Inactivation of Pseudomonas aeruginosa Biofilms by 405-Nanometer-Light-Emitting Diode Illumination

Pseudomonas aeruginosa can form biofilms on medical implants, industrial equipment, and domestic surfaces, contributing to high morbidity and mortality rates. This study examined the antibiofilm activity of 405-nm light-emitting diode (LED) illumination against mature biofilms formed on stainless steel coupons. We found that the disinfectant susceptibility, biofilm structure, and extracellular polymeric substance structure and composition were disrupted by LED illumination. We then investigated the transcription of several critical P. aeruginosa biofilm-related genes and analyzed the effect of illumination temperature on the above characteristics. Our results confirmed that LED illumination could be developed into an effective and safe method to counter P. aeruginosa biofilm contamination. Further research will be focused on the efficacy and application of LED illumination for elimination of complicated biofilms in the environment.

ABSTRACT

Biofilm formation by Pseudomonas aeruginosa contributes to its survival on surfaces and represents a major clinical threat because of the increased tolerance of biofilms to disinfecting agents. This study aimed to investigate the efficacy of 405-nm light-emitting diode (LED) illumination in eliminating P. aeruginosa biofilms formed on stainless steel coupons under different temperatures. Time-dependent killing assays using planktonic and biofilm cells were used to determine the antimicrobial and antibiofilm activities of LED illumination. We also evaluated the effects of LED illumination on the disinfectant susceptibility, biofilm structure, extracellular polymeric substance (EPS) structure and composition, and biofilm-related gene expression of P. aeruginosa biofilm cells. Results showed that the abundance of planktonic P. aeruginosa cells was reduced by 0.88, 0.53, and 0.85 log CFU/ml following LED treatment for 2 h compared with untreated controls at 4, 10, and 25°C, respectively. For cells in biofilms, significant reductions (1.73, 1.59, and 1.68 log CFU/cm²) were observed following LED illumination for 2 h at 4, 10, and 25°C, respectively. Moreover, illuminated P. aeruginosa biofilm cells were more sensitive to benzalkonium chloride or chlorhexidine than untreated cells. Scanning electron microscopy and confocal laser scanning microscopic observation indicated that both the biofilm structure and EPS structure were disrupted by LED illumination. Further, reverse transcription-quantitative PCR revealed that LED illumination downregulated the transcription of several genes associated with biofilm formation. These findings suggest that LED illumination has the potential to be developed as an alternative method for prevention and control of P. aeruginosa biofilm contamination.

IMPORTANCE Pseudomonas aeruginosa can form biofilms on medical implants, industrial equipment, and domestic surfaces, contributing to high morbidity and mortality rates. This study examined the antibiofilm activity of 405-nm light-emitting diode (LED) illumination against mature biofilms formed on stainless steel coupons. We found that the disinfectant susceptibility, biofilm structure, and extracellular polymeric substance structure and composition were disrupted by LED illumination. We then investigated the transcription of several critical P. aeruginosa biofilm-related genes and analyzed the effect of illumination temperature on the above characteristics. Our results confirmed that LED illumination could be developed into an effective and safe method to counter P. aeruginosa biofilm contamination. Further research will be focused on the efficacy and application of LED illumination for elimination of complicated biofilms in the environment.

INTRODUCTION

Pseudomonas aeruginosa, a ubiquitous Gram-negative bacterium, survives in a broad range of natural environments, such as water, soil, and plant surfaces (1). Many health care-associated diseases, including pneumonia, urinary tract infections, surgical site infections, and bloodstream infections, are commonly attributed to P. aeruginosa, particular in patients with an impaired immune response (2). P. aeruginosa is the foremost pathogen causing nosocomial infections, affecting more than 51,000 patients each year in the United States (3). Moreover, it displays high intrinsic resistance to a wide range of common antibiotics and, with approximately 13% of strains showing multidrug resistance, is responsible for almost 400 deaths per annum in the United States alone (2).

Biofilms comprise groups of microorganisms embedded in an extracellular polymeric substance (EPS) matrix (4). Biofilms help bacteria to withstand hostile environmental conditions such as low temperature, starvation, and desiccation (5). A wide range of chronic diseases are caused by biofilm contamination, and treatment of such illnesses can be difficult owing to the emergence of antibiotic resistance in biofilm bacteria (6). P. aeruginosa organisms develop biofilms in water, taps, sinks, toilets, showers, drains, and even on domestic surfaces in a bid to shield themselves from various disinfecting agents (7). Therefore, controlling P. aeruginosa biofilm contamination and decreasing the resistance of biofilm cells to disinfection would be helpful in reducing the risk of this important pathogen in affected sectors.

Biofilm control practices currently exist in the form of sterilization methods such as ethylene oxide, steam autoclaving, and electron-beam, hydrogen peroxide plasma, and gamma irradiation (8). However, these methods can damage thermally and hydrolytically sensitive polymers and metal alloys, diminishing their integrity (9). More recently, light-emitting diodes (LEDs) have been used as an alternative method for biofilm elimination because illumination at wavelengths in the range of 400 to 450 nm has an antibacterial effect (10). Although the antibacterial efficacy of LED illumination is lower than that of other methods, lower-energy photons are produced, resulting in less material degradation and minimal human tissue damage (11). Following exposure to 405-nm light, intracellular photosensitive porphyrin molecules are active, generating reactive oxygen species (ROS). ROS cause oxidative damage to the cell, ultimately causing cell death (12). Li et al. (13) demonstrated that exposure to 405-nm LED illumination (16 ± 2 mW/cm²) for 8 h resulted in 0.4- and 0.5-log CFU/cm² decreases in the abundance of Listeria monocytogenes and Salmonella, respectively, on the surface of ready-to-eat fresh salmon. Similarly, Kim et al. (14) reported 0.3- to 1.3-log CFU/cm² decreases (P < 0.05) in the abundance of Salmonella on fresh fruit after 36- to 48-h exposure to 405-nm LED illumination (1.3 to 1.7 kJ/cm²) under refrigeration.

Although the antimicrobial activity of 405-nm LED illumination has been extensively studied (13–15), little information is available about the effects of this treatment on biofilms or on the mechanism of inactivation. Therefore, the aim of the current study was to document the effects of 405-nm LED illumination on P. aeruginosa biofilms at different temperatures (4, 10, and 25°C). To assess the antibiofilm activity of LED illumination, we compared P. aeruginosa biofilms formed on stainless steel coupons before and after LED illumination. We also examined the effects of LED illumination on the disinfectant sensitivity, EPS composition, and biofilm structure of P. aeruginosa. Finally, we examined whether LED illumination regulates the transcription of critical biofilm-related genes in P. aeruginosa.

RESULTS

Antibacterial activity of LED illumination against planktonic P. aeruginosa.

Time-kill curves are shown in Fig. 1. The initial population of planktonic P. aeruginosa cells in phosphate-buffered saline (PBS) was approximately 6.23 log CFU/ml. Viable cell numbers decreased by 4.66, 5.06, and 4.61 log CFU/ml after 5 h of LED treatment at 4, 10, and 25°C, respectively. A treatment time of 5 h resulted in the greatest decreases in viable cell numbers at 10°C. However, significant (P < 0.01) decreases in viable P. aeruginosa cell numbers compared with the control were also observed following 1 h of LED illumination at 4°C (Fig. 1A). In comparison, significant (P < 0.01) decreases in viable cell numbers were not observed until the 2-h time point in the 10 and 25°C assays (Fig. 1B and C). The number of viable cells decreased rapidly after 2 h at all temperatures. Therefore, an LED treatment duration of 2 h was selected for further analyses of planktonic cells.

FIG 1.

Time-kill curves of LED illumination at (A) 4°C, (B) 10°C, and (C) 25°C against planktonic Pseudomonas aeruginosa cells. **, P < 0.01 versus the control.

Antibiofilm activity of LED illumination against P. aeruginosa.

The initial population of biofilm-associated P. aeruginosa cells on stainless steel coupons was approximately 5.90 log CFU/cm². The abundance of cells in biofilms decreased by 4.41, 4.08, and 4.18 log CFU/cm² after 4 h of LED treatment at 4, 10, and 25°C, respectively (Fig. 2). An LED treatment time of 4 h showed the greatest bactericidal effect against P. aeruginosa biofilms at 4°C. However, a significant (P < 0.01) decrease (0.63 log) in viable cell counts compared with the control was observed after only 30 min of LED illumination at 4°C (Fig. 2A). Interestingly, 30 min of LED treatment at 10 and 25°C resulted in only 0.24 and 0.03 log reductions in viable cell counts, respectively (Fig. 2B and C). Decreases in viable cell counts became more uniform between 1 and 4 h of LED treatment at all temperatures. Therefore, we selected LED treatment periods of 1 or 2 h for all further studies of P. aeruginosa biofilm cells.

FIG 2.

Time-kill curves of LED illumination at (A) 4°C, (B) 10°C, and (C) 25°C against biofilm-associated P. aeruginosa cells. *, P < 0.05; **, P < 0.01 versus the control.

Sensitivity of P. aeruginosa biofilm cells to benzalkonium chloride and chlorhexidine following LED illumination.

P. aeruginosa biofilm cells subjected to LED illumination were more sensitive to disinfectant treatment than unilluminated cells (Fig. 3). After benzalkonium chloride (BC) treatment, P. aeruginosa biofilms pretreated with LED exposure had significantly (P < 0.01) lower viable counts than those of the control, resulting in a maximum 1.27 log difference between untreated populations and those that had been LED-illuminated at 25°C for 1 h prior to BC treatment (Fig. 3C). Similarly, a maximum 0.94 log difference was observed between unilluminated populations and those that had been LED-illuminated at 4°C for 1 h prior to chlorhexidine (CHX) treatment (Fig. 3D).

FIG 3.

Log reductions in the abundance of biofilm-associated P. aeruginosa cells following treatment with (A to C) 100 ppm benzalkonium chloride (BC) or (D to F) chlorhexidine (CHX) for 15 min with and without LED treatment for 2 h at 4°C, 10°C, and 25°C. *, P < 0.05; **, P < 0.01 versus the control.

Effect of LED illumination on EPS components in P. aeruginosa biofilms.

Several different components of EPS were clearly observed in the attenuated total reflection-Fourier transform infrared spectroscopy (ATR-FTIR) spectra (Fig. 4). The primary absorbance peak (1,085 cm⁻¹) correlated with C-C and C-O vibrations (16); however, the peak at 1,085 cm⁻¹ was complex, with high- and low-frequency shoulders located at 1,120 and 1,050 cm⁻¹, respectively, corresponding to DNA nucleotides and polysaccharides, respectively (17). Secondary absorbance peaks observed at 1,647 cm⁻¹ were assigned to amide I (C=O stretch coupled with N-H bend), which is characteristic of proteins (17).

FIG 4.

ATR-FTIR spectra of P. aeruginosa biofilms formed on stainless steel with and without LED treatment for 2 h at (A) 4°C, (B) 10°C, and (C) 25°C.

The absorbance of the key components of P. aeruginosa biofilm EPS (DNA nucleotides, polysaccharides, and proteins) decreased as a result of LED illumination for 2 h, with more obvious decreases observed at 4°C than with the other temperatures.

Field-emission scanning electron microscopy-based analysis of the antibiofilm activity of LED illumination.

As shown in Fig. 5, field-emission scanning electron microscopy (FESEM) analysis at 1,500× and 4,000× magnification demonstrated that biofilm formation by P. aeruginosa PAO1 on stainless steel coupons was inhibited by LED illumination. Untreated P. aeruginosa cells formed a dense biofilm layer, with most cells gathered into large clusters and multilayer structures regardless of temperature (Fig. 5A to C and G to I). In comparison, this typical biofilm structure was not observed following LED treatment. Moreover, with decreases in temperature, P. aeruginosa biofilms showed significant decreases in cell density, consistent with the results of time-kill assays (Fig. 5D to F and J to L).

FIG 5.

Scanning electron microscopic images at 1,500× magnification of P. aeruginosa PAO1 biofilms with or without 2-h LED treatment at (A, D) 4°C, (B, E) 10°C, and (C, F) 25°C. Scanning electron microscope images at a 4,000× magnification of P. aeruginosa PAO1 biofilms with or without 2-h LED treatment at (G, J) 4°C, (H, K) 10°C, and (I, L) 25°C.

Confocal laser scanning microscopy (CLSM)-based analysis of the antibiofilm activity of LED illumination.

Dense areas of blue and green fluorescence were observed in the untreated P. aeruginosa biofilm samples under the confocal laser scanning microscope (Fig. 6A to C, G to I, and M to O). The bacteria were closely connected to each other, forming a large number of microcolonies. Polysaccharide was distributed uniformly throughout the biofilm and agglomerated to blocks of polymers. However, following LED illumination, almost no green fluorescence was detected in the P. aeruginosa biofilm samples, and blue fluorescence was also reduced (Fig. 6D to F, J to L, and P to R). These results suggested that the biofilm had been dispersed and that the abundance of polysaccharides was significantly reduced.

FIG 6.

Confocal laser scanning microscope images at 200× magnification of P. aeruginosa PAO1 biofilms with or without 2-h LED treatment at (A to F) 4°C, (G to L) 10°C, and (M to R) 25°C.

Reverse transcription-quantitative PCR (RT-qPCR) analysis.

The gene expression in the planktonic cultures focused on the adhesion and quorum sensing in P. aeruginosa cells, and in biofilm cultures, it focused on the biofilm EPS matrix and microorganisms in biofilms.

Among planktonic P. aeruginosa cells, LED illumination significantly (P < 0.01) downregulated the expression of all genes associated with biofilm formation except lecA (Fig. 7A to C). Among the genes, the transcription of lasR and rhlR (critical for quorum sensing) and lecB (fucose-binding lectin PA-IIL) was downregulated gradually by LED illumination. In contrast, lecA (PA-I galactophilic lectin) transcription was gradually upregulated by LED treatment in response to increasing temperature.

FIG 7.

Effects of LED treatment for 2 h at (A, D) 4°C, (B, E) 10°C, and (C, F) 25°C on the transcription of various genes in planktonic and biofilm-associated P. aeruginosa cells. *, P < 0.05; **, P < 0.01 versus the control.

For biofilm cells (Fig. 7D to F), the transcription of pslA (biofilm-formation protein PslA) was significantly downregulated (P < 0.05) in response to LED treatment. The transcription of pslB (biofilm-formation protein PslB) was downregulated significantly (P < 0.05) by LED illumination at 10 and 25°C, and the transcription of oprM (outer membrane protein OprM) was downregulated significantly (P < 0.05) only by LED illumination at 10°C. However, regardless of illumination temperature, LED illumination did not significantly affect the transcription of bdlA (biofilm dispersion protein) (P > 0.05).

DISCUSSION

Pseudomonas aeruginosa is an opportunistic pathogen widely recovered from the environment. Medical implants, industrial equipment, and community equipment are readily colonized by P. aeruginosa biofilms, allowing the pathogen to disseminate among at-risk populations (18). To control the spread of P. aeruginosa, we evaluated the antibacterial and antibiofilm activities of 405-nm LED illumination. Stainless steel coupons were selected for use as substrates in this study because stainless steel is commonly used in pipes, invasive devices, and domestic surfaces. The efficiency of LED illumination against both planktonic and biofilm-associated P. aeruginosa cells was analyzed at 4, 10, and 25°C to simulate low-temperature environments, pipeline temperatures, and indoor environments, respectively. To combat biofilm contamination, the following four strategies have been considered: prevention of bacterial adhesion; inhibition of biofilm maturation; disruption of the biofilm EPS matrix; and killing of microorganisms in mature biofilms (19). In this study, we investigated the antibiofilm activity of 405-nm LED illumination according to these four strategies.

P. aeruginosa adhesion is mediated by oligosaccharides using a strategy involving carbohydrate-binding proteins such as lectins and other adhesins (20). LecA and LecB are soluble lectins that bind to galactose and fucose, respectively (21). These lectins act as virulence factors in P. aeruginosa because of their carbohydrate-binding abilities and their involvement in adhesion and biofilm formation (22). Kim et al. (23) found that raffinose regulates P. aeruginosa biofilm development by binding to LecA. Bhargava et al. (24) used fucose-functionalized silver nanoparticles to increase their interactions with the LecB lectins, resulting in a reduction of bacterial colonization on artificial silicone rubber surfaces. In the current study, LED illumination significantly downregulated lecB transcription (P < 0.05), while the transcription of lecA was upregulated (Fig. 7A to C). Taking into account the previous results, these findings suggest that the downregulation of lecB could reduce the adhesion and biofilm formation abilities of P. aeruginosa. However, these changes may be offset by the upregulation of lecA. Thus, the effects of LED illumination on the P. aeruginosa adhesion abilities should be confirmed in further studies.

Quorum sensing (QS) is a cell-to-cell communication system used by bacteria to control group behaviors collectively. Previous studies have demonstrated that P. aeruginosa uses QS to regulate biofilm maturation and virulence (25). The P. aeruginosa genome encodes two QS transcription factors: LasR and RhlR. The concentrations of N-3-oxo-dodecanoyl-homoserine lactone (3O-C₁₂-HSL, regulated by LasR) and N-butanoyl-homoserine lactone (C₄-HSL, regulated by RhlR) increase as cell densities increase (26). However, rhlR transcription is activated by LasR and the expression of both LasR- and RhlR-regulated target genes that are downregulated by the deletion of lasR (27, 28). Singh et al. (29) found that Delftia tsuruhatensis extract exhibited anti-QS and antibiofilm activities against P. aeruginosa via the downregulation of transcription of QS regulatory genes lasR, lasI, rhlR, and rhlI. Our RT-qPCR assay demonstrated that LED illumination at all temperatures significantly (P < 0.01) downregulated the transcription of lasR and rhlR in P. aeruginosa (Fig. 7A to C). We assume that LED illumination inhibited the secretion of signaling molecules, including C₄-HSL and 3O-C₁₂-HSL, and the synthesis of LasR and RhlR, disrupting QS and inhibiting biofilm maturation. Interestingly, because the effects of downregulation are most obvious at 4°C, P. aeruginosa QS systems were inhibited most effectively by LED treatment at 4°C.

Biofilm EPS consists of a mixture of polysaccharides, extracellular DNA, and proteins, which together form a matrix that effectively holds microbial cells together (30). The overall architecture and resistance phenotype of biofilms is determined by the biofilm matrix (31). Lee et al. (32) observed 37% and 69% decreases in the abundance of proteins and polysaccharides, respectively, in P. aeruginosa biofilms following treatment with a combination of copper ions and norspermidine. Liu et al. (33) demonstrated that the abundance of EPS in Enterococcus faecalis biofilms was significantly decreased (P < 0.05) in samples treated with 1.25 or 2.5 mg/ml phenyllactic acid compared with the control samples. In the present study, we confirmed that the abundance of EPS was decreased in P. aeruginosa biofilms treated with LED illumination using a combination of CLSM observations and ATR-FTIR spectra (Fig. 4 and 6). LED treatment also induces the generation of ROS within cells, which could cause severe oxidative damage to unsaturated fatty acids, residues, and cholesterol, resulting in changes in membrane permeability (34). We hypothesize that polysaccharides and proteins in biofilms suffer oxidative damage following LED illumination as a result of ROS accumulation, affecting the structure and functions of the biofilms. Psl, a polysaccharide synthesized by the polysaccharide synthesis locus (psl), is required for biofilm formation and surface attachment in P. aeruginosa (35). RT-qPCR results from the current study showed that the transcription of pslA and pslB was downregulated following LED illumination, further explaining the antibiofilm mechanism.

In the present study, we examined the antibiofilm effects of LED illumination on P. aeruginosa and found that LED treatment was most effective at 4°C compared with the other temperatures (Fig. 2A to C). Similarly, Ghate et al. (36) showed that the photodynamic inactivation of four different foodborne pathogens by 461-nm and 521-nm LED illumination was greater at 10 and 15°C than at 20°C. Li et al. (13) showed that populations of Listeria monocytogenes and Salmonella inoculated onto fresh salmon were reduced by 0.4 and 0.5 log CFU/cm², respectively, compared with the controls following LED illumination for 8 h at 4°C. In comparison, illumination at 12°C resulted in reductions of only 0.3 and 0.4 log CFU/cm², respectively. Low temperatures can delay enzyme activity, decrease the sensitivity of some metabolic regulatory processes, and alter the lipid composition of microbial cells. Low temperatures were shown to increase the proportion of unsaturated fatty acids in bacteria (37). Unsaturated fatty acids are susceptible to ROS generated by cells (34). Hence, we predict that low-temperature LED illumination causes changes in the lipid composition of P. aeruginosa cells, making them more susceptible to ROS and resulting in more effective antibiofilm activity.

Biofilm-associated cells are generally more tolerant of antibiotics and disinfectants than their planktonic counterparts (5). The EPS matrix can protect the deeper layers of cells in biofilms from damage and limit the diffusion of disinfectants into the biofilm (38). BC and CHX are the most common chlorine disinfectants currently used for the elimination of bacterial contamination. In this study, BC or CHX treatment alone was less effective at eliminating biofilms than BC or CHX treatment following LED illumination (Fig. 3). We hypothesize that LED illumination decreased the abundance of EPS in the biofilms, making the cells more susceptible to disinfection. A previous study showed that oprM encodes a major outer membrane efflux pump channel that, when disrupted, increases the susceptibility of bacterial cells to antibiotics usually exported by the pump (39). In the current study, the transcription of oprM was downregulated by LED illumination (Fig. 7D to F), although the decrease was only significant at 10°C. Therefore, we also predict that LED treatment causes slight changes in the outer membrane, making cells more permeable, and therefore more susceptible, to disinfectants.

Conclusion.

We demonstrated that 405-nm LED illumination has antibacterial and antibiofilm activities against P. aeruginosa. LED illumination effectively combats P. aeruginosa biofilms by reducing the biofilm biomass, collapsing the biofilm architecture, and downregulating the transcription of biofilm-associated genes. LED treatment also reduced EPS production, increased biofilm susceptibility to quaternary ammonium disinfectants (BC and CHX), and repressed the transcription of biofilm-associated genes. Importantly, P. aeruginosa cells in biofilms were more susceptible to treatment at low temperatures. Therefore, LED illumination could potentially be developed as an alternative method to prevent and control P. aeruginosa contamination in the environment.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

P. aeruginosa PAO1 was used in this study and stored at −80°C in tryptic soy broth (TSB) supplemented with 25% (vol/vol) glycerol. Prior to each assay, P. aeruginosa was plated on tryptic soy agar (TSA) and incubated at 37°C for 24 h. A single colony was then inoculated into 30 ml of TSB and incubated at 37°C with shaking at 130 rpm overnight. The resulting culture was centrifuged at 8,000 × g for 5 min at 4°C. The cell pellet was then washed twice with sterile phosphate-buffered saline (PBS). Subsequently, cells were diluted in PBS to an optical density at a wavelength of 600 nm (OD₆₀₀) of 0.5 (approximately 4 × 10⁸ CFU/ml).

LED illumination system.

The 405-nm LED (10 W) was purchased from Shenzhen Boya Technology Co. (Shenzhen, China). The LED was installed with a cooling fan and a heat sink to dissipate the heat generated during illumination. The LED illumination system was encased in an acrylonitrile butadiene styrene housing to block out all external light. A 5-Ω resistor was inserted into the circuit to protect the LED from excessive current. LED intensity was measured using a 405-nm radiometer (UHC405; UVATA Ltd., Hong Kong), with the value recorded as 24 ± 2 mW/cm². Cultures were placed into a glass petri dish (90 × 15 mm) for LED treatment, with the distance between the dish and the LED lamp adjusted to 4.5 cm (see Fig. S1 in the supplemental material). The LED system and samples were placed in biochemical incubators (SPX-160B; Shanghai Nanrong Laboratory Equipment Co. Ltd., Shanghai, China) which were set at 4, 10, or 25°C. The samples without LED illumination (control) were placed in biochemical incubators which were set at corresponding temperatures. A Thermocouple temperature monitor (Everett, WA, USA) was used to monitor the temperature variation per minute during LED illumination.

Time-dependent killing assay using planktonic cells.

The method of Kang et al. (40), with some modifications, was used to produce time-kill curves. Briefly, 20 ml of each culture (diluted to 10⁶ CFU/ml) was aliquoted into a glass petri dish and exposed to LED illumination at 4, 10, or 25°C. Cell viability was monitored hourly for 5 h by plating sample dilutions onto TSA plates and incubating at 37°C for 24 h. Because LED illumination causes slight increases in temperature, the control cultures were incubated at 5.4, 12.5, and 27.5°C, respectively. Decreases in the number of viable bacterial cells were determined by plotting the log CFU/ml values over time.

Biofilm formation.

Stainless steel coupons (type 304; finish 4; 5 cm by 2 cm by 0.1 cm) were used in this study. The coupons were sequentially submerged in acetone solution, anhydrous alcohol, and distilled water for ultrasonic cleaning. Following cleaning, coupons were air-dried and sterilized by autoclaving at 121°C for 25 min. The P. aeruginosa PAO1 inoculum was diluted in PBS to 10⁷ CFU/ml, and 30-ml aliquots were added to 50-ml centrifuge tubes containing a stainless-steel coupon. The tubes were then statically incubated at 25°C for 24 h. After attachment, the coupons were rinsed with 200 ml of PBS to remove unattached cells before being transferred to new 50-ml centrifuge tubes containing 30 ml of TSB. The samples were then incubated at 25°C for 48 h.

Time-kill assay using P. aeruginosa biofilms.

To evaluate the effects of LED illumination on P. aeruginosa biofilms formed on stainless steel under different temperatures, time-kill curves were determined according to the method of Amalaradjou and Venkitanarayanan (41) with some modifications. Stainless steel coupons carrying biofilms were used in these assays. Briefly, the coupons were rinsed twice with PBS to remove planktonic cells before being transferred into glass petri dishes and exposed to LED illumination at 4, 10, or 25°C. The control group was incubated at 12.5, 15.5, or 29.5°C, without LED illumination. Following exposure for 0, 0.5, 1, 2, 3, or 4 h, the coupons were transferred to 50-ml centrifuge tubes containing 3 g of glass beads (G8772; 425 to 600 μm; Sigma-Aldrich, St. Louis, MO, USA) and 30 ml of PBS. The tubes were then vortexed for 5 min, and serial dilutions of the bacterial suspension were plated on TSA and incubated at 37°C. Bacterial enumeration was carried out after 24 h.

Disinfectant sensitivity assay.

The disinfectant sensitivity of P. aeruginosa PAO1 biofilms following LED illumination was determined as described by Abdallah et al. (42). Briefly, stainless steel coupons carrying the biofilms were rinsed twice with PBS and exposed to LED illumination for 0, 1, or 2 h at 4, 10, or 25°C. Following illumination, coupons were transferred to 50-ml centrifuge tubes containing 30 ml of benzalkonium chloride (BC, 98%; CAS 63449-41-2, 100 ppm; J&K Scientific Co., Beijing, China) or chlorhexidine (CHX, 99%; CAS 55-56-1, 100 ppm; Chengdu Best Reagent Co., Chengdu, China) and incubated at room temperature for 15 min. The disinfectant treatment control was incubated at 12.5, 15.5, or 29.5°C without LED illumination. Untreated coupons (no disinfectant) were used as a negative control. Following incubation, coupons were submerged in 10 ml of neutralizing solution to stop the disinfection process. The neutralizing solution consisted of Tween 80 (30 g/ml), saponin (30 g/liter), lecithin (30 g/liter), sodium thiosulphate (5 g/liter), l-histidine (1 g/liter), and TSB (9.5 g/liter). After 10 min, the coupons were transferred to fresh 50-ml centrifuge tubes containing 3 g of glass beads and 30 ml of PBS and vortexed for 5 min to dissociate the attached cells. The cell suspensions were plated on TSA, and viability was assessed by plate counting, as described above.

Attenuated total reflection-Fourier transform infrared spectroscopy.

To determine the effects of LED illumination on the EPS component of biofilms, stainless steel coupons (type 304; finish 4; 0.6 cm by 0.6 cm by 0.1 cm) were used for attenuated total reflection-Fourier transform infrared spectroscopy (ATR-FTIR) analysis. The cleaning process and establishment of biofilms were as described above. Following biofilm formation, the coupons were exposed to LED illumination for 2 h at 4, 10, or 25°C. The control coupons were incubated at 12.5, 15.5, or 29.5°C without LED illumination. ATR-FTIR spectra (from 1,800 to 800 cm⁻¹) were acquired using an ATR-FTIR spectrometer (Vetex70; Bruker, Billerica, MA, USA) with a 1-cm⁻¹ resolution and 1,024 scans. Spectra generated for stainless steel coupons without biofilm were used to remove the spectral background. The resulting data were plotted using GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). The peaks corresponding to functional groups were searched and identified as described by Wang et al. (43).

Field-emission scanning electron microscopy observation.

Biofilm structure was evaluated using field-emission scanning electron microscopy (FESEM) (S-4800; Hitachi, Tokyo, Japan). P. aeruginosa biofilms were formed on stainless steel coupons (0.6 cm by 0.6 cm by 0.1 cm) and subjected to LED illumination for 2 h at 4, 10, or 25°C. Control coupons (without LED illumination) were incubated at 12.5, 15.5, or 29.5°C for 2 h. Coupons were incubated at 4°C overnight in PBS containing 2.5% (vol/vol) glutaraldehyde to fix the biofilms. Coupons were then washed twice with PBS and dehydrated using an ethanol gradient (30%, 50%, 70%, 80%, 90%, and 100%) to achieve final fixation. Coupons were then air-dried at room temperature, coated with gold, and observed at 5 kV.

Confocal laser scanning microscopy observation.

Confocal laser scanning microscopy (CLSM) (A1 confocal laser microscope; Nikon, Tokyo, Japan) was used to examine the effects of LED illumination on biofilm polysaccharides and structure at different temperatures. Biofilms were first formed on stainless steel coupons (0.6 cm by 0.6 cm by 0.1 cm) as described above. Following LED illumination for 2 h at 4, 10, or 25°C, the untreated and treated biofilms were stained with concanavalin-A fluorescein conjugate (Con-A; Invitrogen/Molecular Probes, Eugene, OR, USA) for 30 min at 4°C. Thereafter, the coupons were immobilized in 2.5% (vol/vol) glutaraldehyde for 2 h at 4°C and stained with Hoechst 33258 (Solarbio, Beijing, China) for 20 min at room temperature. Con-A stains biofilm polysaccharides green, while Hoechst 33258 stains bacterial cells blue. Finally, the biofilms were washed with PBS and examined using the confocal laser microscope under a 20× lens objective. Serial images were captured at 488 nm and 405 nm excitation wavelengths and processed using NIS-Elements Viewer 4.20 software (44).

RNA extraction and RT-qPCR.

Planktonic and biofilm P. aeruginosa PAO1 cells were used to determine the effects of LED illumination on the transcription of various biofilm-related genes at 4, 10, or 25°C. For planktonic cells, 20 ml of P. aeruginosa PAO1 culture (diluted to an OD₆₀₀ of 0.5) was added to a glass petri dish and exposed to LED illumination for 2 h at 4, 10, or 25°C. The controls were incubated at 5.4, 12.5, or 27.5°C for 2 h without LED illumination. For cells in biofilms, P. aeruginosa biofilms were formed on stainless steel coupons (5 cm by 2 cm by 0.1 cm) and exposed to LED illumination for 2 h at 4, 10, or 25°C. Control coupons not subjected to LED illumination were incubated at 12.5, 15.5, or 29.5°C for 2 h. All coupons were then transferred to 50-ml centrifuge tubes containing 3 g of glass beads and 30 ml of PBS and vortexed for 5 min.

RNA was extracted using an RNAprep pure bacteria kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. A nucleic acid and protein spectrophotometer (Nano-200; Aosheng Instrument Co., Hangzhou, China) was used to determine the RNA quality and concentration. RNA was then reverse transcribed into cDNA using a PrimeScript RT reagent kit (TaKaRa, Kyoto, Japan) as per the manufacturer’s instructions. cDNA samples were stored at −20°C until analysis. The sequences of primers used for RT-qPCR analysis are listed in Table 1.

TABLE 1.

Primers used in this study

Gene	Primer sequence (5′–3′)a
rpoD	F, GGGCGAAGAAGGAAATGGTC
	R, CAGGTGGCGTAGGTGGAGAA
lasR	F, TTCATAGAGTCGGTCCTGCCG
	R, GTTCACATTGGCTTCCGAGCAG
rhlR	F, ACCGGCATCAGGTCTTCATCG
	R, AAGCTCCCATACCGACGGATC
pslB	F, AAGGCTTCGCTGTCGTTGCAG
	R, GCTCTGTACCTCGATCATCACCAG
pslA	F, GGTCAGCGAATACAGCTCGC
	R, GTAGAGGTCGAACCACACCGAC
oprM	F, TACTACCAGCTCGCCGACAAG
	R, TCCTTCTTCGCGGTCTGCTG
lecA	F, TGTGGTGCGCTGGTCATGAAG
	R, GACACTGAACGAGCCGGAGTT
lecB	F, GTGCTGGTCAACAACGAGACG
	R, TAGTCGTTGTCGGTGCCGTCT
bdlA	F, AGATCGCCGAGCAGACCAAC
	R, ACCGCTTCTACCACCTTGTGC

^aF, forward; R, reverse.

RT-qPCR assays were performed in 25-μl volumes using the IQ5 system (Bio-Rad, Hercules, CA, USA) with SYBR Premix Ex Taq II (TaKaRa). Thermal cycling conditions included 1 cycle at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s, with a dissociation step of 95°C for 15 s and 60°C for 30 s. The 2^−ΔΔCT method was used to analyze relative gene transcription in the samples. lasR, rhlR, lecA, and lecB were examined in the planktonic cells, while pslB, pslA, oprM, and bdlA expression levels were examined in the biofilm cells. rpoD was selected as the housekeeping gene to assess relative gene expression (45).

Statistical analysis.

All experiments were performed in triplicate. Statistical analyses were performed using SPSS 23.0 (IBM, New York, NY, USA). Data were expressed as the mean ± standard deviation (SD). P < 0.05 and P < 0.01 were considered statistically significant and extremely significant, respectively.