, memory and their roles in communication and interaction could contribute in mapping molecular and cellular pathways to these behavior. Thereby the mechanisms of social behavior in honey bees could be opened up in more details and mapped which could be further translated to cognitively complex animals and even to human [34].

Supporting information

S1 Fig

Gene expression profile for c-Jun (A), Dop1 (B), GluR (C), Erk7 (D) and 5-HT2α during the daily foraging of honey bees.

(DOCX)

S1 Table. Summarized result for three replicate experiments of kakusei.

(DOCX)

S2 Table. Summarized result for time trained feeding effect and unrewarded foraging on kakusei expression.

(DOCX)

Acknowledgments

Dr. Ned Mantei, Department of Biology, Molecular Health Sciences, ETH Zurich, carefully and thoroughly read the manuscript. He provided valuable suggestions and advices and immensely helped in editing the manuscript. It is great honor to thank Dr. Ned Mantei for his kind and wholehearted support in making the manuscript to this form.

Dr. Axel Brockmann is gratefully acknowledged for providing the facilities in his lab to work and complete this project. Dr. Brockmann also read the manuscript and provided valuable comments. Ms. Neha Tanwar and Dr. Sophia Liyang kindly supported during experimental sample preparation.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was completed with the help of Research Associate Fellowship provided by Council of Scientific and Industrial Research, Govt. of India, Award no. 09/860(0167)/2015—EMR-1 and Bridging Postdoctoral Fellowship by National Centre for Biological Sciences, TIFR, India, to Dr. Asem Surindro Singh.

References

  • 1.Michelsen A (2003) "Karl von Frisch lecture. Signals and flexibility in the dance communication of honey bees". Journal of Comparative Physiology A 189:165–174. [DOI] [PubMed] [Google Scholar]
  • 2.Von Frisch K (1993) The Dance Language and Orientation of Bees; Harvard University Press: Cambridge, MA, USA. [Google Scholar]
  • 3.Riley J, Greggers U, Smith A, Reynolds D, Menzel R (2005) "The flight paths of honey bees recruited by the waggle dance". Nature 435:205–207. 10.1038/nature03526 [DOI] [PubMed] [Google Scholar]
  • 4.Seeley TD, Visscher PK, Passino KM (2006) "Group decision making in honey bee swarms". American Scientist 94:220–229. [Google Scholar]
  • 5.Seeley TD (1995) Wisdom of the Hive. Harvard University Press, Cambridge, MA. [Google Scholar]
  • 6.Thorpe WH (1983) "Karl von Frisch. 20 November 1886–12 June 1982". Biographical Memoirs of Fellows of the Royal Society 29: 196–200. 10.1098/rsbm.1983.0008 [DOI] [Google Scholar]
  • 7.Perez-Cadahia B, Drobic B, Davie JR (2011) Activation and function of immediate-early genes in the nervous system. Biochem Cell Biol 89:61–73. 10.1139/O10-138 [DOI] [PubMed] [Google Scholar]
  • 8.Beckmann AM and Wilce PA (1997) Egr transcription factors in the nervous system. Neurochem Int 31:477–510; discussion 517–6. 10.1016/s0197-0186(96)00136-2 [DOI] [PubMed] [Google Scholar]
  • 9.Hughes P and Dragunow M (1995) Induction of immediate-early genes and the control of neurotransmitter-regulated gene expression within the nervous system. Pharmacol Rev 47:13378. [PubMed] [Google Scholar]
  • 10.Loebrich S and Nedivi E (2009) The function of activity-regulated genes in the nervous system. Physiol Rev 89:1079–103. 10.1152/physrev.00013.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Sommerlandt FMJ, Brockmann A, Rossler W, Spaethe J (2019) Immediate early genes in social insects: a tool to identify brain regions involved in complex behaviors and molecular processes underlying neuroplasticity. Cell Mol Life Sci 76:637–651. 10.1007/s00018-018-2948-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Singh AS, Shah A, Brockmann A (2018) Honey bee foraging induces upregulation of early growth response protein 1, hormone receptor 38 and candidate downstream genes of the ecdysteroid signalling pathway. Insect Mol Biol 27:90–98. 10.1111/imb.12350 [DOI] [PubMed] [Google Scholar]
  • 13.Khamis AM, Hamilton AR, Medvedeva YA, Alam T, Alam I, Essack M et al. (2015) Insights into the transcriptional architecture of behavioral plasticity in the honey bee Apis mellifera. Sci Rep 5:11136 10.1038/srep11136 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Yamazaki Y, Shirai K, Paul RK, Fujiyuki T, Wakamoto A, Takeuchi H et al. (2006) Differential expression of HR38 in the mushroom bodies of the honey bee brain depends on the caste and division of labor. FEBS Lett 580:2667–2670. 10.1016/j.febslet.2006.04.016 [DOI] [PubMed] [Google Scholar]
  • 15.Ishimoto H, Wang Z, Rao Y, Wu C-F, Kitamoto T (2013) A Novel Role for Ecdysone in Drosophila Conditioned Behavior: Linking GPCR-Mediated Noncanonical Steroid Action to cAMP Signaling in the Adult Brain. PLoS Genet 9:e1003843 10.1371/journal.pgen.1003843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lagisz M, Mercer AR, Mouzon C, Santos LLS, Nakagawa S (2016) Association of aminereceptor DNA sequence variants with associative learning in the honey bee. Behav Genet 46:242–251. 10.1007/s10519-015-9749-z [DOI] [PubMed] [Google Scholar]
  • 17.Shah A, Jain R, Brockmann A (2018) Egr-1: a candidate transcription factor involved in molecular processes underlying timememory. Front Psychol 9:865 10.3389/fpsyg.2018.00865 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Alaux C and Robinson GE (2007) Alarm pheromone induces immediate–early gene expression and slow behavioral response in honey bees. J Chem Ecol 33: 1346–1350. 10.1007/s10886-007-9301-6 [DOI] [PubMed] [Google Scholar]
  • 19.Lutz CC and Robinson GE (2013) Activity-dependent gene expression in honey bee mushroom bodies in response to orientation flight. J Exp Biol 216:2031–2038. 10.1242/jeb.084905 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kiya T, Kunieda T, Kubo T (2007) Increased neural activity of a mushroom body neuron subtype in the brains of forager honey bees. PLoS One 2 e371 10.1371/journal.pone.0000371 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kiya T, Kunieda T, Kubo T (2008) Inducible- and constitutive-type transcript variants of kakusei, a novel non-coding immediate early gene, in the honey bee brain. Insect Mol Biol 17:531–536. 10.1111/j.1365-2583.2008.00821.x [DOI] [PubMed] [Google Scholar]
  • 22.Kiya T, Ugajin A, Kunieda T and Kubo T (2012) Identification of kakusei, a Nuclear NonCoding RNA, as an Immediate Early Gene from the Honey bee, and Its Application for Neuroethological Study. Int J Mol Sci 13:15496–15509; 10.3390/ijms131215496 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Abbott KR and Dukas R (2009) Honey bees consider flower danger in their waggle dance. Anim Behav 78: 633–635. [Google Scholar]
  • 24.Bateson M, Desire S, Gartside SE, Wright GA (2011) Agitated honey bees exhibit pessimistic cognitive biases. Curr Biol 21:1070–1073. 10.1016/j.cub.2011.05.017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Nieh JC (2010) A negative feedback signal that is triggered by peril curbs honey bee recruitment. Curr Biol 20:310–315. 10.1016/j.cub.2009.12.060 [DOI] [PubMed] [Google Scholar]
  • 26.Ugajin A, Kunieda T, Kubo T (2013) dentification and characterization of an Egr ortholog as a neural immediate early gene in the European honey bee (Apis mellifera L.). FEBS Lett 587: 3224–3230. 10.1016/j.febslet.2013.08.014 [DOI] [PubMed] [Google Scholar]
  • 27.Motulsky HJ (1999) Analyzing Data with GraphPad Prism. GraphPad Software Inc, San Diego CA, www.graphpad.com. [Google Scholar]
  • 28.Kiya T and Kubo T (2011) Dance Type and Flight Parameters Are Associated with Different Mushroom Body Neural Activities in Worker Honeybee Brains PLoS ONE 6(4): e19301 10.1371/journal.pone.0019301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Singh AS (2019) Immediate Early Genes as Search Tool for Finding Cellular and Molecular Events Underlying Social Behaviors of Honeybees: A Brief Commentary. Nova Medicine and Health, 2020, Advances in Medicine and Biology, Volume 153, ISBN: 978-1-53616-487-9. [Google Scholar]
  • 30.Clayton DF (2013) The genomics of memory and learning in songbirds. Annu Rev Genomics Hum Genet 14:45–65. 10.1146/annurev-genom-090711-163809 [DOI] [PubMed] [Google Scholar]
  • 31.Watanabe T, Ugajin A, Aonuma H, (2018) Immediate-Early Promoter-Driven Transgenic Reporter System for Neuroethological Research in a Hemimetabolous Insect. eNeuro. 10.1523/ENEURO.0061-18.2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Stephanie AM, Melissa SM, and Glenn ES (2011) Early growth response gene 1 (Egr-1) is required for new and reactivated fear memories in the lateral amygdale. Learn Mem 18:24–38. 10.1101/lm.1980211 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Fujita N, Nagata Y, Nishiuchi T, Sato M, Iwami M, Kiya T (2013) Visualization of neural activity in insect brains using a conserved immediate early gene, Hr38. Curr Biol 23:2063–70 10.1016/j.cub.2013.08.051 [DOI] [PubMed] [Google Scholar]
  • 34.Singh AS (2014) Genetic predominance of autism spectrum disorder and finding the risk genes. OA Autism 08;2:8. [Google Scholar]

Decision Letter 0

James C Nieh

14 Oct 2019

PONE-D-19-23918

Immediate early gene kakusei plays a role in the daily foraging and learning of honey bees

PLOS ONE

Dear Dr Singh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Although Reviewer 1 recommended rejection, I feel that you could address these concerns, particularly the ones about overstating your curent findings (see comments of Reviewer 2 as well) and better acknowledging and placing your work in the context of prior work with this gene and similar genes (see Reviewer 1 comments). Both reviewers will be invited to re-review your submission.

We would appreciate receiving your revised manuscript by Nov 28 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

James C. Nieh, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Our internal editors have looked over your manuscript and determined that it may be within the scope of our Neuroscience of Reward and Decision Making Call for Papers. This collection of papers is headed by a team of Guest Editors for PLOS ONE: Stephanie Groman, Satoshi Ikemoto, Jane Taylor and Robert Whelan. With this Collection we hope to bring together researchers working on a wide range of disciplines, from animal subjects research, computational approaches and patient-centered research. Additional information can be found on our announcement page: https://collections.plos.org/s/reward-and-decision-making. If you would like your manuscript to be considered for this collection, please let us know in your cover letter and we will ensure that your paper is treated as if you were responding to this call. Agreeing to be part of the call-for-papers will not affect the date your manuscript is published. If you would prefer to remove your manuscript from collection consideration, please specify this in the cover letter.

3. Please include your tables as part of your main manuscript and remove the individual files. Please note that supplementary tables (should remain/ be uploaded )as separate "supporting information" files

4. Thank you for stating that “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript” in your financial disclosure.

Please also provide the name of the funders of this study (as well as grant numbers if available) in your financial disclosure statement.

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

5.  Please amend your Data availability statement to indicate exactly where the data can be found, and how other researchers can go about obtaining the dataset. Please include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Please amend your Data availability statement to indicate where the data can be found, and how other researchers can go about obtaining the dataset.

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This study analyzed the expression time-course of immediate early gene (IEG) kakusei, which encodes a non-coding RNA, during repetitive foraging flights of honeybee workers. The analysis of neural IEGs including kakusei would give insight into molecular mechanisms underlying honeybee foraging. However, I think that the present study contains some serious problems.

As the authors mentioned, the experimental design in this study is totally the same as it described in their previous study, which analyzed the other IEGs, egr-1 and Hr38. Although the authors assert that “the expansion of previous study”, I think that this is only “reuse”. Furthermore, in conlusion section, the authors note that “The present finding on recently discovered IEG kakusei is an addition into the circle, thus increases the number of IEGs and ultimately more IEG choices available that could be used as search tool in finding molecular and cellular signaling underlying social behaviors, using honey bee foraging as model system.” However, some previous studies (e.g., Kiya et al. 2011, Ugajin et al. 2018, and Sommerlandt et al. 2018) have already discussed this point. It is difficult for me to find what this study newly provides to the field of behavioral and/or molecular biology of honeybees.

I am also afraid that this manuscript contains a lot of overstating.

For example,

• Title: kakusei plays a role in ~

• Abstract: this study describes a fundamental role of the IEG kakusei ~

• Discussion: unraveling its role~, further examined the function of ~

This study does not perform any functional analysis of kakusei, but only examines the correlation between kakusei expression and time-course of foraging flight or food reward. The authors should entirely adjust the tone of their argument.

Moreover, in discussion section, the authors mention as if kakusei involves in the process of associative learning (“this finding of kakusei involvement in learning and memory”). Shorter span upregulation of kakusei during the unrewarded foraging experiment only indicates the relationship between sustained kakusei expression and food reward. There are other possible factors resulting in the low level induction of kakusei during the unrewarded foraging, such as a lack of dance behavior, and lower motivation to fly toward the empty feeder. Further experiment (e.g. PER experiment) is needed to examine an involvement of IEG expression in associative learning.

Minor points:

The results of statistical analysis described in TableS1 are not correctly reflected in Figure1.

Although text says that there is no significant difference among three independent trials of before/after/start foraging experiment, Figure2B still have asterisk symbols.

Gene name should be italicized (Title!).

Von Frisch ---> von Frisch

What does “09.00 hrs later” mean? 9 hours later? Or 9:00PM? Sampling time and procedure is very important for this study.

Reviewer #2: Review for: Immediate early gene kakusei plays a role in the daily foraging and learning of honey bees

This paper is about a non-coding gene, kakusei, that is found in the honey bee brain that seems to play a role in foraging and receiving reward. Generally, the authors collect bees after they have foraged for the day, before they have started foraging for the day, at different time points during their foraging day, at different time points during a time-shifted foraging day, and as they forage but get no reward. The authors find that this gene is upregulated as bees locate food, and if food continues to be found, but is quickly downregulated when there is no food, and is downregulated slowly if food is provided over time. It does not seem to be associated with time-shifted foraging. Overall, I believe the authors present very interesting results, and illustrate a relatively new area of behavioral genetics that deserves attention. However, the manuscript is confusing at times. Further, the authors overstate their results, as they do not test whether kakusei is related to associative learning, just with food reward during foraging. I have made suggestions for changes can be implemented to help the reader (especially readers who are not experts in this field) follow along.

Introduction

Line numbers would be helpful for review.

The introduction beginning with such a strong emphasis on waggle dance lead me to think it was going to be about waggling – although the authors do not examine the waggle dance in relation to kakusei regulation. The authors can give an overview of foraging behavior with short background of the waggle dance, but not such a large portion of the first paragraph.

I suggest breaking up the third paragraph. It has a lot of important information – especially for non-molecular biologists - but is long. A natural break could be right before “In our recent work…”

From the MS: “The IEG c- jun (also known as jun-related antigen, jra in fruit fly) and egr-1 have been used as neuronal markers for the identification in honey bees of specific brain regions involved in the time memory as well as in, innate and learned behaviours [17,18,19].”

This sentence seems a little grammatically off to me – I think the comma before innate is unnecessary

Methods

Methods are clear and concise.

What brand and type of paint markers was used to mark bees?

How many colonies were involved in the experiment? Are they represented across all experiments and samples?

Statistical analysis are effective for these data.

Controls with other IEGs and orthologs are effective.

Single-cohort age-matched bees would be best to use in experiments like these.

Results

Please report statistical analysis performed with stated p-value.

From the MS: “This result demonstrates that Kakuei is involved in associative learning.”

You have not shown that this gene is upregulated in associative learning – another test of associative learning, such as PER, needs to be performed before that conclusion can be made. Kakusei seems to be involved with reward during foraging, but not necessarily with learning. Also Kakusei is spelled incorrectly in that sentence.

Discussion

The link to associative learning has not been established with this study, and I suggest reducing the confidence of this language.

I agree that you have shown this, quoted from the MS: “This indicates that food reward is essential for the increase and sustaining of higher kakusei levels during foraging,…”

I do not agree that you have shown this: “…thus underlying the role of kakusei in associative learning during foraging.”

You have not shown that honey bees are in fact learning during your assay.

One experiment I would love to see to disentangle whether kakusei is upregulated when bees receive a reward or have learned is by doing PER on age matched foragers in the lab that haven’t foraged – and maybe to even see if it’s associated with strength of reward. It is a very easy test and would allow you to make the conclusions about learning.

From the MS: Thereby the hidden mechanisms of social behavior in honey bees could be opened up and mapped which could be further translated to higher animals and man [28].

Again, some of the language is unclear: Mechanisms are not hidden – aspects to gene function like non-coding regions are just now being discovered with relatively new techniques, which is really cool! Also, this hierarchical language of "higher animals" is not helpful in a scientific paper – “cognitively complex” would be a more accurate way to describe some animals (although bees are very cognitively complex). Also please use “humans” instead of “man”, although it is redundant after stating more cognitively complex animals.

Figures

Figures are effective and relatively clear.

In figure 2, I suggest using more descriptive X axis labels – I had to go back to the results to remind myself which experiment was which (although they are not clearly labeled experiment 1,2, and 3 there either). I suggest: During Foraging, Unrewarded Foraging, Time-Shifted Foraging. A and B labels are also missing.

For all figures, do the colors mean anything? I suggest to color-code by experiment, and keep it consistent though the two figures. Also explicitly state this in figure legends

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 May 6;15(5):e0222256. doi: 10.1371/journal.pone.0222256.r002

Author response to Decision Letter 0


28 Jan 2020

We are very grateful to the reviewers for the great effort in thorough reading of the manuscript and for providing valuable comments and suggestions that help to increase the quality of the manuscript.

The answers to the comments of the reviewers are given in the following:

Reviewer #1: This study analyzed the expression time-course of immediate early gene (IEG) kakusei, which encodes a non-coding RNA, during repetitive foraging flights of honeybee workers. The analysis of neural IEGs including kakusei would give insight into molecular mechanisms underlying honeybee foraging. However, I think that the present study contains some serious problems. As the authors mentioned, the experimental design in this study is totally the same as it described in their previous study, which analyzed the other IEGs, egr-1 and Hr38. Although the authors assert that “the expansion of previous study”, I think that this is only “reuse”.

Ans: The reviewer has pointed out very correctly. It is true that our experimental design in this study is same with that of the previous study. The samples that we used are also same; so, to say “reuse” is a correct word at this point. On the other hand, investigating kakusei and the other 5 new genes which we have not studied before to the same experimental design set up is what we mean to “expansion to the previous study”. To enclose reviewer’s comment we have inserted “the same samples have been reused in this study, in the method section line no. 107.

Thus we have also mentioned in discussion section a possible connection with kakusei and the two genes egr-1 and hr38 of the previous report.

Furthermore, in conlusion section, the authors note that “The present finding on recently discovered IEG kakusei is an addition into the circle, thus increases the number of IEGs and ultimately more IEG choices available that could be used as search tool in finding molecular and cellular signaling underlying social behaviors, using honey bee foraging as model system.” However, some previous studies (e.g., Kiya et al. 2011, Ugajin et al. 2018, and Sommerlandt et al. 2018) have already discussed this point. It is difficult for me to find what this study newly provides to the field of behavioral and/or molecular biology of honeybees.

Ans: We have adjusted the tone adding the first line in discussion section citing 4 references, and also modification is made in the conclusion section. Moreover we have cited more reference at the last part of the discussion section.

I am also afraid that this manuscript contains a lot of overstating.

For example,

• Title: kakusei plays a role in ~

Ans: We have added potentially to neutralize the overstatement, in the title.

• Abstract: this study describes a fundamental role of the IEG kakusei ~

Ans: We have substituted the word “fundamental” to “possible”, line no. 17.

• Discussion: unraveling its role~, further examined the function of ~ This study does not perform any functional analysis of kakusei, but only examines the correlation between kakusei expression and time-course of foraging flight or food reward. The authors should entirely adjust the tone of their argument.

Ans: We have also adjusted this tone by replacing “unraveling” with “suggesting” line no. 260, and the “function” by “possible role” line no. 267.

Moreover, in discussion section, the authors mention as if kakusei involves in the process of associative learning (“this finding of kakusei involvement in learning and memory”). Shorter span upregulation of kakusei during the unrewarded foraging experiment only indicates the relationship between sustained kakusei expression and food reward. There are other possible factors resulting in the low level induction of kakusei during the unrewarded foraging, such as a lack of dance behavior, and lower motivation to fly toward the empty feeder. Further experiment (e.g. PER experiment) is needed to examine an involvement of IEG expression in associative learning.

Ans: We have removed “associative” word from the entire text of the manuscript. We are very interested to do PER experiment. However, as all the authors currently work at different places on different projects, we are not able to predict when the facilities will be available to do this experiment. But this experiment is one of our priorities in the future plan.

Minor points:

The results of statistical analysis described in TableS1 are not correctly reflected in Figure1.

Ans: We have corrected in the figure.

Although text says that there is no significant difference among three independent trials of before/after/start foraging experiment, Figure2B still have asterisk symbols.

Ans: We have corrected. The result of the Fig 1 analysis was also mistakenly re-written there. What we wanted to write was the similarity between Fig 1 and Fig 2. We have reconstructed the sentence for more clarity.

Gene name should be italicized (Title!).

Ans: We have corrected.

Von Frisch ---> von Frisch

Ans: We have corrected.

What does “09.00 hrs later” mean? 9 hours later? Or 9:00PM? Sampling time and procedure is very important for this study.

Ans: We have changed to 18.00 hours, line no. 124.

Reviewer #2: Review for: Immediate early gene kakusei plays a role in the daily foraging and learning of honey bees

This paper is about a non-coding gene, kakusei, that is found in the honey bee brain that seems to play a role in foraging and receiving reward. Generally, the authors collect bees after they have foraged for the day, before they have started foraging for the day, at different time points during their foraging day, at different time points during a time-shifted foraging day, and as they forage but get no reward. The authors find that this gene is upregulated as bees locate food, and if food continues to be found, but is quickly downregulated when there is no food, and is downregulated slowly if food is provided over time. It does not seem to be associated with time-shifted foraging. Overall, I believe the authors present very interesting results, and illustrate a relatively new area of behavioral genetics that deserves attention. However, the manuscript is confusing at times. Further, the authors overstate their results, as they do not test whether kakusei is related to associative learning, just with food reward during foraging. I have made suggestions for changes can be implemented to help the reader (especially readers who are not experts in this field) follow along.

Ans: We appreciate for the kind words. We have removed “associative” word throughout the text of the manuscript.

Introduction

Line numbers would be helpful for review.

Ans: We have added line numbers this time.

The introduction beginning with such a strong emphasis on waggle dance lead me to think it was going to be about waggling – although the authors do not examine the waggle dance in relation to kakusei regulation. The authors can give an overview of foraging behavior with short background of the waggle dance, but not such a large portion of the first paragraph.

Ans: We have reduced the length of the sentence to about half from the previous one, line no. 35-36.

I suggest breaking up the third paragraph. It has a lot of important information – especially for non-molecular biologists but is long. A natural break could be right before “In our recent work…”

Ans: We have broken the paragraph right before “in our recent work” line no. line 65.

From the MS: “The IEG c- jun (also known as jun-related antigen, jra in fruit fly) and egr-1 have been used as neuronal markers for the identification in honey bees of specific brain regions involved in the time memory as well as in, innate and learned behaviours [17,18,19].”

This sentence seems a little grammatically off to me – I think the comma before innate is unnecessary.

Ans: We have removed the coma accordingly, line no. 75.

Methods Methods are clear and concise.

Ans: We appreciate for the complement.

What brand and type of paint markers was used to mark bees?

Ans: It is Uni POSCA Paint Markers (Uni Mitsubishi Pencil, UK). We have mentioned this also in the method section, line no. 118.

How many colonies were involved in the experiment? Are they represented across all experiments and samples?

Ans: We have use two colonies. The colony 1 was used for experiment 1 and 2, and colony 2 was used for experiment 3. For further clarity in the manuscript, we have also inserted this in the result section, line no. 177-179.

Statistical analysis are effective for these data.

Ans: We appreciate for the complement.

Controls with other IEGs and orthologs are effective.

Ans: We have done for c-jun another IEG but we found no difference. It is shown in supplementary figure. In our future work we will take it seriously to add more ortholog genes.

Single-cohort age-matched bees would be best to use in experiments like these.

Ans: We very much agree to it. It may be done by marking the bees from the larval stage. In our future experiment we will prioritize to it.

Results

Please report statistical analysis performed with stated p-value.

Ans: More statistics P-values are reported in the text, line no. 193, 228, 231, 243.

From the MS: “This result demonstrates that Kakuei is involved in associative learning.”

You have not shown that this gene is upregulated in associative learning – another test of associative learning, such as PER, needs to be performed before that conclusion can be made. Kakusei seems to be involved with reward during foraging, but not necessarily with learning. Also Kakusei is spelled incorrectly in that sentence.

Ans: We have removed “associative” word from the entire text of the manuscript. We are very interested to do PER experiment. However, as all the authors currently work at different places on different projects, therefore we are not able to predict when the facilities will be available to do this experiment. But this experiment is one of our priorities in the future plan. kakusei spelling is also corrected.

Discussion

The link to associative learning has not been established with this study, and I suggest reducing the confidence of this language.

Ans: We have removed “associative” word from the entire text of the manuscript.

I agree that you have shown this, quoted from the MS: “This indicates that food reward is essential for the increase and sustaining of higher kakusei levels during foraging,…”

I do not agree that you have shown this: “…thus underlying the role of kakusei in associative learning during foraging.” You have not shown that honey bees are in fact learning during your assay.

Ans: We have removed “associative” word from the entire text of the manuscript.

The feeder plate usually contain feeder, but bees still arrived and landed on the feeder plate even when the empty plate was placed. We paint marked the bees at the first arrival, and they still continue to come to the feeder though fewer and fewer, they might be expecting they would be rewarded, thus we were able to collect the samples until 60min, without rewarding food. Since, we observed significantly increased kakusei level from t0 to t15, but reduced after 15min as there was continuous unrewarded of food, we assumed that the bees were motivated to food reward which they experienced previously. If this explanation is still unsatisfactory, we will consider removing learning also from the entire manuscript.

One experiment I would love to see to disentangle whether kakusei is upregulated when bees receive a reward or have learned is by doing PER on age matched foragers in the lab that haven’t foraged – and maybe to even see if it’s associated with strength of reward. It is a very easy test and would allow you to make the conclusions about learning.

Ans: We have removed “associative” word from the entire manuscript. We are very interested to do PER experiment. However, as all the authors currently work at different places on different projects, therefore we are not able to predict when the facilities will be available to do this experiment. But this experiment is one of our priorities in the future plan. kakusei spelling is also corrected.

From the MS: Thereby the hidden mechanisms of social behavior in honey bees could be opened up and mapped which could be further translated to higher animals and man [28].

Again, some of the language is unclear: Mechanisms are not hidden – aspects to gene function like non-coding regions are just now being discovered with relatively new techniques, which is really cool!

Ans: We have removed “hidden”. We appreciate for the complement.

Also, this hierarchical language of "higher animals" is not helpful in a scientific paper – “cognitively complex” would be a more accurate way to describe some animals (although bees are very cognitively complex). Also please use “humans” instead of “man”, although it is redundant after stating more cognitively complex animals.

Ans: We have followed the good advice and changed accordingly, line no. 307.

Figures

Figures are effective and relatively clear.

Ans: We appreciate for the complement.

In figure 2, I suggest using more descriptive X axis labels – I had to go back to the results to remind myself which experiment was which (although they are not clearly labeled experiment 1,2, and 3 there either). I suggest: During Foraging, Unrewarded Foraging, Time-Shifted Foraging. A and B labels are also missing.

Ans: We have made it clearer in the legends to the figure and also we have changed the color pattern for easier viewing. We have also labeled experiment 1, 2 and 3 more clearly on the figure and the same is reflected on the results. We have also labeled A and B in Fig 2 which was missing earlier.

For all figures, do the colors mean anything? I suggest to color-code by experiment, and keep it consistent though the two figures. Also explicitly state this in figure legends

Ans: We have changed the color pattern in the Fig 1, three different colors for three experiments, same color for both A and B for each experiment. We have also mentioned color representations in the figure legends.

Attachment

Submitted filename: Response to the reviewers.docx

Decision Letter 1

James C Nieh

19 Feb 2020

PONE-D-19-23918R1

Immediate early gene kakusei potentially plays a role in the daily foraging and learning of honey bees

PLOS ONE

Dear Dr Singh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please address the comments of both reviewers, particularly the recommendation of reviewer 1 about linking kakusei expression to learning.

We would appreciate receiving your revised manuscript by Apr 04 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

James C. Nieh, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: No

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors generally addressed my comments except for PER experiment. But they carefully adjusted the tone related to the role of kakusei for learning and memory throughout the revised manuscript. Unfortunately, there are still inconsistency between Figure1 and TableS1. For example, regarding experiment 1A, are there significant differences in kakusei expression only “t0 vs t15” and “t15 vs t30”? Please correct Figure1 precisely.

Reviewer #2: The explanation of learning is still not satisfactory. The authors have not fully tested the hypothesis that expression of kakusei is associated with learning. Changes in expression seen in this article could be due to a number of things – such as sensory reception of food or floral cues, digestion, navigation, etc. – which is still interesting! BUT much more work has to be done to link kakusei expression to learning. It is fine to propose in the intro and discussion, but it’s not explicitly tested here. I highly recommend removing any language about learning until it is explicitly tested.

The figures also seem to be low resolution – some of the letters and shapes are difficult to read.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 May 6;15(5):e0222256. doi: 10.1371/journal.pone.0222256.r004

Author response to Decision Letter 1


7 Mar 2020

Reviewer #1: The authors generally addressed my comments except for PER experiment. But they carefully adjusted the tone related to the role of kakusei for learning and memory throughout the revised manuscript. Unfortunately, there are still inconsistency between Figure1 and TableS1. For example, regarding experiment 1A, are there significant differences in kakusei expression only “t0 vs t15” and “t15 vs t30”? Please correct Figure1 precisely.

Ans: PER has been addressed in line no. 284-285 in this revision. Regarding the placing of asterisk symbols for all the significant differences in the figure 1, we have considered only the adjacent time points such as t0 vs t15” and “t15 vs t30, as noted by the reviewer; that is, we have not shown all the significant differences on the figure. This is for the reason that we wanted to show a clean figure as per the need of the description in the result and for further detail presentation of all the significant differences, Table S1 has been created. Nonetheless, we have also tried following the suggestion of the reviewer. However, we have kept the figure without changing the earlier form, because of the congestion of the lines, as shown below

Reviewer #2: The explanation of learning is still not satisfactory. The authors have not fully tested the hypothesis that expression of kakusei is associated with learning. Changes in expression seen in this article could be due to a number of things – such as sensory reception of food or floral cues, digestion, navigation, etc. – which is still interesting! BUT much more work has to be done to link kakusei expression to learning. It is fine to propose in the intro and discussion, but it’s not explicitly tested here. I highly recommend removing any language about learning until it is explicitly tested. The figures also seem to be low resolution – some of the letters and shapes are difficult to read.

Ans: We have diluted about the learning in the discussion to a great extend and we have added our future work plans to give a conclusive comment on it. The changes are made at line nos., 272-274, 282-286 and 300-302. We are also very grateful to the editor’s advice in this regard. We would like to do further changes if it is needed.

We have made the figures more clear this time.

Attachment

Submitted filename: Response to the Reviewers 3.docx

Decision Letter 2

James C Nieh

13 Mar 2020

PONE-D-19-23918R2

Immediate early gene kakusei potentially plays a role in the daily foraging and learning of honey bees

PLOS ONE

Dear Dr Singh,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please remove the words "and learning" from the manuscript title. 

We would appreciate receiving your revised manuscript by Apr 27 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

James C. Nieh, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The title still contains the word "learning" which should be removed to reflect the changes in the manuscript.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 May 6;15(5):e0222256. doi: 10.1371/journal.pone.0222256.r006

Author response to Decision Letter 2


18 Mar 2020

Dear Editor,

We are very grateful to you and to the reviewers for providing valuable comments and suggestions and advices that help to increase the quality of the manuscript for the publication in your reputed journal PLOS ONE.

The answer to the comment of the reviewer is given as below:

Reviewer #2: The title still contains the word "learning" which should be removed to reflect the changes in the manuscript.

Edotor: Please remove the words "and learning" from the manuscript title

Ans: “and Learning” have been removed from the manuscript title.

Attachment

Submitted filename: Response to the Reviewers 4.docx

Decision Letter 3

James C Nieh

20 Mar 2020

Immediate early gene kakusei potentially plays a role in the daily foraging of honey bees

PONE-D-19-23918R3

Dear Dr. Singh,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

James C. Nieh, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

James C Nieh

9 Apr 2020

PONE-D-19-23918R3

Immediate early gene kakusei potentially plays a role in the daily foraging of honey bees 

Dear Dr. Singh:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. James C. Nieh

%CORR_ED_EDITOR_ROLE%

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig

    Gene expression profile for c-Jun (A), Dop1 (B), GluR (C), Erk7 (D) and 5-HT2α during the daily foraging of honey bees.

    (DOCX)

    S1 Table. Summarized result for three replicate experiments of kakusei.

    (DOCX)

    S2 Table. Summarized result for time trained feeding effect and unrewarded foraging on kakusei expression.

    (DOCX)

    Attachment

    Submitted filename: Response to the reviewers.docx

    Attachment

    Submitted filename: Response to the Reviewers 3.docx

    Attachment

    Submitted filename: Response to the Reviewers 4.docx

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES