Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Apr 8.
Published in final edited form as: Cell Host Microbe. 2020 Mar 27;27(4):571–584.e7. doi: 10.1016/j.chom.2020.03.003

Paradoxical Pro-inflammatory Responses by Human Macrophages to an Amoebae Host-Adapted Legionella Effector

Christopher Price 1, Snake Jones 1, Mirna Mihelcic 3, Marina Santic 3, Yousef Abu Kwaik 1,2
PMCID: PMC7224327  NIHMSID: NIHMS1579692  PMID: 32220647

Summary

Legionella pneumophila has co-evolved with amoebae, their natural hosts. Upon transmission to humans, the bacteria proliferate within alveolar macrophages causing pneumonia. Here we show L. pneumophila injects the effector LamA, an amylase, into the cytosol of human macrophage (hMDMs) and amoebae to rapidly degrade glycogen to generate cytosolic hyper-glucose. In response, hMDMs shift their metabolism to aerobic glycolysis, which directly triggers an M1-like pro-inflammatory differentiation and nutritional innate immunity through enhanced tryptophan degradation. This leads to a modest restriction of bacterial proliferation in hMDMs. In contrast, LamA-mediated glycogenolysis in amoebae deprives the natural host from the main building blocks for synthesis of the cellulose-rich cyst wall, leading to subversion of amoeba encystation. This is non-permissive for bacterial proliferation. Therefore, LamA of L. pneumophila is an amoebae host-adapted effector that subverts encystation of the amoebae natural host, and the paradoxical hMDMs pro-inflammatory response is likely an evolutionary accident.

Graphical Abstract

graphic file with name nihms-1579692-f0001.jpg

eTOC blurb

Legionella pneumophila resides within amoebae hosts in the natural environment. Here we show that L. pneumophila injects an amylase to subvert the encystation of the amoebae natural host, to maintain a permissive environment. Paradoxically, the amylase triggers an accidental pro-inflammatory response in the human host that modestly restricts bacterial replication.

Introduction

The hallmarks of cells of the monocyte-macrophage lineage are their functional diversity and plasticity (Sica and Mantovani, 2012; Wynn et al., 2013). Depending on the signals in vitro, macrophages can undergo transient and reversible differentiation into two main subsets: “M1” pro-inflammatory/classically activated and “M2” anti-inflammatory/alternatively activated phenotype (Sica and Mantovani, 2012; Wang et al., 2014a; Wynn et al., 2013). M1 polarized mouse and human macrophages exhibit strong microbiocidal activity and produce pro-inflammatory cytokines such as TNF-α, and IL-1β, IL-12, IL6, and IFN-γ, while M2 polarized macrophages are involved in parasites containment and tissue repair and produce anti-inflammatory cytokines such as IL-4, IL-10, and IL-13 (Price and Vance, 2014). Glucose is the primary source of energy in M1 polarized macrophages that reprogram their metabolism from oxidative phosphorylation into aerobic glycolysis (Warburg effect) with an increased production of lactate (Chang et al., 2013; Freemerman et al., 2014; Jha et al., 2015; Mills et al., 2016; Suzuki et al., 2016; Tannahill et al., 2013; Zhu et al., 2015).

A growing body of data in vitro, in animal models, and in diabetic patients show that excessive amounts of glucose triggers up-regulation of aerobic glycolysis, which directly polarizes monocytes-macrophages toward a M1 pro-inflammatory phenotype (Bradshaw et al., 2009; Bustos and Sobrino, 1992; Haidet et al., 2012; Pan et al., 2012; Reinhold et al., 1996; Torres-Castro et al., 2016). Importantly, upon exposure of human monocytes/macrophages to high levels of glucose in vitro, they undergo M1 polarization along with increased import of glucose; and monocytes/macrophages from patients with Type 1 diabetes exhibit a M1 pro-inflammatory profile (Erbel et al., 2016; Haidet et al., 2012; Kraakman et al., 2014; Pan et al., 2012; Reinhold et al., 1996; Torres-Castro et al., 2016).

In response to bacterial infections, macrophages undergo M1 pro-inflammatory polarization (Benoit et al., 2008; Hielpos et al., 2018; Mori et al., 2018; Yuan et al., 2019), which is an important arm of the innate host defense to restrict invading pathogens (Adam et al., 2014; Benoit et al., 2008; Faris et al., 2019; Guo et al., 2019; Price and Vance, 2014; Sica and Mantovani, 2012; Yang et al., 2018). However, several facultative and obligate intracellular bacterial pathogens such as Mycobacterium, Salmonella, Chlamydia, Coxiella, Brucella, Listeria, and Francisella (Guo et al., 2019; Refai et al., 2018; Yuan et al., 2019) have evolved with mechanisms to interfere with M1 polarization of macrophages (Adam et al., 2014; Benoit et al., 2008; Eisele et al., 2013; Muraille et al., 2014; Pathak et al., 2007; Price and Vance, 2014), but the mechanisms are not known. Paradoxically, macrophages respond to Legionella pneumophila by an inflammasome-independent rapid release of pro-inflammatory cytokines (Asrat et al., 2015; Asrat et al., 2014; Copenhaver et al., 2015; Fontana et al., 2011; Fontana et al., 2012; Ivanov and Roy, 2013; Price and Abu Kwaik, 2014; Rolando et al., 2013). However, the specific pathogenic signals of L. pneumophila or other intracellular pathogens that are sensed by macrophages to modulate M1/M2 differentiation are not known, and the mechanisms are not well understood.

Legionella pneumophila is an aquatic organism that has evolved to proliferate within amoebae as its primary natural host (Fields, 1996; Harb et al., 2000; Molmeret et al., 2005). The bacterium proliferates within the metabolically active trophozoite form of the amoeba (Bouyer et al., 2007; Kilvingston and Price, 1990). Upon exposure to stress stimuli, such as nutrient depletion, metabolically active Acanthamoeba trophozoite differentiates into a double-walled cellulose-rich cyst (Byers et al., 1991; Lorenzo-Morales et al., 2008), which is a spore-like dormant form that completely restricts intracellular growth of L. pneumophila (Bouyer et al., 2007; Kilvingston and Price, 1990). While amoeba and other protists are considered the natural host for L. pneumophila, humans are considered to be an accidental host (Best and Abu Kwaik, 2018; Mori et al., 2018; Shuman et al., 1998; Swart et al., 2018). Upon inhalation of L. pneumophila-contaminated environmental aerosols by humans, the organism proliferates within alveolar macrophages causing pneumonia designated as Legionnaires’ disease (Horwitz, 1983a, b; Horwitz and Silverstein, 1980). The intracellular lifestyle of L. pneumophila within amoebae and macrophages is very similar where the organism is internalized into a phagosome that evades the endosomal-lysosomal pathway and intercepts early secretory vesicles to become an ER-derived vacuole, designated as the Legionella-containing vacuole (LCV) (Bärlocher et al., 2017; Haenssler et al., 2015; Isberg et al., 2009; Kagan and Roy, 2002; Kotewicz et al., 2017; Luo, 2011; Oliva et al., 2018; Richards et al., 2013).

The unique biogenesis of the Legionella-containing vacuole (LCV) and modulation of plethora of cellular processes upon infection of amoebae and human macrophages is mediated by the Dot/Icm type IV secretion system that injects a cargo of >320 protein effectors into the host cells (Burstein et al., 2016; Schroeder, 2017; Zhu et al., 2011). L. pneumophila also utilizes a type II secretion system (T2SS) to secrete an array of 50 degradative and hydrolytic enzymes required for intracellular growth within amoeba, macrophages and in vivo (Abu Khweek and Amer, 2018; Cianciotto and White, 2017; DebRoy et al., 2006; Rossier et al., 2004).

Most translocated effectors of L. pneumophila are not required for proliferation in human macrophages and L. pneumophila has evolved to survive within their amoebae natural hosts, suggesting the effector repertoire is likely a toolbox to interact with various amoebal species (Best and Abu Kwaik, 2018; Park et al., 2020). Therefore, it is likely the many amoebae-adapted effectors may cause accidental responses in human cells. Here we show that the Dot/Icm injection machinery of intra-vacuolar L. pneumophila injects into the macrophage cytosol a Legionella amylase (LamA) that rapidly degrades cytosolic glycogen leading to a M1-like pro-inflammatory response, which partially restricts pathogen proliferation ex vivo and in vivo. In contrast to the paradoxical response of macrophages, LamA-mediated rapid glycogenolysis in the amoebae natural host subverts amoebae encystation. Therefore, LamA of L. pneumophila has evolved to be injected into the amoeba host to catalyze host glycogenolysis in order to subvert encystation of the amoebae natural host. However, the macrophage pro-inflammatory response is likely an evolutionary accident but with no major impact on disease manifestation.

Results

Dot/Icm injection of a Legionella amylase into the macrophage cytosol

Based on a potential putative translocation signal generated by a machine learning algorithm, many potential L. pneumophila candidates effectors have been identified (Lifshitz et al., 2013). Two putative Legionella amylases (Lpg1671 and Lpg2528) were identified, but discounted, since there is no precedence for such an enzyme to be translocated into the host cell through type III-IX translocation systems of bacterial pathogens (Lifshitz et al., 2013). We have designated Lpg1671 and Lpg2528 as Legionella amylase A and B (LamA and LamB), respectively. Since L. pneumophila does not synthesize glycogen or starch, we determined whether these amylases are injected into the host cell cytosol, using adenylate cyclase reporter fusions. We have previously shown that LamB is not translocated into the macrophage (Best et al., 2018). In contrast, we now show that LamA is translocated into the macrophage cytosol by wild type bacteria but not by the type IV translocation-defective (ΔT4SS) mutant, similar to the RalF effector control (Fig. 1A).

Figure 1. Generation of cytosolic hyper-glucose in hMDMs by LamA-mediated glycogenolysis.

Figure 1.

A) Adenylate cyclase (Cya) reporter fusion translocation assays of LamA expressed by wild type L. pneumophila and the translocation-deficient T4SS mutant. The Cya-RalF effector fusion was used a positive control. hMDMs were for 1h in triplicate and cAMP production was assessed by ELISA. Data is shown as mean cAMP concentration ± SD, n=3. ** Student t-test of WT-RalF vs WT-Cya p< 0.0015, ** Student t-test of WT-LamA vs WT-Cya p< 0.0024. B) Amylase activity was measured in lysates of E. coli expressing native or catalytic active site mutants GST-LamA fusions, with and without IPTG induction, since expression was controlled by an IPTG-inducible promoter. Representative data of three independent experiments is shown as mean amylase activity ± SD, n=3 independent cultures. ** Student t-test of IPTG-induced LamA vs un-induced LamA p< 0.0021. C) Quantification of cytosolic glycogen concentrations in hMDMs starved of glucose or infected wild type, T4SS, lamA or lamA/C and its catalytically inactive mutants at 1h and 6h post-infection. D) Representative Z-stack confocal microscopy images of hMDMs infected with various L. pneumophila strains (green) and glycogen granules were labeled by antibody (red). Scale bar represents 5 μm. E) Quantification of glycogen granules per infected cell at 30 and 60 min post-infection. Glycogen granules were counted in Z-stack confocal images and data points show mean granules/infected cell ± SD, n=100 infected cells, and are representative of three independent experiments. *** Student t-test of glycogen granules in either T4SS or lamA infected cells versus wild type infected cells p< 0.0001. F) Quantification of cytosolic glucose-6-phosphate levels in uninfected (U/I) and hMDMs infected with L. pneumophila strains. The data are representative of 3 independent experiments. *** Student t-test of glucose-6-phosphate levels in either wild type or lamA/C infected cells versus uninfected infected cells p< 0.0001. G) Determination of glucose uptake by hMDMs infected with the wild type, T4SS, lamA or lamA/C strains, or pretreated with LPS/IFN-γ at 1h and 6h post-infection. BAY876 was used to block glucose transport *** Student t-test of glucose uptake levels in either wild type or lamA/C infected cells versus mock p< 0.0001

To confirm the enzymatic function of LamA, the native protein and three mutants with substitutions in the catalytic pocket (D199A, E233A and D313A) were expressed in E. coli and the amylase activity was determined in total cell lysates. The data showed that LamA exhibited strong amylase activity, which was abolished by substitution of any of three residues in the catalytic pocket (Fig. 1B, S1A). Taken together, the data show that LamA is a Dot/Icm-injected amylase, which is a unique example for such a hydrolytic enzyme of storage polymeric macromolecules to be injected into the host cell by type III-IX translocation machineries of bacterial pathogens.

Generation of cytosolic hyper-glucose in hMDMs by LamA-mediated glycogenolysis

Glycogen is the sole glucose storage molecule in mammalian cells and is found in dense granules throughout the cytoplasm. We determined whether the pathogen translocated LamA effector hydrolyzes macrophage glycogen. Human monocyte-derived macrophages (hMDMs) were infected with L. pneumophila and the quantity of glycogen was measured at 1h and 6h post-infection. As expected, hMDMs that were starved of glucose, glycogen was rapidly depleted within 1h and was further reduced at 6h following removal of glucose from the culture media, indicative of glycogenolysis (Fig. 1C). Strikingly, infection of hMDMs with the wild type strain of L. pneumophila for 1h, glycogen was significantly depleted compared to uninfected cells (Student t-test, p 0.0132) and was further reduced at 6h post-infection (Student t-test, p 0.0057) (Fig. 1C). In contrast, glycogen levels in hMDMs infected with the translocation deficient ΔT4SS mutant or the ΔlamA mutant were unaffected and similar to uninfected cells at both 1h and 6h post-infection (Fig. 1C). Infection of hMDMs with the complemented ΔlamA mutant, (lamA/C), resulted in rapid glycogen degradation, similar to that observed in cells infected with the wild type strain (Fig. 1C). However, infection of hMDMs with the ΔlamA mutant complemented with the catalytically dead variants of LamA did not result in glycogen degradation (Fig. 1C). LamA-dependent glycogenolysis was further assessed by confocal microscopy. Following 30 min infection, uninfected hMDMs or hMDMs infected with wild type strain, ΔT4SS, ΔlamA, or lamA/C mutants harbored between 10–15 dense glycogen granules (Fig. 1D, E). Remarkably, at 1h and 2h post-infection, hMDMs infected with the wild type, or lamA/C harbored less than 5 glycogen granules while the ΔT4SS and ΔlamA mutant infected cells still harbored over 10 granules, similar to uninfected cells (Student t-test, p <0.0001) (Fig. 1D, E, Fig. S1B). A mutant defective in the T2SS (lspG) that is unable to secrete the glucoamylase, GamA (Herrmann et al., 2011; Rossier and Cianciotto, 2001) or defective for an alternate amylase, ΔlamB (Best et al., 2018), hydrolyzed host glycogen similar to the wild type strain (Fig. 1D, E, Fig. S1B). Our data are clear that the Dot/Icm-translocated LamA catalyzes rapid glycogenolysis in macrophages.

To determine if the rapid LamA-mediated glycogenolysis results in elevation in cytosolic glucose, the level of glucose-6-phosphate (G6P) in infected hMDMs was determined. Following 1h infection of hMDMs, the quantity of G6P in cells infected with wild type bacteria increased by 5-fold compared to uninfected cells (Student t-test, p <0.0001), while those infected with the ΔT4SS or ΔlamA mutant were similar to uninfected cells (Fig. 1F). Importantly, infection of hMDMs with the complemented lamA/C strain resulted in high cytosolic G6P levels, similar to infection by the wild type (Student t-test, p <0.0001) (Fig. 1F). Taken together, LamA-mediated rapid glycogenolysis in macrophages results in cytosolic hyper-glucose.

Next, we determined if the rapid rise in cytosolic hyper-glucose within 1h of infection is due to LamA-mediated glycogenolysis or if increased extracellular glucose uptake by hMDMs contributed to the cytosolic hyper-glucose. We measured glucose uptake by hMDMs infected with the wild type, ΔT4SS, ΔlamA or lamA/C strains at 1h or 6h post-infection or pre-stimulated with LPS/IFN-γ for 24h prior to the assay. We found at 1h post-infection, glucose uptake by hMDMs infected with any of the L. pneumophila strains were similar to mock-infected cells (Fig. 1G). However, at 6h post-infection, hMDMs infected with the wild type or the lamA/C complemented mutant strain exhibited a marked increase in glucose uptake compared to mock-infected cells (Student t-test, p 0.0009, 0.0003 respectively). Importantly, elevated glucose uptake in wild type-infected hMDMs was reversed when the cells were treated with a glucose transport inhibitor BAY876 (Fig. 1G). In contrast, glucose uptake by hMDMs infected with the ΔT4SS or ΔlamA mutants for 6h, did not show increased glucose uptake (Fig. 1G). As expected, hMDMs stimulated with LPS/IFN-γ showed elevated glucose uptake compared mock treated cells (Fig. 1G). This shows that the initial rise in cytosolic hyper-glucose within 1h of infection is due to LamA-mediated glycogenolysis and not uptake of extracellular glucose by hMDMs.

Partial restriction of pathogen proliferation in response to LamA-dependent cytosolic hyper-glucose

We determined the effect of LamA-mediated glycogenolysis on pathogen proliferation in hMDMs. By 24h post-infection, the ΔlamA mutant exhibited 8-fold more intracellular bacteria than the wild type strain, and this increased to over 12-fold at 48h post-infection (Student t-test, p <0.0001) (Fig. 2A). Complementation of the ΔlamA mutant with the wild type lamA gene but not the catalytically dead variants, reversed the increased growth of the ΔlamA mutant, similar to that of the wild type strain (Fig. 2A). L. pneumophila expressed LamA and its catalytically dead variants equally (Fig. S1C). Interestingly, the doubling time of the ΔlamA mutant (70 min) in hMDMs was significantly shorter than the wild type strain (108min) (Student t-test, p <0.001), while growth of the ΔlamA mutant in rich bacteriological growth media was identical to the wild type strain (Fig. S1D). To confirm the intracellular replication phenotype of the ΔlamA mutant at the single cell level, we assessed bacterial burden within LCVs at 6–8h post-infection. At 6h post-infection of hMDMs, LCVs harboring the wild type strain had ~2 bacteria/LCV (Fig. 2B, C). We observed a slight increase in bacterial number for LCVs harboring the ΔlamA mutant at 6 h (~3 bacteria/LCV) but this was not significantly different from the wild type strain (Student t-test, p >0.12) (Fig. 2B, C). However at 8h post-infection, LCVs harboring the ΔlamA mutant contained ~9 bacteria while those harboring the wild type or the complemented lamA/C strain contained 4 bacteria (Student t-test, p <0.0001) (Fig. 2B, C). In contrast to what was observed in hMDMs, the ΔlamA mutant grew similarly to the wild type strain in the natural host of L. pneumophila, Acanthamoeba polyphaga (Fig. S2).

Figure 2. LamA-mediated cytosolic hyper-glucose restricts pathogen proliferation in hMDMs and in vivo.

Figure 2.

Intra-vacuolar replication of wild type, T4SS, lamA and lamA/C and the catalytically inactive mutants were assessed in hMDMs. A) To determine intra-vacuolar replication of L. pneumophila, infected hMDM monolayers were lysed at 2, 24 and 48h post-infection and serial dilutions plated on agar plates to determine CFUs. Data shown are mean CFUs ± SD, n=3, and are representative of three independent experiments. *** Student t-test of the number of lamA mutant bacteria VS wild type at 10h p< 0.0001. B, C) To further assess early time points for intra-vacuolar replication at the single cell level, infected monolayers were fixed, immunostained for L. pneumophila (green) and bacterial numbers in replicative vacuoles were enumerated by confocal microscopy at 6h and 8h post-infection. Scale bar represents 5 μm. Data points show mean number of bacteria/LCV ± SD, n=100 LCVs and are representative of three independent experiments. *** Student t-test of the number of lamA mutant bacteria per LCV at 8h VS wild type p< 0.0001. D) To assess intra-pulmonary proliferation of the lamA mutant, A/J mice were infected with 1 × 106 bacteria and the CFU burden in the lungs was assessed at various time points indicated. Data shown are mean CFUs ± SD per lung of three infected mice. Student t-test of the number of lamA mutant bacteria VS wild type at 48h * p < 0.0138, and at 72h ** p< 0.0041. E) Representative images of pulmonary sections stained with haematoxylin and eosin. Scale bar represents 50 μm. F) Histopathology score of lamA infected lungs VS wild type infected lungs 12h and 24h post-infection; ** Student t-test p< 0.0056 and at 24h *** p< 0.0001. G, H) Analysis of replicative LCVs within hMDMs co-infected with wild type and lamA mutant bacteria using MOI 1:1 for the two strains and analyzed at 8h post-infection using microscopic single cell analyses. Representative confocal images of hMDMs infected with wild type or lamA, or co-infected with both strains. Infected monolayers were fixed and immunostained for L. pneumophila (green), and wild type bacteria expressing m-Cherry (red). Scale bar represents 5 μm. Data points show mean number of bacteria/LCV ± SD, n=100 LCVs and are representative of three independent experiments. *** Student t-test of the number of lamA mutant/LCV VS wild type bacteria at 8h during individual infection with each strain compared to the number of lamA mutant bacteria in co-inhabited cells during co-infection p< 0.0001.

We determined the effect of LamA on intra-pulmonary growth of L. pneumophila in the A/J mouse model of disease after intra-tracheal inoculation of 10 animals/strain for each time point examined (Price and Abu Kwaik, 2010; Price et al., 2009). The data showed that the bacterial burden in the lungs and dissemination to the liver and spleen was significantly higher for the ΔlamA mutant compared to the wild type and lamA/C strains (Fig 2D, Fig S3A, B). Surprisingly, there was no detectable effect on lethality, as 60% of mice infected by either the WT strain or the ΔlamA mutant succumbed to infection by 72h (Fig S3C). Histopathology on pulmonary biopsies at 12 and 24 h post infection showed that the lungs of mice infected by the wild type strain exhibited more severe inflammatory infiltrates within alveolar, bronchial and peribronchial spaces with the infiltration of mononuclear cells (Fig. 2 E, F) than mice infected with the ΔlamA mutant strain (Student t-test, p <0.05) (Fig. 2E, F).

Glucose did not affect growth of L. pneumophila in bacteriological growth media (Fig. S3D). To determine whether the cytosolic hyper-glucose microenvironment was responsible for partial restriction of intracellular growth of the wild type strain, we attempted transfection with LamA, but its ectopic expression was toxic. Therefore, we performed co-infections of hMDMs with the wild type bacteria and the ΔlamA mutant. When both strains co-inhabited the same cell, either within communal LCVs or within distinct LCVs, replication of the ΔlamA mutant was partially restricted, similar to the wild type strain (Student t-test, p <0.0001) (Fig. 2G, H). Thus, the cytosolic hyper-glucose environment of macrophages partially restricts proliferation of L. pneumophila.

The hMDMs M1-like pro-inflammatory response to cytosolic hyper-glucose

We tested the hypothesis that in response to the cytosolic hyper-glucose, hMDMs mount a pro-inflammatory response (Erbel et al., 2016; Haidet et al., 2012; Kraakman et al., 2014; Pan et al., 2012; Reinhold et al., 1996; Torres-Castro et al., 2016). At 6h post-infection of hMDMs, the levels of pro- and anti-inflammatory cytokines released into the culture supernatant were measured. In response to infection with L. pneumophila, hMDMs released elevated levels of the pro-inflammatory cytokines IL-1α, IL-1β, IFN-γ, TNF-α, IL-12p40 and IL-12p70 compared to mock infected cells (Fig. 3A–D, Fig S4A). Importantly, in response to infection with the ΔlamA mutant, hMDMs released reduced levels of these 6 pro-inflammatory cytokines compared to those infected with the wild type strain (Fig. 3A–D, Fig. S4A). Complementation of the ΔlamA mutant with the wild type lamA gene but not the catalytically inactive mutant, restored elevated release of cytokines by hMDMs (Fig. 3A–D, Fig. S4A). No differences were observed for IL-6 secretion by hMDMs infected with any of the strains used (Fig. S4A). In response to infection with L. pneumophila, hMDMs also released the M2 anti-inflammatory cytokines IL-4 and IL-10, but LamA did not play a role in the release of IL-4 and IL-10 (Fig. S4B). Importantly, the bronchoalveolar lavage of mice infected with the wild type strain contained elevated levels of TNF-α, IL-1α, IFN-γ and IL-6 compared to the lamA mutant infection (Student t-test, p <0.0001) (Fig. 3E, S4C). However, production of IL-4 was increased in mice infected with the lamA mutant at 24h post-infection compared to that observed for the wild type strain (Student t-test, p <0.0001), which suggested a more complex cytokine profile in vivo (Fig. 3E) and maybe due to differences between human and mouse macrophages.

Figure 3. M1-like pro-inflammatory differentiation in response to the cytosolic hyper-glucose generated by LamA-mediated glycogenolysis in hMDMs and in vivo.

Figure 3.

A-D) Selected panels of inflammatory cytokines A) IL-1α, B) IFN-γ, C) TNF-α and D) IL12-p40, secreted by hMDMS infected for 6h with wild type, lamA, lamA/C or a catalytically inactive mutant were measured using a Milliplex assay. The rest of the cytokine panels are shown in Fig. S4A. *** Student t-test of cytokine level in lamA mutant infected hMDMS compared to wild type infected cells p< 0.0001. E) Cytokines levels in the bronchoalveolar lavage at 24h post-infection of mice. Data show pg/ml of cytokine present in BAL fluid. *** Student t-test of cytokine level in lamA mutant infected hMDMS compared to wild type infected mice p< 0.0001. F) To determine a paracrine effect during infection of hMDMs, culture supernatants from mock-, WT-, or lamA-infected cells at 6h were transferred to newly lamA-infected hMDMs for 8h, and replicative vacuoles were assessed by confocal microscopy. For WT-infected supernatants, cytokines were neutralized by specific antibodies 1h prior to infection. Data show mean number of bacteria/LCV ± SD, n=100 LCVs and are representative of three independent experiments. *** Student t-test of the number of lamA mutant bacteria per LCV with WT supernatant or TNFα/IL4 neutralized supernatants VS mock supernatant, or the number of WT bacteria per LCV with IFN-γ/IL12 neutralized WT supernatant VS WT supernatant p< 0.0001.

We determined the potential of a paracrine effect of the secreted pro-inflammatory cytokines on bystander hMDMs to restrict pathogen proliferation. Transfer of culture supernatants of 6h infection by the wild type strain to freshly infected hMDMs resulted in partial restriction of intracellular replication of the ΔlamA mutant, which was similar to the wild type strain with only ~5 bacteria per LCV at 8h post-infection (Student t-test, p <0.0001) (Fig. 3F). In contrast, transfer of culture supernatants of hMDMs infected with the ΔlamA mutant for 6h did not restrict intracellular replication of the ΔlamA mutant (Fig. 3F). Neutralization of IFN-γ or IL-12 but not TNF-α or IL-4 in the transferred supernatant from wild type strain infection reduced partial growth suppression of both the wild type and ΔlamA mutant strain in hMDMs with ~8–10 bacteria per LCV (Student t-test, p <0.0001) (Fig. 3F).

Reprogramming hMDM metabolism into aerobic glycolysis in response to L. pneumophila

Pro-inflammatory M1 macrophages reprogram their metabolism into aerobic glycolysis, which leads to elevated secretion of lactate into the extracellular environment. The hMDMs infected with either the wild type or lamA/C bacteria resulted in copious secretion of lactate into the culture supernatant by 6h (157–175 nM) (Fig. 4A), compared to infection by the ΔlamA or ΔT4SS mutants (23 nM) (Student t-test, p <0.0001) (Fig. 4A).

Figure 4. Up-regulation of aerobic glycolysis in response to the cytosolic hyper-glucose generated by LamA-mediated glycogenolysis is essential for M1-like polarization of hMDMs.

Figure 4.

A) Lactate levels in cell culture supernatants of hMDMS infected for 6h with wild type, T4SS, lamA or lamA/C strains were assessed by ELISA. Data represents the mean lactate concentration ± SD, n=3 and is representative of three independent experiments. *** Student t-test of lactate level in lamA mutant infected hMDMS compared to wild type infected cells p < 0.0001. B) Selected panels of pro-inflammatory cytokines secreted by hMDMS in which glycolysis was inhibited by 1mM NaF and infected for 6h with wild type or lamA were measured using a Multi-Analyte ELISArray kit and is representative of three independent experiments. The rest of the cytokine panels are shown in Fig. S5. *** Student t-test of cytokine level in WT or lamA mutant infected hMDMS treated with NaF compared to untreated but infected cells p< 0.0001. C, D) To assess the impact of hMDMs glycolysis on intra-vacuolar replication at the single cell level, hMDMs were treated with NaF C) or koningic acid D) 1h prior to and during infection. Replicative vacuoles were enumerated by confocal microsopy at 8h post-infection. Data points show mean number of bacteria/LCV ± SD, n=100 LCVs and are representative of three independent experiments. *** Student t-test of the number of WT bacteria per LCV in treated cells VS untreated cells p< 0.0001. E) Quantification of IFN-γ mRNA levels in hMDMs pretreated with LPS/IFN-γ, hMDMs infected with either the wild type or lamA mutant, or treated with glycolysis inhibitors NaF and koningic acid.

Since metabolic reprogramming into aerobic glycolysis is the driver for M1 pro-inflammatory polarization of macrophages, we determined the effect of inhibition of glycolysis on the LamA-dependent M1-like pro-inflammatory cytokine response and the partial restriction of pathogen proliferation. The data showed that prior inhibition of the glycolytic enzyme, enolase, by NaF abolished the LamA-dependent M1-like pro-inflammatory cytokine response of hMDMs (Student t-test, p <0.0001) (Fig. 4B, S5). Importantly, inhibition of hMDMs glycolysis by NaF or koningic acid, which inhibits enolase and glyceraldehyde 3-phosphate dehydrogenase respectively, enhanced replication of the wild type strain, which phenocopied the ΔlamA mutant in mock-treated cells (Student t-test, p <0.0001) (Fig. 4C, D). The glycolysis inhibitors had no detectable effect on growth of L. pneumophila in broth culture in vitro (Fig. S4D). Our data also showed that the wild type strain triggered increased IFN-γ transcription compared to the ΔlamA mutant (21 fold vs 5 fold) relative to mock-infected cells (Fig. 4E). Blocking glycolysis by NaF or koningic acid caused reduced IFN-γ transcription (−3.8 fold and −4.4 fold respectively) compared to mock-treated cells (Fig. 4E). As expected, hMDMs pretreated with LPS/ IFN-γ for 24h prior to the assay exhibited increased IFN-γ transcription relative to mock-treated cells (Fig. 4E). Our data indicate that in response to the cytosolic hyper-glucose generated by LamA-mediated glycogenolysis, hMDMs undergo M1-like pro-inflammatory polarization and partial restriction of pathogen proliferation.

Mechanism of LamA-dependent partial suppression of L. pneumophila replication

Pro-inflammatory macrophages restrict intracellular pathogens through multiple mechanisms including production of reactive oxygen species (ROS), increased lysosomal fusion and restriction of nutrients such as tryptophan via increased indoleamine 2,3-dioxygenase 1 (IDO1) activity. The production of ROS by hMDMs infected with either wild type or the ΔlamA mutant bacteria were similar to uninfected hMDMs (Fig. S6A). Additionally, trafficking of both the wild type and ΔlamA mutant bacteria in hMDMs showed that both equally evaded fusion to the lysosomes (Fig. S6B). Next, we assessed expression of IDO1 in hMDMs infected with wild type, ΔT4SS or ΔlamA mutant bacteria or stimulated with LPS and IFN-γ at 2h and 4h post-infection/treatment. At 4h post-infection, there was a dramatic increase in IDO1 expression in hMDMs infected with wild type bacteria, compared to the ΔlamA mutant or the translocation-deficient ΔT4SS mutant (Fig. 5A). As expected, IDO1 expression was induced by LPS/IFN-γ stimulation control (Fig. 5A). Next, we measured the cytosolic concentration of tryptophan. Following 4h of infection by the wild type or lamA/C strain, the cytosolic concentration of tryptophan was reduced by 11 fold compared to hMDMs infected with ΔT4SS, ΔlamA or ΔlamA/C199D-A or mock infected cells (Student t-test, p <0.0001) (Fig. 5B). Importantly, blocking IDO1 activity using 1-methyl-D-tryptophan (1-MDT) reversed depletion of tryptophan in hMDMs infected with the wild type strain (Fig. 5B).

Figure 5. Induction of innate nutritional immunity via tryptophan degradation in response to the cytosolic hyper-glucose generated by LamA-mediated glycogenolysis.

Figure 5.

A) Western blot of IDO1 expression in hMDMs infected with either wild type, T4SS or lamA mutants, or stimulated with LPS/IFNγ, and β-actin served as a loading control. Numbers below loading control represent densitometry ratios of IDO1/actin. ** and *** Student t-test of the density ratio of LPS/IFN-γ and WT at 4h versus Mock at 4h 0.007, <0.0001 respectively, from three independent experiments. B) Quantification of cytosolic tryptophan concentrations in hMDMs infected with wild type, formalin killed wild type, T4SS, lamA, lamA/C and the catalytically inactive mutant 4h post-infection. The IDO1 inhibitor 1-methy-D-tryptophan (1 mM) was added to wild type infected cells. Data points show mean tryptophan levels ± SD, n=3 and are representative of three independent experiments. *** Student t-test of tryptophan concentration in wild type or lamA/C infected cells versus mock p< 0.0001. C) To determine if tryptophan supplementation enhanced intracellular replication of wild type bacteria in hMDMs, cells were incubated with additional tryptophan supplement prior to infection and replicative LCVs were analyzed at 8h post-infection by confocal microscopy at the single cell level. Data points show mean number of bacteria/LCV ± SD, n=100 LCVs and are representative of three independent experiments. *** Student t-test of the number of wild type bacteria per LCV at 180 or 360 μM tryptophan 8h VS 90 μM tryptophan p< 0.0001. D) To assess if IDO1 inhibition restored replication of wild type bacteria, hMDMs were pretreated with increasing concentration of the inhibitor and infected with either the wild type or lamA mutant bacteria for 6h. Data points show mean number of bacteria/LCV ± SD, n=100 LCVs and are representative of three independent experiments. * Student t-test of the number of wild type bacteria per LCV at 0.5 or 1 μM inhibitor VS no inhibitor p< 0.0001.

We determined whether tryptophan supplementation would overcome the partial growth restriction of wild type bacteria. Our data showed that at 8h post-infection with wild type bacteria in media with the standard concentration of tryptophan (90 μM) in RPMI 1640 cell culture media, each LCV harbored ~4 bacteria (Fig. 5C). However, supplementation of the culture media to a 180 or 360 μM tryptophan final concentration dramatically increased the number of wild type bacteria per LCV (~10 bacteria/LCV) (Student t-test, p <0.0001), similar to LCVs harboring the ΔlamA mutant in regular media (Fig. 5C). To confirm the role of IDO1-mediated nutritional restriction of L. pneumophila growth, hMDMs were treated with an IDO1 inhibitor prior to infection and intracellular replication was assessed at the single cell level by confocal microscopy. At 6h post-infection, LCVs harboring wild type bacteria contained ~2 bacteria. However, inhibition of IDO1 resulted in a dose-dependent increase in wild bacteria replication (Student t-test, p <0.0001), phenocopying the replication of the lamA mutant in untreated cells (Fig. 5D). Thus, the modest LamA-dependent restriction in proliferation of wild type L. pneumophila within the M1-like hMDMs is mainly due to innate nutritional immunity of IDO1-dependent tryptophan degradation and deprivation.

Subversion of amoebae host encystation by rapid LamA-mediated glycogenolysis

The LamA-dependent M1-like pro-inflammatory polarization and partial pathogen restriction seems to be counter-evolutionary for the adaptation of an intracellular pathogen to macrophages. These paradoxical findings led credence to the hypothesis that it is more likely that LamA has evolved during co-evolution and adaptation of L. pneumophila with the amoebae natural host (Best and Abu Kwaik, 2018). Not surprisingly, phylogenetic analysis revealed that LamA, which is found in all sequenced L. pneumophila strains, is more closely related to amylases in Acanthamoebae rather than human amylases (Fig. S7A), suggesting inter-kingdom horizontal gene transfer of lamA from an amoebae host into L. pneumophila (de Felipe et al., 2005; Franco et al., 2009).

We utilized Acanthamoebae, since they are the most widespread protist in nature and an established model host (Swart et al., 2018). Upon exposure to stress stimuli, vegetative metabolically active Acanthamoeba trophozoites progressively differentiate into an immature cyst with a minimal immature cellulose wall then to mature cysts characterized by their mature cellulose-rich double-wall, which completely restrict intracellular growth of L. pneumophila. Synthesis of cellulose is essential for encystation, and is accomplished by autophagy-mediated rapid glycogenolysis, releasing a high level of glucose to synthesize the cellulose-rich endocyst wall (Byers et al., 1991; Faber et al., 2017; Lorenzo-Morales et al., 2008; Moon et al., 2014; Schaap and Schilde, 2018). Since interference with glycogenolysis or cellulose biosynthesis block amoebae encystation (Byers et al., 1991; Collins et al., 1984; Faber et al., 2017; Lorenzo-Morales et al., 2008; Moon et al., 2014; Schaap and Schilde, 2018), we tested the hypothesis that LamA-mediated rapid glycogenolysis in the amoebae host interferes with encystation of amoebae, and this pathogenic property has evolved to maintain amoebae in the permissive trophozoite form. To determine if LamA triggered glycogenolysis in amoebae, G6P levels were measured. The data showed that at 1h post-infection, there was little difference in G6P levels in infected amoebae compared to uninfected amoebae (Fig. 6A). However, at 2 and 4h post-infection, amoebae infected with the wild type or the lamA/C strain exhibited significantly higher levels of G6P compared to those infected with the ΔlamA or ΔT4SS mutants (Student t-test, p <0.0001), which were similar to uninfected amoebae (Fig. 6A). As an indicator for elevated glycolysis, we determined lactate secretion by A. polyphaga infected with the wild type, the ΔlamA or ΔT4SS mutants and the complemented lamA/C strain 4h post-infection. The data show that A. polyphaga infected with the wild type or lamA/C secrete significantly more lactate than those infected with the ΔlamA or ΔT4SS mutants or mock-infected cells (Student t-test, p 0.0012, <0.0001) (Fig. 6B). This indicates that similar to hMDMs, increased glycolysis in A. polyphaga is triggered by LamA catalyzed rapid glycogenolysis.

Figure 6. Interference with encystation of A. polyphaga by LamA-mediated glycogenolysis.

Figure 6.

A) Quantification of cytosolic glucose-6-phosphate levels in A. polyphaga infected with L. pneumophila. The data are representative of 3 independent experiments. *** Student t-test of glucose-6-phosphate levels in either wild type or lamA/C infected cells versus uninfected infected cells p< 0.0001. B) Lactate levels in A. polyphaga culture supernatants infected for 4h with wild type, T4SS, lamA or lamA/C strains were assessed by ELISA. Data represents the mean lactate concentration ± SD, n=3 and is representative of three independent experiments. Student t-test of lactate level in wild type or lamA/C infected A. polyphaga compared to mock infected cells p **0.0012, ***< 0.0001. C) Quantification of cytosolic glucose-6-phosphate levels in A. polyphaga infected with L. pneumophila during encystation. Infected amoebae were infected for 4h and G6P levels were measured. Amoebae were then transferred to glucose-free encystation buffer and G6P was measured 6 and 12h post-encystation. *** Student t-test of glucose-6-phosphate levels in either wild type or lamA/C infected cells versus mock infected cells p< 0.0001. D) To assess development of amoebae cysts following infection by L. pneumophila, A. polyphaga were labeled with calcoflour white, which intensely stains the dense cellulose wall of endocysts, and subjected to flow cytometry. Flow cytometry histograms of uninfected (U/I) A. polyphaga or infected with wild type bacteria or the T4SS and lamA mutants 2 days post-incubation in encystation media are shown and quantification is shown in E). The data are representative of 3 independent experiments. *** Student t-test of immature or mature cysts in wild type infected cells vs mock p< 0.0001. F) Representative confocal images of A. polyphaga cysts following infection with the wild type, or the T4SS and lamA mutants 3 days post-incubation in encystation media. Mature cysts (arrows) are characterized by intense endocyst wall staining (blue), while immature precysts (arrowheads) or non-encysted amoebae stain weakly or do not stain. Scale bar represents 5 μm.

Next, we determined if depletion of glycogen in trophozoites infected with the wild type strain prior to encystation stimuli, impacts availability of glucose needed for the biosynthesis of the cellulose rich endocyst wall. To achieve this, A. polyphaga trophozoites were infected with the wild type, ΔT4SS, ΔlamA and lamA/C strains for 4h in culture media containing glucose. At 1h post-infection, G6P levels in all conditions were similar, but at 4h, G6P levels in wild type and lamA/C infected A. polyphaga trophozoites were significantly elevated (Student t-test, p <0.0001) compared to mock infected cells (Fig. 6C). At 4h post-infection, the infected trophozoites were transferred to glucose-free encystation buffer and G6P levels were measured at 6h, 12h and 24h post-encystation. At 6h post-glucose deprivation, G6P levels in mock-infected or ΔT4SS or ΔlamA mutant infected A. polyphaga were elevated compared to pre-encystation levels. In contrast, G6P levels in A. polyphaga infected with the wild type or lamA/C strains were significantly reduced (Student t-test, p <0.0001) (Fig. 6C). At 12h post-glucose deprivation, the G6P levels in mock-infected or ΔT4SS or ΔlamA mutant infected A. polyphaga had reduced to a similar level seen for wild type or lamA/C infected A. polyphaga (Fig. 6C). This data indicate that LamA-dependent depletion of glycogen in wild type L. pneumophila infected A. polyphaga reduces the availability of glucose required for encystation of amoebae.

The impact of rapid LamA-mediated depletion of glycogen prior to amoebae encystation was determined by flow cytometry analysis and by confocal microscopy. A. polyphaga were labeled with calcofluor white, which intensely stains the dense cellulose wall of mature endocysts. Following 2h infection of A. polyphaga by L. pneumophila and two days incubation in glucose-free encystation buffer, > 80% of A. polyphaga infected with either ΔlamA or ΔT4SS mutant formed mature cysts characterized by dense cellulose endocyst walls, similar to uninfected amoebae (Fig. 6D–F). In contrast, only ~20% of A. polyphaga infected with wild type L. pneumophila formed mature cysts (Fig. 6D–F) (Student t-test, p <0.0001) with most amoebae in a cellulose-depleted immature precyst form, indicating interference with amoebal encystation as a result of rapid LamA-mediated glycogenolysis. Similar results were observed 3 days post-encystation (Fig. S7B). Trypan blue dye exclusion and counting show no reduction in amoebal viability and no increase in L. pneumophila populations were observed (data not shown). Taken together, the data indicate that LamA has evolved to modulate an amoeba-specific process that is absent in the more evolved accidental human host, and LamA has likely played a key role in co-evolution and adaptation of L. pneumophila with the amoebae natural hosts. However, the paradoxical macrophage response to the cytosolic hyper-glucose generated by LamA-mediated glycogenolysis is likely an unintended evolutionary accident with no major outcome on disease manifestation. It is not known whether the cytosolic hyper-glucose in the amoebae host has effects on amoebae cellular processes beyond subverting encystation.

Discussion

L. pneumophila reside in a wide range of amoebae species in the environment and has acquired a large repertoire of effector proteins that it utilizes to survive and proliferate within these host cells (Best and Abu Kwaik, 2018). It may not be surprising that most effector mutants of L. pneumophila are not defective in macrophages, as most effectors have likely evolved to adapt to various protists hosts in the environment (Best and Abu Kwaik, 2018; Park et al., 2020). Many effectors modulate conserved processes in both macrophages and amoebae, but no effector has been shown to modulate cellular processes specific to amoebae but are absent in the more evolved human host. Amoebae respond to nutrient deprivation by formation of dormant metabolically inactive cysts (Schaap and Schilde, 2018), which are non-permissive for L. pneumophila (Bouyer et al., 2007; Kilvingston and Price, 1990). We show here that the injected LamA catalyzes rapid glycogenolysis in amoebae and glycogen depletion blocks the ability of amoebae to form mature cysts, suggesting evolutionary selection pressure of LamA to maintain amoebae hosts in the permissive trophozoite form. However, the environmental selection for an injected amylase that targets host glycogen has led to an unintended and paradoxical consequence when L. pneumophila encounters human macrophages.

When L. pneumophila invades human macrophages, it translocates LamA causing glycogenolysis with abnormal rise in cytosolic glucose. However unlike amoebae, the response to cytosolic hyper-glucose in infected macrophages triggers aerobic glycolysis, which triggers a rapid M1-like pro-inflammatory differentiation. This may mimic the M1 pro-inflammatory polarization of macrophages upon exposure to high levels of glucose (Erbel et al., 2016; Haidet et al., 2012; Kraakman et al., 2014; Pan et al., 2012; Reinhold et al., 1996; Torres-Castro et al., 2016). While import of extracellular glucose represents a bottleneck, LamA-mediated hyper-glucose bypasses the glucose import bottleneck. In addition to the critical role of LamA, L. pneumophila targets mitochondrial dynamics to promote a Warburg-like phenotype in macrophages (Escoll et al., 2017; Price et al., 2018). Interestingly, macrophages infected with L. pneumophila produce a number of cytokines even though this bacteria injects several effectors that block host protein synthesis (Asrat et al., 2014; De Leon et al., 2017; Shen et al., 2009). To overcome this blockade, macrophages infected with wild type L. pneumophila produce IL-1α, which signals un-infected bystander cells to produce pro-inflammatory cytokines such as IL-6, TNF-α and IL12, which are made poorly by the infected cells (Copenhaver et al., 2015). Our data show that several pro-inflammatory cytokines are made by hMDMs in response to infection by the wild type strain, and this is dependent on the catalytic activity of LamA. It is important to note that our infection model routinely results in at least 95% of the hMDMs infected with L. pneumophila, however we cannot exclude the possibility that the 1–5% of uninfected bystander cells may contribute to the production of pro-inflammatory cytokines.

To restrict replication of invading bacterial pathogens, pro-inflammatory macrophages employ a variety of mechanisms including increased efficacy of lysosomal degradation, increased ROS killing ability, and elevated indoleamine 2,3-dioxygenase 1 (IDO1) activity. Despite a robust pro-inflammatory macrophage response, wild type L. pneumophila utilizes a powerful lysosomal bypass pathway to avoid degradation within lysosomes of M1-like pro-inflammatory macrophages (Ensminger, 2016). Despite reliance of L. pneumophila on host amino acids (Price et al., 2011), L. pneumophila is auxotrophic for many amino acids, highlighting the necessity of this pathogen to acquire amino acids from its host (Fonseca and Swanson, 2014; Price et al., 2011). Although L. pneumophila is not auxotrophic for tryptophan, acquisition of tryptophan from the host, in addition to de novo synthesis by the bacteria, is required for optimal intracellular growth (Jones et al., 2015). The LamA-mediated pro-inflammatory response of infected hMDMs (IFN-γ in particular) triggers IFN-γ-mediated IDO1 expression leading to depletion of host tryptophan (Wang et al., 2014b), which is responsible for the partial growth restriction through nutritional innate immunity. Since, >95% of the macrophages are infected with L. pneumophila, it is likely that translation of IDO1 in infected cells overcomes the protein synthesis block, similar to that observed for pro-inflammatory cytokines (Asrat et al., 2014). IDO1-mediated tryptophan depletion also limits Toxoplasma, Chlamydia and Leishmania replication (Dai et al., 1994; Murray et al., 1989; Thomas et al., 1993). Therefore, the IFN-γ-mediated elevated IDO1 expression and tryptophan depletion is the mechanism of nutritional innate immunity that partially restricts robust intracellular replication of L. pneumophila.

Besides LamA, L. pneumophila harbors two other characterized amylases. The glucoamylase, GamA, is secreted by the type II secretion system but does not impact intracellular growth (Herrmann et al., 2011). We show that GamA is not involved in glycogenolysis. Additionally, L. pneumophila expresses LamB, which is not injected into the host cytosol but is required for bacterial replication in amoebae, human macrophages and in the murine model of disease via an unknown mechanism (Best et al., 2018). Therefore, LamA is the major factor of L. pneumophila responsible for glycogenolysis during infection of host cells. However, it is possible that other L. pneumophila effectors, and/or host cell signaling pathways may contribute to L. pneumophila-induced glycogenolysis. Amylase and glycosidase activity has also been shown to contribute to the pathogenesis of other bacterial pathogens, but they act on complex extracellular glycans (Arabyan et al., 2016; Marion et al., 2009; Robb et al., 2017). In contrast to LamA-mediated glycogenolysis, the obligate intracellular pathogen, Chlamydia trachomatis, shifts host glycogen stores to its replicative vacuole through bulk uptake and de novo synthesis from host-derived UDP-glucose (Gehre et al., 2016). C. trachomatis translocates bacterial glycogen biosynthesis enzymes into the lumen of its replicative vacuole via its type III secretion system, generating an energy store, that is derived from the host, for the metabolic benefit of the bacterial pathogen (Gehre et al., 2016).

Our data provide strong evidence for manipulation of amoebae-specific cellular processes and intimate co-evolution of L. pneumophila with its amoebae natural hosts. Since the dormant cyst form of amoebae is non-permissive for proliferation of L. pneumophila, the pathogen has evolved to inject LamA into the amoebae host, triggering rapid glycogenolysis to subvert host encystation and promote pathogen proliferation within the permissive trophozoite form. The macrophage M1-like pro-inflammatory differentiation and nutritional innate immunity in response to Legionella-mediated glycogenolysis is paradoxical and counter evolutionary, yet not detrimental, and is likely an evolutionary unintended or accidental event.

STAR Methods

Lead Contact and Materials Availability

Further information and requests for reagents may be directed to, and will be fulfilled by the Lead Contact, Yousef Abu Kwaik (abukwaik@louisville.edu). All unique/stable reagents generated in this study are available from the Lead Contact without restriction.

Experimental Model and Subject Details

Isolation of human monocyte-derived macrophages

Human monocyte-derived macrophages (hMDMs) were isolated from immunocompetent male and female healthy donors who were not involved in previous procedures and test naïve. hMDMs were cultured in RPMI 1640 (Corning Cellgro) as described previously (Al-Khodor et al., 2008; Price et al., 2009). To generate hMDMs, total white blood cells were isolated from whole blood taken from healthy donors using a Ficoll-Hypaque gradient. The collected white blood cells were re-suspended in RPMI containing 20% FBS and incubated in 6-well low adherence plates for three days. Adherent cells were then collected and plated into appropriate wells for the experiment in RPMI containing 10% FBS for 2 days. The media was then changed to RPMI containing 5% FBS for one day, and then RPMI containing 1% FBS for one more day, after which hMDMs were ready for experiments. HEK293T cells were cultured in DMEM (Gibco) supplemented with 10% fetal bovine serum as previously described (Al-Khodor et al., 2008; Price et al., 2009). All methods were carried out and approved in accordance to the University of Louisville Institutional Review Board guidelines and blood donors gave informed consent as required by the University of Louisville Institutional Review Board (IRB # 04.0358).

A/J mouse model

For testing the virulence of the lamA mutant, specific pathogen free, 6–8 weeks old female A/J mice were used as described previously (Price and Abu Kwaik, 2010; Price et al., 2009). All mice were maintained as breeding colonies under specific pathogen-free conditions at the Animal Facility, Faculty of Medicine, University of Rijeka. Experiments were approved by the Ethical Committee of the School of Medicine and conducted in accordance with the international guidelines for animal care and experimental use. Groups of 3 A/J mice were infected intratracheally with 1 × 106 CFUs. At 2, 12, 24, 48 and 72 h after infection mice were humanely sacrificed and lungs, liver and spleen were harvested and homogenized in 5 ml of sterile saline followed by cell lysis in distilled water.

Microbial strains

L. pneumophila strain AA100/130b (ATCC BAA-74), the T2SS-deficient mutant (ΔlspG), ΔankB and ΔdotA T4SS-deficient mutant (ΔT4SS) were grown on BCYE agar or BYE broth media at 37°C with antibiotic selection as appropriate. E. coli BL21 was grown on LB agar or broth at 37°C with antibiotic selection as appropriate.

Data and Code Availability

This study did not generate/analyze datasets or code.

Method Details

Generation of a lamA knockout mutant

To generate an isogenic ΔlamA deletion mutant, 2 kb of DNA flanking either side of the lamA gene was amplified using PCR using primers listed in the Key Resources Table and cloned into the shuttle vector, pBCSK+, resulting in pBCSK+lamAKO1. To delete the entire lamA gene within pBCSK-lamAKO1, inverse PCR was employed using primers listed in the Key Resources Table resulting in a pBCSK+lamAKO2. The kanamycin resistance cassette from the Ez-Tn5 transposon was amplified using primers listed in the Key Resources Table and the resulting PCR product was subcloned into pBCSK+lamAKO2 in between the lamA flanking DNA regions using standard molecular biology procedures, resulting in pBCSK+lamAKO3. This plasmid was introduced into L. pneumophila AA100 via natural transformation, as described previously (Stone and Abu Kwaik, 1999). Following 3 days, natural transformants were recovered by plating on BCYE agar supplemented with 50 μg/ml kanamycin. To confirm deletion of the lamA gene in the transformants, PCR was used using the primers listed in the Key Resources Table. To complement the lamA mutant, PCR was used to amplify the lamA gene and its upstream promoter region using primers listed in the Key Resources Table, and subcloned into pBCSK+, generating pBCSK+lamA/C. This plasmid was introduced into the lamA mutant via electroporation as described previously (Chen et al., 2006). Complemented lamA mutants were selected on BCYE plates supplemented with 5 μg/ml chloramphenicol, resulting in the complemented strain, lamA/C. For infections of cell monolayers, L. pneumophila was grown in BYE broth media with appropriate antibiotic selection at 37°C with shaking to post-exponential phase (OD550nm 2.1–2.2).

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit anti-legionella antiserum This study
Mouse anti-glycogen ESG1A9mAB (Nakamura-Tsuruta et al., 2012) Gift
Alexa-Fluor 488 anti-rabbit IgG Invitrogen Cat # A-21206
RRID:AB_141708
Alexa-Fluor 555 anti-mouse IgG Invitrogen Cat # A-31570
RRID:AB_2536180
Alexa-Fluor 594 anti-mouse IgM Invitrogen Cat # A-21044
RRID:AB_141424
Alexa-Fluor 647 anti-goat IgG Invitrogen Cat # A-21447
RRID:AB_141844
Anti-human TNF-α clone MAb1 Biolegend Cat # 502803
RRID:AB_315251
Anti-human IL-12/23 p40 clone C8.6 Biolegend Cat # 508803
RRID:AB_315530
Anti-human IFN-γ clone B27 Biolegend Cat # 506512
RRID:AB_315445
Anti-human IL-4 clone 11B11 Biolegend Cat # 504121
RRID:AB_11149679
Anti-mouse IDO clone 10.1 Millipore Cat # 05–840
RRID:AB_310044
Anti-mouse IgG HRP Thermo Scientific Cat # 31430
RRID:AB_228307
Anti-rabbit IgG HRP Thermo Scientific Cat # 31460
RRID:AB_228341
Anti-β-actin Proteintech Cat # 20536–1-AP
RRID:AB_10700003
Anti-LAMP2 Novus Cat # NBP2–22217
RRID:AB_2722697
Anti-KDEL Abcam Cat # ab12223
RRID:AB_298945
Bacterial and Virus Strains
Legionella pneumophila AA100/130b (ATCC BAA-74) ATCC Cat # ATCC BAA-74
Escherichia coli BL21 Invitrogen Cat# C600003
Biological Samples
Chemicals, Peptides, and Recombinant Proteins
EDTA-free protease inhibitors Pierce Cat # A32965
LPS Sigma L4130
Human IFN-γ Biolegend Cat # 570202
Human IL-4 Biolegend Cat # 574002
Human TNF-α Biolegend Cat # 570102
Human IL-12p70 Biolegend Cat # 573002
M-Per Mammalian Protein Extraction Reagent Thermo Scientific Cat # 78505
Koningic acid Cayman Chemical Cat # 14079
BAY876 Sigma Cat # SML1774
1-methyl-D-tryptophan Cayman Chemical Cat # 16456
CM-H2DCFDA Invitrogen Cat # C6827
Calcofluor white Sigma Cat # 18909
Fluorescent Brightener 28 Sigma Cat # F3543
Phorbol 12-myristate 13-acetate Sigma Cat # P1585
Critical Commercial Assays
Direct cAMP ELISA kit Enzo Cat # ADI-900–066
Amylase Activity Assay Kit Sigma Cat # MAK-009–1KT
EnzyChrom Glycogen assay kit Bioassay Systems Cat # E2GN-100
Deproteinizing Sample Preparation Kit Biovision Cat # K808–200
High Sensitivity Glucose-6-Phosphate Assay Kit Sigma Cat # MAK021–1KT
Glucose Uptake-Glo Assay Promega Cat # J1341
Lactate Assay Kit Sigma Cat # MAK064–1KT
Tryptophan Assay Kit Sigma Cat # MAK254–1KT
Milliplex Assay (Custom setup) Millipore Custom order
Mouse Inflammation (8-plex) Panel Antigenix MMX270
Human Inflammatory Cytokines Multi-Analyte ELISArray Qiagen Cat # MEH-004A
SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat # 34095
Deposited Data
Experimental Models: Cell Lines
Human monocyte-derived macrophages from healthy donors This study
Acanthamoeba polyphaga ATCC Cat # 30461
Experimental Models: Organisms/Strains
Mouse: A/J Jackson Laboratories
Oligonucleotides
lamA flanking DNA F ggatccATAAGCATAAATTTGTTTG This study
lamA flanking DNA R cggccgTTGAGTAAATCAGAGAA This study
lamA 5’ inverse ctcagttttgtagtgtaataattttttatg This study
lamA 3’ inverse agacctttcgatgcaatcaggttaattgcagct This study
Kan F /5Phos/CTGTCTCTTATACACATCTCAA This study
lamA screening F cagttttgtagtgtaataattttttatgg This study
lamA screening R caattaacctgattgcatcgaaa This study
lamA screening R caattaacctgattgcatcgaaa This study
lamA F, ctcgagtttgtctttttaacgatataataac This study
lamA R, ggatccCTAATGCGAGATTGTATTTC This study
pGEX lamA F GGATCCATGACAGATTCTATGGGA This study
pGEX lamA R GTCGACCTAATGCGAGATTGTATTTC This study
lamA D1 F /5Phos/AGCGACTCGAACACCATC This study
lamA D1 R /5Phos/GCTGTAGGTTATGTACATC This study
lamA E1 F /5Phos/TGCATCAAGGATAACCGG This study
lamA E1 R /5Phos/GCTTTATTTAGTAAACGA This study
lamA D2 F /5Phos/GGCATGATTCCCACAAAA This study
lamA D2 R, /5Phos/TATCGTTCATTGGCGATG This study
Recombinant DNA
pBCSK+lamAKO1 This study
pBCSK+lamAKO2 This study
pBCSK+lamAKO3 This study
pBCSK+lamA/C This study
pBCSK+lamA/CD199A This study
pBCSK+lamA/CE233A This study
pBCSK+lamA/CD313A This study
pGEX-6p-1-lamAD199A This study
pGEX-6p-1-lamAE233A This study
pGEX-6p-1-lamAD313A This study
pCYA-lamA This study
pON.mCherry (Gebhardt et al., 2017) Gift
Software and Algorithms
Bio-plex Manager 6.0 Bio-rad Cat # 171STND01
GraphPad Prism 5.01 GraphPad
Other

Translocation assay

To assess translocation of LamA by L. pneumophila during infection of host cells, an adenylate cyclase fusion to the N-terminus of LamA (Sory and Cornelis, 1994) was generated using standard molecular biology techniques. A total of 1 × 106 hMDMs were infected with wild type or ΔT4SS mutant L. pneumophila harboring plasmids expressing various adenylate cyclase fusions at an MOI of 20 for 1h as described previously (Price et al., 2009; Sory and Cornelis, 1994). Following infection, the cell monolayers were lysed and processed to assess cAMP concentration by ELISA using the Direct cAMP ELISA kit (Enzo) according to the manufacturer’s instructions.

Amylase activity assay

To determine if LamA exhibits amylase activity, the lamA gene was cloned into the IPTG-inducible GST-fusion expression vector pGEX-6p-1 (Amersham) and expressed in E. coli BL21 using primers listed in the Key Resources Table. Additionally, residues constituting the predicted catalytic pocket were substituted to alanine’s using inverse PCR using primers listed in the Key Resources Table. E. coli cultures (5 ml) harboring either the empty vector or lamA and the various catalytic inactive mutants were grown in LB media at 37°C with shaking until the OD600 reached 0.7. The cultures were split and one half was induced with 0.1 mM IPTG for 2.5h at room temperature. One ml of each culture was pelleted by centrifugation and the cells were lysed in 0.5 ml lysis buffer (0.1% v/v Triton X-100, 10 mM Tris pH7.5, 150 mM NaCl), containing protease inhibitors (Pierce EDTA-Free Protease Inhibitors). Insoluble material was pelleted by centrifugation (16000 × g, 10 min, 4°C) and the resulting supernatant was retained. Expression of fusion proteins was similar in all cultures (Fig. S1B). To measure amylase activity, 25 μl of supernatant was analyzed using an Amylase Assay Kit (Sigma), following the manufacturer’s instructions.

Analysis of intracellular glycogen

Glycogen levels in hMDMs during infection by L. pneumophila were determined using the EnzyChrom Glycogen assay kit (Bioassay Systems). Briefly, a total of 3 × 106 hMDMs were seeded into 6 well plates and infected with the wild type, ΔT4SS, ΔlamA, lamA/C and the catalytically inactive mutants at an MOI of 10 for 1h and 6h. As a control for glycogenolysis, hMDMs were starved of glucose 1h prior to the commencement of the experiment. Cells were harvested and lysed in 25 mM sodium citrate containing 60 mM NaF. Following centrifugation at 13000 × g for 5 minutes to pellet cellular debris, the supernatants were then analyzed following the manufacturers’ instructions. Degradation of intracellular glycogen was also determined using confocal microscopy. To achieve this, hMDMs were plated into 24-well plates containing glass coverslips (2 × 105 cells per well) and infected with either post-exponential phase wild type, ΔT4SS, ΔlamA and lamA/C, and a type II secretion defective mutant (ΔlspG) bacteria at an MOI of 1. At various timepoints, the monolayers were fixed and permeabilized using methanol at −20°C for 5 min. The monolayers were labeled with rabbit anti-Legionella antiserum (1/1000 dilution), mouse anti-glycogen antibody (ESG1A9mAB, 1/50 dilution) (Nakamura-Tsuruta et al., 2012), a kind gift from Dr Ashida (Kobe University) and counter-labeled with Alexa-Fluor 488 anti-rabbit IgG antibody and Alexa-Fluor 594 anti-mouse IgM (1/4000 dilution, Invitrogen) and DAPI to stain nuclei. The cells were examined by confocal microscopy using an Olympus FV1000 laser scanning confocal microscope (Olympus). Quantification of glycogen granules was performed manually by counting Z-stack images (8 μM depth with 0.2 μM slices) of infected cells. Over 100 infected cells were counted for each condition and performed in triplicate.

Determination of cytosolic glucose-6-phosphate

To determine G6P levels in either infected hMDMs or A. polyphaga a total of 3 × 106 cells were infected with either wild type, ΔT4SS, ΔlamA or lamA/C bacteria at an MOI of 20 for the time indicated in each experiment. Following infection, the infected cells were collected in ice-cold PBS and rapidly homogenized on ice. Samples were centrifuged (16000 × g for 20 min at 4°C), and the resulting supernatants were subjected to deproteinization using a Deproteinizing Sample Preparation Kit (Biovision) following the manufacturer’s instructions. For measuring G6P in amoebae undergoing encystation, amoebae were infected as described above. At 1h and 4h post-infection, aliquots of the infected amoebae were lysed and treated as above. The remaining amoebae were washed in Pages saline and the transferred to encystation buffer. At 6 and 12h post-encystation, amoebae and cysts were collected by centrifugation and lysed by sonication. The samples were analyzed for G6P using a High Sensitivity Glucose-6-Phosphate Assay Kit (Sigma) according to the manufacturer’s instructions with a Synergy H1 microplate reader (Biotek).

Glucose uptake assay

To measure uptake of glucose by L. pneumophila infected hMDMs, the Glucose Uptake-Glo Assay (Promega) was used. Briefly, a total of 1 × 105 hMDMs were seeded into black 96 well plates and infected with wild type, ΔT4SS, ΔlamA or lamA/C bacteria at an MOI of 10 for 1h or 6h in triplicate. As a control, hMDMs were pre-stimulated with LPS/IFN-γ for 24h prior to the assay. At 1h or 6h post-infection, the culture media was removed and PBS containing 1mM 2-deoxyglucose was added for 10 minutes. Glucose uptake was blocked by adding 0.2 μM BAY876 (Sigma) prior to the assay. Glucose uptake was then directly measured according to the manufacturer’s instructions with a Synergy H1 microplate reader (Biotek).

In vitro broth culture growth curves

To determine growth of the ΔlamA mutant during in vitro broth culture relative to the wild type strain, cultures of both the wild type and ΔlamA mutant were grown in BYE medium at 37°C to an OD550 of ~1. The cultures were diluted to an OD550 of 0.05 in triplicate with fresh BYE media and incubated at 37°C with shaking at 200 rpm for a further 24h, during which the optical density was measured periodically. Additionally, to determine if glucose impacts growth of the wild type strain, growth curves were performed as described above with BYE supplemented with increasing concentrations of glucose, up to 44 mM.

Intracellular replication

The wild type strain and the isogenic mutants, ΔT4SS and ΔlamA, and lamA/C and catalytically inactive mutants were grown to post-exponential phase in BYE broth at 37°C prior to infection and used to infect hMDMs, or A. polyphaga as described previously (Al-Khodor et al., 2008; Price et al., 2009). A total of 1 × 105 host cells per well were plated in 96 well plates and infected with L. pneumophila at an MOI of 10 for 1h and then treated for 1h with gentamicin to kill remaining extracellular bacteria as previously described (Al-Khodor et al., 2008; Price et al., 2009). Over a 24–48h time course, the host cells were lysed with sterile water (hMDMs), or 0.02% v/v Triton X-100 (A. polyphaga) and L. pneumophila CFUs were determined by plating serial dilutions onto BCYE agar.

To analyze replicative vacuoles, 2 × 105 hMDMs were seeded onto glass coverslips in 24-well plates. The cell monolayers were infected with wild type, ΔT4SS, ΔlamA, or lamA/C at an MOI of 10 for 1h and then the monolayers were treated with gentamicin for 1h to kill remaining extracellular bacteria as previously described (Al-Khodor et al., 2008; Price et al., 2009). Following extensive washing to remove gentamicin, the infection proceeded for 6 and 8h. At 6 and 8h the monolayers were permeabilized and fixed at −20°C in 100% methanol for 5 min, and then labeled with rabbit anti-Legionella antiserum (1/1000 dilution) and counter-labelled with Alexa-Fluor 488 anti-rabbit antibody (1/4000 dilution, Invitrogen) and DAPI to stain the nuclei. Monolayers were examined by confocal microscopy. A total of 100 replicative vacuoles from 100 individual cells were analyzed for each experimental condition and performed in triplicate.

For culture supernatant transfer experiments, hMDMs were infected as above for analysis of replicative vacuoles or stimulated with 100ng LPS and 10U IFNγ for 8h. Culture supernatants were collected and filter-sterilized through 0.22μM syringe filters and used as culture media for infection of fresh hMDMs with the ΔlamA mutant as described above. Cytokines were neutralized for 1h prior to infection using anti-IFNγ, anti-IL12, anti-TNFα or anti-IL4 (1/100 dilution) (Biolegend). Analysis of replicative vacuoles was performed as described above. To determine the impact of glycolysis on L. pneumophila replication, hMDMs were pretreated with 1 mM NaF or koningic acid for 1h prior to infection with the wild type or ΔlamA mutant strain as described above for 8h. The inhibitors were maintained throughout the experiment and analysis of replicative vacuoles was performed as described above. For tryptophan supplementation experiments, the RPMI media was supplemented with an additional 90 or 180 μM tryptophan prior to infection of hMDMs with the wild type or ΔlamA mutant strain as described above for 8h. The additional tryptophan was maintained throughout the experiment and analysis of replicative vacuoles was performed as described above.

Co-infection of hMDMs with wild type and lamA bacteria

To determine the impact of co-infection on intracellular replication of wild type and ΔlamA mutant bacteria, the wild type strain was transformed with pON.mCherry (Gebhardt et al., 2017), resulting in constitutive expression of mCherry fluorescent protein. hMDMs were infected with the wild type pON.mCherry and ΔlamA mutant bacteria alone or in combination (MOI 5) as described for replicative vacuole analysis. At 8h post-infection, hMDM monolayers were fixed using 3.7% v/v formaldehyde for 15 minutes and then permeabilized with 0.1% v/v Triton X-100 for 15 minutes. The monolayers were labeled with anti-Legionella antiserum as described above. Analysis of replicative vacuoles was performed as described above.

Determination of secreted lactate by infected hMDMs

To determine lactate secretion by infected hMDMs into the culture medium, a total of 1 × 106 hMDMs in triplicate were infected with either wild type, ΔT4SS, ΔlamA or lamA/C bacteria at an MOI of 10 for 6h. Following infection, the culture media was retained and cooled on ice and subjected to deproteinization using a Deproteinizing Sample Preparation Kit (Biovision) following the manufacturer’s instructions. The samples were analyzed for lactate using a Lactate Assay Kit (Sigma) according to the manufacturer’s instructions with a Synergy H1 microplate reader (Biotek).

Analysis of indoleamine 2,3-dioxygenase

To determine if indoleamine 2,3-dioxygenase 1 (IDO1) expression by hMDMs was altered by infection by L. pneumophila, a total of 3 × 106 hMDMs were infected with the wild type, ΔT4SS, ΔlamA or lamA/C bacteria at an MOI of 10 for 2 and 4h. Following infection, the monolayers were lysed using M-PER reagent (Thermo) containing protease inhibitors (Pierce). Samples were elecrophoresed by SDS-PAGE and transferred to PVDF membranes for western blotting using standard techniques. To detect IDO, mouse anti-IDO antibody clone 10.1 (Millipore) was used at 1/100 dilution and detected with an anti-mouse HRP conjugate (Pierce). For chemiluminescence, SuperSignal West Femto (Thermo) was used according to the manufacturer’s instructions, and imaged using a C300 imager (Azure Biosystems). Membranes were stripped using standard techniques are re-probed using a rabbit anti-β-actin antibody to serve as a loading control.

To determine the cytosolic concentration of tryptophan in hMDMs infected with L. pneumophila the Tryptophan Assay Kit (Biovision) was used. Briefly, a total of 3 × 106 hMDMs were infected with wild type, ΔT4SS, ΔlamA, lamA/C, the catalytically inactive mutant or formalin killed wild type bacteria at an MOI of 20, for 4h in triplicate. As a control, 1μM 1-methyl-D-tryptophan was added to wild type infected wells 1 h prior to commencement of the experiment to block IDO1 activity. Cells were harvested and analyzed according to the manufacturers’ instructions.

To determine the impact of IDO1 on L. pneumophila replication, hMDMs were treated with 0.5, 1 or 2μM 1-methyl-D-tryptophan 1h prior to infection. Following this treatment, hMDMs were infected with the wild type or ΔlamA mutant bacteria for 6h and the inhibitor was maintained throughout the experiment. Following infection, analysis of replicative vacuoles was performed as described above.

Analysis of reactive oxygen species production and intracellular trafficking of L. pneumophila

Production of reactive oxygen species by infected hMDMs was performed using the indicator dye, CM-H2DCFDA (Invitrogen). A total of 1 × 105 hMDMs were seeded into 96-well plates and infected with the wild type, ΔT4SS, ΔlamA or formalin-killed wild type bacteria at an MOI of 20. As a positive control, hMDMs were stimulated with phorbol 12-myristate 13-acetate (100 ng/ml). CM-H2DCFDA was added to the wells at a final concentration of 2μM and the cells were placed into a Synergy H1 microplate reader (Biotek) set at 37°C. Fluorescence detection was performed using Ex492nm and Em518nm every 2 minutes for a total of 50 minutes.

To determine if the ΔlamA mutant exhibits similar intracellular trafficking and LCV development as the wild type strain, hMDMs were infected at MOI of 10 for 2h. The hMDMs were fixed and permeabilized with −20°C methanol for 5 minutes and labeled with rabbit anti-L. pneumophila antiserum (1/1000 dilution) and mouse anti-LAMP2 (lysosome marker) or KDEL (endoplasmic reticulum marker) (1/2000 and 1/200 dilutions respectively, Transduction Labs, Stressgen). Anti-mouse IgG Alexa-fluor 555 and anti-rabbit IgG Alexa-fluor 488 secondary antibodies (1/4000 dilution, Invitrogen) were used to visualize vacuolar markers and L. pneumophila respectively. A total of 100 LCVs from 100 individual cells were analyzed by confocal microscopy for each experimental condition and performed in triplicate.

Cytokine analysis

To determine cytokine production by hMDMs, a total of 3 × 106 cells per well were plated in 6 well plates and infected with L. pneumophila at an MOI of 20 for 1h and then treated for 1h with gentamicin to kill remaining extracellular bacteria. Culture supernatants were collected 6h post-infection and then analyzed using the Milliplex (Millipore) assay. Assays were performed according to the manufacturer’s instruction. Standards or culture supernatant samples were mixed with antibody-bound magnetic beads, and incubated overnight at 4 °C. Beads were washed and then incubated with the biotinylated detection antibody for one hour at room temperature. The beads were incubated with phycoerythrin-labeled streptavidin for thirty minutes at room temperature and the median fluorescent intensities were quantified with a Bio-plex 200 analyzer and analyzed with Bio-plex Manager 6.0 software. All samples were measured in duplicate. In some experiments 1mM NaF was added to block glycolysis 1h prior to infection and maintained throughout the experiment. Following, 6 h infection, culture supernatants were retained and immediately analyzed for cytokines using Human Inflammatory Cytokines Multi-Analyte ELISArray™ (Qiagen), following the manufacturer’s instructions. Infections were performed in triplicate.

Mouse model of infection

For testing the virulence of the ΔlamA mutant, specific pathogen free, 6–8 weeks old A/J mice were used as described previously (Price and Abu Kwaik, 2010; Price et al., 2009). Groups of 3 A/J mice were infected intratracheally with 1 × 106 CFUs. At 2, 12, 24, 48 and 72 h after infection mice were humanely sacrificed and lungs, liver and spleen were harvested and homogenized in 5 ml of sterile saline followed by cell lysis in distilled water. To determine CFUs, serial 10-fold dilutions were plated on BCYE agar and incubated at 37°C. For histopathology, lungs of infected mice were fixed in 10% neutral formalin and embedded in paraffin. Serial 5 μm sections were cut, stained with haematoxylin and eosin (H&E), and analyzed by light microscopy. Twenty random high-powered fields (HPFs) were assessed to grade inflammation severity including alveolar and bronchial damage as well as percentage of parenchyma involved. The histology assessment included the number of the mononuclear cells and percent of parenchyma involved by using modification of double-blind scoring method at a magnification of 40x, as described previously (De Simone et al., 2014). The inflammation process was graded normal (score of 0) when there were 0–19 monocular cells infiltrates per HPF with no alveolar and bronchial involvement, mild (score of 1) for 20 to 49 cells per HPF including mild damage of alveolar and bronchial regions, moderate (score of 2) for 50 to 99 cells per HPF with moderate alveolar and bronchial inflammation, or severe (score of 3) for 100 to 200 mononuclear cells per HPF with severe effacement of alveolar and bronchial regions. The murine lung section was examined in sagittal direction and percent of parenchyma involved was scored as 0 when no area was compromised. The involvement of the parenchyma was scored as 1 when up to 25% of the total area was occupied by inflammatory exudate; was scored as 2 when 26 to 50% of parenchyma area was occupied with inflammatory cells, 3 if comprised more than 51%. The total histology score was calculated as an average of individual criteria scores. The uninfected tissue was used as a baseline score.

To determine cytokine production, the broncho-alveolar lavage (BAL) of infected mice was performed at 2, 12, 24, 48 and 72 h after infection. BAL was collected using a 1 ml syringe with 0.5 ml of fresh saline via the trachea. After three lavages, approximately 350 L of BAL was recovered and stored at −25°C for determination of cytokine levels. The levels of cytokines KC, MCP-1, TNFα, IL6, IL1a, IL4, IL10, IFN-γ and IL12p70 were determined using Antigenix Mouse Inflammation Kit on a BD FACSAria flow cytometer (Lenartic et al., 2017).

Encystation of Acanthamoeba polyphaga infected with L. pneumophila

Amoebas were grown to 50–80% confluence in tissue culture flasks in PYG at 25°C. Prior to infection, the medium was replaced with PY, and adherent amoebas were scraped and harvested, adjusted to 2 × 106 per ml. Six well plates were seeded with 1 ml amoebas, and incubated at 35°C for 30–60 min. Post-exponential L. pneumophila cultures were diluted to 1 × 108 per ml in PY, and 1 ml was added to each well, for a MOI of 50. Plates were centrifuged for 5 min at 200 × g, then incubated at 35°C for 4h. Monolayers were washed 1 × with 2 ml of Page’s saline (PS), then 3 ml of encystation buffer (0.1M KCl, 0.02M 2-amino-2-methy-1,3-propanediol, 0.008M MgSO4, 0.001 NaHCO3, 0.0004M CaCl2, pH 9) was added to each well. Plates were incubated at 35°C for 24, 48, or 72 h. Amoebas were harvested by scraping, centrifuged 5 min at 500 × g, washed 1 × with PS, centrifuged again, and resuspended in 1 ml 5% formaldehyde in PS. Tubes were rotated at room temperature for 1 h, washed 1 × with PS, centrifuged again, and resuspended in 1 ml blocking buffer, 3% BSA in PBS, and stored at 4°C. After blocking, amoebas were centrifuged, and resuspended in 1 ml blocking buffer containing goat anti-Legionella antiserum. Tubes were rotated 1 hr at room temp, centrifuged, and pellets were washed 1 × with PBS, and centrifuged again. Pellets were resuspended in blocking buffer containing Alexa Fluor 647 donkey anti-goat (Invitrogen) and 0.01% calcofluor white, Fluorescent Brightener 28 (Sigma). Tubes were rotated for 1h at room temp, centrifuged, and pellets were washed 1 × with PBS, and centrifuged again. Pellets were resuspended in 800 μl PBS and stored at 4°C. Flow cytometry was done on a 4 laser, 18 parameter BD LSRFortessa, using the Pacific Blue parameter for detection of calcofluor white. Analyses were done with BD FACSDiva software and Flowing Software 2.5. Samples were also used for confocal microscopy.

Quantification and statistical analysis

Statistical parameters including the exact value of n, (mean ± SD) and statistical significance are reported in the Figures and Figure Legends. Statistical analysis was performed in GraphPad PRISM 5.

Supplementary Material

2
3

Highlights.

  • L. pneumophila injects LamA, which degrades host cell glycogen

  • LamA has evolved to interfere with amoebae host specific processes

  • In the amoebae natural host, LamA subverts encystation to promote a permissive host

  • In humans, LamA triggers accidental inflammatory responses and nutritional immunity

Acknowledgments

We thank Robert Miller for assistance with flow cytometry and Hitoshi Ashidi for the kind gift of the anti-glycogen antibody. We thank the Functional Microbiomics Core facility supported by the FMIP cobre grant (GM-125504) at the University of Louisville for providing support in analyzing samples and interpretation of data.

Funding: YA is supported by the National Institutes of Health awards R01AI140195 and R01AI140195–01A, and by the Commonwealth of Kentucky Research Challenge Trust Fund.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Competing Interests: The authors declare no competing financial interests. All data is available in the manuscript or the supplementary materials.

Declaration of Interests: The authors declare no competing interests.

References

  1. Abu Khweek A, and Amer AO (2018). Factors Mediating Environmental Biofilm Formation by Legionella pneumophila. Frontiers in cellular and infection microbiology 8, 38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Adam CL, Annie-Carole T-T, and and Young SH (2014). The Role of Macrophage Polarization in Infectious and Inflammatory Diseases. Mol Cells 37, 275–285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Al-Khodor S, Price CT, Habyarimana F, Kalia A, and Abu Kwaik Y (2008). A Dot/Icm-translocated ankyrin protein of Legionella pneumophila is required for intracellular proliferation within human macrophages and protozoa. Mol Microbiol 70, 908–923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Arabyan N, Park D, Foutouhi S, Weis AM, Huang BC, Williams CC, Desai P, Shah J, Jeannotte R, Kong N, et al. (2016). Salmonella Degrades the Host Glycocalyx Leading to Altered Infection and Glycan Remodeling. Sci Rep 6, 29525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Asrat S, Davis KM, and Isberg RR (2015). Modulation of the host innate immune and inflammatory response by translocated bacterial proteins. Cellular microbiology 17, 785–795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Asrat S, Dugan AS, and Isberg RR (2014). The frustrated host response to Legionella pneumophila is bypassed by MyD88-dependent translation of pro-inflammatory cytokines. PLoS Pathog 10, e1004229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bärlocher K, Welin A, and Hilbi H (2017). Formation of the Legionella Replicative Compartment at the Crossroads of Retrograde Trafficking. Frontiers in cellular and infection microbiology 7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Benoit M, Desnues B, and Mege J-L (2008). Macrophage Polarization in Bacterial Infections. The Journal of Immunology 181, 3733–3739. [DOI] [PubMed] [Google Scholar]
  9. Best A, and Abu Kwaik Y (2018). Evolution of the arsenal of Legionella pneumophila effectors to modulate protist hosts. MBio 9, e01313–01318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Best A, Price C, Ozanic M, Santic M, Jones S, and Abu Kwaik Y (2018). A Legionella pneumophila amylase is essential for intracellular replication in human macrophages and amoebae. Sci Rep 8, 6340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Bouyer S, Imbert C, Rodier MH, and Hechard Y (2007). Long-term survival of Legionella pneumophila associated with Acanthamoeba castellanii vesicles. Environ Microbiol 9, 1341–1344. [DOI] [PubMed] [Google Scholar]
  12. Bradshaw EM, Raddassi K, Elyaman W, Orban T, Gottlieb PA, Kent SC, and Hafler DA (2009). Monocytes from Patients with Type 1 Diabetes Spontaneously Secrete Proinflammatory Cytokines Inducing Th17 Cells. The Journal of Immunology 183, 4432–4439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Burstein D, Amaro F, Zusman T, Lifshitz Z, Cohen O, Gilbert JA, Pupko T, Shuman HA, and Segal G (2016). Genomic analysis of 38 Legionella species identifies large and diverse effector repertoires. Nature genetics 48, 167–175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Bustos R, and Sobrino F (1992). Stimulation of glycolysis as an activation signal in rat peritoneal macrophages. Effect of glucocorticoids on this process. Biochem J 282 (Pt 1), 299–303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Byers TJ, Kim BG, King LE, and Hugo ER (1991). Molecular aspects of the cell cycle and encystment of Acanthamoeba. RevInfectDis 13(Suppl 5), S378–S384. [DOI] [PubMed] [Google Scholar]
  16. Chang C-H, Curtis Jonathan D., Maggi Leonard B. Jr, Faubert B, Villarino Alejandro V., O’Sullivan D, Huang Stanley C.-C., van der Windt Gerritje J.W., Blagih J, Qiu J, et al. (2013). Posttranscriptional Control of T Cell Effector Function by Aerobic Glycolysis. Cell 153, 1239–1251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Chen DQ, Huang SS, and Lu YJ (2006). Efficient transformation of Legionella pneumophila by high-voltage electroporation. Microbiol Res 161, 246–251. [DOI] [PubMed] [Google Scholar]
  18. Cianciotto NP, and White RC (2017). The Expanding Role of Type II Secretion in Bacterial Pathogenesis and Beyond. Infection and immunity. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Collins MT, McDonald J, Hoiby N, and Aalund O (1984). Agglutinating antibody titers to members of the family Legionellaceae in cystic fibrosis patients as a result of cross-reacting antibodies to Pseudomonas aeruginosa. JClinMicrobiol 19, 757–762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Copenhaver AM, Casson CN, Nguyen HT, Duda MM, and Shin S (2015). IL-1R signaling enables bystander cells to overcome bacterial blockade of host protein synthesis. Proceedings of the National Academy of Sciences 112, 7557–7562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Dai W, Pan H, Kwok O, and Dubey JP (1994). Human indoleamine 2,3-dioxygenase inhibits Toxoplasma gondii growth in fibroblast cells. J Interferon Res 14, 313–317. [DOI] [PubMed] [Google Scholar]
  22. de Felipe KS, Pampou S, Jovanovic OS, Pericone CD, Ye SF, Kalachikov S, and Shuman HA (2005). Evidence for acquisition of Legionella type IV secretion substrates via interdomain horizontal gene transfer. J Bacteriol 187, 7716–7726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. De Leon JA, Qiu J, Nicolai CJ, Counihan JL, Barry KC, Xu L, Lawrence RE, Castellano BM, Zoncu R, Nomura DK, et al. (2017). Positive and Negative Regulation of the Master Metabolic Regulator mTORC1 by Two Families of Legionella pneumophila Effectors. Cell Rep 21, 2031–2038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. De Simone M, Spagnuolo L, Lore NI, Rossi G, Cigana C, De Fino I, Iraqi FA, and Bragonzi A (2014). Host genetic background influences the response to the opportunistic Pseudomonas aeruginosa infection altering cell-mediated immunity and bacterial replication. PloS one 9, e106873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. DebRoy S, Dao J, Soderberg M, Rossier O, and Cianciotto NP (2006). Legionella pneumophila type II secretome reveals unique exoproteins and a chitinase that promotes bacterial persistence in the lung. Proc Natl Acad Sci U S A 103, 19146–19151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Eisele Nicholas A., Ruby T, Jacobson A, Manzanillo Paolo S., Cox Jeffery S., Lam L, Mukundan L, Chawla A, and Monack Denise M. (2013). Salmonella Require the Fatty Acid Regulator PPARδ for the Establishment of a Metabolic Environment Essential for Long-Term Persistence. Cell host & microbe 14, 171–182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ensminger AW (2016). Legionella pneumophila, armed to the hilt: justifying the largest arsenal of effectors in the bacterial world. Current opinion in microbiology 29, 74–80. [DOI] [PubMed] [Google Scholar]
  28. Erbel C, Rupp G, Domschke G, Linden F, Akhavanpoor M, Doesch AO, Katus HA, and Gleissner CA (2016). Differential regulation of aldose reductase expression during macrophage polarization depends on hyperglycemia. Innate Immun 22, 230–237. [DOI] [PubMed] [Google Scholar]
  29. Escoll P, Song O-R, Viana F, Steiner B, Lagache T, Olivo-Marin J-C, Impens F, Brodin P, Hilbi H, and Buchrieser C (2017). Legionella pneumophila Modulates Mitochondrial Dynamics to Trigger Metabolic Repurposing of Infected Macrophages. Cell host & microbe. [DOI] [PubMed] [Google Scholar]
  30. Faber K, Zorzi GK, Brazil NT, Rott MB, and Teixeira HF (2017). siRNA-loaded liposomes: Inhibition of encystment of Acanthamoeba and toxicity on the eye surface. Chem Biol Drug Des. [DOI] [PubMed] [Google Scholar]
  31. Faris R, Andersen SE, McCullough A, Gourronc F, Klingelhutz AJ, and Weber MM (2019). Chlamydia trachomatis Serovars Drive Differential Production of Proinflammatory Cytokines and Chemokines Depending on the Type of Cell Infected. Frontiers in cellular and infection microbiology 9, 399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Fields BS (1996). The molecular ecology of legionellae. TrendsMicrobiol 4, 286–290. [DOI] [PubMed] [Google Scholar]
  33. Fonseca MV, and Swanson MS (2014). Nutrient salvaging and metabolism by the intracellular pathogen Legionella pneumophila. Frontiers in cellular and infection microbiology 4, 12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Fontana MF, Banga S, Barry KC, Shen X, Tan Y, Luo ZQ, and Vance RE (2011). Secreted bacterial effectors that inhibit host protein synthesis are critical for induction of the innate immune response to virulent Legionella pneumophila. PLoS Pathog 7, e1001289. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Fontana MF, Shin S, and Vance RE (2012). Activation of host mitogen-activated protein kinases by secreted Legionella pneumophila effectors that inhibit host protein translation. Infection and immunity 80, 3570–3575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Franco IS, Shuman HA, and Charpentier X (2009). The perplexing functions and surprising origins of Legionella pneumophila type IV secretion effectors. Cellular microbiology 11, 1435–1443. [DOI] [PubMed] [Google Scholar]
  37. Freemerman AJ, Johnson AR, Sacks GN, Milner JJ, Kirk EL, Troester MA, Macintyre AN, Goraksha-Hicks P, Rathmell JC, and Makowski L (2014). Metabolic Reprogramming of Macrophages: GLUCOSE TRANSPORTER 1 (GLUT1)-MEDIATED GLUCOSE METABOLISM DRIVES A PROINFLAMMATORY PHENOTYPE. Journal of Biological Chemistry 289, 7884–7896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Gebhardt MJ, Jacobson RK, and Shuman HA (2017). Seeing red; the development of pON.mCherry, a broad-host range constitutive expression plasmid for Gram-negative bacteria. PloS one 12, e0173116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Gehre L, Gorgette O, Perrinet S, Prevost MC, Ducatez M, Giebel AM, Nelson DE, Ball SG, and Subtil A (2016). Sequestration of host metabolism by an intracellular pathogen. eLife 5, e12552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Guo Q, Bi J, Li M, Ge W, Xu Y, Fan W, Wang H, and Zhang X (2019). ESX Secretion-Associated Protein C From Mycobacterium tuberculosis Induces Macrophage Activation Through the Toll-Like Receptor-4/Mitogen-Activated Protein Kinase Signaling Pathway. Frontiers in cellular and infection microbiology 9, 158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Haenssler E, Ramabhadran V, Murphy CS, Heidtman MI, and Isberg RR (2015). Endoplasmic Reticulum Tubule Protein Reticulon 4 Associates with the Legionella pneumophila Vacuole and with Translocated Substrate Ceg9. Infection and immunity 83, 3479–3489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Haidet J, Cifarelli V, Trucco M, and Luppi P (2012). C-peptide reduces pro-inflammatory cytokine secretion in LPS-stimulated U937 monocytes in condition of hyperglycemia. Inflammation Research 61, 27–35. [DOI] [PubMed] [Google Scholar]
  43. Harb OS, Gao L-Y, and Abu Kwaik Y (2000). From protozoa to mammalian cells: A new paradigm in the life cycle of intracellular bacterial pathogens. Environ Microbiol 2, 251–265. [DOI] [PubMed] [Google Scholar]
  44. Herrmann V, Eidner A, Rydzewski K, Bladel I, Jules M, Buchrieser C, Eisenreich W, and Heuner K (2011). GamA is a eukaryotic-like glucoamylase responsible for glycogen- and starch-degrading activity of Legionella pneumophila. Int J Med Microbiol 301, 133–139. [DOI] [PubMed] [Google Scholar]
  45. Hielpos MS, Fernandez AG, Falivene J, Alonso Paiva IM, Munoz Gonzalez F, Ferrero MC, Campos PC, Vieira AT, Oliveira SC, and Baldi PC (2018). IL-1R and Inflammasomes Mediate Early Pulmonary Protective Mechanisms in Respiratory Brucella Abortus Infection. Frontiers in cellular and infection microbiology 8, 391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Horwitz MA (1983a). Formation of a novel phagosome by the Legionnaires’ disease bacterium (Legionella pneumophila) in human monocytes. JExpMed 158, 1319–1331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Horwitz MA (1983b). The Legionnaires’ disease bacterium (Legionella pneumophila) inhibits phagosome-lysosome fusion in human monocytes. JExpMed 158, 2108–2126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Horwitz MA, and Silverstein SC (1980). Legionnaires’ disease bacterium (Legionella pneumophila) multiples intracellularly in human monocytes. JClinInvest 66, 441–450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Isberg RR, O’Connor TJ, and Heidtman M (2009). The Legionella pneumophila replication vacuole: making a cosy niche inside host cells. Nature reviews Microbiology 7, 13–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Ivanov SS, and Roy CR (2013). Pathogen signatures activate a ubiquitination pathway that modulates the function of the metabolic checkpoint kinase mTOR. Nature immunology 14, 1219–1228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Jha AK, Huang SC, Sergushichev A, Lampropoulou V, Ivanova Y, Loginicheva E, Chmielewski K, Stewart KM, Ashall J, Everts B, et al. (2015). Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization. Immunity 42, 419–430. [DOI] [PubMed] [Google Scholar]
  52. Jones S, Price CT, Santic M, and Abu Kwaik Y (2015). Selective requirement of the shikimate pathway of Legionella pneumophila for intra-vacuolar growth within human macrophages but not Acanthamoeba. Infection and immunity 83, 2487–2495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Kagan JC, and Roy CR (2002). Legionella phagosomes intercept vesicular traffic from endoplasmic reticulum exit sites. Nat Cell Biol 4, 945–954. [DOI] [PubMed] [Google Scholar]
  54. Kilvingston S, and Price J (1990). Survival of Legionella pneumophila within cysts of Acanthamoeba polyphaga following chlorine exposure. JApplBacteriol 68, 519–525. [DOI] [PubMed] [Google Scholar]
  55. Kotewicz KM, Ramabhadran V, Sjoblom N, Vogel JP, Haenssler E, Zhang M, Behringer J, Scheck RA, and Isberg RR (2017). A Single Legionella Effector Catalyzes a Multistep Ubiquitination Pathway to Rearrange Tubular Endoplasmic Reticulum for Replication. Cell host & microbe 21, 169–181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Kraakman MJ, Murphy AJ, Jandeleit-Dahm K, and Kammoun HL (2014). Macrophage polarization in obesity and type 2 diabetes: weighing down our understanding of macrophage function? Front Immunol 5, 470. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Lenartic M, Jelencic V, Zafirova B, Ozanic M, Marecic V, Jurkovic S, Sexl V, Santic M, Wensveen FM, and Polic B (2017). NKG2D Promotes B1a Cell Development and Protection against Bacterial Infection. Journal of immunology (Baltimore, Md : 1950) 198, 1531–1542. [DOI] [PubMed] [Google Scholar]
  58. Lifshitz Z, Burstein D, Peeri M, Zusman T, Schwartz K, Shuman HA, Pupko T, and Segal G (2013). Computational modeling and experimental validation of the Legionella and Coxiella virulence-related type-IVB secretion signal. Proc Natl Acad Sci U S A 110, E707–715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Lorenzo-Morales J, Kliescikova J, Martinez-Carretero E, De Pablos LM, Profotova B, Nohynkova E, Osuna A, and Valladares B (2008). Glycogen phosphorylase in Acanthamoeba spp.: determining the role of the enzyme during the encystment process using RNA interference. Eukaryot Cell 7, 509–517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Luo ZQ (2011). Legionella secreted effectors and innate immune responses. Cellular microbiology. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Marion C, Limoli DH, Bobulsky GS, Abraham JL, Burnaugh AM, and King SJ (2009). Identification of a pneumococcal glycosidase that modifies O-linked glycans. Infection and immunity 77, 1389–1396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Mills EL, Kelly B, Logan A, Costa AS, Varma M, Bryant CE, Tourlomousis P, Dabritz JH, Gottlieb E, Latorre I, et al. (2016). Succinate Dehydrogenase Supports Metabolic Repurposing of Mitochondria to Drive Inflammatory Macrophages. Cell 167, 457–470 e413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Molmeret M, Horn M, Wagner M, Santic M, and Abu Kwaik Y (2005). Amoebae as training grounds for intracellular bacterial pathogens. Applied and environmental microbiology 71, 20–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Moon EK, Hong Y, Chung DI, Goo YK, and Kong HH (2014). Down-regulation of cellulose synthase inhibits the formation of endocysts in Acanthamoeba. The Korean journal of parasitology 52, 131–135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Mori M, Mode R, and Pieters J (2018). From Phagocytes to Immune Defense: Roles for Coronin Proteins in Dictyostelium and Mammalian Immunity. Frontiers in cellular and infection microbiology 8, 77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Muraille E, Leo O, and Moser M (2014). TH1/TH2 paradigm extended: macrophage polarization as an unappreciated pathogen-driven escape mechanism? Front Immunol 5, 603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Murray HW, Szuro-Sudol A, Wellner D, Oca MJ, Granger AM, Libby DM, Rothermel CD, and Rubin BY (1989). Role of tryptophan degradation in respiratory burst-independent antimicrobial activity of gamma interferon-stimulated human macrophages. Infection and immunity 57, 845–849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Nakamura-Tsuruta S, Yasuda M, Nakamura T, Shinoda E, Furuyashiki T, Kakutani R, Takata H, Kato Y, and Ashida H (2012). Comparative analysis of carbohydrate-binding specificities of two anti-glycogen monoclonal antibodies using ELISA and surface plasmon resonance. Carbohydr Res 350, 49–54. [DOI] [PubMed] [Google Scholar]
  69. Oliva G, Sahr T, and Buchrieser C (2018). The Life Cycle of L. pneumophila: Cellular Differentiation Is Linked to Virulence and Metabolism. Frontiers in cellular and infection microbiology 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Pan Y, Wang Y, Cai L, Cai Y, Hu J, Yu C, Li J, Feng Z, Yang S, Li X, et al. (2012). Inhibition of high glucose-induced inflammatory response and macrophage infiltration by a novel curcumin derivative prevents renal injury in diabetic rats. British Journal of Pharmacology 166, 1169–1182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Park JM, Ghosh S, and O’Connor TJ (2020). Combinatorial selection in amoebal hosts drives the evolution of the human pathogen Legionella pneumophila. Nature microbiology. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Pathak SK, Basu S, Basu KK, Banerjee A, Pathak S, Bhattacharyya A, Kaisho T, Kundu M, and Basu J (2007). Direct extracellular interaction between the early secreted antigen ESAT-6 of Mycobacterium tuberculosis and TLR2 inhibits TLR signaling in macrophages. Nature immunology 8, 610–618. [DOI] [PubMed] [Google Scholar]
  73. Price CT, and Abu Kwaik Y (2010). Exploitation of Host Polyubiquitination Machinery through Molecular Mimicry by Eukaryotic-Like Bacterial F-Box Effectors. Front Microbiol 1, 122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Price CT, Al-Khodor S, Al-Quadan T, Santic M, Habyarimana F, Kalia A, and Kwaik YA (2009). Molecular mimicry by an F-box effector of Legionella pneumophila hijacks a conserved polyubiquitination machinery within macrophages and protozoa. PLoS Pathog 5, e1000704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Price CT, Al-Quadan T, Santic M, Rosenshine I, and Abu Kwaik Y (2011). Host proteasomal degradation generates amino acids essential for intracellular bacterial growth. Science (New York, NY) 334, 1553–1557. [DOI] [PubMed] [Google Scholar]
  76. Price CTD, and Abu Kwaik Y (2014). The Transcriptome of Legionella pneumophila-Infected Human Monocyte-Derived Macrophages. PloS one 9, e114914. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Price JV, Jiang K, Galantowicz A, Freifeld A, and Vance RE (2018). Legionella pneumophila Is Directly Sensitive to 2-Deoxyglucose-Phosphate via Its UhpC Transporter but Is Indifferent to Shifts in Host Cell Glycolytic Metabolism. J Bacteriol 200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Price JV, and Vance RE (2014). The macrophage paradox. Immunity 41, 685–693. [DOI] [PubMed] [Google Scholar]
  79. Refai A, Gritli S, Barbouche M-R, and Essafi M (2018). Mycobacterium tuberculosis Virulent Factor ESAT-6 Drives Macrophage Differentiation Toward the Pro-inflammatory M1 Phenotype and Subsequently Switches It to the Anti-inflammatory M2 Phenotype. Frontiers in cellular and infection microbiology 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  80. Reinhold D, Ansorge S, and Schleicher ED (1996). Elevated glucose levels stimulate transforming growth factor-beta 1 (TGF-beta 1), suppress interleukin IL-2, IL-6 and IL-10 production and DNA synthesis in peripheral blood mononuclear cells. Horm Metab Res 28, 267–270. [DOI] [PubMed] [Google Scholar]
  81. Richards AM, Von Dwingelo JE, Price CT, and Abu Kwaik Y (2013). Cellular microbiology and molecular ecology of Legionella-amoeba interaction. Virulence 4, 307–314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Robb M, Hobbs JK, Woodiga SA, Shapiro-Ward S, Suits MD, McGregor N, Brumer H, Yesilkaya H, King SJ, and Boraston AB (2017). Molecular Characterization of N-glycan Degradation and Transport in Streptococcus pneumoniae and Its Contribution to Virulence. PLoS Pathog 13, e1006090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Rolando M, Sanulli S, Rusniok C, Gomez-Valero L, Bertholet C, Sahr T, Margueron R, and Buchrieser C (2013). Legionella pneumophila effector RomA uniquely modifies host chromatin to repress gene expression and promote intracellular bacterial replication. Cell host & microbe 13, 395–405. [DOI] [PubMed] [Google Scholar]
  84. Rossier O, and Cianciotto NP (2001). Type II protein secretion is a subset of the PilD-dependent processes that facilitate intracellular infection by Legionella pneumophila. Infection and immunity 69, 2092–2098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Rossier O, Starkenburg SR, and Cianciotto NP (2004). Legionella pneumophila type II protein secretion promotes virulence in the A/J mouse model of Legionnaires’ disease pneumonia. Infection and immunity 72, 310–321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Schaap P, and Schilde C (2018). Encystation: the most prevalent and underinvestigated differentiation pathway of eukaryotes. Microbiology (Reading, England). [DOI] [PubMed] [Google Scholar]
  87. Schroeder GN (2017). The Toolbox for Uncovering the Functions of Legionella Dot/Icm Type IVb Secretion System Effectors: Current State and Future Directions. Frontiers in cellular and infection microbiology 7, 528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Shen X, Banga S, Liu Y, Xu L, Gao P, Shamovsky I, Nudler E, and Luo ZQ (2009). Targeting eEF1A by a Legionella pneumophila effector leads to inhibition of protein synthesis and induction of host stress response. Cellular microbiology 11, 911–926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  89. Shuman HA, Purcell M, Segal G, Hales L, and Wiater LA (1998). Intracellular multiplication of Legionella pneumophila: Human pathogen or accidental tourist? CurrTopMicrobiolImmunol 225, 99–112. [DOI] [PubMed] [Google Scholar]
  90. Sica A, and Mantovani A (2012). Macrophage plasticity and polarization: in vivo veritas. The Journal of clinical investigation 122, 787–795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Sory MP, and Cornelis GR (1994). Translocation of a hybrid YopE-adenylate cyclase from Yersinia enterocolitica into HeLa cells. Mol Microbiol 14, 583–594. [DOI] [PubMed] [Google Scholar]
  92. Stone BJ, and Abu Kwaik Y (1999). Natural competency for DNA uptake by Legionella pneumophila and its association with expression of type IV pili. JBacteriol 181, 1395–1402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  93. Suzuki H, Hisamatsu T, Chiba S, Mori K, Kitazume MT, Shimamura K, Nakamoto N, Matsuoka K, Ebinuma H, Naganuma M, et al. (2016). Glycolytic pathway affects differentiation of human monocytes to regulatory macrophages. Immunol Lett 176, 18–27. [DOI] [PubMed] [Google Scholar]
  94. Swart AL, Harrison CF, Eichinger L, Steinert M, and Hilbi H (2018). Acanthamoeba and Dictyostelium as Cellular Models for Legionella Infection. Frontiers in cellular and infection microbiology 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Tannahill GM, Curtis AM, Adamik J, Palsson-McDermott EM, McGettrick AF, Goel G, Frezza C, Bernard NJ, Kelly B, Foley NH, et al. (2013). Succinate is an inflammatory signal that induces IL-1[bgr] through HIF-1[agr]. Nature 496, 238–242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  96. Thomas SM, Garrity LF, Brandt CR, Schobert CS, Feng GS, Taylor MW, Carlin JM, and Byrne GI (1993). IFN-gamma-mediated antimicrobial response. Indoleamine 2,3-dioxygenase-deficient mutant host cells no longer inhibit intracellular Chlamydia spp. or Toxoplasma growth. Journal of immunology (Baltimore, Md : 1950) 150, 5529–5534. [PubMed] [Google Scholar]
  97. Torres-Castro I, Arroyo-Camarena ÚD, Martínez-Reyes CP, Gómez-Arauz AY, Dueñas-Andrade Y, Hernández-Ruiz J, Béjar YL, Zaga-Clavellina V, Morales-Montor J, Terrazas LI, et al. (2016). Human monocytes and macrophages undergo M1-type inflammatory polarization in response to high levels of glucose. Immunology Letters 176, 81–89. [DOI] [PubMed] [Google Scholar]
  98. Wang N, Liang H, and Zen K (2014a). Molecular mechanisms that influence the macrophage m1-m2 polarization balance. Front Immunol 5, 614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  99. Wang XF, Wang HS, Wang H, Zhang F, Wang KF, Guo Q, Zhang G, Cai SH, and Du J (2014b). The role of indoleamine 2,3-dioxygenase (IDO) in immune tolerance: focus on macrophage polarization of THP-1 cells. Cell Immunol 289, 42–48. [DOI] [PubMed] [Google Scholar]
  100. Wynn TA, Chawla A, and Pollard JW (2013). Macrophage biology in development, homeostasis and disease. Nature 496, 445–455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  101. Yang X, Pan Y, Xu X, Tong T, Yu S, Zhao Y, Lin L, Liu J, Zhang D, and Li C (2018). Sialidase Deficiency in Porphyromonas gingivalis Increases IL-12 Secretion in Stimulated Macrophages Through Regulation of CR3, IncRNA GAS5 and miR-21. Frontiers in cellular and infection microbiology 8, 100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  102. Yuan CH, Zhang S, Xiang F, Gong H, Wang Q, Chen Y, and Luo W (2019). Secreted Rv1768 From RD14 of Mycobacterium tuberculosis Activates Macrophages and Induces a Strong IFN-gamma-Releasing of CD4(+) T Cells. Frontiers in cellular and infection microbiology 9, 341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  103. Zhu L, Zhao Q, Yang T, Ding W, and Zhao Y (2015). Cellular metabolism and macrophage functional polarization. Int Rev Immunol 34, 82–100. [DOI] [PubMed] [Google Scholar]
  104. Zhu W, Banga S, Tan Y, Zheng C, Stephenson R, Gately J, and Luo ZQ (2011). Comprehensive identification of protein substrates of the Dot/Icm type IV transporter of Legionella pneumophila. PloS one 6, e17638. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

2
3

Data Availability Statement

This study did not generate/analyze datasets or code.

RESOURCES