Strain-Dependent Inhibition of Clostridioides difficile by Commensal Clostridia Carrying the Bile Acid-Inducible (bai) Operon

A D Reed; M A Nethery; A Stewart; R Barrangou; C M Theriot

doi:10.1128/JB.00039-20

. 2020 May 11;202(11):e00039-20. doi: 10.1128/JB.00039-20

Strain-Dependent Inhibition of Clostridioides difficile by Commensal Clostridia Carrying the Bile Acid-Inducible (bai) Operon

A D Reed ^a, M A Nethery ^b, A Stewart ^c, R Barrangou ^b, C M Theriot ^a,^✉

Editor: Laurie E Comstock^d

PMCID: PMC7221253 PMID: 32179626

Commensal Clostridia carrying the bai operon, such as C. scindens, have been associated with protection against CDI; however, the mechanism for this protection is unknown. Herein, we show four commensal Clostridia that carry the bai operon and affect C. difficile growth in a strain-dependent manner, with and without the addition of cholate. Inhibition of C. difficile by commensals correlated with the efficient conversion of cholate to deoxycholate, a secondary bile acid that inhibits C. difficile germination, growth, and toxin production. Competition studies also revealed that C. difficile was able to outcompete the commensals in an in vitro coculture system. These studies are instrumental in understanding the relationship between commensal Clostridia and C. difficile in the gut, which is vital for designing targeted bacterial therapeutics.

KEYWORDS: 7α-dehydroxylation, Clostridia, Clostridioides difficile, bile acids, cholate, deoxycholate

ABSTRACT

Clostridioides difficile is one of the leading causes of antibiotic-associated diarrhea. Gut microbiota-derived secondary bile acids and commensal Clostridia that carry the bile acid-inducible (bai) operon are associated with protection from C. difficile infection (CDI), although the mechanism is not known. In this study, we hypothesized that commensal Clostridia are important for providing colonization resistance against C. difficile due to their ability to produce secondary bile acids, as well as potentially competing against C. difficile for similar nutrients. To test this hypothesis, we examined the abilities of four commensal Clostridia carrying the bai operon (Clostridium scindens VPI 12708, C. scindens ATCC 35704, Clostridium hiranonis, and Clostridium hylemonae) to convert cholate (CA) to deoxycholate (DCA) in vitro, and we determined whether the amount of DCA produced was sufficient to inhibit the growth of a clinically relevant C. difficile strain. We also investigated the competitive relationships between these commensals and C. difficile using an in vitro coculture system. We found that inhibition of C. difficile growth by commensal Clostridia supplemented with CA was strain dependent, correlated with the production of ∼2 mM DCA, and increased the expression of bai operon genes. We also found that C. difficile was able to outcompete all four commensal Clostridia in an in vitro coculture system. These studies are instrumental in understanding the relationship between commensal Clostridia and C. difficile in the gut, which is vital for designing targeted bacterial therapeutics. Future studies dissecting the regulation of the bai operon in vitro and in vivo and how this affects CDI will be important.

IMPORTANCE Commensal Clostridia carrying the bai operon, such as C. scindens, have been associated with protection against CDI; however, the mechanism for this protection is unknown. Herein, we show four commensal Clostridia that carry the bai operon and affect C. difficile growth in a strain-dependent manner, with and without the addition of cholate. Inhibition of C. difficile by commensals correlated with the efficient conversion of cholate to deoxycholate, a secondary bile acid that inhibits C. difficile germination, growth, and toxin production. Competition studies also revealed that C. difficile was able to outcompete the commensals in an in vitro coculture system. These studies are instrumental in understanding the relationship between commensal Clostridia and C. difficile in the gut, which is vital for designing targeted bacterial therapeutics.

INTRODUCTION

Clostridioides difficile is an anaerobic, spore-forming, toxigenic bacterial pathogen (1). C. difficile infection (CDI) is a major cause of antibiotic-associated diarrhea and a significant health issue, as it causes 453,000 infections and is associated with 29,000 deaths and $4.8 billion in excess medical costs a year in the United States alone (2). While the current first-line treatment of vancomycin can resolve CDI, 20% to 30% of patients who successfully clear the infection experience recurrence (recurrent CDI [rCDI]) within 30 days, and 40% to 60% of those who experience one episode of rCDI will experience further recurrences (3, 4). Antibiotic use is a significant risk factor for CDI, as antibiotics alter the gut microbiome, causing a loss of colonization resistance against C. difficile (5 –7). This alteration of the microbiome also affects the gut metabolome, causing a loss in beneficial metabolites, including secondary bile acids generated by the gut microbiota (6, 8). Many of these secondary bile acids are inhibitory to C. difficile in vitro and are associated with protection against CDI in mice and humans (9, 10).

Deoxycholate (DCA) is an abundant secondary bile acid in the gut, with concentrations ranging from 0.03 to 0.7 mM in the non-antibiotic-treated gut (11). DCA is synthesized from the primary bile acid cholate (CA) via a multistep pathway that results in 7α-dehydroxylation of CA (12). The enzymes responsible for this synthesis are encoded by the bile acid-inducible (bai) operon, which is also capable of synthesizing the secondary bile acid lithocholate (LCA) from the primary bile acid chenodeoxycholate (CDCA) (13). A small population of commensal bacteria carrying the bai operon are capable of transforming CA to DCA, including Clostridium cluster XIVa members Clostridium scindens and Clostridium hylemonae, as well as Clostridium cluster XI member Clostridium hiranonis (14 –16). Several enzymes are capable of completing the steps in this transformation, including the bile acid transporter BaiG, the bile acid 7α-dehydratase BaiE, and the flavoprotein BaiN (13, 17 –19). While regulation of the bai operon and of baiN has yet to be completely elucidated, in vitro studies show that CA upregulates genes in the bai operon and DCA downregulates them in C. scindens ATCC 35704, C. hylemonae, and C. hiranonis (20, 21).

Secondary bile acids are able to inhibit different stages of the C. difficile life cycle. DCA alone is able to inhibit the outgrowth of C. difficile, reduce motility, and decrease the expression of flagellar proteins and toxins in vitro (9, 22 –24). In vivo studies show the presence of baiCD, a gene needed for 7α-dehydroxylation, is negatively correlated with CDI in humans, although in another study, C. scindens was present in the same stool samples as C. difficile (25, 26). In addition, C. scindens ATCC 35704 is associated with protection against CDI in mouse models, and C. hiranonis is negatively correlated with the presence of C. difficile in canines, but the exact mechanism of this potential protective effect is still unknown (27 –29).

While the production of inhibitory metabolites such as secondary bile acids may be responsible for these potential protective effects, competition for nutrients from other bacteria in the gut, including commensal Clostridia, may also play a role. Nutrient competition is another mechanism by which the gut microbiota provides colonization resistance against pathogens. A decrease in specific gut metabolites that C. difficile requires for growth (e.g., proline, branched-chain amino acids, and carbohydrates) has been associated with CDI in a mouse model and in humans (30 –32). In support of this, colonization of a susceptible host by a nontoxigenic strain of C. difficile can protect against later colonization by a toxigenic strain (33, 34). This suggests that colonization by a bacterial strain with similar nutritional requirements can have a protective effect on the host. There is evidence that C. difficile shares some nutritional requirements with commensal Clostridia, including the amino acid tryptophan and the vitamins pantothenate and pyridoxine, for which both C. scindens ATCC 35704 and C. difficile are auxotrophic (21, 35). C. difficile is also auxotrophic for five additional amino acids other than tryptophan, including isoleucine, leucine, and proline, which are all highly efficient electron donors or acceptors in Stickland fermentation (35, 36). Products of Stickland fermentation are important for growth in C. difficile and many other Clostridia, such as Clostridium sticklandii and Clostridium sporogenes (35 –40). C. hiranonis and C. hylemonae both carry genes encoding enzymes involved in Stickland fermentation that were highly expressed in vivo. C. scindens ATCC 35704 has also demonstrated in vitro genomic potential for Stickland fermentation (20, 21). Therefore, these commensal Clostridia could potentially compete with C. difficile for the amino acids it requires for growth and colonization.

In this study, we hypothesized that commensal Clostridia are important for providing colonization resistance against C. difficile due to their ability to produce secondary bile acids and their potential competition against C. difficile for similar nutrients. This hypothesis was tested by examining the ability of four commensal Clostridia carrying the bai operon (C. scindens VPI 12708, C. scindens ATCC 35704, C. hiranonis TO-931, and C. hylemonae TN-271) to convert CA to DCA in vitro. The amount of DCA produced was analyzed, and the inhibitory effects of the supernatants against a clinically relevant strain of C. difficile were tested. We also investigated the competitive relationships between these commensals and C. difficile using an in vitro coculture system. We found that inhibition of C. difficile growth by commensal Clostridia supplemented with CA was strain dependent, correlated with the production of ∼2 mM DCA, and increased the expression of bai operon genes. We also found that C. difficile was able to outcompete all four commensal Clostridia in an in vitro coculture system. These studies will be instrumental in understanding the relationships between commensal Clostridia and the pathogen C. difficile in the gut, which is vital for designing targeted bacterial therapeutics. Future studies dissecting the regulation of the bai operon in vitro and in vivo and how this affects CDI will be important.

RESULTS

Genomic comparison between commensal Clostridia that carry the bai operon.

The bai operons and the baiN genes from C. scindens VPI 12708, C. hiranonis TO-931, and C. hylemonae TN-271 were visually aligned, and the amino acid sequences were compared to those of the reference strain C. scindens ATCC 35704 (Fig. 1). The operons of both C. scindens ATCC 35704 and C. scindens VPI 12708 are architecturally similar, with each gene within the operon sharing at least 97% identity at the amino acid level. Interestingly, C. hylemonae TN-271 possesses a shorter bai operon due to the lack of the baiA2 gene, while the bai operon of C. hiranonis TO-931 is ∼1 kb longer than the reference operon due to expanded intergenic regions. C. hylemonae TN-271 shares between 63% and 89% identity with the reference operon, and C. hiranonis displays between 48% and 90% identity. Notably, the outermost protein-coding sequences in the bai operon of C. hylemonae TN-271 and C. hiranonis TO-931, baiB and baiI, exhibit a significantly reduced percent identity compared to other genes in the operon.

FIG 1 — Genomic variation in selected *bai* genes carried by commensal *Clostridia*. Alignment of the *bai* operon and *baiN* across *Clostridium* strains. Each protein sequence was compared against its counterpart in the reference strain *Clostridium scindens* ATCC 35704, generating the amino acid percent identity labeled within each gene.

The differences in identity across these four operons are largely representative of the whole-genome nucleotide comparison of each strain (see Fig. S2 in the supplemental material), with C. hiranonis TO-931 sharing the least identity to the reference strain C. scindens ATCC 35704, followed by the slightly higher percent nucleotide identity of C. hylemonae TN-271, with C. scindens VPI 12708 sharing the highest nucleotide identity.

C. difficile is more resistant to cholate and less resistant to deoxycholate than are commensal Clostridia.

Since secondary bile acids such as DCA are made by specific commensal Clostridia carrying the bai operon from CA and are inhibitory against C. difficile, we sought to examine the resistance profiles of these bacteria to CA and DCA (9). We did this by performing MIC assays with CA and DCA for multiple strains of C. difficile as well as four commensal Clostridia that carry the bai operon (14 –16). C. difficile R20291 had a high MIC of 10 mM with CA but a much lower MIC of 1.56 mM with DCA (Fig. 2 and Table S1). When four other C. difficile strains were tested, the results were similar, with 630, CD196, CF5, and M68 all having MICs greater than 10 mM for CA and MICs of 1.25 mM for DCA (Fig. S3). Of the commensal Clostridia, C. hylemonae had the highest MIC against CA with 7 mM, while C. hiranonis and the two C. scindens strains all had an MIC of 2.5 mM for CA. Of the commensals, C. hiranonis was most sensitive to DCA, with an MIC of 0.78 mM. C. hylemonae was also sensitive to DCA, with an MIC of 1.25 mM. The two C. scindens strains were more resistant to DCA, with C. scindens VPI 12708 having an MIC of 1.88 mM and C. scindens ATCC 35704 having an MIC of 2.19 mM. Although the commensal Clostridia tested have all shown the ability to produce DCA in vitro, they all display sensitivity to it. Out of the four commensal strains, only the two C. scindens strains had higher resistance to DCA than did C. difficile R20291. Different concentrations of CA and DCA were also able to alter the growth kinetics of the commensal Clostridia and C. difficile R20291, as seen in Fig. S4 and S5.

FIG 2 — *C. difficile* and *C. hylemonae* are more resistant to cholate than are other commensal *Clostridia* tested. The MICs of CA and DCA were tested on *C. difficile* R20291, *C. scindens* VPI 12708, *C scindens* ATCC 35704, *C. hiranonis,* and *C. hylemonae*. The MIC was defined as the lowest concentration of compound that showed no visible growth. Growth was defined at 24 h for *C. difficile* and 48 h for commensal *Clostridia*. Four biological replicates were performed.

Commensal Clostridia inhibit C. difficile in a strain-dependent manner that correlates with the conversion of cholate to deoxycholate.

While all four commensal Clostridia examined in this study have been shown to produce DCA from CA in vitro, we wanted to ascertain whether this was sufficient to inhibit C. difficile growth (15, 16, 41). We developed an in vitro inhibition assay using supernatants from overnight cultures of commensal Clostridia supplemented or not with different concentrations of CA. The supernatants were then added to fresh C. difficile cultures to investigate if commensal Clostridia capable of producing DCA from CA were able to inhibit C. difficile growth. When the supernatant from C. scindens VPI 12708 cultures supplemented with 0.25 mM CA and no CA were added to C. difficile cultures, there was no inhibition of growth after 24 h. When C. scindens VPI 12708 cultures were supplemented with 2.5 mM CA, the supernatant significantly inhibited C. difficile growth (Fig. 3A). The level of inhibition was similar to the level of inhibition seen when C. difficile was grown with 2.5 mM DCA alone (Fig. S6). In order to determine the levels of CA and DCA present in the supernatants added to C. difficile cultures, targeted liquid chromatography-mass spectrometry (LC/MS) was performed. C. scindens VPI 12708 was able to convert almost all of the CA present in the medium to DCA (Fig. 3A). When the medium was supplemented with 0.25 mM CA, 0.24 ± 0.02 mM DCA was produced, and 1.97 ± 0.21 mM DCA was produced when the medium was supplemented with 2.5 mM CA (DCA values are means ± standard deviations). Supernatant from C. scindens ATCC 35704 cultures also greatly inhibited C. difficile when grown in medium supplemented with 2.5 mM CA (Fig. 3B), but some inhibition was also seen with supernatant from cultures supplemented with 0.25 mM CA and no CA. This is likely due to the production of tryptophan-derived antimicrobials produced by this C. scindens strain that have previously been shown to inhibit C. difficile (42). C. scindens ATCC 35704 also converted most of the CA present in the medium to DCA (Fig. 3B), with 0.19 ± 0.05 mM DCA being produced when the medium was supplemented with 0.25 mM CA and 1.95 ± 0.38 mM DCA produced when supplemented with 2.5 mM CA. The C. hiranonis and C. hylemonae culture supernatants did not significantly inhibit C. difficile growth (Fig. 3C and D), regardless of the amount of CA present in the culture medium. C. hiranonis did convert some of the CA to DCA (Fig. 3C), with 0.14 ± 0.03 mM DCA being produced when supplemented with 0.25 mM CA and 0.78 ± 0.05 mM DCA produced when supplemented with 2.5 mM CA. C. hylemonae did not convert any of the CA present in the medium to DCA (Fig. 3D).

FIG 3 — Inhibition of *C. difficile* by *C. scindens* grown in medium supplemented with 2.5 mM cholate is correlated with high levels of deoxycholate production. Shown is inhibition of *C. difficile* after 24 h of growth with supernatants from *C. scindens* VPI 12708 (A), *C. scindens* ATCC 35704 (B), *C. hiranonis* grown without bile acid supplementation or supplemented with 0.25 or 2.5 mM CA (C), and *C. hylemonae* grown without bile acid supplementation or supplemented with 2.5 mM or 7.0 mM CA (D). The concentrations of CA and DCA in each supernatant are shown to the right of the inhibition data. Experiments were run in duplicate, and three biological replicates were performed. Inhibition by the supernatants was compared to a no-bile-acid *C. difficile* control consisting of a 4:1 dilution of PBS to BHI. Statistical significance between treatments and the control was determined using one-way ANOVA, with Tukey used for multiple comparisons (**, P < 0.01; ****, P < 0.0001).

Expression of baiE and baiG is increased when cholate is converted to deoxycholate.

To investigate the effect of different concentrations of CA on the expression of the bai operon, three genes were selected for quantitative reverse transcription-PCR (qRT-PCR) analysis. We selected baiG, which is responsible for transport of CA into the cell, baiE, which is responsible for the irreversible and rate-limiting conversion from 3-oxo-4,5-dehydro-cholyl coenzyme A (3-oxo-4,5-dehydro-cholyl-CoA) to 3-oxo-4,5-6,7-didehydro-deoxy-cholyl-CoA, and baiN, which is capable of performing the first two reductive steps in the pathway (18, 19, 43). Commensal Clostridia cultures were grown in a rich medium supplemented with different concentrations of CA for a 24-h period, followed by RNA extraction before qRT-PCR analysis. C. scindens VPI 12708 had a significant increase in the expression of baiE and baiG when 0.25 mM or 2.5 mM CA was present in the cultures (Fig. 4A). C. scindens ATCC 35704 also showed a significant increase in the expression in baiE and baiG when 2.5 mM CA was present in cultures but not with 0.25 mM CA (Fig. 4B). C. hiranonis had a significant increase in expression in baiE and baiG when 2.5 mM CA was present in the cultures (Fig. 4C), but the increased expression is approximately 10-fold less than with either C. scindens strain with an equal amount of CA in the medium. C. hylemonae had a decrease in the expression of baiE when 2.5 mM CA was added (Fig. 4D), and decreased expression of baiE and baiG occurred when 7 mM CA was added. The expression of baiN was not affected by the different CA concentrations in the medium, although a small but significant increase was seen in C. scindens ATCC 35704 when supplemented with 2.5 mM CA.

FIG 4 — *C. scindens* and *C. hiranonis* have increased expression in *bai* operon genes when medium is supplemented with 2.5 mM CA. Shown is expression of *baiG*, *baiE,* and *baiN* in *C. scindens* ATCC 35704 (A), *C. scindens* VPI 12708 (B), *C. hiranonis* in medium without CA or medium supplemented with 0.25 mM or 2.5 mM CA (C), and *C. hylemonae* in medium without CA or medium supplemented with 2.5 mM or 7.0 mM CA (D). Experiments were run in quadruplicate, and three biological replicates were performed. The expression in medium supplemented with CA was compared to the expression in medium without CA. Statistical significance was determined by one-way ANOVA, with Tukey used for multiple comparisons (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

C. difficile outcompetes commensal Clostridia in a strain-dependent manner.

In order to explore our additional hypothesis that commensal Clostridia are able to compete against C. difficile for similar nutrients, we performed 1:1 competition assays between commensal Clostridia and C. difficile in rich medium without the addition of CA (Fig. 5 and S7). A monoculture of each strain was used as a control for each replicate performed. The competition index (Fig. 5) was calculated by dividing the CFU of each strain after 24 h of growth in the 1:1 competition assay by the CFU of the monoculture control after 24 h. The raw data from the competition assays are available in Fig. S7. All commensal Clostridia growth was significantly inhibited in coculture with C. difficile, with C. hiranonis being affected the most. C. difficile growth was not negatively affected by any commensal strain except for C. scindens ATCC 35704, which is consistent with the inhibition observed by C. scindens ATCC 35704 culture supernatant without CA in Fig. 3A and the inhibition observed by Kang et al. (42).

FIG 5 — *C. difficile* outcompetes commensal *Clostridia in vitro*. Competition index for 1:1 competition between *C. difficile* and *C. scindens* ATCC 35704, *C. scindens* VPI 12708, *C. hylemonae,* and *C. hiranonis*. The competition index value was determined by comparing the CFU per milliliter of the competition coculture to that of the monoculture for each strain at 24 h. Statistical significance was determined by using Student's t test (**, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

DISCUSSION

In this study, we examined the genomic variation between four commensal Clostridia strains containing the bai operon, determined their ability to produce DCA when supplemented with CA, and investigated their ability to inhibit C. difficile in vitro. While C. scindens VPI 12708, C. scindens ATCC 35704, and C. hiranonis all produced DCA under these conditions (Fig. 4), only C. scindens strains were able to inhibit C. difficile when supplemented with 2.5 mM CA. This is likely due to the efficient conversion of CA to DCA produced when they were supplemented with 2.5 mM CA. C. hiranonis produced less DCA (0.78 mM) when supplemented with 2.5 mM CA. This could be due to the lower MIC of C. hiranonis with DCA (0.78 mM) than those of C. scindens VPI 12708 (1.88 mM) and C. scindens ATCC 35704 (2.19 mM). Additionally, C. difficile inhibited the growth of all four commensals tested in a 1:1 in vitro competition assay without the presence of CA, with only C. scindens ATCC 35704 affecting C. difficile growth, which is likely due to the antimicrobial it produces (42).

The proteins encoded by the bai operon of C. scindens VPI 12708 had a high amino acid similarity (∼97%) to those of C. scindens ATCC 35704, but C. hylemonae and C. hiranonis were more divergent than expected. This pattern continued when examining the genome, with C. hiranonis and C. hylemonae diverging from C. scindens ATCC 35704 more than C. scindens VPI 12708. Of particular interest is the lack of baiA2 in the bai operon in C. hylemonae. baiA2 encodes a short-chain dehydrogenase/reductase that is responsible for two steps in the 7α-dehydroxylation pathway. One of those steps is the conversion from cholyl-CoA to 3-oxo-cholyl-CoA in the oxidative arm, and the other is the conversion from 3-oxo-DCA to DCA in the reductive arm of the pathway (13, 44). However, it is important to note that while C. hylemonae lacks baiA2 in the main bai operon, baiA1 is present elsewhere in the genome under the control of a different promoter (12). baiA1 can also perform the conversion from cholyl-CoA to 3-oxo-cholyl-CoA (44, 45). It is also important to note that there may be other redundancies built in to the 7α-dehydroxylation pathway. When baiN was expressed in Escherichia coli, it was capable of performing two conversions, that of 3-oxo-4,5-6,7-didehydro-DCA to 3-oxo-4,5-dehydro-DCA and then to 3-oxo-DCA. More recently, the entire bai operon pathway was expressed in C. sporogenes and showed the same two steps being performed by different enzymes, BaiH and BaiCD, respectively (13, 43). While both sets of enzymes are capable of performing these transformations, it is still unknown which one is preferentially utilized by Clostridia carrying the bai operon.

Given the complexity of the 7α-dehydroxylation pathway and the apparent redundancies built in, the production of DCA is likely very important for the commensal Clostridia carrying the bai operon. It was surprising to see relatively low MICs for all four commensal Clostridia against DCA (Fig. 2), as this indicates that the organisms are producing something that is detrimental to them in a sufficient concentration. The reason these commensals produce DCA is not known, but dietary DCA has been shown to affect the microbiota in chickens, and dietary CA supplementation in rats resulted in the outgrowth of Clostridia and an increase in DCA, suggesting that the production of DCA may modulate the microbiome in a way that is favorable to these Clostridia (46, 47). While DCA, like other bile acids, has detergent-like properties, the specific mechanisms of action of DCA or other bile acids involved in 7α-dehydroxylation, such as CDCA and LCA, against commensal Clostridia have yet to be elucidated. DCA and other bile acids have various effects on other bacteria found in the gut. In Lactobacillus and Bifidobacteria spp., DCA, CA, and CDCA can inhibit growth by dissipating transmembrane electric potential and the transmembrane proton gradient (48). Bile acids, including DCA, can induce the transcription of several genes responsible for DNA repair and recombination in Escherichia coli, Salmonella enterica serovar Typhimurium, Bacillus cereus, and Listeria monocytogenes (49). Genes responsible for maintaining the integrity of the cellular envelope were also upregulated in B. cereus and L. monocytogenes, indicating that bile acids such as DCA and CDCA damage the bacterial membrane and cellular DNA (49).

Bile acids have multiple effects on C. difficile as well. The presence of flagella, as well as the presence of the flagellar structural protein FliC, was significantly decreased when C difficile was challenged with DCA, CDCA, and LCA, with LCA causing a near-complete loss of flagellar filaments (24). CA did not have any significant effect on flagella in C. difficile, but cells challenged with CA, DCA, or CDCA were significantly longer than the control cells, while LCA had no significant effect on cellular shape (24). While this indicates a potential mechanism for the inhibition of growth by DCA, CDCA, and LCA, the mechanism for how these bile acids inhibit C. difficile toxin activity is still unknown (9, 24, 50).

C. difficile showed a very high tolerance to CA, with an MIC of 10 mM when grown in 100 μl of brain heart infusion (BHI) medium (Fig. 2). Interestingly, when C. difficile was grown in 200 μl of BHI medium in the growth kinetics assay, growth was observed at 10 mM CA, and complete inhibition only occurred at a concentration of 13 mM CA (see Fig. S4 in the supplemental material). It is important to note that while no precipitation was visible in either the MIC or growth kinetics assay, bile acids do form micelles at millimolar concentrations, such as the ones used in this study, especially in lipid-rich environments such as BHI medium, meaning that some of the CA may be in micelles and not interacting with C. difficile (51). CA also appeared to decrease the lag time of C. difficile when growth kinetics were analyzed (Fig. S4), indicating that supplementation with CA could be beneficial to C. difficile growth as well as spore germination (22).

While all four commensal strains tested are capable of making DCA, only the C. scindens strains were capable of making enough to inhibit C. difficile (Fig. 3A and B) in the in vitro assay performed. This is likely due to the larger amount of DCA produced when C. scindens was supplemented with 2.5 mM CA. Under the conditions tested, C. hylemonae did not produce DCA regardless of the amount of CA added to the medium (Fig. 3D), and no increased activity in the bai operon was observed when the medium was supplemented with 2.5 mM CA or 7 mM CA. In another study, C. hylemonae did have increased expression of several genes in the bai operon, including baiE and baiG, in a defined medium supplemented with 0.1 mM CA. We tested the expression of baiG, baiE, and baiN in BHI medium supplemented with 0.1 mM CA and found no increase in expression (data not shown) (20). This indicates that the regulation of the bai operon may be dependent upon changes in the nutritional needs of the bacterium as well as the presence or absence of bile acids, and there may be strain-specific differences in regulation. While C. hiranonis did produce DCA and had increased expression in bai operon genes (Fig. 4C) under the conditions tested, supernatants from C. hiranonis were not able to inhibit C. difficile, as it produced less DCA than did either C. scindens strain (Fig. 3C). This is likely due to the susceptibility of C. hiranonis to DCA, as the MIC for DCA was lower than that of C. difficile, and the amount of DCA produced (0.78 mM) was the same as the MIC for DCA (Table S1). While we did not perform the inhibition assay with CDCA, which is converted to LCA by the bai operon, the expression of baiG, baiE, and baiN was tested in C. scindens VPI 12708 and C. hylemonae cultures supplemented with 0.025, 0.25, and 1.25 mM CDCA. No significant changes in expression were found in the presence of CDCA compared to the no-bile-acid control (data not shown).

While the production of DCA is a factor in the inhibition of C. difficile by commensal Clostridia containing the bai operon, competition for nutrients may also play a role. Like most Clostridia, C. scindens, C. hylemonae, and C. hiranonis encode enzymes that are used in Stickland fermentation, which is required for the growth of C. difficile and several other Clostridia (20, 21, 36, 37). In particular, proline, for which C. difficile is auxotrophic, is one of the most efficient electron acceptors. Another amino acid that most commensal Clostridia can utilize for growth is hydroxyproline, which can be converted to proline using the hypD gene, which is present in many Clostridia (52, 53). There is also the production of other inhibitory metabolites to consider, such as the tryptophan-derived antibiotics 1-acetyl-β-carboline and turbomycin A, that are produced by C. scindens ATCC 35704 and inhibit C. difficile (42). C. difficile is also capable of the production of inhibitory molecules. C. difficile ATCC 9689 produces proline-based cyclic dipeptides which inhibit C. scindens ATCC 35704, Clostridium sordellii, and several other bacterial strains commonly found in the gut (42). As well as suggesting an important role for tryptophan, which is required for the growth of C. difficile and C. scindens ATCC 35704, this indicates a potential mechanism for the inhibition of commensal Clostridia when cocultured with C. difficile (21, 35) (Fig. 5).

Finally, there are some limitations to this study. As was seen with the expression of baiE and baiG in C. hylemonae (Fig. 4), the type of medium that is used for in vitro assays could affect the expression of some genes. In addition, in vitro assays do not systematically mimic the in vivo environment, especially when studying a complex gut environment. In addition, due to the lack of genetic tools available for these commensal Clostridia at the time of the study, all assays were performed with wild-type strains. This means that in the experiments assessing the inhibition of commensal Clostridia by CA, the MIC values for C. scindens and C. hiranonis were likely affected by the conversion of some of the CA in the medium to DCA in the assay. While 7α-dehydroxylation also transforms CDCA to LCA, only the inhibition of C. difficile by commensal Clostridia supplemented with CA was examined in this study due to solubility issues with LCA in medium.

The genetic intractability of commensal Clostridia has made separating the inhibitory effects of 7α-dehydroxylation from other potentially inhibitory mechanisms, such as nutrient competition or the production of antimicrobials, difficult (42). However, a recently published CRISPR-Cas9-based method for constructing multiple markerless deletions in commensal Clostridia shows great promise in assisting with this analysis (54). Future in vitro studies using defined medium are also needed to further examine the role nutrient competition between C. difficile and commensal Clostridia. Additional in vivo studies are also needed to elucidate the direct mechanistic role that 7α-dehydroxylation by commensal Clostridia plays in colonization resistance against C. difficile. Additional studies dissecting the regulation of the bai operon in vitro and in vivo and how this affects CDI will be important for future therapeutic interventions.

MATERIALS AND METHODS

Genomic analysis of commensal Clostridia strains and the bai operon.

The bai operon alignment was constructed by first extracting the positional information for each bai gene of interest from Geneious (55) and then obtaining amino acid identity percentages through BLASTp alignments (56) against coding sequences from the reference strain C. scindens ATCC 35704. These data were visualized using the publicly available gggenes R package (57), with slight modifications. All alignments that were compared to C. scindens ATCC 35704 were visualized using the BLAST Ring Image Generator (58), including entries for GC content and GC skew. BLASTn was used for this alignment, with an upper identity threshold of 90%, a lower identity threshold of 50%, and a ring size of 30.

Bacterial strain collection and growth conditions.

The C. difficile strain used throughout this study was R20291, a clinically relevant strain from the 027 epidemic ribotype (9). Additional C. difficile strains used were CD196 also from ribotype 027, CF5 and M68 from the 017 ribotype, and 630 from ribotype 012 (9). All assays using C. difficile were started from spore stocks, which were prepared and tested for purity as described previously (9, 59). C. difficile spores were maintained on brain heart infusion (BHI) medium supplemented with 100 mg/liter l-cysteine and 0.1% taurocholate (catalog no. T4009; Sigma-Aldrich). Then, cultures were started by inoculating a single colony from the plate into BHI liquid medium supplemented with 100 mg/liter l-cysteine.

Four strains of commensal Clostridia carrying the bai operon were used in this study. Clostridium scindens ATCC 35704 (catalog no. 35704) was purchased from the American Type Culture Collection. Clostridium scindens VPI 12708, Clostridium hylemonae TN-271, and Clostridium hiranonis TO-931 were obtained from Jason M. Ridlon (University of Illinois at Urbana-Champaign, Champaign, IL). All strains were maintained on 15% glycerol stocks stored in −80°C until use and were grown in BHI medium supplemented with 100 mg/liter l-cysteine. The medium for C. hiranonis was BHI supplemented with 100 mg/liter l-cysteine and 2 μM hemin. All strains used in this study were grown under 2.5% hydrogen under anaerobic conditions (Coy, USA) at 37°C.

MIC assay with the addition of bile acids.

MICs were determined using the modified Clinical and Laboratory Standards Institute broth microdilution method, as described previously (59). The inoculum was prepared by the direct colony suspension method. All cell concentrations were adjusted to an optical density at 600 nm (OD₆₀₀) of 0.01. Briefly, the MIC plates were prepared by making fresh bile acid dilution stocks in the test medium and then adding 90 μl to each well such that the final concentration of the bile acid after the addition of cells (10 μl) ranged from 0.04 mM to 10 mM for CA (catalog no. 102897; MP Biomedicals) and 0.01 mM to 2.5 mM for DCA (catalog no. D6750; Sigma-Aldrich). Four biological replicates were performed. Positive controls were inoculated cells with no bile acid in the test medium. The uninoculated medium was used as a control for sterility. C. scindens, C. hiranonis, and C hylemonae were incubated for 48 h, while C. difficile was incubated for 24 h anaerobically at 37°C. All assays were performed in BHI medium supplemented with 100 mg/liter l-cysteine. For assays involving C. hiranonis, the BHI medium was also supplemented with 2 μM hemin.

Growth kinetics assay.

C. scindens, C. hiranonis, C. hylemonae, and C. difficile liquid cultures were started from a single colony, grown for 14 h, subcultured 1:10 and 1:5 in liquid medium, and allowed to grow for 3 h or until doubling. Cultures were then diluted in fresh BHI medium supplemented with various concentrations of CA or DCA so that the starting OD₆₀₀ was 0.01. The growth medium for C. hylemonae was BHI medium supplemented with 2 μM hemin and various concentrations of CA or DCA. Growth studies were performed in 200 μl of medium over 24 h using a Tecan plate reader inside the anaerobic chamber. The OD₆₀₀ was measured every 30 min for 24 h, and the plate was shaken for 90 s before each reading was taken. Three technical replicates were performed for each concentration of bile acid, and three biological replicates were performed for each organism.

C. difficile inhibition assay with supernatants from commensal Clostridia supplemented or not with bile acids.

Cultures of C. scindens and C. hiranonis were grown in fresh BHI medium supplemented with 0 mM, 0.25 mM, or 2.5 mM CA, while cultures of C hylemonae were grown in fresh BHI medium supplemented with 0 mM, 2.5 mM, or 7 mM CA. After 14 h of growth, cultures were spun down anaerobically at 6,000 rpm for 5 min. Supernatants were then sterilized under anaerobic conditions using a 0.22-μm filter and used in the inhibition assay at a ratio of 4 parts supernatant to one part BHI medium.

Cultures of C. difficile were started from a single colony, grown for 14 h, subcultured 1:10 and 1:5 in liquid medium, allowed to grow for 3 h or until doubling, and then diluted to an optical density (OD) of 0.01 in a mixture of 4 parts filtered supernatant to 1 part BHI medium. C. difficile grown in a mixture of 4 parts phosphate-buffered saline (PBS) to 1 part BHI medium was used as a control for this assay.

Bile acid controls included C. difficile grown in BHI medium supplemented with 0.25 mM, 2.5 mM, or 7 mM CA, as well as BHI medium supplemented with 0.25 mM or 2.5 mM DCA. C. difficile grown in BHI without bile acid supplementation was used as a positive control. Cultures were allowed to incubate for 24 h anaerobically at 37°C, dilutions were plated on BHI plates, and the number of CFU was calculated the next day. Aliquots of the supernatants from C. scindens, C. hiranonis, and C. hylemonae from this assay were stored at −80°C for later bile acid metabolomic analysis.

Bile acid metabolomic analysis.

Culture medium supernatants were diluted 1:100 in methanol (2 μl supernatant, 198 μl methanol [MeOH]) and analyzed by ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS). BHI medium alone was also analyzed for the presence of CA and DCA. Both CA and DCA were below the lower limit of quantification (LLOQ) in the BHI medium controls. The analysis was performed using a Thermo Vanquish LC instrument (Thermo Fisher Scientific, San Jose, CA) coupled to a Thermo TSQ Altis triple quadrupole mass spectrometer (Thermo Fisher Scientific) with a heated electrospray ionization (HESI) source. Chromatographic separation was achieved on a Restek Raptor C₁₈ column (2.1 by 50 mm, 1.8 mM) maintained at 50°C. The following linear gradient of mobile phase A (5 mM ammonium acetate) and mobile phase B (1:1 MeOH-acetonitrile [MeOH-MeCN]) was used: 0 to 2 min, 35% to 40% B, at 0.5 ml/min; 2 to 2.5 min, 40% to 45% B, at 0.5 ml/min; 2.5 to 3.5 min, 45% to 50% B, at 0.5 ml/min; 3.5 to 4.6 min, 50% to 55% B, at 0.5 ml/min; 4.6 to 5.7 min, 55% to 80% B, at 0.8 ml/min; 5.7 to 5.9 min, 80% to 85% B, at 0.8 ml/min; 5.9 to 6.5 min, 85% B, at 0.8 ml/min; and 6.5 to 8.5 min, 35% B, at 0.5 ml/min. For quantification, certified reference material (50 mg/ml) for CA and DCA was obtained from Cerilliant. These individual stocks were combined and diluted to achieve a 250 mM working standard solution. Seven calibration standards ranging from 8 nM to 125 mM were prepared by serially diluting the working standard solution. Both samples and standards were analyzed (2-ml injections) in negative ion mode (spray voltage, 2.5 kV; ion transfer tube temperature, 325°C; vaporizer temperature, 350°C; sheath gas, 50 arbitrary units [a.u.]; auxiliary [aux] gas, 10 a.u.; and sweep gas, 1 a.u.) using a Q1 resolution of m/z 0.7, a Q3 resolution of m/z 1.2, and a collision energy of 22 V. The following multiple-reaction monitoring (MRM) transitions were used: 407.1→407.1 (CA) and 391.1→391.1 (DCA).

Targeted data processing.

Peak integration and quantification were performed in TraceFinder 4.1 (Thermo Fisher Scientific, San Jose, CA). Individual standard curves for CA and DCA were constructed using peak areas from the quantifier transitions (407.1→407.1 for CA and 391.1→391.1 for DCA). The concentrations of CA and DCA in the study samples were calculated in an identical manner relative to the regression line. Calibration curves for CA and DCA had R² values of 0.9995 and 0.9983, respectively, for the linear range of 8 nM to 125 mM with a weighting of 1/x. Validation of the curve with a quality control (QC) sample (2.5 mM) passed with a threshold of 10%.

RNA extraction from commensal Clostridia cultures supplemented with CA.

C. scindens, C. hiranonis, and C. hylemonae liquid cultures were started from a single colony, grown for 14 h, subcultured 1:10 and 1:5 in liquid medium, and allowed to grow for 3 h or until doubling. Cultures of C. scindens and C. hiranonis were then diluted to an OD of 0.1 in fresh BHI medium supplemented with 0 mM, 0.25 mM, or 2.5 mM CA, while cultures of C hylemonae were diluted to an OD of 0.1 in fresh BHI medium supplemented with 0 mM, 2.5 mM, or 7 mM CA. Cultures were allowed to grow to mid-log phase (OD, 0.3 to 0.5), and then half of the culture was removed and stored for later extraction. The remaining portion of the culture was allowed to grow for 14 h until stationary phase was reached.

Cultures were fixed by adding equal volumes of a 1:1 mixture of ethanol (EtOH) and acetone and stored at −80°C for later RNA extraction. For extraction, the culture was thawed then centrifuged at 10,000 rpm for 10 min at 4°C. The supernatant was discarded, and the cell pellet was resuspended in 1 ml of 1:100 β-mercaptoethanol (BME)–H₂O and then spun down at 14,000 rpm for 1 min. The cell pellet was resuspended in 0.3 ml of lysis buffer from an Ambion RNA purification kit (catalog no. AM1912; Invitrogen) and then sonicated while on ice for 10 pulses of 2 s with a pause of 3 s between each pulse. Extraction was then performed following the manufacturer’s protocol from the Ambion RNA purification kit.

Reverse transcription and quantitative real-time PCR.

Reverse transcription and quantitative real-time PCR were performed as described previously (30). Briefly, RNA was depleted by using Turbo DNase according to the manufacturer’s instructions (catalog no. AM2238; Invitrogen). The DNased RNA was then cleaned using an RNA cleanup kit (catalog no. R1019; Zymo), according to the manufacturer’s instructions, and DNA depletion was verified by amplifying 1 μl of RNA in a PCR. The DNA-depleted RNA was used as the template for reverse transcription performed with Moloney murine leukemia virus (MMLV) reverse transcriptase (catalog no. M0253; NEB). The cDNA samples were then diluted 1:4 in water and used in quantitative real-time PCR with gene-specific primers using SsoAdvanced Universal SYBR green supermix (catalog no. 1725271; Bio-Rad), according to the manufacturer’s protocol. Amplifications were performed in technical quadruplicates, and copy numbers were calculated by the use of a standard curve and normalized to that of a housekeeping gene. gyrA was the housekeeping gene used for C. scindens, and rpoC was the housekeeping gene used for C. hiranonis and C. hylemonae.

The housekeeping gene for each strain was determined by testing a list of genes (Tables 1 and 2) using cDNA standardized to a concentration of 0.3 μg/μl. Three technical replicates were performed for each assay, and three biological replicates were performed. C. scindens and C. hiranonis were tested with RNA from cultures grown to mid-log and stationary phase in medium supplemented with 0 mM, 0.25 mM, or 2.5 mM CA, while C. hylemonae was tested with RNA from cultures grown to mid-log and stationary phase in medium supplemented with 0 mM, 2.5 mM, or 7 mM CA, and copy numbers were calculated by the use of a standard curve. Analysis of copy numbers was performed with NormFinder (60), and the gene with the lowest intergroup variance, or stability value, was selected (Table 3). The relative copy numbers for each gene and each condition were log₂ transformed to give the log₂ fold change (see Table S1 in the supplemental material).

TABLE 1.

Candidate reference genes

Putative housekeeping gene	Function
rpoC	RNA polymerase subunit C
gyrA	Gyrase subunit A
gluD	Glutamate dehydrogenase
adk	Adenylate kinase
dnaG	DNA primase
recA	Recombination protein A
rpsJ	30S ribosomal protein S10

Open in a new tab

TABLE 2.

Primer sequences used

Gene	Organism	Primer direction – sequence (5′–3′)
rpoC	C. scindens	F – GGACTCTTACCAGTGGTTTCTG
	C. scindens	R – CGTCATCCTCGCACAAAGTA
	C. hylemonae	F – GTGCGAGGATGATGTGAAGTA
	C. hylemonae	R – CATCGGTTTCCTTGTTGTGAAG
	C. hiranonis	F – ACAGTTCATGGACCAGACTAAC
	C. hiranonis	R – GAACCCAGCTCTTTCTCTTGA
gyrA	C. scindens	F – CCATCTATGGAGCACTGGTAAA
	C. scindens	R – CCATCTACGGAGCCAAAGTT
	C. hylemonae	F – AGACGCTGGAAGAGGACTA
	C. hylemonae	R – GGTATACGCGGCCTGTATTT
	C. hiranonis	F – GCAGTTGGTATGGCTACATCTAT
	C. hiranonis	R – CAACATCTGCATCTGGTCTATCT
gluD	C. scindens	F – TGCGTTCACGGAGTTGTT
	C. scindens	R – GTACATTCTTGACGGTGAACATAAC
	C. hylemonae	F – TTCACCGGGAAGGAATGAAG
	C. hylemonae	R – TGGGACAGGTAGTCGAGAAT
	C. hiranonis	F – GGTGCCCTAAACATGGTACTT
	C. hiranonis	R – AAATCTCCGTTAGCTGCTCTG
adk	C. scindens	F – ATTGCCGCAAAGTATGGTATTC
	C. scindens	R – TCCATGTACGTCTTGGCTTT
	C. hylemonae	F – ACGTTGATGTTCCGGATGAG
	C. hylemonae	R – GTCACAGATGCCGTCTTTCT
	C. hiranonis	F – AGTAGGAAGAGCTGTAGGAAGA
	C. hiranonis	R – TCGTCTGCTCTCTGATGTAGA
dnaG	C. scindens	F – GGAAACTTTGGCTCCGTAGAT
	C. scindens	R – GTTGATATCAGCAGTCAGTTCCA
	C. hylemonae	F – GCAGGCAGAAGCAGATGTA
	C. hylemonae	R – AGCGCTTCCAGAAACGTATAG
	C. hiranonis	F – GATGCTGTACCTCGGATTAAGT
	C. hiranonis	R – ACAGGGCTCTTTAGCTGTTT
recA	C. scindens	F – GAGACGATTCCCACAGGTTC
	C. scindens	R – CTGGATTCCGGGCCATATAC
	C. hylemonae	F – GCGCGATGGATATCGTAGTT
	C. hylemonae	R – CTAAGCGCCTGGGACATAAG
	C. hiranonis	F – AGGAGAACAGGCACTAGAGATA
	C. hiranonis	R – TCACCTTCTATTTCGGCTTTAGG
rpsJ	C. scindens	F – GAGAATCACTTTGAAAGCGTATGA
	C. scindens	R – GCTCACCTGTGATCCATTCT
	C. hylemonae	F – GGTCGCTCTCGTTGAAGAAT
	C. hylemonae	R – GCCTCCACAACTGGAATGATA
	C. hiranonis	F – GACCTTAAAGAAGCAGTAGTAGGT
	C. hiranonis	R – TCCAGTGAAAGCTCCGTTATC
baiG	C. scindens ATCC 35704	F – GGTAACTTCCTTCGGGCTATG
	C. scindens ATCC 35704	R – GGATGGTCTTCCACAGCATTTA
	C. scindens VPI 12708	F – CCCATCCTTCGGACAGAATAT
	C. scindens VPI 12708	R – GATCGGACTCTTCGCTTTCTT
	C. hylemonae	F – GGCCGTATTCCTGATCTGTATG
	C. hylemonae	R – CACAGGAACAGGCTGAAGAA
	C. hiranonis	F – ATGATCGGACTCTTCGCTTTC
	C. hiranonis	R – AGCTTCTGCAGTTCCGTTAG
baiE	C. scindens ATCC 35704	F – GGTAACTTCCTTCGGGCTATG
	C. scindens ATCC 35704	R – GACGGAAAGATGTGGGATGAA
	C. scindens VPI 12708	F – GACGGAAAGATGTGGGATGAG
	C. scindens VPI 12708	R – CTTCCTTCGGGCTATGGAATAC
	C. hylemonae	F – CCCGAACATTGTAACTTCCTACT
	C. hylemonae	R – GTCCCATGTGCATGCTTATTTC
	C. hiranonis	F – CTGCTACAGGAAGATGGTACTT
	C. hiranonis	R – GTAGAATGCTCCACCGTTTATTC
baiN	C. scindens ATCC 35704	F – GTTCCAGCAGTCTTGGGATTA
	C. scindens ATCC 35704	R – CAGGTACGCAAGGCATTTAAC
	C. scindens VPI 12708	F – TGACACGCTGGAAGAAGTAATC
	C. scindens VPI 12708	R – CGTAATCAAAGGTCCCATCCTC
	C. hylemonae	F – GGATGTGATCTGCATGGTAGAC
	C. hylemonae	R – CCGGGATTCTTTATGAGGGAAC
	C. hiranonis	F – AGG GTA CGA AGA CGA GGT TAT
	C. hiranonis	R – GTAAGTCCACCCTGGAAGTAAAC

Open in a new tab

TABLE 3.

NormFinder analysis results

Strain	Gene^a	Stability value
C. scindens ATCC 35704	*gyrA*	0.41
	recA	0.45
	rpoC	0.50
	dnaG	0.59
	adk	0.94
	rpsJ	0.99
	gluD	2.04
C. scindens VPI 12708	*gyrA*	0.70
	recA	0.73
	dnaG	0.84
	rpoC	1.10
	adk	1.40
	rpsJ	1.55
C. hylemonae	*rpoC*	0.63
	gyrA	0.65
	dnaG	0.89
	recA	1.16
	gluD	1.21
	adk	1.54
	rpsJ	1.79
C. hiranonis	*rpoC*	0.34
	dnaG	0.38
	gyrA	0.44
	adk	0.47
	gluD	0.48
	recA	0.52
	rpsJ	0.56

Open in a new tab

Genes in boldface are the housekeeping genes used in each assay.

Competition studies between C. difficile and commensal Clostridia.

C. scindens, C. hylemonae, and C difficile liquid cultures were started from a single colony, as described above. Monocultures of each organism were diluted to ∼1 × 10⁵ CFU/ml in fresh BHI medium, and 1:1 competition assays were ∼1 × 10⁵ CFU/ml of each organism in fresh medium. Determination of the conversion from OD to CFU per milliliter was performed for C. difficile, C. scindens, and C. hylemonae using a growth curve to measure the OD and number of CFU per milliliter. The conversion from OD to CFU per milliliter was calculated using a linear regression analysis (Fig. S1).

Dilutions were performed at 0 h and after 24 h of incubation, and colonies were counted to determine the number of CFU per milliliter. Colonies were counted after the plates had been incubated long enough to allow individual colonies to form, which was 24 h for C. difficile and 48 h for C. scindens and C. hylemonae. Differences in colony morphology and growth time were used to distinguish between C. scindens, C. hylemonae, and C. difficile.

Statistical analyses.

Statistical tests were performed using Prism version 7.0c for Mac OSX (GraphPad Software, La Jolla, CA). Significance was determined by using one-way analysis of variance (ANOVA) to determine significance across all conditions, with Tukey’s test used to correct for multiple comparisons. Statistical significance was set at a P value of <0.05 for all analyses. All assays were performed with at least three biological replicates.

Supplementary Material

Supplemental file 1

JB.00039-20-s0001.pdf^{(8.8MB, pdf)}

ACKNOWLEDGMENTS

We thank Jason Ridlon for providing the commensal Clostridia strains.

A.D.R. was funded by the NCSU Molecular Biology Training Program grant T32 GM008776 through the NIH. C.M.T. is funded by the National Institute of General Medical Sciences of the National Institutes of Health under award number R35GM119438.

R.B. is a shareholder of Caribou Biosciences, Intellia Therapeutics, Locus Biosciences, and Inari Ag and the former CSO and Chairman of the Scientific Advisory Board of Locus Biosciences. C.M.T. is a scientific advisor to Locus Biosciences and a consultant for Vedanta Biosciences and Summit Therapeutics.

Footnotes

Supplemental material is available online only.

REFERENCES

1.Burke KE, Lamont JT. 2014. Clostridium difficile infection: a worldwide disease. Gut Liver 8:1–6. doi: 10.5009/gnl.2014.8.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Lessa FC, Mu Y, Bamberg WM, Beldavs ZG, Dumyati GK, Dunn JR, Farley MM, Holzbauer SM, Meek JI, Phipps EC, Wilson LE, Winston LG, Cohen JA, Limbago BM, Fridkin SK, Gerding DN, McDonald LC. 2015. Burden of Clostridium difficile infection in the United States. N Engl J Med 372:825–834. doi: 10.1056/NEJMoa1408913. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Cornely OA, Miller MA, Louie TJ, Crook DW, Gorbach SL. 2012. Treatment of first recurrence of Clostridium difficile infection: fidaxomicin versus vancomycin. Clin Infect Dis 55(Suppl 2):S154–S161. doi: 10.1093/cid/cis462. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Fekety R, McFarland LV, Surawicz CM, Greenberg RN, Elmer GW, Mulligan ME. 1997. Recurrent Clostridium difficile diarrhea: characteristics of and risk factors for patients enrolled in a prospective, randomized, double-blinded trial. Clin Infect Dis 24:324–333. doi: 10.1093/clinids/24.3.324. [DOI] [PubMed] [Google Scholar]
5.Owens RC Jr, Donskey CJ, Gaynes RP, Loo VG, Muto CA. 2008. Antimicrobial-associated risk factors for Clostridium difficile infection. Clin Infect Dis 46(Suppl 1):S19–S31. doi: 10.1086/521859. [DOI] [PubMed] [Google Scholar]
6.Theriot CM, Koenigsknecht MJ, Carlson PE Jr, Hatton GE, Nelson AM, Li B, Huffnagle GB, J ZL, Young VB. 2014. Antibiotic-induced shifts in the mouse gut microbiome and metabolome increase susceptibility to Clostridium difficile infection. Nat Commun 5:3114. doi: 10.1038/ncomms4114. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Buffie CG, Jarchum I, Equinda M, Lipuma L, Gobourne A, Viale A, Ubeda C, Xavier J, Pamer EG. 2012. Profound alterations of intestinal microbiota following a single dose of clindamycin results in sustained susceptibility to Clostridium difficile-induced colitis. Infect Immun 80:62–73. doi: 10.1128/IAI.05496-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Lewis BB, Carter RA, Ling L, Leiner I, Taur Y, Kamboj M, Dubberke ER, Xavier J, Pamer EG. 2017. Pathogenicity locus, core genome, and accessory gene contributions to Clostridium difficile virulence. mBio 8:e00885-17. doi: 10.1128/mBio.00885-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Thanissery R, Winston JA, Theriot CM. 2017. Inhibition of spore germination, growth, and toxin activity of clinically relevant C. difficile strains by gut microbiota derived secondary bile acids. Anaerobe 45:86–100. doi: 10.1016/j.anaerobe.2017.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Weingarden AR, Chen C, Bobr A, Yao D, Lu Y, Nelson VM, Sadowsky MJ, Khoruts A. 2014. Microbiota transplantation restores normal fecal bile acid composition in recurrent Clostridium difficile infection. Am J Physiol Gastrointest Liver Physiol 306:G310–G319. doi: 10.1152/ajpgi.00282.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Hamilton JP, Xie G, Raufman JP, Hogan S, Griffin TL, Packard CA, Chatfield DA, Hagey LR, Steinbach JH, Hofmann AF. 2007. Human cecal bile acids: concentration and spectrum. Am J Physiol Gastrointest Liver Physiol 293:G256–G263. doi: 10.1152/ajpgi.00027.2007. [DOI] [PubMed] [Google Scholar]
12.Ridlon JM, Harris SC, Bhowmik S, Kang DJ, Hylemon PB. 2016. Consequences of bile salt biotransformations by intestinal bacteria. Gut Microbes 7:22–39. doi: 10.1080/19490976.2015.1127483. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Funabashi M, Grove TL, Pascal V, Varma Y, McFadden ME, Brown LC, Guo C, Medema MH, Almo SC, Fischbach MA. 2019. A metabolic pathway for bile acid dehydroxylation by the gut microbiome. bioRxiv doi: 10.1101/758557. [DOI] [PMC free article] [PubMed]
14.Hylemon PB, Cacciapuoti AF, White BA, Whitehead TR, Fricke RJ. 1980. 7α-Dehydroxylation of cholic acid by cell extracts of Eubacterium species V.P.I. 12708. Am J Clin Nutr 33:2507–2510. doi: 10.1093/ajcn/33.11.2507. [DOI] [PubMed] [Google Scholar]
15.Kitahara M, Takamine F, Imamura T, Benno Y. 2000. Assignment of Eubacterium sp. VPI 12708 and related strains with high bile acid 7α-dehydroxylating activity to Clostridium scindens and proposal of Clostridium hylemonae sp. nov., isolated from human faeces. Int J Syst Evol Microbiol 50:971–978. doi: 10.1099/00207713-50-3-971. [DOI] [PubMed] [Google Scholar]
16.Kitahara M, Takamine F, Imamura T, Benno Y. 2001. Clostridium hiranonis sp. nov., a human intestinal bacterium with bile acid 7α-dehydroxylating activity. Int J Syst Evol Microbiol 51:39–44. doi: 10.1099/00207713-51-1-39. [DOI] [PubMed] [Google Scholar]
17.Ridlon JM, Kang DJ, Hylemon PB. 2010. Isolation and characterization of a bile acid inducible 7α-dehydroxylating operon in Clostridium hylemonae TN-271. Anaerobe 16:137–146. doi: 10.1016/j.anaerobe.2009.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Mallonee DH, Hylemon PB. 1996. Sequencing and expression of a gene encoding a bile acid transporter from Eubacterium sp. strain VPI 12708. J Bacteriol 178:7053–7058. doi: 10.1128/jb.178.24.7053-7058.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Bhowmik S, Chiu HP, Jones DH, Chiu HJ, Miller MD, Xu Q, Farr CL, Ridlon JM, Wells JE, Elsliger MA, Wilson IA, Hylemon PB, Lesley SA. 2016. Structure and functional characterization of a bile acid 7α dehydratase BaiE in secondary bile acid synthesis. Proteins 84:316–331. doi: 10.1002/prot.24971. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Ridlon JM, Devendran S, Alves JM, Doden H, Wolf PG, Pereira GV, Ly L, Volland A, Takei H, Nittono H, Murai T, Kurosawa T, Chlipala GE, Green SJ, Hernandez AG, Fields CJ, Wright CL, Kakiyama G, Cann I, Kashyap P, McCracken V, Gaskins HR. 2019. The “in vivo lifestyle” of bile acid 7α-dehydroxylating bacteria: comparative genomics, metatranscriptomic, and bile acid metabolomics analysis of a defined microbial community in gnotobiotic mice. Gut Microbes Jun 9:1–24. doi: 10.1080/19490976.2019.1618173. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Devendran S, Shrestha R, Alves JMP, Wolf PG, Ly L, Hernandez AG, Mendez-Garcia C, Inboden A, Wiley J, Paul O, Allen A, Springer E, Wright CL, Fields CJ, Daniel SL, Ridlon JM. 2019. Clostridium scindens ATCC 35704: integration of nutritional requirements, the complete genome sequence, and global transcriptional responses to bile acids. Appl Environ Microbiol 85:e00052-19. doi: 10.1128/AEM.00052-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Sorg JA, Sonenshein AL. 2008. Bile salts and glycine as cogerminants for Clostridium difficile spores. J Bacteriol 190:2505–2512. doi: 10.1128/JB.01765-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Dubois T, Tremblay YDN, Hamiot A, Martin-Verstraete I, Deschamps J, Monot M, Briandet R, Dupuy B. 2019. A microbiota-generated bile salt induces biofilm formation in Clostridium difficile. NPJ Biofilms Microbiomes 5:14. doi: 10.1038/s41522-019-0087-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Sievers S, Metzendorf NG, Dittmann S, Troitzsch D, Gast V, Troger SM, Wolff C, Zuhlke D, Hirschfeld C, Schluter R, Riedel K. 2019. Differential view on the bile acid stress response of Clostridioides difficile. Front Microbiol 10:258. doi: 10.3389/fmicb.2019.00258. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Solbach P, Chhatwal P, Woltemate S, Tacconelli E, Buhl M, Gerhard M, Thoeringer CK, Vehreschild M, Jazmati N, Rupp J, Manns MP, Bachmann O, Suerbaum S. 2018. BaiCD gene cluster abundance is negatively correlated with Clostridium difficile infection. PLoS One 13:e0196977. doi: 10.1371/journal.pone.0196977. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Amrane S, Bachar D, Lagier JC, Raoult D. 2018. Clostridium scindens is present in the gut microbiota during Clostridium difficile infection: a metagenomic and culturomic analysis. J Clin Microbiol 56:e01663-17. doi: 10.1128/JCM.01663-17. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
27.Buffie CG, Bucci V, Stein RR, McKenney PT, Ling L, Gobourne A, No D, Liu H, Kinnebrew M, Viale A, Littmann E, van den Brink MR, Jenq RR, Taur Y, Sander C, Cross JR, Toussaint NC, Xavier JB, Pamer EG. 2015. Precision microbiome reconstitution restores bile acid mediated resistance to Clostridium difficile. Nature 517:205–208. doi: 10.1038/nature13828. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Thanissery R, McLaren MR, Rivera A, Reed AD, Betrapally NS, Burdette T, Winston JA, Jacob M, Callahan BJ, Theriot CM. 2019. Characterization of C. difficile strains isolated from companion animals and the associated changes in the host fecal microbiota. bioRxiv doi: 10.1101/822577. [DOI] [PMC free article] [PubMed]
29.Studer N, Desharnais L, Beutler M, Brugiroux S, Terrazos MA, Menin L, Schürch CM, McCoy KD, Kuehne SA, Minton NP, Stecher B, Bernier-Latmani R, Hapfelmeier S. 2016. Functional intestinal bile acid 7α-dehydroxylation by Clostridium scindens associated with protection from Clostridium difficile infection in a gnotobiotic mouse model. Front Cell Infect Microbiol 6:191. doi: 10.3389/fcimb.2016.00191. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Fletcher JR, Erwin S, Lanzas C, Theriot CM. 2018. Shifts in the gut metabolome and Clostridium difficile transcriptome throughout colonization and infection in a mouse model. mSphere 3:e00089-18. doi: 10.1128/mSphere.00089-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Wilson KH, Perini F. 1988. Role of competition for nutrients in suppression of Clostridium difficile by the colonic microflora. Infect Immun 56:2610–2614. doi: 10.1128/IAI.56.10.2610-2614.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Robinson JI, Weir WH, Crowley JR, Hink T, Reske KA, Kwon JH, Burnham CD, Dubberke ER, Mucha PJ, Henderson JP. 2019. Metabolomic networks connect host-microbiome processes to human Clostridioides difficile infections. J Clin Invest 130:3792–3806. doi: 10.1172/JCI126905. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Wilson KH, Sheagren JN. 1983. Antagonism of toxigenic Clostridium difficile by nontoxigenic C. difficile. J Infect Dis 147:733–736. doi: 10.1093/infdis/147.4.733. [DOI] [PubMed] [Google Scholar]
34.Gerding DN, Meyer T, Lee C, Cohen SH, Murthy UK, Poirier A, Van Schooneveld TC, Pardi DS, Ramos A, Barron MA, Chen H, Villano S. 2015. Administration of spores of nontoxigenic Clostridium difficile strain M3 for prevention of recurrent C. difficile infection: a randomized clinical trial. JAMA 313:1719–1727. doi: 10.1001/jama.2015.3725. [DOI] [PubMed] [Google Scholar]
35.Karasawa T, Ikoma S, Yamakawa K, Nakamura S. 1995. A defined growth medium for Clostridium difficile. Microbiology 141:371–375. doi: 10.1099/13500872-141-2-371. [DOI] [PubMed] [Google Scholar]
36.Bouillaut L, Self WT, Sonenshein AL. 2013. Proline-dependent regulation of Clostridium difficile Stickland metabolism. J Bacteriol 195:844–854. doi: 10.1128/JB.01492-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Nisman B, Raynaud M, Cohen GN. 1948. Extension of the Stickland reaction to several bacterial species. Arch Biochem 16:473. [PubMed] [Google Scholar]
38.Stadtman TC, Elliott P. 1957. Studies on the enzymic reduction of amino acids. II. Purification and properties of d-proline reductase and a proline racemase from Clostridium sticklandii. J Biol Chem 228:983–997. [PubMed] [Google Scholar]
39.Costilow RN. 1977. Selenium requirement for the growth of Clostridium sporogenes with glycine as the oxidant in Stickland reaction systems. J Bacteriol 131:366–368. doi: 10.1128/JB.131.1.366-368.1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Mead GC. 1971. The amino acid-fermenting clostridia. J Gen Microbiol 67:47–56. doi: 10.1099/00221287-67-1-47. [DOI] [PubMed] [Google Scholar]
41.Morris GN, Winter J, Cato EP, Ritchie AE, Bokkenheuser VD. 1985. Clostridium scindens sp. nov., a human intestinal bacterium with desmolytic activity on corticoids. Int J Syst Evol Microbiol 35:478–481. doi: 10.1099/00207713-35-4-478. [DOI] [Google Scholar]
42.Kang JD, Myers CJ, Harris SC, Kakiyama G, Lee IK, Yun BS, Matsuzaki K, Furukawa M, Min HK, Bajaj JS, Zhou H, Hylemon PB. 2019. Bile acid 7α-dehydroxylating gut bacteria secrete antibiotics that inhibit Clostridium difficile: role of secondary bile acids. Cell Chem Biol 26:27–34.e24. doi: 10.1016/j.chembiol.2018.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Harris SC, Devendran S, Alves JMP, Mythen SM, Hylemon PB, Ridlon JM. 2018. Identification of a gene encoding a flavoprotein involved in bile acid metabolism by the human gut bacterium Clostridium scindens ATCC 35704. Biochim Biophys Acta Mol Cell Biol Lipids 1863:276–283. doi: 10.1016/j.bbalip.2017.12.001. [DOI] [PubMed] [Google Scholar]
44.Bhowmik S, Jones DH, Chiu HP, Park IH, Chiu HJ, Axelrod HL, Farr CL, Tien HJ, Agarwalla S, Lesley SA. 2014. Structural and functional characterization of BaiA, an enzyme involved in secondary bile acid synthesis in human gut microbe. Proteins 82:216–229. doi: 10.1002/prot.24353. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Mallonee DH, Lijewski MA, Hylemon PB. 1995. Expression in Escherichia coli and characterization of a bile acid-inducible 3 α-hydroxysteroid dehydrogenase from Eubacterium sp. strain VPI 12708. Curr Microbiol 30:259–263. doi: 10.1007/bf00295498. [DOI] [PubMed] [Google Scholar]
46.Wang H, Latorre JD, Bansal M, Abraha M, Al-Rubaye B, Tellez-Isaias G, Hargis B, Sun X. 2019. Microbial metabolite deoxycholic acid controls Clostridium perfringens-induced chicken necrotic enteritis through attenuating inflammatory cyclooxygenase signaling. Sci Rep 9:14541. doi: 10.1038/s41598-019-51104-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Islam KB, Fukiya S, Hagio M, Fujii N, Ishizuka S, Ooka T, Ogura Y, Hayashi T, Yokota A. 2011. Bile acid is a host factor that regulates the composition of the cecal microbiota in rats. Gastroenterology 141:1773–1781. doi: 10.1053/j.gastro.2011.07.046. [DOI] [PubMed] [Google Scholar]
48.Kurdi P, Kawanishi K, Mizutani K, Yokota A. 2006. Mechanism of growth inhibition by free bile acids in lactobacilli and bifidobacteria. J Bacteriol 188:1979–1986. doi: 10.1128/JB.188.5.1979-1986.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Merritt ME, Donaldson JR. 2009. Effect of bile salts on the DNA and membrane integrity of enteric bacteria. J Med Microbiol 58:1533–1541. doi: 10.1099/jmm.0.014092-0. [DOI] [PubMed] [Google Scholar]
50.Sorg JA, Sonenshein AL. 2009. Chenodeoxycholate is an inhibitor of Clostridium difficile spore germination. J Bacteriol 191:1115–1117. doi: 10.1128/JB.01260-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Hofmann AF, Roda A. 1984. Physicochemical properties of bile acids and their relationship to biological properties: an overview of the problem. J Lipid Res 25:1477–1489. [PubMed] [Google Scholar]
52.Huang YY, Martinez-Del Campo A, Balskus EP. 2018. Anaerobic 4-hydroxyproline utilization: discovery of a new glycyl radical enzyme in the human gut microbiome uncovers a widespread microbial metabolic activity. Gut Microbes 9:437–451. doi: 10.1080/19490976.2018.1435244. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Levin BJ, Huang YY, Peck SC, Wei Y, Martinez-Del Campo A, Marks JA, Franzosa EA, Huttenhower C, Balskus EP. 2017. A prominent glycyl radical enzyme in human gut microbiomes metabolizes trans-4-hydroxy-l-proline. Science 355:eaai8386. doi: 10.1126/science.aai8386. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Guo CJ, Allen BM, Hiam KJ, Dodd D, Van Treuren W, Higginbottom S, Nagashima K, Fischer CR, Sonnenburg JL, Spitzer MH, Fischbach MA. 2019. Depletion of microbiome-derived molecules in the host using Clostridium genetics. Science 366:eaav1282. doi: 10.1126/science.aav1282. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647–1649. doi: 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
56.Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Wilkins D. 2019. gggenes: draw gene arrow maps in ‘ggplot2’. R package version 0.4.0. https://rdrr.io/cran/gggenes/.
58.Alikhan NF, Petty NK, Ben Zakour NL, Beatson SA. 2011. BLAST Ring Image Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics 12:402. doi: 10.1186/1471-2164-12-402. [DOI] [PMC free article] [PubMed] [Google Scholar]
59.Thanissery R, Zeng D, Doyle RG, Theriot CM. 2018. A small molecule-screening pipeline to evaluate the therapeutic potential of 2-aminoimidazole molecules against Clostridium difficile. Front Microbiol 9:1206. doi: 10.3389/fmicb.2018.01206. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Andersen CL, Jensen JL, Orntoft TF. 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64:5245–5250. doi: 10.1158/0008-5472.CAN-04-0496. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

JB.00039-20-s0001.pdf^{(8.8MB, pdf)}

[B1] 1.Burke KE, Lamont JT. 2014. Clostridium difficile infection: a worldwide disease. Gut Liver 8:1–6. doi: 10.5009/gnl.2014.8.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B2] 2.Lessa FC, Mu Y, Bamberg WM, Beldavs ZG, Dumyati GK, Dunn JR, Farley MM, Holzbauer SM, Meek JI, Phipps EC, Wilson LE, Winston LG, Cohen JA, Limbago BM, Fridkin SK, Gerding DN, McDonald LC. 2015. Burden of Clostridium difficile infection in the United States. N Engl J Med 372:825–834. doi: 10.1056/NEJMoa1408913. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3.Cornely OA, Miller MA, Louie TJ, Crook DW, Gorbach SL. 2012. Treatment of first recurrence of Clostridium difficile infection: fidaxomicin versus vancomycin. Clin Infect Dis 55(Suppl 2):S154–S161. doi: 10.1093/cid/cis462. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4.Fekety R, McFarland LV, Surawicz CM, Greenberg RN, Elmer GW, Mulligan ME. 1997. Recurrent Clostridium difficile diarrhea: characteristics of and risk factors for patients enrolled in a prospective, randomized, double-blinded trial. Clin Infect Dis 24:324–333. doi: 10.1093/clinids/24.3.324. [DOI] [PubMed] [Google Scholar]

[B5] 5.Owens RC Jr, Donskey CJ, Gaynes RP, Loo VG, Muto CA. 2008. Antimicrobial-associated risk factors for Clostridium difficile infection. Clin Infect Dis 46(Suppl 1):S19–S31. doi: 10.1086/521859. [DOI] [PubMed] [Google Scholar]

[B6] 6.Theriot CM, Koenigsknecht MJ, Carlson PE Jr, Hatton GE, Nelson AM, Li B, Huffnagle GB, J ZL, Young VB. 2014. Antibiotic-induced shifts in the mouse gut microbiome and metabolome increase susceptibility to Clostridium difficile infection. Nat Commun 5:3114. doi: 10.1038/ncomms4114. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7.Buffie CG, Jarchum I, Equinda M, Lipuma L, Gobourne A, Viale A, Ubeda C, Xavier J, Pamer EG. 2012. Profound alterations of intestinal microbiota following a single dose of clindamycin results in sustained susceptibility to Clostridium difficile-induced colitis. Infect Immun 80:62–73. doi: 10.1128/IAI.05496-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8.Lewis BB, Carter RA, Ling L, Leiner I, Taur Y, Kamboj M, Dubberke ER, Xavier J, Pamer EG. 2017. Pathogenicity locus, core genome, and accessory gene contributions to Clostridium difficile virulence. mBio 8:e00885-17. doi: 10.1128/mBio.00885-17. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9.Thanissery R, Winston JA, Theriot CM. 2017. Inhibition of spore germination, growth, and toxin activity of clinically relevant C. difficile strains by gut microbiota derived secondary bile acids. Anaerobe 45:86–100. doi: 10.1016/j.anaerobe.2017.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10.Weingarden AR, Chen C, Bobr A, Yao D, Lu Y, Nelson VM, Sadowsky MJ, Khoruts A. 2014. Microbiota transplantation restores normal fecal bile acid composition in recurrent Clostridium difficile infection. Am J Physiol Gastrointest Liver Physiol 306:G310–G319. doi: 10.1152/ajpgi.00282.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B11] 11.Hamilton JP, Xie G, Raufman JP, Hogan S, Griffin TL, Packard CA, Chatfield DA, Hagey LR, Steinbach JH, Hofmann AF. 2007. Human cecal bile acids: concentration and spectrum. Am J Physiol Gastrointest Liver Physiol 293:G256–G263. doi: 10.1152/ajpgi.00027.2007. [DOI] [PubMed] [Google Scholar]

[B12] 12.Ridlon JM, Harris SC, Bhowmik S, Kang DJ, Hylemon PB. 2016. Consequences of bile salt biotransformations by intestinal bacteria. Gut Microbes 7:22–39. doi: 10.1080/19490976.2015.1127483. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13.Funabashi M, Grove TL, Pascal V, Varma Y, McFadden ME, Brown LC, Guo C, Medema MH, Almo SC, Fischbach MA. 2019. A metabolic pathway for bile acid dehydroxylation by the gut microbiome. bioRxiv doi: 10.1101/758557. [DOI] [PMC free article] [PubMed]

[B14] 14.Hylemon PB, Cacciapuoti AF, White BA, Whitehead TR, Fricke RJ. 1980. 7α-Dehydroxylation of cholic acid by cell extracts of Eubacterium species V.P.I. 12708. Am J Clin Nutr 33:2507–2510. doi: 10.1093/ajcn/33.11.2507. [DOI] [PubMed] [Google Scholar]

[B15] 15.Kitahara M, Takamine F, Imamura T, Benno Y. 2000. Assignment of Eubacterium sp. VPI 12708 and related strains with high bile acid 7α-dehydroxylating activity to Clostridium scindens and proposal of Clostridium hylemonae sp. nov., isolated from human faeces. Int J Syst Evol Microbiol 50:971–978. doi: 10.1099/00207713-50-3-971. [DOI] [PubMed] [Google Scholar]

[B16] 16.Kitahara M, Takamine F, Imamura T, Benno Y. 2001. Clostridium hiranonis sp. nov., a human intestinal bacterium with bile acid 7α-dehydroxylating activity. Int J Syst Evol Microbiol 51:39–44. doi: 10.1099/00207713-51-1-39. [DOI] [PubMed] [Google Scholar]

[B17] 17.Ridlon JM, Kang DJ, Hylemon PB. 2010. Isolation and characterization of a bile acid inducible 7α-dehydroxylating operon in Clostridium hylemonae TN-271. Anaerobe 16:137–146. doi: 10.1016/j.anaerobe.2009.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18.Mallonee DH, Hylemon PB. 1996. Sequencing and expression of a gene encoding a bile acid transporter from Eubacterium sp. strain VPI 12708. J Bacteriol 178:7053–7058. doi: 10.1128/jb.178.24.7053-7058.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] 19.Bhowmik S, Chiu HP, Jones DH, Chiu HJ, Miller MD, Xu Q, Farr CL, Ridlon JM, Wells JE, Elsliger MA, Wilson IA, Hylemon PB, Lesley SA. 2016. Structure and functional characterization of a bile acid 7α dehydratase BaiE in secondary bile acid synthesis. Proteins 84:316–331. doi: 10.1002/prot.24971. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20.Ridlon JM, Devendran S, Alves JM, Doden H, Wolf PG, Pereira GV, Ly L, Volland A, Takei H, Nittono H, Murai T, Kurosawa T, Chlipala GE, Green SJ, Hernandez AG, Fields CJ, Wright CL, Kakiyama G, Cann I, Kashyap P, McCracken V, Gaskins HR. 2019. The “in vivo lifestyle” of bile acid 7α-dehydroxylating bacteria: comparative genomics, metatranscriptomic, and bile acid metabolomics analysis of a defined microbial community in gnotobiotic mice. Gut Microbes Jun 9:1–24. doi: 10.1080/19490976.2019.1618173. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21.Devendran S, Shrestha R, Alves JMP, Wolf PG, Ly L, Hernandez AG, Mendez-Garcia C, Inboden A, Wiley J, Paul O, Allen A, Springer E, Wright CL, Fields CJ, Daniel SL, Ridlon JM. 2019. Clostridium scindens ATCC 35704: integration of nutritional requirements, the complete genome sequence, and global transcriptional responses to bile acids. Appl Environ Microbiol 85:e00052-19. doi: 10.1128/AEM.00052-19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22.Sorg JA, Sonenshein AL. 2008. Bile salts and glycine as cogerminants for Clostridium difficile spores. J Bacteriol 190:2505–2512. doi: 10.1128/JB.01765-07. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23.Dubois T, Tremblay YDN, Hamiot A, Martin-Verstraete I, Deschamps J, Monot M, Briandet R, Dupuy B. 2019. A microbiota-generated bile salt induces biofilm formation in Clostridium difficile. NPJ Biofilms Microbiomes 5:14. doi: 10.1038/s41522-019-0087-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24.Sievers S, Metzendorf NG, Dittmann S, Troitzsch D, Gast V, Troger SM, Wolff C, Zuhlke D, Hirschfeld C, Schluter R, Riedel K. 2019. Differential view on the bile acid stress response of Clostridioides difficile. Front Microbiol 10:258. doi: 10.3389/fmicb.2019.00258. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25.Solbach P, Chhatwal P, Woltemate S, Tacconelli E, Buhl M, Gerhard M, Thoeringer CK, Vehreschild M, Jazmati N, Rupp J, Manns MP, Bachmann O, Suerbaum S. 2018. BaiCD gene cluster abundance is negatively correlated with Clostridium difficile infection. PLoS One 13:e0196977. doi: 10.1371/journal.pone.0196977. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26.Amrane S, Bachar D, Lagier JC, Raoult D. 2018. Clostridium scindens is present in the gut microbiota during Clostridium difficile infection: a metagenomic and culturomic analysis. J Clin Microbiol 56:e01663-17. doi: 10.1128/JCM.01663-17. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

[B27] 27.Buffie CG, Bucci V, Stein RR, McKenney PT, Ling L, Gobourne A, No D, Liu H, Kinnebrew M, Viale A, Littmann E, van den Brink MR, Jenq RR, Taur Y, Sander C, Cross JR, Toussaint NC, Xavier JB, Pamer EG. 2015. Precision microbiome reconstitution restores bile acid mediated resistance to Clostridium difficile. Nature 517:205–208. doi: 10.1038/nature13828. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28.Thanissery R, McLaren MR, Rivera A, Reed AD, Betrapally NS, Burdette T, Winston JA, Jacob M, Callahan BJ, Theriot CM. 2019. Characterization of C. difficile strains isolated from companion animals and the associated changes in the host fecal microbiota. bioRxiv doi: 10.1101/822577. [DOI] [PMC free article] [PubMed]

[B29] 29.Studer N, Desharnais L, Beutler M, Brugiroux S, Terrazos MA, Menin L, Schürch CM, McCoy KD, Kuehne SA, Minton NP, Stecher B, Bernier-Latmani R, Hapfelmeier S. 2016. Functional intestinal bile acid 7α-dehydroxylation by Clostridium scindens associated with protection from Clostridium difficile infection in a gnotobiotic mouse model. Front Cell Infect Microbiol 6:191. doi: 10.3389/fcimb.2016.00191. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B30] 30.Fletcher JR, Erwin S, Lanzas C, Theriot CM. 2018. Shifts in the gut metabolome and Clostridium difficile transcriptome throughout colonization and infection in a mouse model. mSphere 3:e00089-18. doi: 10.1128/mSphere.00089-18. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31.Wilson KH, Perini F. 1988. Role of competition for nutrients in suppression of Clostridium difficile by the colonic microflora. Infect Immun 56:2610–2614. doi: 10.1128/IAI.56.10.2610-2614.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B32] 32.Robinson JI, Weir WH, Crowley JR, Hink T, Reske KA, Kwon JH, Burnham CD, Dubberke ER, Mucha PJ, Henderson JP. 2019. Metabolomic networks connect host-microbiome processes to human Clostridioides difficile infections. J Clin Invest 130:3792–3806. doi: 10.1172/JCI126905. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33.Wilson KH, Sheagren JN. 1983. Antagonism of toxigenic Clostridium difficile by nontoxigenic C. difficile. J Infect Dis 147:733–736. doi: 10.1093/infdis/147.4.733. [DOI] [PubMed] [Google Scholar]

[B34] 34.Gerding DN, Meyer T, Lee C, Cohen SH, Murthy UK, Poirier A, Van Schooneveld TC, Pardi DS, Ramos A, Barron MA, Chen H, Villano S. 2015. Administration of spores of nontoxigenic Clostridium difficile strain M3 for prevention of recurrent C. difficile infection: a randomized clinical trial. JAMA 313:1719–1727. doi: 10.1001/jama.2015.3725. [DOI] [PubMed] [Google Scholar]

[B35] 35.Karasawa T, Ikoma S, Yamakawa K, Nakamura S. 1995. A defined growth medium for Clostridium difficile. Microbiology 141:371–375. doi: 10.1099/13500872-141-2-371. [DOI] [PubMed] [Google Scholar]

[B36] 36.Bouillaut L, Self WT, Sonenshein AL. 2013. Proline-dependent regulation of Clostridium difficile Stickland metabolism. J Bacteriol 195:844–854. doi: 10.1128/JB.01492-12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B37] 37.Nisman B, Raynaud M, Cohen GN. 1948. Extension of the Stickland reaction to several bacterial species. Arch Biochem 16:473. [PubMed] [Google Scholar]

[B38] 38.Stadtman TC, Elliott P. 1957. Studies on the enzymic reduction of amino acids. II. Purification and properties of d-proline reductase and a proline racemase from Clostridium sticklandii. J Biol Chem 228:983–997. [PubMed] [Google Scholar]

[B39] 39.Costilow RN. 1977. Selenium requirement for the growth of Clostridium sporogenes with glycine as the oxidant in Stickland reaction systems. J Bacteriol 131:366–368. doi: 10.1128/JB.131.1.366-368.1977. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40.Mead GC. 1971. The amino acid-fermenting clostridia. J Gen Microbiol 67:47–56. doi: 10.1099/00221287-67-1-47. [DOI] [PubMed] [Google Scholar]

[B41] 41.Morris GN, Winter J, Cato EP, Ritchie AE, Bokkenheuser VD. 1985. Clostridium scindens sp. nov., a human intestinal bacterium with desmolytic activity on corticoids. Int J Syst Evol Microbiol 35:478–481. doi: 10.1099/00207713-35-4-478. [DOI] [Google Scholar]

[B42] 42.Kang JD, Myers CJ, Harris SC, Kakiyama G, Lee IK, Yun BS, Matsuzaki K, Furukawa M, Min HK, Bajaj JS, Zhou H, Hylemon PB. 2019. Bile acid 7α-dehydroxylating gut bacteria secrete antibiotics that inhibit Clostridium difficile: role of secondary bile acids. Cell Chem Biol 26:27–34.e24. doi: 10.1016/j.chembiol.2018.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43.Harris SC, Devendran S, Alves JMP, Mythen SM, Hylemon PB, Ridlon JM. 2018. Identification of a gene encoding a flavoprotein involved in bile acid metabolism by the human gut bacterium Clostridium scindens ATCC 35704. Biochim Biophys Acta Mol Cell Biol Lipids 1863:276–283. doi: 10.1016/j.bbalip.2017.12.001. [DOI] [PubMed] [Google Scholar]

[B44] 44.Bhowmik S, Jones DH, Chiu HP, Park IH, Chiu HJ, Axelrod HL, Farr CL, Tien HJ, Agarwalla S, Lesley SA. 2014. Structural and functional characterization of BaiA, an enzyme involved in secondary bile acid synthesis in human gut microbe. Proteins 82:216–229. doi: 10.1002/prot.24353. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B45] 45.Mallonee DH, Lijewski MA, Hylemon PB. 1995. Expression in Escherichia coli and characterization of a bile acid-inducible 3 α-hydroxysteroid dehydrogenase from Eubacterium sp. strain VPI 12708. Curr Microbiol 30:259–263. doi: 10.1007/bf00295498. [DOI] [PubMed] [Google Scholar]

[B46] 46.Wang H, Latorre JD, Bansal M, Abraha M, Al-Rubaye B, Tellez-Isaias G, Hargis B, Sun X. 2019. Microbial metabolite deoxycholic acid controls Clostridium perfringens-induced chicken necrotic enteritis through attenuating inflammatory cyclooxygenase signaling. Sci Rep 9:14541. doi: 10.1038/s41598-019-51104-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47.Islam KB, Fukiya S, Hagio M, Fujii N, Ishizuka S, Ooka T, Ogura Y, Hayashi T, Yokota A. 2011. Bile acid is a host factor that regulates the composition of the cecal microbiota in rats. Gastroenterology 141:1773–1781. doi: 10.1053/j.gastro.2011.07.046. [DOI] [PubMed] [Google Scholar]

[B48] 48.Kurdi P, Kawanishi K, Mizutani K, Yokota A. 2006. Mechanism of growth inhibition by free bile acids in lactobacilli and bifidobacteria. J Bacteriol 188:1979–1986. doi: 10.1128/JB.188.5.1979-1986.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B49] 49.Merritt ME, Donaldson JR. 2009. Effect of bile salts on the DNA and membrane integrity of enteric bacteria. J Med Microbiol 58:1533–1541. doi: 10.1099/jmm.0.014092-0. [DOI] [PubMed] [Google Scholar]

[B50] 50.Sorg JA, Sonenshein AL. 2009. Chenodeoxycholate is an inhibitor of Clostridium difficile spore germination. J Bacteriol 191:1115–1117. doi: 10.1128/JB.01260-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B51] 51.Hofmann AF, Roda A. 1984. Physicochemical properties of bile acids and their relationship to biological properties: an overview of the problem. J Lipid Res 25:1477–1489. [PubMed] [Google Scholar]

[B52] 52.Huang YY, Martinez-Del Campo A, Balskus EP. 2018. Anaerobic 4-hydroxyproline utilization: discovery of a new glycyl radical enzyme in the human gut microbiome uncovers a widespread microbial metabolic activity. Gut Microbes 9:437–451. doi: 10.1080/19490976.2018.1435244. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53.Levin BJ, Huang YY, Peck SC, Wei Y, Martinez-Del Campo A, Marks JA, Franzosa EA, Huttenhower C, Balskus EP. 2017. A prominent glycyl radical enzyme in human gut microbiomes metabolizes trans-4-hydroxy-l-proline. Science 355:eaai8386. doi: 10.1126/science.aai8386. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B54] 54.Guo CJ, Allen BM, Hiam KJ, Dodd D, Van Treuren W, Higginbottom S, Nagashima K, Fischer CR, Sonnenburg JL, Spitzer MH, Fischbach MA. 2019. Depletion of microbiome-derived molecules in the host using Clostridium genetics. Science 366:eaav1282. doi: 10.1126/science.aav1282. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B55] 55.Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647–1649. doi: 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B56] 56.Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B57] 57.Wilkins D. 2019. gggenes: draw gene arrow maps in ‘ggplot2’. R package version 0.4.0. https://rdrr.io/cran/gggenes/.

[B58] 58.Alikhan NF, Petty NK, Ben Zakour NL, Beatson SA. 2011. BLAST Ring Image Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics 12:402. doi: 10.1186/1471-2164-12-402. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B59] 59.Thanissery R, Zeng D, Doyle RG, Theriot CM. 2018. A small molecule-screening pipeline to evaluate the therapeutic potential of 2-aminoimidazole molecules against Clostridium difficile. Front Microbiol 9:1206. doi: 10.3389/fmicb.2018.01206. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60.Andersen CL, Jensen JL, Orntoft TF. 2004. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 64:5245–5250. doi: 10.1158/0008-5472.CAN-04-0496. [DOI] [PubMed] [Google Scholar]

PERMALINK

Strain-Dependent Inhibition of Clostridioides difficile by Commensal Clostridia Carrying the Bile Acid-Inducible (bai) Operon

A D Reed

M A Nethery

A Stewart

R Barrangou

C M Theriot

Roles

ABSTRACT

INTRODUCTION

RESULTS

Genomic comparison between commensal Clostridia that carry the bai operon.

FIG 1.

C. difficile is more resistant to cholate and less resistant to deoxycholate than are commensal Clostridia.

FIG 2.

Commensal Clostridia inhibit C. difficile in a strain-dependent manner that correlates with the conversion of cholate to deoxycholate.

FIG 3.

Expression of baiE and baiG is increased when cholate is converted to deoxycholate.

FIG 4.

C. difficile outcompetes commensal Clostridia in a strain-dependent manner.

FIG 5.

DISCUSSION

MATERIALS AND METHODS

Genomic analysis of commensal Clostridia strains and the bai operon.

Bacterial strain collection and growth conditions.

MIC assay with the addition of bile acids.

Growth kinetics assay.

C. difficile inhibition assay with supernatants from commensal Clostridia supplemented or not with bile acids.

Bile acid metabolomic analysis.

Targeted data processing.

RNA extraction from commensal Clostridia cultures supplemented with CA.

Reverse transcription and quantitative real-time PCR.

TABLE 1.

TABLE 2.

TABLE 3.

Competition studies between C. difficile and commensal Clostridia.

Statistical analyses.

Supplementary Material

ACKNOWLEDGMENTS

Footnotes

REFERENCES

Associated Data

Supplementary Materials

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases