Skip to main content
PLOS One logoLink to PLOS One
. 2020 May 6;15(5):e0232694. doi: 10.1371/journal.pone.0232694

Effects of iron deficiency and exogenous sucrose on the intermediates of chlorophyll biosynthesis in Malus halliana

Aixia Guo 1,2, Ya Hu 1,2, Mingfu Shi 1, Hai Wang 1, Yuxia Wu 1, Yanxiu Wang 1,*
Editor: Basharat Ali3
PMCID: PMC7202898  PMID: 32375166

Abstract

Malus halliana is an iron (Fe)-efficient apple rootstock growing in calcareous soil that shows obvious ‘greenness’ traits during Fe deficiency. Recent studies have shown that exogenous sugars can be involved in abiotic stress. To identify the key regulatory steps of chlorophyll (Chl) biosynthesis in M. halliana under Fe deficiency and to verify whether exogenous sucrose (Suc) is involved in Fe deficiency stress, we determined the contents of the Chl precursor and the expression of several Chl biosynthetic genes in M. halliana. The results showed that Fe deficiency caused a significant increase in the contents of protoporphyrin IX (Proto IX), Mg-protoporphyrin IX (Mg-Proto IX) and protochlorophyllide (Pchlide) in M. halliana compared to the Fe-sensitive rootstock Malus hupehensis. Quantitative real-time PCR (RT-qPCR) also showed that the expression of protoporphyrinogen oxidase (PPOX), which synthesizes Proto IX, was upregulated in M. halliana and downregulated in M. hupehensis under Fe deficiency. Exogenous Suc application prominently enhanced the contents of porphobilinogen (PBG) and the subsequent precursor, whereas it decreased the level of δ-aminolaevulinic acid (ALA), suggesting that the transformation from ALA to PBG was catalyzed in M. halliana. Additionally, the transcript level of δ-aminolevulinate acid dehydratase (ALAD) was noticeably upregulated after exogenous Suc treatment. This result, combined with the precursor contents, indicated that Suc accelerated the steps of Chl biosynthesis by modulating the ALAD gene. Therefore, we conclude that PPOX is the key regulatory gene of M. halliana in response to Fe deficiency. Exogenous Suc enhances M. halliana tolerance to Fe deficiency stress by regulating Chl biosynthesis.

Introduction

Iron (Fe) is an essential micronutrient required by all plants [1]. Fe deficiency in plants results in severe chlorosis of leaves [2]. The application of tolerant rootstocks is an effective method to prevent chlorosis in fruit production due to Fe stress [3]. Malus halliana, an indigenous apple rootstock originating from arid saline-alkali habitats in Gansu, grows very well and shows characteristics of a Fe deficiency-tolerant rootstock. The chlorosis associated with Fe deficiency was not found in the northwest Loess Plateau of China [4].

Leaf chlorosis may be caused by deficient chlorophyll (Chl) biosynthesis [5]. Chl biosynthesis plays essential roles in photosynthesis and plant growth in response to environmental change [6]. The Chl biosynthesis pathway has many steps and involves various enzymes, and a blockade in one step will affect Chl biosynthesis and cause changes in leaf color [7]. The key regulatory sites of Chl synthesis are different for each crop under external stress. A study of adzuki bean reported that the transformation of protoporphyrin IX (Proto IX) is blocked in Chl synthesis, causing etiolated seedlings [8]. Salinity-alkalinity stress disrupted Chl synthesis by blocking the conversion of URO III to Proto IX, which reduced the Chl content in tomato [9]. Another study suggested that Chl biosynthesis is blocked in a mutant at the Chl a production step, and the expression of multiple genes related to Chl biosynthesis was downregulated in pylm [10]. A study on the effect of different light qualities of LEDs on the Chl biosynthesis precursors of nonheading Chinese cabbage showed that red plus blue LEDs enhanced Chl biosynthesis precursors [11]. Remarkably, Fe deficiency directly affected Chl synthesis [12]. Research in poplar revealed that Chl synthesis was inhibited under Fe-deficient conditions [13]. Spiller et al. attempted to study the effect of Fe on the Chl biosynthetic pathway, and the results indicated that Fe deficiency leads to the accumulation and excretion of intermediates in the tetrapyrrole biosynthetic pathway, particularly coproporphyrin [14]. Moreover, an investigation was initiated to locate possible sites where a deficiency of Fe might limit Chl synthesis of cowpea plants [2]. However, the responses of Chl biosynthesis to Fe deficiency stress and the key regulatory sites in M. halliana are still unknown.

Sucrose (Suc) is the major sugar that plants assimilate in photosynthesis and transport to various nonphotosynthetic tissues; it was not only originally recognized as an energy source for metabolism but also functions as a signaling molecule involved in the regulation of various physiological processes in plants [15–18]. Increased accumulation of Suc is a critical requirement for the adaptation of plants to stresses [19, 20]. Higher accumulation of soluble sugars in roots increases the resistance of maize plants to salt-induced osmotic stress [21]. Increased Suc accumulation is required for the regulation of Fe deficiency responses in Arabidopsis plants [22]. However, little is known about how exogenous Suc regulates the response of M. halliana to Fe deficiency through Chl synthesis.

Studies of Chl biosynthesis have focused on various aspects [23, 24], whether biochemical [25, 26] or genetic [27, 28]. However, gaps remain in the knowledge of Chl biosynthesis and the related genes in apple rootstocks. Therefore, it is important to elucidate the Chl biosynthetic molecular responses of M. halliana to Fe deficiency. In this article, we characterized the Chl biosynthetic pathway and gene expression patterns of protoporphyrin IX and porphobilinogen precursor formation in M. halliana under Fe deficiency and exogenous Suc. This study provides a foundation for improved understanding of Fe tolerance responses in apples and gives insights into the functional characterization of Fe resistance genes.

Materials and methods

Plant materials and treatment of iron deficiency

Seeds of M. halliana and M. hupehensis (provided by Lanzhou, Gansu Province, China) were surface-sterilized in 0.2% KMnO4 for 30 min and then washed with running water for 12 h. Seeds were subsequently stratified at 4°C sand for 40 d, and germinated seeds were directly sown into plastic pots filled with substrates. Seedlings with eight true leaves were employed as test materials. Uniform seedlings were transferred to foam boxes filled with half-strength Han’s nutrient solution [29] for preculture. The nutrient solution was aerated and renewed every 7 d. After 14 d, the seedlings were transferred to Han’s nutrient solution that contained either 4 μM (-Fe) or 40 μM Fe (Ⅲ)-EDTA (CK). After 0, 0.5, 3, 6 and 12 d of Fe deficiency, the leaves were used to measure Chl precursors. However, according to transcriptome data analysis [30], the relative expression of related genes was assayed after 0, 0.5 and 3 d of Fe deficiency.

Exogenous sucrose treatments

Eight-true-leaf M. halliana seedlings were uniformly transferred to foam boxes with half-strength Han’s nutrient solution for 14 d to adapt to the environment for hydroponic cultivation. After 14 d of Fe deficiency, the uniform seedlings were transferred to Han’s nutrient solution containing 4 μM Fe, 40 μM Fe, 2 mM Suc [22] and 40 μM Fe mixed with 2 mM Suc. Therefore, this part of the experiment included six treatments: T1 (-Fe 0 d), T2 (-Fe 14 d), T3 (-Fe 21d), T4 (-Fe 14 d +Fe 7 d), T5 (-Fe 14 d +Suc 7 d), T6 (-Fe 14 d + (Fe +Suc) 7 d). Leaf samples were collected at different times, frozen immediately in liquid nitrogen, and stored in the refrigerator at -80°C until needed.

Determination of chlorophyll precursors

δ-aminolaevulinic acid (ALA) was determined as described by Morton [31]. Porphobilinogen (PBG) and Uroorphyinogen III (URO III) were measured according to Bogorad [32]. Protoporphyrin IX (Proto IX), Mg-protoporphyrin IX (Mg-Proto IX), and Protochlorophyllide (Pchlide) were assayed following the method of Hodgins and Van Huystee [33].

RNA isolation and real-time PCR

Total RNA was isolated using a TRIzol kit (Invitrogen, Carlsbad, CA, USA). After extraction, the RNA quality was measured by gel electrophoresis using 1% agarose gel. For real-time PCR (RT-qPCR) analysis, cDNA was synthesized from total RNA using the PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa, Dalian, China) according to the manufacturer's instructions. RT-qPCR was performed with a DNA Engine Opticon System using a Light Cycler® 96 Instrument (Roche, Shanghai, China). GAPDH was used as a reference gene. Measurements for each plate were replicated three times. The relative gene expression levels were calculated using the 2-ΔΔCt method. RT-qPCR primer pairs are tabulated in Table 1.

Table 1. Primers used for RT-qPCR.

Gene name Gene ID Primer sequence (5'-3')
Forward primer Reverse primer
ALAD 103423306 GCGTTGTCATGGAGTCCTGATGG CCAGTTGGCGACCACTTCAGC
PBGD 103423833 CCTTGCAACCTTCCGCGAGAG TCAGCCGTGTCTGGACGTTACC
UROS 103455996 CCACCTTCTTGTCCGCCACTTC TTGCTGTTCTTGCCGTGCTCTC
UROD 103444879 AGGTAGAAGGCGACTGGGAC CCCTCTACCGGCTTTCCTCA
PPOX 103444480 TTCTGTTGACTGCGTGGTGGTG GGTGTCGCCGTGCTTGGTAG
CHLH 103456287 AATACCAAAGCCTAACTCC AACAGCAGCCTCATCG
MgPMT 103454888 AAAACCTACCACCCTAAA CTTCACCACCTCCTTGT
MPE 103454703 CTTTGCTCTGCGTTGT GCTGTGGTGCGATTT

Statistical analysis

All data were analyzed with SPSS version 22.0 for Windows (IBM, Armonk, NY, USA). Graphs were generated using the Origin 9.0 software (Origin Lab, Hampton, MA, USA). The results are presented as the means of three independent experiments.

Statistical analysis of parameters was tested by analysis of variance and mean comparison was performed with a Duncan's test (P <0.05)

Results

Effects of iron deficiency on the chlorophyll precursor contents of M. halliana and M. hupehensis

As shown in Fig 1, the contents of six precursors in M. halliana were noticeably higher than those in M. hupehensis. From 0 to 12 d of Fe deficiency, the contents of ALA, PBG and URO III of the two apple rootstocks increased (Fig 1A, 1B and 1C). However, the levels of Proto IX, Mg-Proto IX, and Pchlide in M. halliana were generally increased but decreased in M. hupehensis. Moreover, the levels in M. halliana were approximately 2-fold those in M. hupehensis (Fig 1D, 1E and 1F). Therefore, we hypothesized that the regulatory site of Chl biosynthesis in M. halliana affected Fe deficiency was the transformation from URO III to Proto IX.

Fig 1. Effects of Fe deficiency on Chl precursor contents in the leaves of M. halliana and M. hupehensis.

Fig 1

The seedlings underwent Fe deficiency for 0, 0.5, 3, 6, and 12 d as indicated. (a) ALA content. (b) PBG content. (c) URO III content; (d) Proto IX content. (e): Mg-Proto IX content. (f): Pchlide content. Vertical bars represent the mean ± SD value from three temporal replicates (n = 3).

Expression of genes involved in chlorophyll biosynthesis under iron deficiency

To prove the validity of the above hypothesis and gain insight into the key genes of M. halliana in response to Fe deficiency, we determined the relative expression levels of 8 genes related to Chl synthesis under Fe deficiency. Fig 2 shows that the relative levels of genes in M. halliana were dramatically higher than those in M. hupehensis. The relative levels of the δ- aminolevulinate acid dehydratase (ALAD), porphobilinogen deaminase (PBGD) and uroporphyrinogen III synthase (UROS) genes in M. halliana and M. hupehensis increased first and then dropped, peaking on 0.5 d, and the expression was no more than 3 in both groups. (Fig 2A, 2B and 2C). Thereafter, at 0.5 d, the relative levels of Uroporphyrinogen decarboxylase (UROD) and Protoporphyrinogen IX oxidase (PPOX) in M. halliana increased quickly, especially the expression of PPOX, which was approximately 75 in M. halliana instead of no more than 1 in M. hupehensis (Fig 2D and 2E). These results suggested that PPOX was responsive mainly to stresses and could improve resistance to Fe deficiency. Subsequently, the relative expression of genes in M. halliana, such as Magnesium chelatase (Subunit CHLH), Magnesium-protoporphyrin IX methyltransferase (MgPMT), and Mg-protoporphyrin IX monomethyl ester cyclase (MPEs), exhibited a gradually increasing trend during stress at 0–3 d (Fig 2F, 2G and 2H). These results were consistent with the Chl precursor analysis.

Fig 2. Expression pattern of eight genes in response to Fe deficiency in M. halliana and M. hupehensis.

Fig 2

(a)Expression of ALAD. (b) Expression of PBGD. (c) Expression of UROS. (d) Expression of UROD. (e) Expression of PPOX. (f) Expression of CHLH. (g) Expression of MgPMT. (h) Expression of MPE. Data are expressed as the mean ± SD (n = 3). The different letters and an asterisk show significant differences between the two apple rootstocks at each time point (P < 0.05).

Regulation of the iron deficiency phenotype by exogenous sucrose

We found that the leaves of M. halliana initially showed chlorosis symptoms after 12 d of Fe deficiency, and one of the important reasons was believed to be the loss of Suc or Fe. To investigate the effects of exogenous Suc on the phenotype of M. halliana seedlings, we conducted phenotype analysis of plants grown hydroponically in Suc-and Fe-sufficient and Fe-deficient conditions (Fig 3). The phenotype revealed that differences still existed. After 21 d of growth in Fe-deficient conditions (T3), the leaves of the plants exhibited more severe chlorosis symptoms than those of the plants treated with T4, T5, and T6. Additionally, the plants supplied with Suc and Fe (T6) showed pale green leaves compared with those under the T4 and T5 treatments. The Suc-supplied leaves (T5) were greener than the Fe-supplied leaves (T4). As a result, leaf chlorosis was ameliorated by Suc application. These results showed that the tolerance of Fe deficiency of M. halliana was positively regulated by Suc.

Fig 3. Effects of exogenous Suc on the phenotype of leaves from M. halliana.

Fig 3

T3: -Fe 21 d (Fe deficiency 21 d). T4: -Fe 14 d + Fe 7 d (applied Fe after 14 d of Fe deficiency). T5: -Fe 14 d + Suc 7 d (applied Suc after 14 d of Fe deficiency). T6: -Fe 14 d+ (Fe + Suc) 7 d (applied Fe and Suc after 14 d of Fe deficiency).

Effects of exogenous sucrose on the chlorophyll precursor contents in M. halliana

As shown in Fig 3, exogenous Suc may also be required for regulating the tolerance of Fe deficiency in M. halliana. Chlorosis was attributable to the reduction of Chl content causing defects in Chl biosynthesis. We determined the contents of the Chl precursors of the six treatments. Compared with the T3 treatment, the T5 treatment resulted in a clear decrease in the ALA level (Fig 4A) but increased the contents of PBG and URO III. (Fig 4B and 4C). The Chl intermediates Mg-Proto IX and Pchlide under T5 treatment were not significantly different from those under the other treatments (Fig 4D, 4E and 4F). The transformation of ALA to PBG and PBG to URO III was enhanced after application of Suc. As a result, after the application of exogenous Suc, the regulatory step of Chl precursor synthesis in M. halliana affected by Fe deficiency might be the conversion of ALA to PBG, suggesting this process was enhanced.

Fig 4. Effects of exogenous Suc on Chl precursor contents in the leaves of M. halliana.

Fig 4

(a) ALA content. (b) PBG content. (c) URO III content. (d) Proto IX content. (e) Mg- Proto IX content. (f) Pchlide content. Data are the mean ± SD (n = 3). Different letters indicate significant differences among treatments (P < 0.05).

Comparison of gene expression in M. halliana after sucrose application

Given that exogenous Suc catalyzed the steps of Chl biosynthesis, we wanted to test the effects of exogenous Suc on the relative expression levels of related genes. As shown in Fig 5, compared with the other treatments, T5 significantly enhanced the expression of ALAD, PBGD and UROS (Fig 5A, 5B and 5C), consistent with a change in the corresponding precursor contents (Fig 4). Therefore, the expression of ALAD was significantly upregulated by the Suc treatment under Fe-deficient conditions. Nevertheless, for the other five genes, their expression levels not affected by the application of exogenous Suc, Fe or Suc and Fe. Enhanced relative levels of UROD, PPOX, CHLH, MgPMT, and MPE were associated with Fe deficiency, peaking on 21 d of Fe deficiency. Therefore, Fe deficiency caused a dramatic elevation in the relative levels of the above genes.

Fig 5. Comparison of gene expression in the leaves of M. halliana under exogenous sucrose treatment.

Fig 5

(a) Expression of ALAD. (b) Expression of PBGD. (c) Expression of UROS. (d) Expression of UROD. (e) Expression of PPOX. (f) Expression of CHLH. (g) Expression of MgPMT. (h) Expression of MPE. Data are expressed as the mean ± SD (n = 3). Different letters indicate significant differences between 6 treatments (P < 0.05).

Schematic model of key genes involved in chlorophyll biosynthesis during iron deficiency and sucrose application

Overall, based on the variations in Chl precursor contents (Figs 1 and 5), gene expression (Figs 2 and 6) and phenotype characterization (Fig 3), we concluded that, under short-term stress, the key for the ‘greenness’ of M. halliana was high expression of PPOX. After long-term stress (over 12 d), M. halliana showed chlorosis symptoms.

Fig 6. The key synthetic sites of Chl biosynthesis under Fe deficiency and exogenous Suc treatment.

Fig 6

Results showed that (1) PPOX expression of M. halliana was enhanced to adapt to Fe-deficient condition. (2) Under Fe deficiency, application of exogenous Suc increased the expression of ALAD and further enhanced Chl synthesis.

Exogenous Suc can alleviate chlorosis. The accumulation of PBG precursor under Suc treatment enhanced the Chl synthesis, and the corresponding gene ALAD was up-regulated. Hence, PPOX and ALAD were key genes in mediating Fe-deficient and exogenous Suc-regulated Chl biosynthesis, respectively (Fig 6). Application of Suc could enhance the tolerance of M. halliana to Fe deficiency through improvement in Chl biosynthesis.

Discussion

Iron is an essential element for all living organisms, functioning in various cellular processes, such as Chl biosynthesis [34]. Fe deficiency is a nutritional disorder in plants, contributing to chlorosis by limiting Chl biosynthesis [35]. Disruption of any one step of Chl biosynthesis may lead to evident accumulation of the intermediates produced in previous steps, leading to disruption and substantial decreases in the amount of products produced in the subsequent steps. Previous research has found that seawater stress hinders the transformation of PBG to URO III in spinach [36]. The study showed that UV-B disrupts Chl synthesis at the point of ALA conversion to PBG [37]. In the present study, Chl synthesis at the step of URO III conversion to Proto IX indicated that Fe deficiency stress disrupted Chl biosynthesis in M. hupehensis, and the Chl biosynthesis of M. halliana was not blocked after Fe deficiency. The leaves of M. hupehensis exhibited chlorotic symptoms before M. halliana, consistent with the finding that the Chl precursor contents of M. hupehensis were significantly lower than those of M. halliana. Similar to a study on cabbage, M. halliana could maintain plant growth and preserve adequate chlorophyll synthesis under iron-limiting conditions, probably due to its better Fe-use efficiency than M. hupehensis [38]. The accumulation of chlorophyll intermediate metabolites can sometimes prevent adverse effects on M. halliana.

Protoporphyrinogen IX oxidase is the last enzyme in the common pathway of heme and chlorophyll synthesis and catalyzes the oxidation of protoporphyrinogen-IX to protoporphyrin IX by molecular oxygen [39, 40]. Research has suggested that the PbPPO1 gene might be involved in core browning under modified atmosphere storage in ‘Yali’ pears [41]. The PPO gene expression level in response to Aspergillus tubingensis in table grapes was enhanced with trehalose [42]. In this study, the relative expression of PPOX changed slightly in M. hupehensis but showed high expression levels in M. halliana, indicating that PPOX was the key gene in response to Fe deficiency in M. halliana, which lays the foundation for cloning genes responsive to Fe deficiency stress.

Sucrose plays a vital role in plant growth and development as well as the response to abiotic stress [43]. The application of sucrose in unripe strawberries resulted in the induction of ripening [44]. A study found that sucrose is one of most abundant metabolites in the glucose metabolic pathway, which plays an indispensable role in balancing photosynthetic activity in M. halliana [45]. In this study, Fe-deficient apple seedlings showed a typical Fe-stress phenotype, becoming yellow. The phenotypes of plants treated with Suc, Fe, and both Suc and Fe were found to be similar and showed good growth, and the Suc-supplied plants were greener than the Fe-supplied and Fe-Suc-supplied plants. This phenotype indicated that the repressions of Fe deficiency was partially reversed by exogenous Suc application. Furthermore, exogenous Suc increased the contents of PBG and subsequent precursors but decreased the ALA content in M. halliana, suggesting that the key regulatory point of Chl biosynthesis was moved forward after the application of exogenous Suc. Therefore, Suc was involved in the regulation of Chl intermediate products in M. halliana under Fe deficiency.

δ-Aminoleuvulinate acid dehydratase catalyzes the formation of PBG from two ALA molecules via the formation of two successive Schiff base intermediates [46, 47]. The ALAD gene, encoding δ-aminolevulinic acid dehydratase, is the rate-limiting enzyme of Chl biosynthesis [48]. In this study, after exogenous Suc application, increased expression of ALAD in M. halliana suggested that the accumulated intermediates of the PBG may have been efficiently utilized and enhanced the Chl biosynthetic pathway. As a result, in response to Fe deficiency, Suc may act as a signaling molecule to regulate the upregulation of the expression of related genes [49–51].

Conclusion

Our experimental results have showed that up regulation of PPOX gene enhanced Chl biosynthesis of M. halliana. Suc positively regulated the responses to Fe deficiency in M. halliana via Chl biosynthesis. Thus, PPOX is the key regulatory gene of M. halliana in response to Fe deficiency. Exogenous Suc application on apple seedlings could ameliorate the adverse effects caused by Fe deficiency. In future work, cloning and functional characterization of the key genes for Chl biosynthesis of M. halliana in response to Fe deficiency will be performed.

Supporting information

S1 File. Relevant data underlying the finding described in manuscript.

(XLSX)

Abbreviations

Fe

Iron

M. halliana

Malus Halliana

M. hupehensis

Malus hupehensis

Chl

Chlorophyll

Suc

Sucrose

ALA

δ-aminolaevulinic acid

PBG

Porphobilinogen

URO III

Uroorphyinogen III

Proto IX

Protoporphyrin IX

Mg-Proto IX

Mg-protoporphyrin IX

Pchlide

Protochlorophyllide

ALAD

δ- aminolevulinate acid dehydratase

PBGD

Porphobilinogen deaminase

UROS

Uroporphyrinogen III synthase

UROD

Uroporphyrinogen decarboxylase

PPOX

Protoporphyrinogen IX oxidase

MgCh

Magnesium chelatase

MgPMT

Magnesium-protoporphyrin IX methyltransferase

MPE

Mg-protoporphyrin IX monomethyl ester cyclase

RT-qPCR

Quantitative Real-time PCR

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was supported by Gansu Agricultural University Youth Postgraduate Tutor Support Fund Project (project No. GAU-2NDS-201710).

References

  • 1.Zargar SM, Agrawal GK, Rakwal R, Fukao Y. Quantitative proteomics reveals role of sugar in decreasing photosynthetic activity due to Fe deficiency. Frontiers in Plant Science. 2015;6:592 10.3389/fpls.2015.00592 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Marsh HV, Matrone G, Evans HJ. Investigations of role of iron in chlorophyll metabolism .2. effect of iron deficiency on chlorophyll synthesis. Plant Physiology. 1963;38(6):632–642. 10.1104/pp.38.6.632 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Rombola AD, Tagliavini M. Iron nutrition of fruit tree crops. Iron Nutrition in Plants and Rhizospheric Microorganisms. 2006;61–83. 10.1007/1-4020-4743-6_3 [DOI] [Google Scholar]
  • 4.Wang YX, Hu Y, Zhu YF, Baloch AW, Jia XM, Guo AX. Transcriptional and physiological analyses of short-term Iron deficiency response in apple seedlings provide insight into the regulation involved in photosynthesis. BMC Genomics. 2018;19(1):461 10.1186/s12864-018-4846-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yuan S, Liu ZL, Liu WJ, Lei T, Luo MH, Du JB, et al. A chlorophyll-less barley mutant "NYB" is insensitive to water stress. Zeitschrift Fur Naturforschung C-a Journal of Biosciences. 2007;62(5–6):403–409. 10.1515/znc-2007-5-614 [DOI] [PubMed] [Google Scholar]
  • 6.Li ZY, Mo WP, Jia LQ, Xu YC, Tang WJ, Yang WQ, et al. Rice fluorescent1 is involved in the regulation of chlorophyll. Plant and Cell Physiology. 2019;60(10): 2307–2318. 10.1093/pcp/pcz129 [DOI] [PubMed] [Google Scholar]
  • 7.Jin XQ, Liu T, Xu JJ, Gao ZX, Hu XH. Exogenous GABA enhances muskmelon tolerance to salinity-alkalinity stress by regulating redox balance and chlorophyll biosynthesis. BMC Plant Biol. 2019;19:48 10.1186/s12870-019-1660-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.He N, Wang XY, Cao LZ, Cao DW, Luo Y, Jiang LZ, et al. Effects of photoperiods and temperatures on physiological characteristics and chlorophyll synthesis precursors of adzuki bean seedlings. Acta Agronomica Sinica. 2019;45(3):460–468. 10.3724/SP.J.1006.2019.84002 [DOI] [Google Scholar]
  • 9.Li JM, Hu LP, Zhang L, Pan XB, Hu XH. Exogenous spermidine is enhancing tomato tolerance to salinity-alkalinity stress by regulating chloroplast antioxidant system and chlorophyll metabolism. BMC Plant Biol. 2015;15:303 10.1186/s12870-015-0699-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zhang K, Liu ZY, Shan XF, Li CY, Tang XY, Chi MY, et al. Physiological properties and chlorophyll biosynthesis in a Pak-choi (Brassica rapa L. ssp chinensis) yellow leaf mutant, pylm. Acta Physiologiae Plantarum. 2017;39(1):22 10.1007/s11738-016-2321-5 [DOI] [Google Scholar]
  • 11.Fan XX, Zang J, Xu ZG, Guo SR, Jiao XL, Liu XY, et al. Effects of different light quality on growth, chlorophyll concentration and chlorophyll biosynthesis precursors of non-heading Chinese cabbage (Brassica campestris L.). Acta Physiologiae Plantarum. 2013;35(9):2721–2726. 10.1007/s11738-013-1304-z [DOI] [Google Scholar]
  • 12.Buoso S, Pagliari L, Musetti R, Martini M, Marroni F, Schmidt W, et al. 'Candidatus Phytoplasma solani' interferes with the distribution and uptake of iron in tomato. Bmc Genomics. 2019;20(1):703 10.1186/s12864-019-6062-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Chen HM, Wang YM, Yang HL, Zeng QY, Liu YJ. NRAMP1 promotes iron uptake at the late stage of iron deficiency in poplars. Tree Physiology. 2019;39(7): 1235–1250. 10.1093/treephys/tpz055 [DOI] [PubMed] [Google Scholar]
  • 14.Spiller SC, Castelfranco AM, Castelfranco PA. Effects of iron and oxygen on chlorophyll biosynthesis .1. invivo observations on iron and oxygen-defi-cient plants. Plant Physiology. 1982;69(1):107–111. 10.1104/pp.69.1.107 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Jia HF, Wang YH, Sun MZ, Li BB, Han Y, Zhao YX, et al. Sucrose functions as a signal involved in the regulation of strawberry fruit development and ripening. New Phytologist. 2013;198(2):453–465. 10.1111/nph.12176 [DOI] [PubMed] [Google Scholar]
  • 16.Lilley JLS, Gee CW, Sairanen I, Ljung K, Nemhauser JL. An endogenous carbon-sensing pathway triggers increased auxin flux and hypocotyl elongation. Plant Physiology. 2012;160(4): 2261–2270. 10.1104/pp.112.205575 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ohto M, Onai K, Furukawa Y, Aoki E, Araki T, Nakamura K. Effects of sugar on vegetative development and floral transition in Arabidopsis. Plant Physiology. 2001;127(1): 252–261. 10.1104/pp.127.1.252 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ruan YL. Sucrose metabolism: gateway to diverse carbon use and sugar si-gnaling. Annual Review of Plant Biology. 2014;65:33–67. 10.1146/annurev-arplant-050213-040251 [DOI] [PubMed] [Google Scholar]
  • 19.Hammond JP, White PJ. Sucrose transport in the phloem: integrating root responses to phosphorus starvation. Journal of experimental botany. 2008;59(1):93–109. 10.1093/jxb/erm221 [DOI] [PubMed] [Google Scholar]
  • 20.Hermans C, Hammond JP, White PJ, Verbruggen N. How do plants respond to nutrient shortage by biomass allocation?. Trends in Plant Science. 2006;11(12): 610–617. 10.1016/j.tplants.2006.10.007 [DOI] [PubMed] [Google Scholar]
  • 21.Feng G, Zhang FS, Li XL, Tian CY, Tang C, Rengel Z. Improved tolerance of maize plants to salt stress by arbuscular mycorrhiza is related to higher accumulation of soluble sugars in roots. Mycorrhiza. 2002;12(4):185–190. 10.1007/s00572-002-0170-0 [DOI] [PubMed] [Google Scholar]
  • 22.Lin XY, Ye YQ, Fan SK, Jin CW, Zheng SJ. Increased sucrose accumulation regulates iron-deficiency responses by promoting auxin signaling in Ara-bidopsis plants. Plant Physiology. 2016;170(2):907–920. 10.1104/pp.15.01598 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Xiong JL, Wang HC, Tan XY, Zhang CL, Naeem MS. 5-aminolevulinic acid improves salt tolerance mediated by regulation of tetrapyrrole and proline metabolism in Brassica napus L. seedlings under NaCl stress. Plant Physi-ology and Biochemistry. 2018;124:88–99. 10.1016/j.plaphy.2018.01.001 [DOI] [PubMed] [Google Scholar]
  • 24.Zhou M, Gong XL, Ying W, Chao L, Hong MM, Wang L, et al. Cerium relieves the inhibition of chlorophyll biosynthesis of maize caused by magn-esium deficiency. Biological Trace Element Research. 2011;143(1):468–477. 10.1007/s12011-010-8830-y [DOI] [PubMed] [Google Scholar]
  • 25.Wu ZM, Zhang X, He B, Diao L, Sheng SL, Wang JL, et al. A chlorophyll-deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiology. 2007;145(1):29–40. 10.1104/pp.107.100321 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zhou Y, Gong ZY, Yang ZF, Yuan Y, Zhu JY, Wang M, et al. Mutation of the light-induced yellow leaf 1 gene, which encodes a geranylgeranyl reductase, affects chlorophyll biosynthesis and light sensitivity in rice. PLoS ONE. 2013;8(9): e75299 10.1371/journal.pone.0075299 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chen H, Cheng ZJ, Ma XD, Wu H, Liu YL, Zhou KN, et al. A knockdown mutation of yellow-green leaf2 blocks chlorophyll biosynthesis in rice. Plant Cell Rep. 2013;32(12):1855–1867. 10.1007/s00299-013-1498-y [DOI] [PubMed] [Google Scholar]
  • 28.Mueller AH, Dockter C, Gough SP, Lundqvist U, von Wettstein D, Hansso-n M. Characterization of mutations in barley fch2 encoding chlorophyllide a oxygenase. Plant and Cell Physiology. 2012;53(7):1232–1246. 10.1093/pcp/pcs062 [DOI] [PubMed] [Google Scholar]
  • 29.Han ZH, Wang Q, Shen T. Comparison of some physiological and bioche-mical characteristics between iron-efficient and iron-inefficient species in the genus Malus. Journal of Plant Nutrition. 1994;17(7):1257–1264. 10.1080/01904169409364803 [DOI] [Google Scholar]
  • 30.Hu Y, Zhu YF, Guo AX, Jia XM, Cheng L, Zhao T, et al. Transcriptome analysis in Malus halliana roots in response to iron deficiency reveals insi-ght into sugar regulation. Molecular Genetics and Genomics. 2018; 293(6): 1523–1534. 10.1007/s00438-018-1479-5 [DOI] [PubMed] [Google Scholar]
  • 31.Morton RA. Biochemical Spectroscopy. A. Hilger; 1975. [Google Scholar]
  • 32.Bogorad L. Porphyrin synthesis .1. uroporphyrinogen-I synthetase. Methods in Enzymology. 1962;5:885–895. 10.1016/S0076-6879(62)05334-3 [DOI] [Google Scholar]
  • 33.Hodgins RR,Vanhuystee RB. Rapid Simultaneous estimation of protoporphyrin and Mg-porphyrins in higher-plants. Journal of Plant Physiology. 1986;125(3–4):311–323. 10.1016/S0176-1617(86)80153-5 [DOI] [Google Scholar]
  • 34.Israelstam GF. Anomalous growth response of bean plants in iron-deficient media to cyanide. Nature. 1968;218(5139):390–391. 10.1038/218390a0 [DOI] [Google Scholar]
  • 35.Yadavalli V, Jolley CC, Malleda C, Thangaraj B, Fromme P, Subramanyam R. Alteration of proteins and pigments influence the function of photosystem I under iron deficiency from chlamydomonas reinhardtii. PLoS ONE. 2012;7(4):e35084 10.1371/journal.pone.0035084 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Chen XB, Sun J, Guo SR, Gao P, Du J. Chlorophyll metabolism of spinach leaves under seawater stress. Acta Botanica Boreali-Occidentalia Sinica. 2012;32(9): 1781–1787. [Google Scholar]
  • 37.Wang XL. Research advances about effects of enhanced UV-B radiation on plants and ecosystems. Acta Botanica Boreali-Occidentalla Sinica. 2002;22(3):670–681. 10.1088/1009-1963/11/5/313 [DOI] [Google Scholar]
  • 38.Wasli H, Jelali N, Silva AMS, Ksouri R, Cardoso SM. Variation of polyphenolic composition, antioxidants and physiological characteristics of dill (An-ethum graveolens L.) as affected by bicarbonate-induced iron deficiency conditions. Industrial Crops and Products. 2018;126:466–476. 10.1016/j.indcrop.2018.10.007 [DOI] [Google Scholar]
  • 39.Duke SO, Lydon J, Becerril JM, Sherman TD, Lehnen LP, Matsumoto H. Protoporphyrinogen oxidase-inhibiting herbicides. Weed Science. 1991;39(3): 465–473. 10.1017/S0043174500073239 [DOI] [Google Scholar]
  • 40.Hao GF, Zhu XL, Ji FQ, Zhang L, Yang GF, Zhan CG. Understanding the mechanism of drug resistance due to a codon deletion in protoporphyrinogen oxidase through computational modeling. Journal of Physical Chemistry B. 2009; 113(14):4865–4875. 10.1021/jp807442n [DOI] [PubMed] [Google Scholar]
  • 41.Cheng YD, Liu LQ, Zhao GQ, Shen CG, Yan HB, Guan JF, et al. The effects of modified atmosphere packaging on core browning and the expression patterns of PPO and PAL genes in 'Yali' pears during cold storage. Lwt-Food Science and Technology. 2015;60(2):1243–1248. 10.1016/j.lwt.2014.09.005 [DOI] [Google Scholar]
  • 42.Apaliya MT, Zhang HY, Yang QY, Zheng XF, Zhao LN, Kwaw E, et al. Hanseniaspora uvarum enhanced with trehalose induced defense-related enzy-me activities and relative genes expression levels against Aspergillus tubingensis in table. Postharvest Biology and Technology. 2017;132:162–170. 10.1016/j.postharvbio.2017.06.008 [DOI] [Google Scholar]
  • 43.Koch K. Sucrose metabolism: regulatory mechanisms and pivotal roles in sugar sensing and plant development. Current Opinion in Plant Biology. 2004;7(3):235–246. 10.1016/j.pbi.2004.03.014 [DOI] [PubMed] [Google Scholar]
  • 44.Siebeneichler TJ, Crizel RL, Camozatto GH, Paim BT, Messias RD, Rombaldi CV, et al. The postharvest ripening of strawberry fruits induced by abscisic acid and sucrose differs from their in vivo ripening. Food chemistry. 2020;317:126407 10.1016/j.foodchem.2020.126407 [DOI] [PubMed] [Google Scholar]
  • 45.Zhang XY, Jia XM, Zhang R, Zhu ZL, Liu B, Gao LY, et al. Metabolic analysis in Malus halliana leaves in response to iron deficiency. Scientia Horticulturae. 2019; 258:108792 10.1016/j.scienta.2019.108792 [DOI] [Google Scholar]
  • 46.Breinig S, Kervinen J, Stith L, Wasson AS, Fairman R, Wlodawer A, et al. Control of tetrapyrrole biosynthesis by alternate quaternary forms of porp-hobilinogen synthase. Nature Structural Biology. 2003;10(9):757–763. 10.1038/nsb963 [DOI] [PubMed] [Google Scholar]
  • 47.Jaffe EK, Ali S, Mitchell LW, Taylor KM, Volin M, Markham GD. Characterization of the role of the stimulatory magnesium of Escherichia coli por-phobilinogen synthase. Biochemistry. 1995;34(1):244–251. 10.1021/bi00001a029 [DOI] [PubMed] [Google Scholar]
  • 48.Meinecke L, Alawady A, Schroda M, Willows R, Kobayashi MC, Niyogi KK, et al. Chlorophyll-deficient mutants of chlamydomonas reinhardtii that accumulate magnesium protoporphyrin IX. Plant Molecular Biology. 2010;72(6):643–658. 10.1007/s11103-010-9604-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Moore B, Zhou L, Rolland F, Hall Q, Cheng WH, Liu YX, et al. Role of the Arabidopsis glucose sensor HXK1 in nutrient, light, and hormonal signaling. Science. 2003;300(5617):332–336. 10.1126/science.1080585 [DOI] [PubMed] [Google Scholar]
  • 50.Rolland F, Baena-Gonzalez E, Sheen J. Sugar sensing and signaling in plants: Conserved and novel mechanisms. Annual Review of Plant Biology. 2006;57: 675–709. 10.1146/annurev.arplant.57.032905.105441 [DOI] [PubMed] [Google Scholar]
  • 51.Rosa M, Prado C, Podazza G, Interdonato R, Gonzalez JA, Hilal M, et al. Soluble sugars—metabolism, sensing and abiotic stress: a complex network in the life of plants. Plant signaling & behavior. 2009;4(5):388–393. 10.4161/psb.4.5.8294 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Basharat Ali

18 Feb 2020

PONE-D-19-35123

Effects of Iron Deficiency and Exogenous Sucrose on the Intermediates of Chlorophyll Biosynthesis in Malus halliana

PLOS ONE

Dear Dr Wang,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

ACADEMIC EDITOR: Thank you for submitting your manuscript to PLOS ONE. I agree with the reviewers that English language needs to be checked thoroughly. Main claims of the paper are not properly placed in the context of previous literature. Authors did not treat the literature fairly. Introduction is too general. 

We would appreciate receiving your revised manuscript by 45 days. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Basharat Ali, Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

Thank you for submitting your manuscript to PLOS ONE. I agree with the reviewers that English language needs to be checked thoroughly. Main claims of the paper are not properly placed in the context of previous literature. Authors did not treat the literature fairly. Introduction is too general.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed:

https://bmcplantbiol.biomedcentral.com/articles/10.1186/s12870-015-0699-7

In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.

3. In your Methods, please state the source of the seeds used in your study.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Apple is an important fruit due to its nutritional and commercial value and study of apple rootstocks is an important research direction. It is imperative to fully understand the complex mechanisms involved under stressful environments. The authors presented the effects of Iron deficiency and exogenous application of Sucrose on the intermediates of chlorophyll biosynthesis in Apple rootstocks. The results are interesting and valuable for scientific research but I have several concerns. The manuscript is not acceptable in its present form. If authors can address the stress modulated mechanism in more elaborated way then the paper is worth of publication after major revision.

These points must be addressed:

1. First you need to mention the common name in Title. You can mention scientific name in Abstract or Introduction in Parenthesis. Each scientific name has “L.” at the end according to nomenclature therefore, revise it thoroughly.

2. All abbreviations must be mentioned in full form at its first place. Mention all these abbreviations in footnotes of the first page.

3. In the last paragraph of Introduction you have described some results. You just need to mention the background of your work as well as the significance for scientific world. You should discuss results in discussion part.

4. Insert line numbers in the manuscript for better review process.

5. Meaning is not clear “pylm”….is it Palm??

6. “nonphotosynthetic must be replaced with non-photosynthetic”

7. You have mentioned “Increased Suc accumulation is required for regulating Fe-deficiency responses in plants, with auxins acting downstream in transmitting the Fe-deficiency signal”. How could you explain the downstreaming??

8. “Exogenous Suc treatments”. Must mention Sucrose in full form in heading or subheadings. Similarly “Determination of Chl Precursors” as Determination of Chlorophyll Precursors.

9. Caption of Fig 3. shows treatment codes as T1, T2 etc….all the punctuation must be appropriate like T3: Fe 21 d. Revise all codes in figure captions.

10. You have used various abbreviations in your manuscript. You should also include Pn for Photosynthesis.

11. “Stay green” must be replaced with greenness.

12. You must have to mention your main findings/conclusions under separate heading. Also mention your major outcomes in more elaborative way.

13. Arrange the references alphabetically.

14. For the figures, you need to mention the x axis once for A, C, E and combine them, then mention x-axis scale once for B, D and F and combine them. Move Y-axis to right side of three figures (B, D, F). Similarly, move Y-axis on the left side of three figures (A, C, E). Combine all the six figures into single figure and enhance the dpi up to 500 for better understanding. Follow this procedure for Fig 1, 2, 3 and 5.

15. You should include a graphical abstract for clear understanding of the readers. You may modify Fig. 6 into graphical abstract after appropriate incorporation.

Reviewer #2: Overall, I think this study provides a valuable dataset for understanding the effects of iron deficiency and exogenous sucrose on the intermediates of chlorophyll biosynthesis in Malus halliana. However, there are several components of the manuscript that need to be improved before this paper is ready for publication, including grammatical issues that need to be addressed throughout the manuscript. Furthermore, with regard to grammar and structure, there are grammatically incorrect sentences or poorly written throughout the manuscript. I suggest that the authors work with an editor to revise their writing before resubmission. Few examples are given below. I suggest rejection of this article in this form.

In Introduction part:

Need to revise these sentence

Inhibition of any steps of Chl synthesis will cause reduced Chl content.

A study investigating the biochemical mechanism of Chl deficiency in pylm by examining Chl biosynthesis precursors in this mutant has shown that Chl biosynthesis is blocked in the mutant at the Chl a production step

Material and Method

In the material and method procedure regarding the isolation of RNA and preparation of cDNA was not discussed briefly.

In discussion part:

Fe deficiency stress upset the Chl biosynthesis balance in M. hupehensis, the Chl biosynthesis of M. halliana instead wasn’t blocked after Fe deficiency, which might be.

Besides, research has suggested that PbPPO1 genes might be involved in core browning under

modified atmosphere storage in ‘Yali’ pears[43].

Need to italic the technical name

And PPO gene expression level against Aspergillus tubingensis in table grapes was enhanced with trehalose

Need to revised this sentence

In this study, the PPOX gene was researched about the expression differences between two

apple rootstocks under Fe deficiency.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 May 6;15(5):e0232694. doi: 10.1371/journal.pone.0232694.r002

Author response to Decision Letter 0


29 Mar 2020

Dear Editors and Reviewers,

Thank you very much for your kind work and for the reviewers’ comments concerning our manuscript entitled “Effects of Iron Deficiency and Exogenous Sucrose on the Intermediates of Chlorophyll Biosynthesis in Malus halliana”. Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. We would like to revise manuscript if there are any requirements later. Revised portion are marked in red in the paper. The main corrections in the paper and the responses to the editor and reviewers’ comments are as following:

ACADEMIC EDITOR:

1. Thank you for submitting your manuscript to PLOS ONE. I agree with the reviewers that English language needs to be checked thoroughly. Main claims of the paper are not properly placed in the context of previous literature. Authors did not treat the literature fairly. Introduction is too general.

Response: English language has been checked and modified by American Journal Experts (AJE)

To express well the main claims of paper, we have added more related literature and deleted some unnecessary literature in introduction parts. All changes have been marked in red in the manuscript.

Add (1) “The Chl biosynthesis pathway has many steps and involves various enzymes, and a blockade in one step will affect Chl biosynthesis and cause changes in leaf color[7].” in line 44-46.

(2) “Chl biosynthesis plays essential roles in photosynthesis and plant growth in response to environmental change[6].” in line 42-44.

(3) “The key regulatory sites of Chl synthesis are different for each crop under external stress.” in line 46-47.

(4) “A study of adzuki bean reported that the transformation of protoporphyrin IX (Proto IX) is blocked in Chl synthesis, causing etiolated seedlings[8]. ” in line 47-48.

(5) “Remarkably, Fe deficiency directly affected Chl synthesis[12].” in line 55-56.

(6) “Research in poplar revealed that Chl synthesis was inhibited under Fe-deficient conditions[13].” in line 56-57.

(7) “Spiller et al. attempted to study the effect of Fe on the Chl biosynthetic pathway, and the results indicated that Fe deficiency leads to the accumulation and excretion of intermediates in the tetrapyrrole biosynthetic pathway, particularly coproporphyrin[14].” in line 57-60.

(8) “Moreover, an investigation was initiated to locate possible sites where a deficiency of Fe might limit Chl synthesis of cowpea plants[2].” in line 60-61.

(9) “However, the responses of Chl biosynthesis to Fe deficiency stress and the key regulatory sites in M. halliana are still unknown.” in line 62-63.

(10) “However, little is known about how exogenous sucrose regulates the response of M. halliana to Fe deficiency through chlorophyll synthesis.” in line 71-73.

(11) “Studies of Chl biosynthesis have focused on various aspects[23, 24], whether biochemical[25, 26] or genetic[27, 28].” in line 74-75.

(12) “However, gaps remain in the knowledge of Chl biosynthesis and the related genes in apple rootstocks.” in line 75-76.

(13) “Therefore, it is important to elucidate the Chl biosynthetic molecular responses of M. halliana to Fe deficiency.” in line 76-77.

(14) “This study is original research work investigating the differences between two apple rootstocks under Fe deficiency at a molecular scale.” In line 80-81.

2. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

Response: We have updated statement about funding in my cover letter.

3. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Response: We have deposited laboratory protocols in protocols.io, and DOI is dx.doi.org/10.17504/protocols.io.beb6jare.

Additional Editor Comments (if provided):

1. Thank you for submitting your manuscript to PLOS ONE. I agree with the reviewers that English language needs to be checked thoroughly. Main claims of the paper are not properly placed in the context of previous literature. Authors did not treat the literature fairly. Introduction is too general.

Response: English language has been checked and modified by American Journal Experts (AJE)

To express well the main claims of paper, we have added more related literature and deleted some unnecessary literature in introduction parts. All changes have been marked in red in the manuscript.

Add (1) “The Chl biosynthesis pathway has many steps and involves various enzymes, and a blockade in one step will affect Chl biosynthesis and cause changes in leaf color[7].” in line 44-46.

(2) “Chl biosynthesis plays essential roles in photosynthesis and plant growth in response to environmental change[6].” in line 42-44.

(3) “The key regulatory sites of Chl synthesis are different for each crop under external stress.” in line 46-47.

(4) “A study of adzuki bean reported that the transformation of protoporphyrin IX (Proto IX) is blocked in Chl synthesis, causing etiolated seedlings[8]. ” in line 47-48.

(5) “Remarkably, Fe deficiency directly affected Chl synthesis[12].” in line 55-56.

(6) “Research in poplar revealed that Chl synthesis was inhibited under Fe-deficient conditions[13].” in line 56-57.

(7) “Spiller et al. attempted to study the effect of Fe on the Chl biosynthetic pathway, and the results indicated that Fe deficiency leads to the accumulation and excretion of intermediates in the tetrapyrrole biosynthetic pathway, particularly coproporphyrin[14].” in line 57-60.

(8) “Moreover, an investigation was initiated to locate possible sites where a deficiency of Fe might limit Chl synthesis of cowpea plants[2].” in line 60-61.

(9) “However, the responses of Chl biosynthesis to Fe deficiency stress and the key regulatory sites in M. halliana are still unknown.” in line 62-63.

(10) “However, little is known about how exogenous sucrose regulates the response of M. halliana to Fe deficiency through chlorophyll synthesis.” in line 71-73.

(11) “Studies of Chl biosynthesis have focused on various aspects[23, 24], whether biochemical[25, 26] or genetic[27, 28].” in line 74-75.

(12) “However, gaps remain in the knowledge of Chl biosynthesis and the related genes in apple rootstocks.” in line 75-76.

(13) “Therefore, it is important to elucidate the Chl biosynthetic molecular responses of M. halliana to Fe deficiency.” in line 76-77.

(14) “This study is original research work investigating the differences between two apple rootstocks under Fe deficiency at a molecular scale.” In line 80-81.

Journal Requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Response: We have revised the manuscript style according to style requirements. If the manuscript is still inappropriate, don't hesitate to contact me.

2. We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed: https://bmcplantbiol.biomedcentral.com/articles/10.1186/s12870-015-0699-7. In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.

Response: We have addressed all overlapping text and cited all works sources in the introduction and discussion sections.

3. In your Methods, please state the source of the seeds used in your study.

Response: We have stated the source of seeds and marked in red in line 85-86.

4. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements.

Response: My uploaded figures have passed the PACE checks, and the PACE report signifies that the figure files need no adjustment.

Reviewer #1:

1. First you need to mention the common name in Title. You can mention scientific name in Abstract or Introduction in Parenthesis. Each scientific name has “L.” at the end according to nomenclature therefore, revise it thoroughly.

Response: We have submitted the article to AJE for language editing, and the title is recommended not to be changed. Additionally, we have revised thoroughly scientific name in abstract and introduction in parenthesis.

2. All abbreviations must be mentioned in full form at its first place. Mention all these abbreviations in footnotes of the first page.

Response: All abbreviations have been mentioned in full form at its first place, and all abbreviations have been mentioned in footnotes of the first page.

3. In the last paragraph of Introduction you have described some results. You just need to mention the background of your work as well as the significance for scientific world. You should discuss results in discussion part.

Response: We have moved some results in the Introduction section to the discussion part. In the meantime, we have added the background of work and the significance for scientific world in the introduction parts (line 55-75).

4. Insert line numbers in the manuscript for better review process.

Response: We have inserted line numbers in the manuscript.

5. Meaning is not clear “pylm”….is it Palm??

Response: We have confirmed again from the literature and determined that it is pylm and not Palm.

6. “nonphotosynthetic must be replaced with non-photosynthetic”

Response: This manuscript was edited and revised by the AJE. nonphotosynthetic cannot be replaced by non-photosynthetic.

7. You have mentioned “Increased Suc accumulation is required for regulating Fe-deficiency responses in plants, with auxins acting downstream in transmitting the Fe-deficiency signal”. How could you explain the downstreaming??

Response: This sentence comes from the 22nd reference to show that sucrose is required for regulating Fe-deficiency responses in plants (See 22nd reference).

8. “Exogenous Suc treatments”. Must mention Sucrose in full form in heading or subheadings. Similarly “Determination of Chl Precursors” as Determination of Chlorophyll Precursors.

Response: Sucrose in full form in heading or subheadings has been mentioned, and “Determination of Chl Precursors” has been replaced by “Determination of Chlorophyll Precursors”.

9. Caption of Fig 3. shows treatment codes as T1, T2 etc…all the punctuation must be appropriate like T3: Fe 21 d. Revise all codes in figure captions.

Response: We have revised all treatments codes in Fig 3 according to the above example.

10. You have used various abbreviations in your manuscript. You should also include Pn for Photosynthesis.

Response: We have added Pn (Photosynthesis) to the Abbreviation section.

11. “Stay green” must be replaced with greenness.

Response: “Stay green” has been replaced with “greenness”.

12. You must have to mention your main findings/conclusions under separate heading. Also mention your major outcomes in more elaborative way.

Response: We have mentioned main findings under separate heading and mentioned major outcomes in Results, Discussion and Conclusion parts.

13. Arrange the references alphabetically.

Response: Based on the PLoS ONE's style requirements, references should be arranged in the order in which they are inserted. So, we have arranged the references as requirements.

14. For the figures, you need to mention the x axis once for A, C, E and combine them, then mention x-axis scale once for B, D and F and combine them. Move Y-axis to right side of three figures (B, D, F). Similarly, move Y-axis on the left side of three figures (A, C, E). Combine all the six figures into single figure and enhance the dpi up to 500 for better understanding. Follow this procedure for Fig 1, 2, 3 and 5.

Response: We have generated the figures as required.

15. You should include a graphical abstract for clear understanding of the readers. You may modify Fig. 6 into graphical abstract after appropriate incorporation.

Response: We have tried to modified Fig 6 into graphical abstract. See Fig 6 and the Fig 6 legend (line 232-243) for the changes. We are willing to continue to modify when there are any requirements later.

Reviewer #2:

1. In Introduction part:

Need to revise these sentence

Inhibition of any steps of Chl synthesis will cause reduced Chl content.

A study investigating the biochemical mechanism of Chl deficiency in pylm by examining Chl biosynthesis precursors in this mutant has shown that Chl biosynthesis is blocked in the mutant at the Chl a production step

Response: We have revised and modified these sentences and the changes have been marked in red in the text.

2. Material and Method

In the material and method procedure regarding the isolation of RNA and preparation of cDNA was not discussed briefly.

Response: We have briefly added the isolation of RNA and preparation of cDNA in the material and method part.

3. In discussion part:

Fe deficiency stress upset the Chl biosynthesis balance in M. hupehensis, the Chl biosynthesis of M. halliana instead wasn’t blocked after Fe deficiency, which might be.

Besides, research has suggested that PbPPO1 genes might be involved in core browning under

modified atmosphere storage in ‘Yali’ pears[43].

Response: We have revised again these sentences as required, and the manuscript has been edited and modified by AJE. Changes are marked in red in the paper.

4. Need to italic the technical name

And PPO gene expression level against Aspergillus tubingensis in table grapes was enhanced with trehalose.

Response: The technical name has been changed to italic and marked in red in the text.

5. Need to revised this sentence

In this study, the PPOX gene was researched about the expression differences between two

apple rootstocks under Fe deficiency.

Response: We have deleted this sentence and restated in line 254-255.

We have added and revised details in the article according to your suggestions. Thank you again for improving our paper.

Best Regards,

Yours Sincerely

Ai-xia Guo

Corresponding author:

Name: Yan-xiu WANG

E-mail: wangxy@gsau.edu.cn

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Basharat Ali

12 Apr 2020

PONE-D-19-35123R1

Effects of iron deficiency and exogenous sucrose on the intermediates of chlorophyll biosynthesis in Malus halliana

PLOS ONE

Dear Dr. Wang,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

ACADEMIC EDITOR: I really appreciate the efforts did by authors during revision, but according to the reviewer there are still some points which need to be corrected. 

==============================

We would appreciate receiving your revised manuscript by May 27 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Basharat Ali, Ph.D

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors did good efforts in revising the manuscript according to the comments. But at some points, I still feel that changes should be made. You should have to follow the below mentioned points before acceptance for publication.

1. Even you have revised your paper from an English Editor but you cannot mention this “Iron1” in Title. You can show corresponding author email with asterisk that will also show abbreviation list in footnotes which is usually followed in literature.

2. In the first revision I have mentioned this but I can’t find this in text. Each scientific name has “L.” at the end according to nomenclature therefore, revise it thoroughly.

3. In the first revision I have mentioned this but I can still find some related mistakes in the text. “Exogenous Suc treatments”. Must mention Sucrose in full form in heading or subheadings. Similarly “Determination of Chl Precursors” as Determination of Chlorophyll Precursors.

For example:

“Effects of Fe deficiency on the Chl precursor contents of M.halliana and M. hupehensis”

“Expression of genes involved in Chl biosynthesis under Fe deficiency”

“Regulation of the Fe deficiency phenotype by exogenous Suc”

4. For better understanding of the readers, you can move graphical abstract right after Abstract or Introduction before Materials and Methods. You can also quote this figure if there is any text relevant to this in the main body.

Reviewer #2: Authors have improved all the points very well. The manuscript has been revised well. Now paper is accepted for the publication in the journal.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Shahbaz Atta Tung

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 May 6;15(5):e0232694. doi: 10.1371/journal.pone.0232694.r004

Author response to Decision Letter 1


15 Apr 2020

Dear Editors and Reviewers,

Thank you very much for your kind work and for the reviewers’ comments concerning our manuscript entitled “Effects of iron deficiency and exogenous sucrose on the intermediates of chlorophyll biosynthesis in Malus halliana”. Those comments are all valuable and very helpful for revising and improving our paper, as well as the important guiding significance to our researches. We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in red in the paper. The main corrections in the paper and the responses to the editor and reviewers’ comments are as following:

Reviewer #1

1. Even you have revised your paper from an English Editor but you cannot mention this “Iron1” in Title. You can show corresponding author email with asterisk that will also show abbreviation list in footnotes which is usually followed in literature.

Response: Thank you for your comments. We have revised “Iron1” in Title part, and we have showed corresponding author email with asterisk. All changes have been marked in red in the manuscript. If the manuscript is still inappropriate, don't hesitate to contact me.

2. In the first revision I have mentioned this but I can’t find this in text. Each scientific name has “L.” at the end according to nomenclature therefore, revise it thoroughly.

Response: Thank you very much for your suggestion and patience. We have referred to the relevant literature (the 4th and 45th references in text). The scientific name of two apple rootstock in the text may not include "L.". Then we consulted the academic editor. Editor has indicated that the change that reviewer#1 suggested is not necessary. Combining relevant literature (the 4th and 45th references in text) and editorial reply, we decided not to review the scientific name in the full text of my manuscript. If you have any questions or concerns about my manuscript, please don't hesitate to reach out and let me know.

3. In the first revision I have mentioned this but I can still find some related mistakes in the text. “Exogenous Suc treatments”. Must mention Sucrose in full form in heading or subheadings. Similarly “Determination of Chl Precursors” as Determination of Chlorophyll Precursors.

For example:

“Effects of Fe deficiency on the Chl precursor contents of M. halliana and M. hupehensis”

“Expression of genes involved in Chl biosynthesis under Fe deficiency”

“Regulation of the Fe deficiency phenotype by exogenous Suc”

Response: Thank you very much for your suggestion and patience. We have revised related mistakes in heading or subheadings. All changes have been marked in red in lines 81, 104, 126, 141, 142, 163, 164, 181, 198, 217 and 218.

4. For better understanding of the readers, you can move graphical abstract right after Abstract or Introduction before Materials and Methods. You can also quote this figure if there is any text relevant to this in the main body.

Response: Thank you very much for your suggestions. We can move graphical abstract right after Abstract or Introduction before Materials and Methods, but I think it's more understandable for the authors and readers without moving the graphical abstract. Additionally, this figure is a schematic model of key genes involved in chlorophyll biosynthesis of apple rootstock during iron deficiency and sucrose application. We haven't found a consistent graphics yet. Therefore, we didn’t quote this figure in the main body.

We have revised some details in the article according to your suggestions. Thank you again for improving our paper.

Best Regards,

Yours Sincerely

Ai-xia Guo

Corresponding author:

Name: Yan-xiu WANG

E-mail: wangxy@gsau.edu.cn

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 2

Basharat Ali

21 Apr 2020

Effects of iron deficiency and exogenous sucrose on the intermediates of chlorophyll biosynthesis in Malus halliana

PONE-D-19-35123R2

Dear Dr. Wang,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Basharat Ali, Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have revised all the suggested changes positively in the revised version. The manuscript is suitable for publication in PLOS ONE.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Shahbaz Atta Tung

Acceptance letter

Basharat Ali

24 Apr 2020

PONE-D-19-35123R2

Effects of iron deficiency and exogenous sucrose on the intermediates of chlorophyll biosynthesis in Malus halliana

Dear Dr. Wang:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Basharat Ali

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 File. Relevant data underlying the finding described in manuscript.

    (XLSX)

    Attachment

    Submitted filename: Response to Reviewers.docx

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES