Skip to main content
NCBI home page
Molecular Human Reproduction logoLink to Molecular Human Reproduction
. 2020 Mar 11;26(5):353–365. doi: 10.1093/molehr/gaaa018

Establishment of an in vitro placental barrier model cultured under physiologically relevant oxygen levels

Michael K Wong 1,2, Edward W Li 2, Mohamed Adam 2, Ponnambalam R Selvaganapathy 3, Sandeep Raha 1,2,4,✉
PMCID: PMC7227181  PMID: 32159799

Abstract

The human placental barrier facilitates many key functions during pregnancy, most notably the exchange of all substances between the mother and fetus. However, preclinical models of the placental barrier often lacked the multiple cell layers, syncytialization of the trophoblast cells and the low oxygen levels that are present within the body. Therefore, we aimed to design and develop an in vitro model of the placental barrier that would reinstate these factors and enable improved investigations of barrier function. BeWo placental trophoblastic cells and human umbilical vein endothelial cells were co-cultured on contralateral sides of an extracellular matrix-coated transwell insert to establish a multilayered barrier. Epidermal growth factor and forskolin led to significantly increased multi-nucleation of the BeWo cell layer and increased biochemical markers of syncytial fusion, for example syncytin-1 and hCGβ. Our in vitro placental barrier possessed size-specific permeability, with 4000-Da molecules experiencing greater transport and a lower apparent permeability coefficient than 70 000-Da molecules. We further demonstrated that the BeWo layer had greater resistance to smaller molecules compared to the endothelial layer. Chronic, physiologically low oxygen exposure (3–8%) increased the expression of hypoxia-inducible factor 1α and syncytin-1, further increased multi-nucleation of the BeWo cell layer and decreased barrier permeability only against smaller molecules (457 Da/4000 Da). In conclusion, we built a novel in vitro co-culture model of the placental barrier that possessed size-specific permeability and could function under physiologically low oxygen levels. Importantly, this will enable future researchers to better study the maternal–fetal transport of nutrients and drugs during pregnancy.

Keywords: hypoxia, oxygen, placenta, placental barrier, transport, trophoblast, cell culture, BeWo, HUVEC

Introduction

The human placental barrier is a complex and dynamic interface that facilitates substance exchange, hormone secretion and barrier protection between the mother and fetus during pregnancy (Huppertz et al., 2014b). The placental barrier mainly consists of a thin, multi-nucleated layer of syncytiotrophoblast and vascular endothelial cells, alongside variable populations of cytotrophoblasts and other placental and immune cell types, as well as extracellular matrix (ECM) proteins (Rubinchik-Stern and Eyal, 2012; Huppertz et al., 2014a). The fused, multi-nucleated syncytiotrophoblast layer is immersed in maternal blood, while the vascular endothelial cells line the blood vessels within the chorionic villi containing fetal blood (Rubinchik-Stern and Eyal, 2012; Huppertz et al., 2014a). Like many physiological barriers within the body, the placental barrier is of great clinical relevance because of its central role in modulating not only the transfer of beneficial nutrients but also drugs, toxins and other agents between mother and fetus. Clinical tragedies, such as thalidomide-induced teratogenesis, could perhaps have been avoided by a deeper understanding of what can and cannot cross the placental barrier (Vargesson, 2015).

While progress has been made, there is still much work to be done in recapitulating the anatomy and function of the placental barrier into preclinical models and elucidating the many factors that dictate its physiology, such as syncytialization, multiple cell layers and the oxygen environment. The BeWo choriocarcinoma cell line or primary cytotrophoblast mono-culture transwell models have been well used in the past (Heaton et al., 2008; Li et al., 2013; Huang et al., 2016), but the fetal vascular endothelial layer is a crucial component of the placental barrier that cannot be excluded in the study of maternal-fetal transport (Elad et al., 2014; Boss et al., 2018). Recently, several BeWo-endothelial co-culture transwell models have also been published (Bode et al., 2006, Lee et al., 2015; Aengenheister et al., 2018; Aengenheister et al., 2019; Pemathilaka et al., 2019; Yin et al., 2019), but these models did not include syncytialization of the trophoblast layer. Syncytialization is a crucial feature in emulating the placental barrier phenotype in vivo since the syncytiotrophoblast layer has been shown to possess altered expression of specific nutrient and drug transporters (Liu and Liu, 2019). Advances in these areas will create more predictive testing platforms and unlock new discoveries for prominent pregnancy-related diseases. The low oxygen environment under which placental development and trophoblast syncytialization commences in vivo is also of particular importance. Physiological oxygen levels in the human placenta are in the range of 20–60 mmHg (~3–8%) depending on the trimester (Rodesch et al., 1992; Jauniaux et al., 2000, Lackman et al., 2001; Miller et al., 2005; Huppertz et al., 2014b; Andrade et al., 2015). Yet, the majority of in vitro research is conducted under atmospheric air (21% oxygen), an environment which should be extremely hyperoxic for placental cells (Tuuli et al., 2011). Such observations raise questions and concerns about past studies that classify placental trophoblasts in the low oxygen group (<3%) as the ‘pathological, hypoxic group’, and atmospheric air (21%) as the ‘healthy, normoxic group’ (Alsat et al., 1996; Kudo et al., 2003). With all the knowledge we have today regarding the fundamental role of low oxygen in mediating early trophoblast processes, such as proliferation and differentiation (Genbacev et al., 1997; Zhou et al., 2011), and its dynamic, sub-atmospheric alterations from 3 to 8% following key events like spiral artery remodeling (Jauniaux et al., 2000; Huppertz et al., 2014b), modern in vitro approaches must incorporate physiological levels into experimental design and characterize the impact accordingly.

Therefore, in the present study, we aim to develop an in vitro model of the human placental barrier by co-culturing syncytialized trophoblastic cells and vascular endothelial cells on contralateral sides of ECM-coated transwell inserts. Moreover, we aim to investigate how chronic, physiologically low oxygen tension (3–8%) may impact trophoblast syncytialization, placental barrier development and transport of molecules of varying sizes.

Materials and Methods

Cell culture

BeWo placental trophoblastic cells (ATCC; Manassas, VA, USA) were cultured at 37°C in 95% room air/5% CO2 in F-12K media (Corning; Corning, NY, USA) supplemented with 10% heat-inactivated fetal bovine serum, 1% L-glutamine and 1% penicillin–streptomycin. BeWo cells were transfected with a green fluorescent protein vector (EGFP-N1; Addgene; Cambridge, MA, USA; plasmid # 54767; a gift from Dr Michael Davidson; http://n2t.net/addgene: 54767; RRID:Addgene_54767) using FuGENE 6 Transfection Reagent (Promega; Madison, WI, USA), similar to previously described (Wang et al., 2014). After 24 h, transfected cells (EGFP-BeWo) underwent 14 days of selection in media with G418 (Thermo; Waltham, MA, USA). Bright, fluorescent EGFP-BeWo were confirmed using fluorescent microscopy and expanded for experimentation. Cells between passages 10 and 20 were used for all experiments and seeded at a density of 1 × 105 cells/cm2. Red fluorescent protein-transfected human umbilical vein endothelial cells (RFP-HUVEC; Angio-Proteomie; Boston, MA, USA) were cultured at 37°C in 95% room air/5% CO2 in EGM-2 Endothelial Cell Growth Medium-2 BulletKit (Lonza; Basel, Switzerland). Cells between passages 4 and 8 were used for all experiments and seeded at a density of 1 × 106 cells/cm2. Low oxygen (3–8%) culturing was performed in the Xvivo System Model X3 incubator (BioSpherix; Parish, NY, USA), which allowed long-term cell incubation and handling under specific, constant oxygen levels.

Transwell insert co-culture model

On Day 0, polyester transwell inserts (Falcon; 12-well, 0.4 μm pores) were placed upside-down and the basolateral sides of the membranes were coated with fibronectin (0.1 mg/mL) for 2 h at 37° to promote cellular attachment (Fig. 1A). In the ‘BeWo only’ and ‘Co-Culture’ groups, EGFP-BeWo cells were seeded onto the basolateral side of the transwell insert at 1 × 105 cells/cm2 and incubated at 37° for 3 h to allow attachment. For the ‘HUVEC only’ and ‘No Cell’ groups, an equal volume of cell-free, F-12K media was added to the basolateral side of the transwell insert. All transwell inserts were then reversed and inserted into a multi-well plate filled with F-12K media. On Day 1, to induce BeWo syncytial fusion, F-12K media with epidermal growth factor (EGF; 50 ng/mL) was added to the basolateral chamber for 48 h, and F-12K media with EGF (50 ng/mL) and forskolin (50 μM) was added to the basolateral chamber for another 48 h. In experiments that included control, unfused BeWo cell groups, F-12K media with an equal volume of vehicle solution was added instead (PBS instead of EGF, dimethyl sulfoxide instead of forskolin). On Day 5, in the ‘HUVEC only’ and ‘Co-Culture’ groups, RFP-HUVEC cells were seeded at 1 × 106 cells/cm2 onto the apical side of the transwell insert and allowed to reach confluence over 48 h. In the ‘BeWo only’ and ‘No Cell’ groups, an equal volume of cell-free, EGM-2 media was added to the apical chamber.

Figure 1.

Figure 1

Open in a new tab

BeWo and HUVECs co-cultured on contralateral sides of a transwell insert for up to 7 days. (A) Schematic of co-culture method to establish in vitro placental barrier model. (B) Live, immunofluorescent images of BeWo placental trophoblastic cells and human umbilical vein endothelial cells (HUVECs) in co-culture. Green color indicates BeWo cells and red color indicates HUVECs. Scale bar indicates 100 μm. (C) Confluency of growth of all cell groups, as determined by the surface area of fluorescent signal normalized to the total surface area of field of view. CON: control, FUS: fusion. One-way ANOVA was used to assess significant differences between the groups. (D) 3D-rendered images of the X-Z axis of BeWo and HUVECs cultured on the transwell insert at Day 7. ECM: extracellular matrix.

Cell concentration

BeWo cells were detached from the growth surface using Trypsin solution (Corning; 0.025%), and cell concentration (cells/mL) was calculated using trypan blue solution (Thermo) and the Countess Automated Cell Counter (Thermo), as per the manufacturer’s instructions.

Transport experiments

457 Da Lucifer Yellow (10 μM; Sigma; St. Louis, MO, USA), 4000 Da fluorescein-dextran (10 μM; Sigma) or 70 000 Da fluorescein-dextran (10 μM; Sigma) were introduced into the basolateral side of the transwell system, whereas fresh media were introduced into the apical side. Media (50 μL) were taken from both apical and basolateral sides at 0, 1, 2, 8, 24 and 48 h. Fluorescent intensities of the media samples collected were measured at 485 nm excitation/528 nm emission using a Synergy Plate Reader (BioTek; Winooski, VT, USA). The ‘fetal chamber amount’ was calculated by normalizing the fluorescence intensity measured in the fetal chamber to the total fluorescence measured in both fetal and maternal chambers. The apparent permeability coefficient was calculated as follows: Apparent permeability coefficient (cm/s) = (dQ/dt)/(A × C0), where dQ is the change in fluorescence intensity compared to the initial fluorescence intensity in the fetal chamber; dt is the change in time; A is the surface area of the transwell insert membrane; C0 is the initial fluorescence intensity in the maternal chamber (adapted from Huang et al. (2016)).

Live cell imaging

Live, fluorescence images were captured using an Eclipse Ti-E Inverted Confocal Microscope (Nikon) under 4× or 10× objective magnification. The FITC channel was used to capture images of EGFP-BeWo cells, and the TRITC channel was used to capture images of RFP-HUVECs, both from the basal side. Z-stack images of co-cultures were captured in 1-μm-thick sections and 3D-rendered using NIS Elements software (Nikon; Mississauga, ON, Canada) to allow X-Z visualization of the cell layers on the transwell insert.

Immunofluorescence

Cells were fixed for 10 min in ice-cold methanol (100%) and permeabilized for 5 min with Triton X-100 in PBS (0.1%). Immunofluorescence was performed as previously described (Wong et al., 2018; Wong et al., 2019). In brief, samples were incubated with either anti-E-Cadherin primary antibody (1:500; Abcam; ab40772) or anti-hCG primary antibody (1:1000; Meridian; Memphis, TN, USA; MAF05-019) overnight at 4° and then incubated with goat anti-rabbit IgG H&L Alexa Fluor® 488 secondary antibody (2 μg/mL; Abcam; Cambridge, UK; ab150077) or goat anti-mouse IgG H&L Alexa Fluor® 488 secondary antibody (1:1000; Abcam; ab150117) for 1 h. Samples were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; 1.5 μg/mL; Santa Cruz; Dallas, TX, USA) and mounted onto glass slides using Fluoromount™ Aqueous Mounting Medium (Sigma-Aldrich). Slides were visualized using an Eclipse Ti-E Inverted Fluorescence Microscope (Nikon). To assess syncytial fusion, E-Cadherin was visualized to identify cell borders (as E-Cadherin is localized to the plasma membrane (Ishikawa et al., 2014)) and DAPI to identify nuclei. The relative syncytial fusion percentage was then calculated as follows (adapted from Orendi et al. (2010)): Fusion Percentage (%) = (Number of nuclei in syncytia/Total number of nuclei) * 100%, where syncytia may be defined as having two or more nuclei.

RNA extraction and quantitative RT-PCR

Total RNA (500 ng) was isolated using Direct-zol RNA Miniprep Kit (Zymo Research; Irvine, CA, USA) and reserve-transcribed to cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Foster City, CA, USA), as previously described (Wong et al., 2018). In brief, primer sets directed against gene targets of interest were designed through the National Center for Biotechnology Information’s Primer-BLAST primer designing tool and synthesized at McMaster’s Mobix Labs (Table I). Quantitative analysis of mRNA expression was performed via quantitative RT-PCR using SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad) and the CFX384 Touch Real-Time PCR Detection System (Bio-Rad). The cycling conditions were 95°C for 10 min, followed by 40 cycles of 95°C for 10 s, 60°C for 10 s and 72°C for 15 s. Relative fold changes were calculated using the comparative cycle times (Ct) method, normalizing all values to the geometric mean of three endogenous control genes (18S, beta-actin (ACTB), GAPDH). The endogenous control gene was selected based on experimentally determined Ct stability across all treatment groups. Given that all primer sets had equal priming efficiency, the ΔCt values for each primer set were calibrated to the average of all control Ct values, and the relative abundance of each primer set compared with calibrator was determined by the formula 2ΔΔCt, in which ΔΔCt was the normalized value.

Table I.

Forward and reverse sequences for the primers used for quantitative RT-PCR.

Gene Gene name Forward 5′ to 3′ Reverse 5′ to 3′ GenBank
18S (RNA18S5) 18S ribosomal RNA CACGCCAGTACAAGATCCCA AAGTGACGCAGCCCTCTATG NR_003286.2
ACTB Beta-actin TTACAGGAAGTCCCTTGCCATC GCAATGCTATCACCTCCCCTG NM_001101.5
GAPDH Glyceraldehyde 3-phosphate dehydrogenase TCACCATCTTCCAGGAGCGA ATGACGAACATGGGGGCATC NM_001357943.1
HIF1A Hypoxia-inducible factor 1-alpha CAGCAACGACACAGAAACTGA TTGGGTGAGGGGAGCATTAC AF208487.1
PLGF Placental growth factor ACCCTCAGGAATTCAGTGCCTTCA GGCCACGTGTCTTGCTTCTTTCAA X54936.1
ERVWE1 Syncytin-1 GTTAATGACATCAAAGGCACCC CCCCATCTCAACAGGAAAACC NM_014590
CGB Chorionic gonadotrophin-beta ACCCCTTGACCTGTGAT CTTTATTGTGGGAGGATCGG J00117.1
Open in a new tab

Protein extraction and western blot

Total protein was extracted from cells using RIPA buffer supplemented with protease and phosphatase inhibitor cocktails (Roche; Basel, Switzerland), as previously described (Wong et al., 2019). The solution was sonicated for 5 s total, 1 s per pulse, vortexed and quantified by colorimetric DC protein assay (Bio-Rad; Hercules, CA, USA). Loading samples were prepared from fresh total protein extract, Laemmli sample buffer (4×) (Bio-Rad) and β-mercaptoethanol and heated at 90°C for 5 min to denature the proteins. Proteins (20 μg/well) were separated by size via gel electrophoresis in Mini-PROTEAN® TGX Stain-Free™ 4–20% polyacrylamide gels (Bio-Rad) and transferred onto polyvinylidene difluoride membranes using the Trans-Blot® Turbo™ Transfer System (Bio-Rad). Membranes were cut into sections based on the predicted molecular weight of the target protein, as guided by ladder standard (FroggaBio; Toronto, ON, Canada). Membrane sections were then blocked in 1× Tris-buffered saline-Tween 20 buffer with 5% non-fat milk and probed using hypoxia-inducible factor 1α (HIF1α) (1:1000; Abcam; ab179483), hCG (1:20000; Agilent Dako; Santa Clara, CA, USA; A0231) and syncytin-1 (ERVWE1, 1:200; Abcam; ab71115) antibodies diluted in the blocking solution. Anti-rabbit (1:5000; GE Healthcare; Chicago, IL, USA; NA9340) secondary antibody was used to detect the species-specific portion of the primary antibody, diluted in the blocking solution. Immuno-reactive bands were visualized using Clarity™ Western ECL Substrate (Bio-Rad). Total protein was stained on the membrane using Amido Black and imaged to ensure even loading and transfer (Aldridge et al., 2008). Full, raw blots are shown in Supplementary Fig. S1.

ELISA

Cell media was collected and protein levels of secreted hCGβ and placental growth factor (PLGF) were analyzed via ELISA kits (Abcam), as described by the manufacturer. Secreted protein levels were normalized against total BeWo intracellular protein per well using the colorimetric DC protein assay (Bio-Rad).

Statistical analysis

All statistical analyses were performed using Prism 5 software (GraphPad). Results were expressed as the mean of normalized values ± SEM. Experiments were replicated at least three times (n ≥ 3), unless otherwise specified. The significance of differences (P < 0.05) between normalized mean values was then evaluated using unpaired, two-tailed Student’s t test or ANOVA followed by Tukey’s post-test, as appropriate.

Results

Formation of an in vitro placental barrier model

We established our in vitro placental barrier model by contralaterally co-culturing BeWo trophoblastic cells and HUVECs on opposing sides of fibronectin-coated transwell inserts (Fig. 1A). Both BeWo and HUVECs could be grown to around 93% confluency in co-culture by Day 7 (Fig. 1B and C). Syncytial fusion of the BeWo layer via EGF (50 mg/mL) and forskolin (50 μM) did not impact overall surface area confluency of either layers, although the augmentation of fluorescence intensity at certain regions suggests increased clustering of BeWo cells (Fig. 1B and C). The 1-μm, z-stack images of co-cultures were captured and 3D-rendered to allow X–Z axis visualization of the cell layers on the transwell insert (Fig. 1D). Distinct cell layers may be seen on contralateral sides of the membrane, revealing maintained adjacency of the co-culture in both control and syncytial fusion groups. Overall, the establishment of our co-culture placental barrier model allows us to emulate the critical maternal blood- and fetal blood-facing layers that constitute the human placental barrier in vivo (Huppertz et al., 2014a).

To characterize the syncytial fusion of the BeWo layer, we performed immunofluorescence staining for E-Cadherin protein, which visualizes the plasma membrane borders between cells. BeWo cells that received the fusion treatment exhibited larger and fewer nuclei and increased multi-nucleation as shown through decreased E-Cadherin expression between nuclei (Fig. 2A). Control BeWo cells had a fusion percentage of 8.56 ± 0.40%, whereas BeWo cells that received the fusion treatment had a significantly increased fusion percentage of 30.58 ± 1.49% (P < 0.001; Fig. 2A). Furthermore, hCG was found to be increased in BeWo cells that received the fusion treatment, as seen through immunofluorescence staining (Fig. 2B) and western blot (P < 0.0001; Fig. 2C). ERVWE1/syncytin-1, a protein responsible for facilitating syncytial fusion, was also found to be significantly increased in BeWo cells that received the fusion treatment compared to controls (P = 0.0242; Fig. 2D). Collectively, these results suggest that the BeWo cell layer in our placental barrier model may be driven towards a syncytialized phenotype in vitro through our fusion treatment.

Figure 2.

Figure 2

Open in a new tab

BeWo trophoblastic cells treated with epidermal growth factor (50 ng/mL) and forskolin (50 μM) express increased markers of syncytial fusion. (A) Immunofluorescent staining for E-Cadherin protein of BeWo cells in the control and fusion treatment groups. (B) Immunofluorescent staining for hCG protein and nuclei (DAPI). Scale bar indicates 100 μm. Western blots and densitometry quantifications of (C) hCGβ and (D) ERVWE1 (syncytin-1) protein. Densitometric quantification of relative protein expression was based on band intensity. All arbitrary values were expressed as means normalized to Amido black ± SEM. Significant differences between treatment groups determined by Student’s t test; n ≥ 3. Significant differences between means indicated by *P < 0.05 or ***P < 0.0001. Enlarged versions of the immunofluorescent images may be found in Supplementary Figs. S2 and S3.

BeWo layer of placental barrier exhibits size-specific permeability to various molecules

We were next interested in determining how syncytial fusion of the BeWo cell layer might impact the permeability of our placental barrier system to molecules of varying sizes. The use of fluorescein-dextran molecules and other dyes to assess barrier permeability, integrity and size specificity has been well established in various in vitro organ systems (Matsukawa et al., 1997; Schwabe et al., 2005; Huang et al., 2016). Two fluorescein-dextran molecules (4000 and 70 000 Da) were introduced into the BeWo-facing, ‘maternal chamber’ of the transwell insert, and the resultant intensity of fluorescence signal accumulated in the ‘fetal chamber’ was measured and normalized to the total fluorescence in both maternal and fetal chambers. Lower fluorescence intensity indicated a lower number of molecules that passively transported into the fetal chamber, and thus, greater barrier permeability, and vice versa (Matsukawa et al., 1997; Huang et al., 2016). Syncytial fusion of the BeWo layer (FUS) did not cause any significant differences in the amount of both 4000- and 70 000-Da molecules that crossed into the fetal chamber compared to the unfused control group (CON) at all time points (Fig. 3A and B). We calculated the apparent permeability coefficients of the 4000- and 70 000- molecules at 48 h in order to compare the permeability of the BeWo layer to each molecule. Significantly lower permeability coefficients were found for the 70 000-Da molecules compared to 4000-Da molecules in both unfused and fused BeWo groups at 48 h (P < 0.0001; Fig. 3C), demonstrating that smaller molecules more readily permeate the BeWo layer.

Figure 3.

Figure 3

Open in a new tab

The placental barrier exhibits size-specific permeability to 4000- and 70 000-Da molecules. Percentage of fluorescence intensity measured in the fetal chamber normalized to total fluorescence intensity in both maternal and fetal chambers in the No Cell, unfused BeWo (CON), or fused BeWo (FUS) groups for (A) 4000 Da fluorescein-dextran molecules or (B) 70 000 Da fluorescein-dextran molecules. (C) Apparent permeability coefficients of 4000- and 70 000-Da molecules in BeWo control and fusion groups at 48 h normalized to the No Cell control group. Percentage of fluorescence intensity measured in the fetal chamber normalized to total fluorescence intensity in the No Cell, BeWo only, HUVEC only or Co-Culture groups for (D) 4000 Da or (E) 70 000 Da. (F) Apparent permeability coefficients of 4000- and 70 000-Da molecules in BeWo only, HUVEC only and Co-Culture groups at 48 h. Significant differences between treatment groups determined by two-way ANOVA; n ≥ 3. Significant differences between means indicated by ***P < 0.001.

BeWo and HUVEC layers differentially regulate barrier permeability

We were next interested in determining the individual and joint contributions of the BeWo and vascular endothelial cell layers in regulating the permeability of the barrier. All BeWo cells from this point onwards received the syncytial fusion treatment. The BeWo only and Co-Culture groups had significantly less 4000-Da fluorescein-dextran molecules cross into the fetal chamber compared to the No Cell group at 2, 8, 24 and 48 h and compared to the HUVEC only group at 48 h (P < 0.05; Fig. 3D). The HUVEC only group also had significantly less 4000-Da molecule cross into the fetal chamber compared to the No Cell group at 2, 8 and 24 h (P < 0.05; Fig. 3D). All groups had significantly less 70 000-Da molecules cross into the fetal chamber compared to the No Cell group at 2, 8, 24 and 48 h (P < 0.01; Fig. 3E). The Co-Culture group also had significantly less 70 000-Da molecules cross into the fetal chamber compared to the HUVEC only group at 48 h (P < 0.01; Fig. 3E). We calculated the apparent permeability coefficients of both molecules at 48 h to compare the permeability of the molecules across each layer of the barrier. Significantly lower permeability coefficients were found for the 70 000-Da molecule than for the 4000-Da molecule in all groups (P < 0.001; Fig. 3F), suggesting both BeWo and HUVEC layers contribute to the size-specific permeability. Furthermore, the ratio between the apparent permeability coefficients of BeWo only and HUVEC only layers is lower for the 4000-Da molecule (0.678 ± 0.061) than for the 70 000-Da molecule (0.789 ± 0.040; P = 0.0589), suggesting the BeWo layer may play a more substantial role in the size exclusion and resistance of smaller molecules across the barrier.

Low oxygen tension impacts growth patterns and syncytial fusion

To evaluate the impact of physiologically low oxygen tension (3–8%) on syncytial fusion of the trophoblastic layer and barrier exchange, BeWo cells were seeded under 21% oxygen for 48 h, transferred into chronic 21, 8 or 3% oxygen tension to acclimatize for 24 h and induced to syncytialize under the respective oxygen tensions for another 48 h. HIF1α protein levels were significantly increased in a dose-dependent manner when BeWo cells were fused under 3 and 8% oxygen compared to 21% oxygen, confirming the cells’ responsiveness to a low oxygen environment (P < 0.05; Fig. 4A and B). The α-subunit of HIF1 is constitutively expressed under low oxygen conditions, but rapidly degraded in the presence of oxygen, making it a useful sensor for relative oxygen levels (Huang et al., 1996; Lee et al., 2004). PLGF is known to decrease under low oxygen and thus may be used as a second marker to verify the cellular response (Fujii et al., 2017). Indeed, secreted PLGF protein levels were significantly decreased in a dose-dependent manner (P < 0.05; Fig. 4C). HIF1A mRNA levels were consistently increased at 3% oxygen compared to 21 and 8% oxygen (P < 0.05; Fig. 4D), and PLGF mRNA levels were decreased in an oxygen-dependent manner (P < 0.001; Fig. 4E). Furthermore, BeWo cell concentration did not significantly change across 7 days under 3% oxygen, whereas BeWo cell concentration significantly increased under 21% oxygen (P < 0.001; Fig. 4F).

Figure 4.

Figure 4

Open in a new tab

Low oxygen tension impacts expression of various protein markers of hypoxia in BeWo cells. (A) Protein levels of hypoxia-inducible factor 1α (HIF1α), as determined by western blot. The full, raw blot may be found in Supplementary Fig. S1. (B) Densitometric quantification of relative protein expression based on band intensity. All arbitrary values were expressed as mean normalized to total protein ± SEM. (C) Secreted protein levels of placental growth factor (PLGF), as determined by ELISA. All arbitrary values were expressed as mean normalized to total intracellular protein ± SEM. mRNA levels of (D) HIF1 and (E) PLGF, as determined by quantitative RT-PCR. All arbitrary values were expressed as mean normalized to the geometric mean of housekeeping genes ± SEM. Significant differences between groups determined by one-way ANOVA; n ≥ 3. (F) Cell concentration of BeWo cells cultured in 21% or 3% oxygen for up to 7 days. Significant differences between groups determined by two-way ANOVA; n ≥ 3. Significant differences between means indicated by *P < 0.05, **P < 0.01 or ***P < 0.001.

Live-cell imaging of the co-cultures revealed relatively less BeWo cell growth at 3 and 8% oxygen compared to 21% based on fluorescent intensity (Fig. 5A), which is consistent with the inhibition of proliferation demonstrated above (Fig. 4F). The HUVEC layer of the co-culture appeared more abundant at 3 and 8% oxygen compared to 21% (Fig. 5A). E-Cadherin immunofluorescence staining revealed a significantly increased percentage of syncytial fusion in an oxygen-dependent manner, as BeWo cells were cultured under 21% oxygen (28.57 ± 2.68% fusion), 8% oxygen (38.86 ± 6.29% fusion) and 3% oxygen (50.44 ± 4.68% fusion) (P < 0.05 for all; Fig. 5B). BeWo cells also appeared to grow more evenly and organized under 3% with fewer instances of clustering. ERVWE1 protein levels were significantly increased under 3 and 8% oxygen compared to 21% oxygen (P < 0.001; Fig. 5C and D). However, both intracellular and secreted protein levels of hCGβ were significantly decreased in a dose-dependent manner in 3 and 8% oxygen compared to 21% oxygen (P < 0.05; Fig. 5C, E and F). ERVWE1 (P < 0.001; Fig. 5G) and CGB mRNA levels (P < 0.05; Fig. 5H) were also decreased at 3 and 8% oxygen compared to 21%.

Figure 5.

Figure 5

Open in a new tab

Low oxygen tension impacts morphology and expression of various markers of syncytial fusion. (A) Live cell imaging of EGFP-BeWo (green) and red fluorescent protein-transfected (RFP)-HUVECs (red). Images were taken at 10× magnification and scale bar indicates 100 μm. (B) Immunofluorescence staining of E-Cadherin and DAPI. Green fluorescence indicates E-Cadherin staining and blue fluorescence indicates DAPI staining for cell nuclei. Images were taken at 20× magnification and scale bar indicates 100 μm. (C) Protein levels of ERVWE1 and hCGβ as determined by western blot. Densitometric quantification of (D) ERVWE1 and (E) hCGβ relative protein expression based on band intensity. Full, raw blots may be found in Supplementary Fig. S1. (F) Secreted protein levels of hCGβ, as determined by ELISA. All arbitrary values were expressed as mean normalized to total intracellular protein ± SEM. mRNA levels of (G) ERVWE1 and (H) CGB, as determined by quantitative RT-PCR. All arbitrary values were expressed as mean normalized to the geometric mean of housekeeping genes ± SEM. Significant differences between groups determined by one-way ANOVA; n ≥ 3. Significant differences between means indicated by *P < 0.05, **P < 0.01 or ***P < 0.001.

Low oxygen tension increases specificity of permeability across the placental barrier

Given the impact of low oxygen tension on syncytial fusion of the BeWo trophoblastic layer, we were next interested in investigating the effects on barrier permeability. Three fluorescent molecules of varying sizes (457 Da Lucifer Yellow, 4000 Da fluorescein-dextran and 70 000 Da fluorescein-dextran) were introduced into the ‘maternal chamber’, and the resultant intensity of the fluorescent signal in the ‘fetal chamber’ was measured as described above. The Co-Culture group had significantly fewer 457-Da molecules from 2 to 48 h, 4000-Da molecules from 1 to 48 h and 70 000-Da molecules from 24 to 48 h cross into the fetal chamber, compared to the No Cell control under all oxygen levels (P < 0.05; Fig. 6A, B and C). We further calculated the apparent permeability coefficients for each molecule at 48 h to compare the differences across oxygen levels. The apparent permeability coefficient of the 457-Da molecule was significantly lower in the placental barrier under 8% oxygen compared to 21% oxygen and 3% oxygen (P < 0.01; Fig. 6D). The apparent permeability coefficient of the 4000-Da molecule was significantly lower under 3% and 8% oxygen compared to 21% oxygen (P < 0.01; Fig. 6D). There were no significant differences between groups in the apparent permeability coefficient of the 70 000-Da molecule (Fig. 6D).

Figure 6.

Figure 6

Open in a new tab

Permeability of in vitro placental barrier to various molecules under 21, 8 and 3% oxygen levels. Percentage of fluorescence intensity measured in the fetal chamber normalized to total fluorescence intensity in both maternal and fetal chambers in the No Cell and Co-Culture groups cultured under 21, 8 and 3% oxygen levels for (A) 457 Da Lucifer Yellow molecules, (B) 4000 Da fluorescein-dextran molecules or (C) 70 000-Da fluorescein-dextran molecules. (D) Apparent permeability coefficients of 457, 4000 and 70 000 Da molecules in the Co-Culture group under 21, 8 and 3% oxygen levels at 48 h normalized to the No Cell control group. Significant differences between treatment groups determined by two-way ANOVA; n ≥ 4. Significant differences between means indicated by **P < 0.01 or ***P < 0.001.

Discussion

Improved preclinical models of the placental barrier are key towards advancing our understanding of the effects of maternal drug and toxin exposure on the fetus. In the current study, we designed and characterized a new approach to modeling the placental barrier in vitro, where BeWo trophoblastic cells and HUVECs may be co-cultured on contralateral sides of an ECM-coated transwell insert. Our approach was novel in the following ways: firstly, by seeding the BeWo cells on the basolateral side of the transwell insert, we were able to induce syncytial fusion without exposing the HUVECs to forskolin, which is unique compared to many past transport models that do not attempt to induce syncytial fusion at all (Bode et al., 2006; Aengenheister et al., 2018; Aengenheister et al., 2019). Secondly, we demonstrated that our placental barrier model can exhibit size-specific barrier permeability to various fluorescent molecules (457 Da Lucifer Yellow, 4000 Da fluorescein-dextran and 70 000 Da fluorescein-dextran). Lastly, we profiled the response of our placental barrier to physiologically low oxygen environments (3–8%) and the impact on syncytial fusion and barrier permeability. Through use of readily accessible tools (such as transwell inserts) and well-characterized cell lines (BeWo and HUVEC), our approach is also very practical for other placental researchers to adopt.

The low oxygen environment (3–8%) under which placental development occurs within the body is an important factor that has been controversially ignored in many in vitro systems to date (Lackman et al., 2001; Miller et al., 2005; Andrade et al., 2015). Our results, however, show that the BeWo cell layer is responsive to altered environmental oxygen levels. This is important as oxygen-sensitive transcription factors, such as HIF1, control the expression of many development-related genes and proteins (Lee et al., 2004; Breckenridge et al., 2013; Rath et al., 2014), and the disruption of its signaling can lead to impaired placental development and cellular differentiation (Fryer and Simon, 2006). Thus, placental cultures performed under atmospheric air, which we demonstrated here to indeed have degraded HIF1α protein levels compared to low oxygen cultures, are expected to lead to markedly altered HIF1-dependent transcriptomic and functional phenotypes (Lee et al., 2004; Breckenridge et al., 2013; Rath et al., 2014). Low oxygen has also been demonstrated to lead to membrane-to-cytoplasm translocation and reduced expression of connexin43 in trophoblastic cells, which may be a potential molecular mechanism underlying the altered barrier permeability in low oxygen given the role of gap junction formation in intercellular exchange of small molecules (Knerr et al., 2005; Otto et al., 2015).

Past studies have reported controversial interpretations regarding the impact of oxygen on syncytial fusion, where many assumed a priori that low oxygen should be a deleterious treatment group for trophoblast culture in vitro when compared to atmospheric air (Alsat et al., 1996; Kudo et al., 2003). Yet, pregnancy pathologies, such as preterm birth and intrauterine growth restriction, have been found at times to be associated with hyperoxia, not hypoxia (Kakogawa et al., 2010; Sibley et al., 2002). While pathological hypoxia and ischemia may be undoubtedly harmful in the body, the use of atmospheric air as the ‘healthy, normal group’ in placental experiments may be confounding and misleading, given the weak evidence for hypoxia in the etiology of placental diseases (Tuuli et al., 2011; Huppertz et al., 2014b). Moreover, it does not reflect the chronic, low oxygen tension experienced within the placenta throughout gestation, especially during trophoblast syncytialization (Alsat et al., 1996; Genbacev et al., 1996; Genbacev et al., 2003; Knerr et al., 2003; Kudo et al., 2003; Tuuli et al., 2011). Furthermore, placental explants cultured under 8% oxygen exhibit better tissue structure and RNA quality than those cultured under atmospheric air (Brew et al., 2016). However, some caution must be taken in interpreting these results as BeWo cells have historically been maintained in atmospheric air. Thus, there may be some differences in their response to physiologically low oxygen compared to trophoblast cells in vivo. Nonetheless, this emphasizes the necessity to better define the oxygen environment in future experimental and model designs.

The increased presence of multi-nucleated cells and elevated ERVWE1/syncytin-1 protein expression under 8 and 3% oxygen provided evidence supporting our hypothesis for improved syncytialization under low oxygen. Furthermore, the selectively decreased permeability only to the smaller particles (457 and 4000 Da) at low oxygen would suggest increased barrier specificity. However, lower oxygen also led to decreased levels of some traditional markers of syncytialization (e.g. hCG protein, CGB and ERVWE1 mRNA), which is consistent with findings by others (Strohmer et al., 1997). To help interpret this, Diaz et al. (2016) also found that hCG expression and secretion was decreased in placental explants with established, intact syncytiotrophoblast layers cultured under 6% oxygen, compared to similar explants cultured under 21% oxygen. These findings alongside expert opinions by Huppertz and Gauster (2011) suggest that the state of syncytial fusion does not always correlate with hCG levels and that oxygen may even directly regulate hCG expression (Diaz et al., 2016). Furthermore, JEG-3 cells, a non-fusogenic, trophoblastic cell line, may also exhibit augmented hCG expression under certain experimental conditions without any evidence of fusion (Vargas et al., 2008; Rothbauer et al., 2017). Thus, changing levels of hCG and other classical mRNA or protein markers can help indicate syncytial fusion, but must be supported by additional tests (e.g. plasma membrane visualization via E-Cadherin (Borges et al., 2003)), especially when assessing experiments involving changes in oxygen.

While BeWo cells have some limitations as a choriocarcinoma cell line, the forskolin-induced model is well validated with controlled, predictable rates of fusion, allowing precise study of barrier permeability and response to low oxygen tension (Ishikawa et al., 2014; Wang et al., 2014). Primary trophoblast cells would have been challenging and perhaps disadvantageous to use in this study, given their spontaneous, uncontrollable fusion events and unpredictable rates across donors (Huppertz and Gauster, 2011; Poidatz et al., 2015). In fact, another BeWo co-culture model was recently demonstrated to show barrier permeability to nanoparticles (Aengenheister et al., 2018). However, these authors cultured BeWo cells on the apical side and HUVECs on the basal side and did not attempt to induce fusion in the BeWo cells (Aengenheister et al., 2018). Syncytial fusion is a crucial phenotype required to emulate the human placental barrier, and our novel approach to reverse-culturing BeWo cells on the basal side of the transwell insert enables the selective induction of syncytial fusion prior to seeding the endothelial cell layer. While we did not demonstrate any changes in barrier permeability to fluorescein dextran molecules after syncytial fusion, there are many other specific transporters expressed on the placental barrier for functional molecules (e.g. ATP-binding cassette transporter A1 and A2, glucose transporter 1) that may change in expression and function after syncytialization or low oxygen exposure (Huang et al., 2016; Francois et al., 2017). Therefore, there is much promise for future studies to build upon and apply our current model to explore the impact of oxygen and/or syncytial fusion on the transport of specific, functional molecules.

In conclusion, we established a multi-layered, in vitro model of the human placental barrier that may undergo syncytial fusion, exhibit size-specific barrier permeability and function under physiologically low oxygen. These findings will contribute vital biological insights to the advancement of future micro-physiological placental systems, such as the placenta-on-a-chip or bio-printed models, ultimately progressing our understanding of maternal–fetal exchange during pregnancy.

Supplementary Material

Supplementary_Information_final_gaaa018
Click here for additional data file. (464.3KB, pdf)

Acknowledgement

We thank Dr Hawke and Dr Truant and their laboratories for providing access to the microscopes.

Authors’ roles

M.K.W. wrote the main manuscript text. M.K.W., E.L. and M.A. conducted all experiments and analyses. P.R.S. and S.R. contributed to the experimental design. All authors reviewed the manuscript.

Funding

Natural Sciences and Engineering Research Council (Vanier Canada Graduate Scholarship to M.W.); Canadian Institutes of Health Research and Natural Sciences and Engineering Research Council (Collaborative Health Research Program award to S.R. and P.R.S.); Canada Research Chairs Program (to P.R.S.).

Conflict of interest

None to declare.

References

  1. Aengenheister L, Dugershaw BB, Manser P, Wichser A, Schoenenberger R, Wick P, Hesler M, Kohl Y, Straskraba S, Suter MJ et al. Investigating the accumulation and translocation of titanium dioxide nanoparticles with different surface modifications in static and dynamic human placental transfer models. Eur J Pharm Biopharm 2019;142:488–497. [DOI] [PubMed] [Google Scholar]
  2. Aengenheister L, Keevend K, Muoth C, Schonenberger R, Diener L, Wick P, Buerki-Thurnherr T. An advanced human in vitro co-culture model for translocation studies across the placental barrier. Sci Rep 2018;8:5388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aldridge GM, Podrebarac DM, Greenough WT, Weiler IJ. The use of total protein stains as loading controls: an alternative to high-abundance single-protein controls in semi-quantitative immunoblotting. J Neurosci Meth 2008;172:250–254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Alsat E, Wyplosz P, Malassine A, Guibourdenche J, Porquet D, Nessmann C, Evain-Brion D. Hypoxia impairs cell fusion and differentiation process in human cytotrophoblast, in vitro. J Cell Physiol 1996;168:346–353. [DOI] [PubMed] [Google Scholar]
  5. Andrade PZ, Soure AM, Dos Santos F, Paiva A, Cabral JM, Silva CL. Ex vivo expansion of cord blood haematopoietic stem/progenitor cells under physiological oxygen tensions: clear-cut effects on cell proliferation, differentiation and metabolism. J Tissue Eng Regen Med 2015;9:1172–1181. [DOI] [PubMed] [Google Scholar]
  6. Bode CJ, Jin H, Rytting E, Silverstein PS, Young AM, Audus KL. In vitro models for studying trophoblast transcellular transport. Methods Mol Med 2006;122:225–239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Borges M, Bose P, Frank HG, Kaufmann P, Pötgens AJG. A two-colour fluorescence assay for the measurement of syncytial fusion between trophoblast-derived cell lines. Placenta 2003;24:959–964. [DOI] [PubMed] [Google Scholar]
  8. Boss AL, Chamley LW, James JL. Placental formation in early pregnancy: how is the centre of the placenta made? Hum Reprod Update 2018;24:750–760. [DOI] [PubMed] [Google Scholar]
  9. Breckenridge RA, Piotrowska I, Ng KE, Ragan TJ, West JA, Kotecha S, Towers N, Bennett M, Kienesberger PC, Smolenski RT et al. Hypoxic regulation of hand1 controls the fetal-neonatal switch in cardiac metabolism. PLoS Biol 2013;11:e1001666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Brew O, Nikolopoulou E, Hughes A, Christian M, Lee Y, Oduwole O, Sullivan MH, Woodman A. Quality of placental RNA: effects of explant size and culture duration. Placenta 2016;46:45–48. [DOI] [PubMed] [Google Scholar]
  11. Diaz P, Sibley CP, Greenwood SL. Oxygen-sensitive K+ channels modulate human chorionic gonadotropin secretion from human placental trophoblast. PloS one 2016;11:e0149021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Elad D, Levkovitz R, Jaffa AJ, Desoye G, Hod M. Have we neglected the role of fetal endothelium in transplacental transport? Traffic 2014;15:122–126. [DOI] [PubMed] [Google Scholar]
  13. Francois LN, Gorczyca L, Du J, Bircsak KM, Yen E, Wen X, Tu MJ, Yu AM, Illsley NP, Zamudio S et al. Down-regulation of the placental BCRP/ABCG2 transporter in response to hypoxia signaling. Placenta 2017;51:57–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fryer BH, Simon MC. Hypoxia, HIF and the placenta. Cell Cycle 2006;5:495–498. [DOI] [PubMed] [Google Scholar]
  15. Fujii T, Nagamatsu T, Morita K, Schust DJ, Iriyama T, Komatsu A, Osuga Y, Fujii T. Enhanced HIF2alpha expression during human trophoblast differentiation into syncytiotrophoblast suppresses transcription of placental growth factor. Sci Rep 2017;7:12455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Genbacev O, Joslin R, Damsky CH, Polliotti BM, Fisher SJ. Hypoxia alters early gestation human cytotrophoblast differentiation/invasion in vitro and models the placental defects that occur in preeclampsia. J Clin Invest 1996;97:540–550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Genbacev O, McMaster MT, Zdravkovic T, Fisher SJ. Disruption of oxygen-regulated responses underlies pathological changes in the placentas of women who smoke or who are passively exposed to smoke during pregnancy. Reprod Toxicol 2003;17:509–518. [DOI] [PubMed] [Google Scholar]
  18. Genbacev O, Zhou Y, Ludlow JW, Fisher SJ. Regulation of human placental development by oxygen tension. Science 1997;277:1669–1672. [DOI] [PubMed] [Google Scholar]
  19. Heaton SJ, Eady JJ, Parker ML, Gotts KL, Dainty JR, Fairweather-Tait SJ, McArdle HJ, Srai KS, Elliott RM. The use of BeWo cells as an in vitro model for placental iron transport. Am J Physiol Cell Physiol 2008;295:C1445–C1453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Huang LE, Arany Z, Livingston DM, Bunn HF. Activation of hypoxia-inducible transcription factor depends primarily upon redox-sensitive stabilization of its subunit. J Biol Chem 1996;271:32253–32259. [DOI] [PubMed] [Google Scholar]
  21. Huang X, Luthi M, Ontsouka EC, Kallol S, Baumann MU, Surbek DV, Albrecht C. Establishment of a confluent monolayer model with human primary trophoblast cells: novel insights into placental glucose transport. Mol Hum Reprod 2016;22:442–456. [DOI] [PubMed] [Google Scholar]
  22. Huppertz B, Gauster M. Mechanisms regulating human trophoblast fusion. Cell Fusions 2011;203–217. [Google Scholar]
  23. Huppertz B, Ghosh D, Sengupta J. An integrative view on the physiology of human early placental villi. Prog Biophys Mol Biol 2014a;114:33–48. [DOI] [PubMed] [Google Scholar]
  24. Huppertz B, Weiss G, Moser G. Trophoblast invasion and oxygenation of the placenta: measurements versus presumptions. J Reprod Immunol 2014b;101-102:74–79. [DOI] [PubMed] [Google Scholar]
  25. Ishikawa A, Omata W, Ackerman WE, Takeshita T, Vandre DD, Robinson JM. Cell fusion mediates dramatic alterations in the actin cytoskeleton, focal adhesions, and E-cadherin in trophoblastic cells. Cytoskeleton (Hoboken) 2014;71:241–256. [DOI] [PubMed] [Google Scholar]
  26. Jauniaux E, Watson AL, Hempstock J, Bao Y-P, Skepper JN, Burton GJ. Onset of maternal arterial blood flow and placental oxidative stress. Am J Pathol 2000;157:2111–2122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Kakogawa J, Sumimoto K, Kawamura T, Minoura S, Kanayama N. Noninvasive monitoring of placental oxygenation by near-infrared spectroscopy. Am J Perinatol 2010;27:463–468. [DOI] [PubMed] [Google Scholar]
  28. Knerr I, Schubert SW, Wich C, Amann K, Aigner T, Vogler T, Jung R, Dotsch J, Rascher W, Hashemolhosseini S. Stimulation of GCMa and syncytin via cAMP mediated PKA signaling in human trophoblastic cells under normoxic and hypoxic conditions. FEBS Lett 2005;579:3991–3998. [DOI] [PubMed] [Google Scholar]
  29. Knerr I, Weigel C, Linnemann K, Dötsch J, Meißner U, Fusch C, Rascher W. Transcriptional effects of hypoxia on fusiogenic syncytin and its receptor ASCT2 in human cytotrophoblast BeWo cells and in ex vivo perfused placental cotyledons. Am J Obstet Gynecol 2003;189:583–588. [DOI] [PubMed] [Google Scholar]
  30. Kudo Y, Boyd CAR, Sargent IL, Redman CWG. Hypoxia alters expression and function of syncytin and its receptor during trophoblast cell fusion of human placental BeWo cells: implications for impaired trophoblast syncytialisation in pre-eclampsia. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 2003;1638:63–71. [DOI] [PubMed] [Google Scholar]
  31. Lackman F, Capewell V, Gagnon R, Richardson B. Fetal umbilical cord oxygen values and birth to placental weight ratio in relation to size at birth. Am J Obstet Gynecol 2001;185:674–682. [DOI] [PubMed] [Google Scholar]
  32. Lee JS, Romero R, Han YM, Kim HC, Kim CJ, Hong J-S, Huh D. Placenta-on-a-chip: a novel platform to study the biology of the human placenta. J Matern Fetal Neonatal Med 2015;1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Lee JW, Bae SH, Jeong JW, Kim SH, Kim KW. Hypoxia-inducible factor (HIF-1)alpha: its protein stability and biological functions. Exp Mol Med 2004;36:1–12. [DOI] [PubMed] [Google Scholar]
  34. Li H, Ravenzwaay B, Rietjens IM, Louisse J. Assessment of an in vitro transport model using BeWo b30 cells to predict placental transfer of compounds. Arch Toxicol 2013;87:1661–1669. [DOI] [PubMed] [Google Scholar]
  35. Liu L, Liu X. Contributions of drug transporters to blood-placental barrier. Adv Exp Med Biol 2019;1141:505–548. [DOI] [PubMed] [Google Scholar]
  36. Matsukawa Y, Lee VH, Crandall ED, Kim KJ. Size-dependent dextran transport across rat alveolar epithelial cell monolayers. J Pharm Sci 1997;86:305–309. [DOI] [PubMed] [Google Scholar]
  37. Miller RK, Genbacev O, Turner MA, Aplin JD, Caniggia I, Huppertz B. Human placental explants in culture: approaches and assessments. Placenta 2005;26:439–448. [DOI] [PubMed] [Google Scholar]
  38. Orendi K, Gauster M, Moser G, Meiri H, Huppertz B. The choriocarcinoma cell line BeWo: syncytial fusion and expression of syncytium-specific proteins. Reproduction 2010;140:759–766. [DOI] [PubMed] [Google Scholar]
  39. Otto T, Gellhaus A, Luschen N, Scheidler J, Bendix I, Dunk C, Wolf N, Lennartz K, Koninger A, Schmidt M et al. Oxygen sensitivity of placental trophoblast connexins 43 and 46: a role in preeclampsia? J Cell Biochem 2015;116:2924–2937. [DOI] [PubMed] [Google Scholar]
  40. Pemathilaka RL, Caplin JD, Aykar SS, Montazami R, Hashemi NN. Placenta-on-a-chip: in vitro study of caffeine transport across placental barrier using liquid chromatography mass spectrometry. Global Challenges 2019;3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Poidatz D, Dos Santos E, Gronier H, Vialard F, Maury B, De Mazancourt P, Dieudonne MN. Trophoblast syncytialisation necessitates mitochondrial function through estrogen-related receptor-gamma activation. Mol Hum Reprod 2015;21:206–216. [DOI] [PubMed] [Google Scholar]
  42. Rath G, Aggarwal R, Jawanjal P, Tripathi R, Batra A. HIF-1 alpha and placental growth factor in pregnancies complicated with preeclampsia: a qualitative and quantitative analysis. J Clin Lab Anal 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Rodesch F, Simon P, Donner C, Jauniaux E. Oxygen measurements in endometrial and trophoblastic tissues during early pregnancy. Obstet Gynecol 1992;80:283–285. [PubMed] [Google Scholar]
  44. Rothbauer M, Patel N, Gondola H, Siwetz M, Huppertz B, Ertl P. A comparative study of five physiological key parameters between four different human trophoblast-derived cell lines. Sci Rep 2017;7:5892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Rubinchik-Stern M, Eyal S. Drug interactions at the human placenta: what is the evidence? Front Pharmacol 2012;3:126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Schwabe T, Bainton RJ, Fetter RD, Heberlein U, Gaul U. GPCR signaling is required for blood-brain barrier formation in drosophila. Cell 2005;123:133–144. [DOI] [PubMed] [Google Scholar]
  47. Sibley CP, Pardi G, Cetin I, Todros T, Piccoli E, Kaufmann P, Huppertz B, Bulfamante G, Cribiu FM, Ayuk P et al. Pathogenesis of intrauterine growth restriction (IUGR)-conclusions derived from a European Union Biomed 2 Concerted Action project 'Importance of Oxygen Supply in Intrauterine Growth Restricted Pregnancies'-a workshop report. Placenta 2002;23:S75–S79. [DOI] [PubMed] [Google Scholar]
  48. Strohmer H, Kiss H, Mosl B, Egarter C, Husslein P, Knofler M. Hypoxia downregulates continuous and interleukin-1-induced expression of human chorionic gonadotropin in choriocarcinoma cells. Placenta 1997;18:597–604. [DOI] [PubMed] [Google Scholar]
  49. Tuuli MG, Longtine MS, Nelson DM. Review: oxygen and trophoblast biology--a source of controversy. Placenta 2011;32:S109–S118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Vargas A, Moreau J, Le Bellego F, Lafond J, Barbeau B. Induction of trophoblast cell fusion by a protein tyrosine phosphatase inhibitor. Placenta 2008;29:170–174. [DOI] [PubMed] [Google Scholar]
  51. Vargesson N. Thalidomide-induced teratogenesis: history and mechanisms. Birth Defects Res C Embryo Today 2015;105:140–156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wang R, Dang YL, Zheng R, Li Y, Li W, Lu X, Wang LJ, Zhu C, Lin HY, Wang H. Live cell imaging of in vitro human trophoblast syncytialization. Biol Reprod 2014;90:117. [DOI] [PubMed] [Google Scholar]
  53. Wong MK, Shawky SA, Aryasomayajula A, Green MA, Ewart T, Selvaganapathy PR, Raha S. Extracellular matrix surface regulates self-assembly of three-dimensional placental trophoblast spheroids. PloS one 2018;13:e0199632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wong MK, Wahed M, Shawky SA, Dvorkin-Gheva A, Raha S. Transcriptomic and functional analyses of 3D placental extravillous trophoblast spheroids. Sci Rep 2019;9:12607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Yin F, Zhu Y, Zhang M, Yu H, Chen W, Qin J. A 3D human placenta-on-a-chip model to probe nanoparticle exposure at the placental barrier. Toxicology in vitro : an international journal published in association with BIBRA 2019;54:105–113. [DOI] [PubMed] [Google Scholar]
  56. Zhou S, Xie Y, Puscheck EE, Rappolee DA. Oxygen levels that optimize TSC culture are identified by maximizing growth rates and minimizing stress. Placenta 2011;32:475–481. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary_Information_final_gaaa018
Click here for additional data file. (464.3KB, pdf)

Articles from Molecular Human Reproduction are provided here courtesy of Oxford University Press

RESOURCES