Skip to main content
Biological Research logoLink to Biological Research
. 2020 May 14;53:21. doi: 10.1186/s40659-020-00289-0

Development of nuclear SSR and chloroplast genome markers in diverse Liriodendron chinense germplasm based on low-coverage whole genome sequencing

Bin Li 1,2,3,#, Furong Lin 1,2,3,#, Ping Huang 1,2,3, Wenying Guo 1,2,3, Yongqi Zheng 1,2,3,✉
PMCID: PMC7227249  PMID: 32410692

Abstract

Background

Liriodendron chinense ranges widely in subtropical China and northern Vietnam; however, it inhabits several small, isolated populations and is now an endangered species due to its limited seed production. The objective of this study was to develop a set of nuclear SSR (simple sequence repeats) and multiple chloroplast genome markers for genetic studies in L. chinense and their characterization in diverse germplasm.

Results

We performed low-coverage whole genome sequencing of the L. chinense from four genotypes, assembled the chloroplast genome and identified nuclear SSR loci by searching in contigs for SSR motifs. Comparative analysis of the four chloroplast genomes of L. chinense revealed 45 SNPs, 17 indels, 49 polymorphic SSR loci, and five small inversions. Most chloroplast intraspecific polymorphisms were located in the interspaces of single-copy regions. In total, 6147 SSR markers were isolated from low-coverage whole genome sequences. The most common SSR motifs were dinucleotide (70.09%), followed by trinucleotide motifs (23.10%). The motif AG/TC (33.51%) was the most abundant, followed by TC/AG (25.53%). A set of 13 SSR primer combinations were tested for amplification and their ability to detect polymorphisms in a set of 109 L. chinense individuals, representing distinct varieties or germplasm. The number of alleles per locus ranged from 8 to 28 with an average of 21 alleles. The expected heterozygosity (He) varied from 0.19 to 0.93 and the observed heterozygosity (Ho) ranged from 0.11 to 0.79.

Conclusions

The genetic resources characterized and tested in this study provide a valuable tool to detect polymorphisms in L. chinense for future genetic studies and breeding programs.

Keywords: Liriodendron chinense, SSR, Genetic diversity, Molecular markers

Background

Liriodendron chinense (Hemsl.) Sarg., one of the only two living Liriodendron species on the earth, is Asia’s native Liriodendron species, known as the Chinese tulip tree [1, 2]. Depending on fossil evidence, Liriodendron species were reported to become extinct in Europe due to large-scale glaciation and climate aridity during glacial phases, leaving a discontinuous distribution of L. chinense and its American relative, L. tulipifera [3]. L. chinense grows in central and southern China and locally in northern Vietnam. These tulip trees can grow to more than 40 m in height, and their large flowers superficially resemble tulips. The trees are therefore cultivated on other continents as ornamental trees [4]. In addition, L. chinense wood is hard but light and difficult to deform, making it useful for construction, ship building and furniture framing. The tree’s leaves and bark are used medicinally for dispersing cold and relieving cough [5].

Liriodendron chinense is a cross-pollinated plant; however, parthenogenesis exists, and gynoecium can develop without insemination, causing a low germination percentage in the natural environment. Seed reproduction of this species often requires artificial pollination, whereas seeds still have poor vitality [6]. The development and utilization of L. chinense germplasm resources began in the 1960s when crossbreeding of Asia and American tulip trees was successfully accomplished. The hybrids maintained parental advantages, such as peculiar leaf shape and long flowering phase; moreover, they performed even better in flower color, growth rate, insect resistance, etc. Excellent characteristics are inherited through asexual reproduction techniques, such as cuttage, grafting and tissue culture in modern L. chinense cultivation. Various cultivars flourished from different reproducing techniques, growing areas and genetic backgrounds. The original genetic resources that breed all kinds of cultivars may be missing due to long cultivating history, multiple market circulation and careless management. Comprehensive lineage cataloguing and genetic diversity investigation are required to supervise and protect a healthy development of tulip tree resources [7].

DNA sequences may be applied in species identification, molecular phylogeny, population genetics etc. For various kinds of DNA molecular markers, microsatellite sequences are thought to be sensitive in assessing the genetic diversity and structure of plant populations. This term refers to simple sequence repeats (SSR) markers, which are codominant, highly polymorphic, reproducible, reliable, and distributed throughout the genome. In the traditional methodology, microsatellite development involves an enriched library followed by gene cloning. Tedious lab work is time-consuming and still may not be able to produce even a small number of polymorphic loci [8, 9]. Next-generation sequencing provides a good alternative, in which the genome is fully screened literally, developing thousands of SSR candidates at one time [10, 11].

The chloroplast genome is conservatively inherited uniparentally mostly via maternal inheritance [12]. In general, with a size from 120 to 160 kb, the chloroplast genome is structurally highly conserved across land plants. The chloroplast genome in angiosperms has a circular structure of two copies of large inverted repeats (IR) separated by small (SSC) and large (LSC) single-copy regions [13, 14]. Chloroplast genome markers, such as single nucleotide polymorphisms (SNPs), indels, simple sequence repeats (SSRs), and small inversion, have been used for studying genetic and genome diversity and phylogenetic and systematic evolutionary analyses [15–20]. For example, using the whole plastid genome sequence data of wild extant Ginkgo populations revealed the deepest temporal footprint dating back to approximately 390,000 year ago [21]. Diversity and phylogenetic analyses using the chloroplast genome data revealed some selection characteristics in the chloroplast genome that Asian rice had been domesticated at least twice [22]. Phyloplastomic and network analyses clarified the taxonomic position of Pepper species (Capsicum spp.) [23]. Moreover, the genetic information in angiosperm chloroplasts is inherited maternally, making the chloroplast markers a good indicator of maternal ancestry. Intraspecific chloroplast sequence variation is used to investigate the population structure of L. chinense germplasm and is applied to guide molecular breeding.

In our study, we performed low-coverage shotgun sequencing of the four genotypes of L. chinense using Next Generation Sequencing (NGS) technology. The study aimed to (1) assemble the chloroplast genome of L. chinense and identify the chloroplast genome markers, including chloroplast SSRs, indels, and SNPs; (2) develop the nuclear SSR loci by searching in contigs for SSR motifs, design candidate SSR PCR primers, and screen for fragment length polymorphisms among different L. chinense individuals.

Materials and methods

DNA extraction and high-throughput sequencing

Four genotypes of L. chinense were used in this study (Table 1). L. chinense were obtained from Monan, Songtao, Guizhou (GZST), Jiujiang, Jiangxi (JXLS), Liping, Guizhou (GZLP), and Shuining, Hunan (HNSN) of China, representing the geographical distribution of this species. Young leaves of L. chinense were picked for silica gel conservation. Total genomic DNA was extracted from dried leaves using the modified CTAB method [24] and further purified via the Wizard® Genomic DNA Purification Kit (A1120, Promega, USA). DNA (5 ng) amount was accurately calculated on a Qubit fluorometer and digested for library construction with the TruePrep DNA Library Prep Kit V2 for Illumina (TD502, Vazyme, Nanjing, China) in accordance with the manufacturer’s instructions. A library of 350 bp was selected for sequencing on the HiSeq 4000 platform of the Novogene genome sequencing company in Tianjin, China.

Table 1.

Summary of the complete chloroplast genome characteristics of L. chinense

Genotype GZST JXLS GZLP HNSN
Locality Songtao, Guizhou, China Jiujiang, Jiangxi, China Liping, Guizhou, China Shuining, Hunan China
Raw data no. 18,356,004 13,602,045 13,189,374 13,142,198
Mapped read no. 1154,826 1,099,724 1,391,064 1,603,014
Precent of chloroplast genome reads (%) 6.29% 8.08% 10.55% 12.20%
Chloroplast gemome coverage (X) 1,087 1035 1305 1506
Accession Number in Genbank MK887905 MK887907 MK887904 MK887906
Size (bp) 159,429 159,428 159,890 159,611
LSC (bp) 87,766 87,765 88,240 87,916
SSC (bp) 18,997 18,997 19,000 19,029
IRs (bp) 26,333 26,333 26,325 26,333
GC % 39.16% 39.16% 39.15% 39.17%

Chloroplast genome assembly and annotation

The software Trimmomatic was employed to filter low-quality reads from the raw data [25]. The remaining high-quality reads were assembled into contigs with SPAdes 3.6.1 [26]. Chloroplast genome contigs were selected from the SPAdes assembly by using BLAST search using the published Liriodendron chloroplast genome as a reference (GenBank accession number: KU170538). The selected contigs were second assembled with Sequencher 5.4.5 (Gene Codes, MI, USA). Ambiguous nucleotides or gaps in the chloroplast genome sequences were further confirmed by PCR amplification and Sanger sequencing with specific primers [27]. Finally, clean reads were remapped to the draft genome sequences, yielding the sequences. The chloroplast genome annotations were performed with Plann [28]. The chloroplast genome map was drawn using Genome Vx software [29].

Chloroplast genome marker development and validation

To develop the chloroplast genome markers and to show the intraspecific variations in L. chinense, the four sequenced L. chinense chloroplast genomes were aligned using MIFFT v7 [30] and then adjusted manually using Se-Al 2.0. [31]. The markers of single nucleotide substitutions (SNPs), indels, SSRs, and inversions in the L. chinense chloroplast genome were identified. SNPs were calculated using MEGA 6.0 software [32]. Variable SSRs, indels and inversions were identified in the chloroplast genomes of four L. chinense genotypes based on the aligned sequence matrix. Using the GZST genotype genome sequence as the standard reference, the size, location, and evolutionary direction of the chloroplast genome markers were counted.

Nuclear SSR marker development and primer design

The GZST genotype was used to develop nuclear SSR markers. We applied MISA software [33] to detect microsatellite repeats in assembled contigs. The search parameters were fixed six di-, five tri- and tetranucleotide repeats, respectively while the minimum product size was set to 100 bp. Primer pairs were designed for all candidate loci in Primer3 software [34]. Primer size was controlled between 18 and 22 bp with an optimal size of 20 bp. The minimum primer annealing temperature was set to 60 °C, and other settings were performed with default values.

Primer testing and polymorphism detection

First, forty-eight di- or trinucleotide repeats were tested for PCR primer universality in two tulip tree samples. When synthetizing the candidate SSR primer pairs, an 18 bp tail (5′-TGTAAAACGACGGCCAGT-3′) was added to the 5′ end of the forward primer to improve efficiency and lower cost, as described in MJ Blacket, C Robin, RT Good, SF Lee and AD Miller [35]. Each 10-μL PCR mixture contained 1 × PCR buffer (with Mg2+), 0.25 mmol/L each dNTP, 0.25 μmol/L each primer, 1.25 U of Taq polymerase, and 20-30 ng of DNA. The PCR program was 94 °C for 4 min, followed by 35 cycles of 30 s at 94 °C, 40 s at 55 °C, and 30 s at 72 °C, with a final step of 10 min at 72 °C. The PCR products were examined via electrophoresis in a 1% agarose gel containing ethidium bromide and were visualized using an ultraviolet transilluminator. Loci amplified to be strong bands in both samples were considered for further testing in the next step.

Second, polymorphism examination of selected repeats in previous steps was performed in eight L. chinense from eight different populations. Each 10-μL PCR mixture contained 1 × PCR buffer (with Mg2+), 0.25 mmol/L each dNTP, 0.25 μmol/L each primer, 0.25 μmol/L 18 bp tail primer modified by fluorescence (FAM (blue), HEX (green), and ROX (red)) including different colors, 1.25 U of Taq polymerase, and 20-30 ng of DNA. The amplification program was the same as above. The ABI 3730xl DNA Analyzer (Applied Biosystems, Foster, CA, USA) was used to analyze the amplified PCR fragments with the GeneScan 500 LIZ size standard (Applied Biosystems).

Finally, marker primers screened out by the first two steps were validated in all 109 samples from different populations. The amplification mixture, amplification program, and analysis of PCR fragments were the same as the second step. Genotyping data were identified, and errors were corrected by GeneMapper software version 4.0 (Applied Biosystems, Thermo Fisher, USA). Genetic analyses for polymorphic loci were performed using ATetra version1.2 [36] to calculate such parameters as the number of alleles, effective number of alleles, expected heterozygosity, observed heterozygosity and Shannon’s information index.

Result

Chloroplast genome assembly and genome features

Using the Illumina HiSeq 4000 system, total DNA from four genotypes of L. chinense were sequenced to produce 13,142,198—18,356,014 paired-end raw reads (150 bp average read length) per genotype. We obtained four chloroplast genome sequences of L. chinense with coverage of 1035–1506 X after de nova assembly. The chloroplast genome sequences were deposited in GenBank (Table 1).

The whole chloroplast genome sequences of the four genotypes of L. chinense ranged from 159,428 to 159,890 bp in length (Table 1 and Fig. 1). The chloroplast genome of L. chinense displayed the typical circular quadripartite structure, consisting of a pair of inverted repeat (IR) regions (26,325–26,333 bp) separated by a larger single copy (LSC) region (87,765–88,240 bp), and small single copy (SSC) region (18,997–19,029 bp). The overall GC contents were 37.8% in the LSC region, 43.2% in the IR regions, 34.3% in the SSC region, and 39.2% in the entire chloroplast genome.

Fig. 1.

Fig. 1

Chloroplast genome map of L. chinense. Genes drawn outside of the circle are transcribed clockwise, while those inside are counterclockwise. Small single copy (SSC), large single copy (LSC), and inverted repeats (IRa, IRb) are indicated

Gene content and arrangement were identical in four genotypes of L. chinense chloroplast genomes. The L. chinense chloroplast genome contains 113 different genes, including 79 protein-coding genes, 30 tRNA genes and 4 rRNA genes. Ten protein-coding genes (atpF, ndhA, ndhB, petB, petD, rpl2, rpl16, rpoC1, rps12 and rps16) and six tRNA genes (trnA-UGC, trnG-UCC, trnI-GAU, trnK-UUU, trnL-UAA, trnV-UAC) had a single intron, while two protein-coding genes (ycf3, and clpP) contained two introns. matK was located within the intron of trnK-UUU in the L. chinense chloroplast genomes.

Chloroplast genome marker development

There were 45 SNPs in the four genotypes of the L. chinense chloroplast genome, including 26 SNPs in the intergenic regions, 3 in the intronic regions, and 16 SNPs in the coding sequences (Table 2). All detected SNPs were located in the single copy region. More than two SNPs were detected in each of three positions (trnK-rps16, psbE-petL, and ycf1). Ycf1, which had the highest number of SNPs of all the positions examined, contained four SNPs. The C to G and A to T SNPs had the lowest frequencies among the six direction types of SNPs. We designed primer pairs for amplification of all the SNPs (Additional file 1: Table S1).

Table 2.

The patterns of SNP marker in the L. chinense chloroplast genome

Position Loction Region Type GZST JXLS GZLP HNSN
matK Exon LSC T/C T T C C
matK Exon LSC T/C T T C C
matK-trnK Spacer LSC A/G A A G A
trnK-rps16 Spacer LSC T/G T T G T
trnK-rps16 Spacer LSC T/C C C C T
trnK-rps16 Spacer LSC A/C A A C C
rps16-trnQ Spacer LSC T/G T T G G
trnQ-psbK Spacer LSC T/G G G T G
psbK-psbI Spacer LSC T/C T T C T
trnG Intron LSC A/G G G G A
trnR-atpA Spacer LSC T/C T T T C
atpF Intron LSC A/G G G G A
atpF-atpH Spacer LSC T/C C C C T
atpH-atpI Spacer LSC A/C C C A A
atpH-atpI Spacer LSC C/G G G G C
rps2-rpoC2 Spacer LSC A/T A A A T
rpoC2 Exon LSC T/G T T G T
rpoC1 Exon LSC A/G A A G G
rpoB-trnC Spacer LSC T/G G G T G
trnT-psbD Spacer LSC T/G G G G T
ndhC-trnV Spacer LSC A/C C C C A
trnV Intron LSC A/T T T A A
atpB Exon LSC T/C T T C C
accD-psaI Spacer LSC T/G G G T G
psaI-ycf4 Spacer LSC A/G G G A A
ycf4-cemA Spacer LSC T/G G G T G
psbE-petL Spacer LSC A/G A A A G
psbE-petL Spacer LSC A/G G G G A
psbE-petL Spacer LSC A/C C C C A
rpl20-rps12 Spacer LSC A/C A A C A
psbB Exon LSC A/C A A C C
rps11-rpl36 Spacer LSC A/C A A C C
rpl14 Exon LSC A/T A A T T
ndhF Exon SSC A/C A A C C
ndhF Exon SSC T/C C C T C
ndhF-rpl32 Spacer SSC A/C C C C A
ndhF-rpl32 Spacer SSC A/C A A C C
rpl32 Exon SSC T/G G G G T
psaC-ndhE Spacer SSC A/C A A C A
ndhA Exon SSC A/G G G A G
ndhH Exon SSC T/G T T G G
ycf1 Exon SSC T/C T T C C
ycf1 Exon SSC T/C C C T C
ycf1 Exon SSC A/G A A G G
ycf1 Exon SSC A/G A A A G

We identified 17 indels among the four genotypes of the L. chinense chloroplast genome (Table 3, Additional file 2: Table S2). All indels were found in noncoding regions. Most indels were located in the single copy regions. The size of the indels ranged from 2 to 458 bp. The largest indel (458 bp), in ndhC-trnV, was a deletion in chloroplast genome of the GZST and JXLS genotypes. The other two larger indels (> 100 bp) were found in the ndhC-trnV and petN-psbM regions.

Table 3.

The indels makers in the L. chinense chloroplast genome

Position Loction Region Length (bp) GZST JXLS GZLP HNSN
matK-trnK Spacer LSC 9 Insertion Insertion Deletion Insertion
trnK-rps16 Spacer LSC 15 Deletion Deletion Insertion Insertion
rps16-trnQ Spacer LSC 2 Deletion Insertion Insertion Insertion
rps16-trnQ Spacer LSC 24 Insertion Insertion Insertion Deletion
trnG-trnR Spacer LSC 9 Insertion Insertion Insertion Deletion
petN-psbM Spacer LSC 153 Insertion Insertion Insertion Deletion
trnE-trnT Spacer LSC 5 Deletion Deletion Insertion Deletion
trnfM-rps14 Spacer LSC 30 Insertion Insertion Deletion Deletion
ndhC-trnV Spacer LSC 126 Insertion Insertion Insertion Deletion
ndhC-trnV Spacer LSC 458 Deletion Deletion Insertion Insertion
clpP Intron LSC 3 Insertion Insertion Insertion Deletion
petD-rps11 Spacer LSC 15 Deletion Deletion Insertion Deletion
rpl16 Intron LSC 8 Deletion Deletion Insertion Insertion
trnN-ycf1 Spacer IR 9 Insertion Insertion Deletion Insertion
ccsA-ycf1 Spacer SSC 22 Deletion Deletion Deletion Insertion
ndhE-ndhG Spacer SSC 6 Deletion Deletion Deletion Insertion
ycf1-trnN Spacer IR 9 Insertion Insertion Deletion Insertion

Forty-nine SSR loci showed polymorphism after in silico comparative analysis among the four genotypes of the L. chinense chloroplast genome (Additional file 1: Table S1). All polymorphic SSR loci were located in noncoding regions. Thirty-seven regions harbored SSRs; the trnG intron had the highest number of SSRs (three), followed by trnH-psbA, rps16-trnQ, atpF-atpH, atpH-atpI, rps2-rpoC2, psbM-trnD, trnE-trnT, ycf4-cemA, and rpl32-trnL, all of which had two SSRs. Mononucleotide motifs were the most abundant type of repeat (95.92%). Furthermore, almost all SSR loci were composed of A or T, which contributed to the bias in base composition (A/T; both 60.8%) in the chloroplast genomes of L. chinense. We designed primer pairs for amplification of all the SSRs (Additional file 3: Table S3).

Moreover, a total of five small inversions were uncovered based on the sequence alignment of the four chloroplast genomes (Table 4, Additional file 4: Table S4). Of which these inversions, three were located in the LSC region and two were in the SSC region. All inversions were accompanied by a pair of inverted repeats immediately flanking the inversion. The inversions were from 3 to 23 bp and the franking repeats were from 17 to 29 bp in length. The two small inversions from petA-psbJ and the inversion from trnH-psbA only occurred in the GZLP genotype. The small inversions in rpl32-trnL, and ccsA-ycf1 occurred in the GZLP and HNSN genotypes.

Table 4.

The locations, directions, and lengths of small inversions

Location Region Length of inversions (bp) Direction of the small inversions
Length of inversion Length of inverted repeat GZST JXLS GZLP HNSN
trnH-psbA LSC 8 21 No No Yes No
petA-psbJ LSC 10 17 No No Yes No
petA-psbJ LSC 12 29 No No Yes No
rpl32-trnL SSC 3 22 No No Yes Yes
ccsA-ycf1 SSC 23 17 No No Yes Yes

Nuclear microsatellite marker development

The paired end reads of the GZST genotype were qualitatively assessed and assembled with SPAdes 3.6.1. There were 161,179 contigs assembled and the contig length ranged from 150 bp to 113,929 bp.

A total of 9155 SSRs were discovered using MISA from the assembled contigs. These SSRs included 6417 di-, 2115 tri-, 312 tetra-, 219 penta- and 92 hexanucleotide repeats, which corresponded to 70.09%, 23.10%, 3.41%, 2.39%, and 1.00% of total SSRs, respectively (Fig. 2a). According to the distribution of microsatellites, SSR frequency and density varied with motif length, as motif length increased (from mono- to hexanucleotide repeats). Dinucleotide repeats are more common than the higher order motif, which is in agreement with previous research examining other wood plants. The ten most frequent motif types in the L. chinense genome (Fig. 2b) were five dinucleotides (GA/CT, TC/AG, TG/AC, AT/TA, GT/CA, AT/TA), and five trinucleotides (TTC/AAG, GAA/CTT, CAT/GTA, TTA/AAT, TCT/AGA).

Fig. 2.

Fig. 2

Distribution and type of SSRs in L. chinense. a Number of different SSRs types. b Number of identified SSR motifs in different repeat class types

Primer design and evaluation

Primer3 was used to generate primer pairs targeting these SSR regions (Additional file 5: Table S5). In total, there were 5339 SSR-designed primers. We randomly selected 48 SSRs for initial validation in eight individuals. After screening in 2% agarose electrophoresis, 18 of the 48 primer pairs produced clear, unique amplification products of the expected size. Of 18 SSRs, 13 loci had polymorphic amplifications, and 5 loci were monomorphic. These polymorphic loci serve as candidate markers in the following analysis.

Genetic diversity and relationships among genotypes

To evaluate the genetic diversity of L. chinense, 109 individuals were collected and analyzed using 13 primer pairs selected. Based on 13 polymorphic primer pairs, the number of alleles (A) per locus ranged from 8 to 28, with an average of 21. The expected heterozygosity (He) varied from 0.1919 to 0.9344 and the observed heterozygosity (Ho) ranged from 0.1101 to 0.7944 (Table 5).

Table 5.

Characterization of the 13 polymorphic nuclear SSR markers

Loci Forward primer sequences(5′ to 3′) Reverse primer sequences(5′ to 3′) Predicted size Motif Repeats A Ho He H’
Loci01 CGATAGCGAGAAGAGATACGGG AGAGAAAAATCAGGCCAGTCCA 248 CA 7 16 0.3564 0.8693 2.2622
Loci02 CGGGGTCTTGATTTTGGAGAGA CTGTAGACGTGCTCTTCCGATT 269 AG 10 8 0.3084 0.4916 1.0601
Loci03 GTTTTCTCCAATGCTCCACACC CTCTATAGTCCTCGTGTCGCAC 253 AG 13 24 0.2909 0.9344 2.9145
Loci04 CGTTTCAAATAGGTGGGAGGGA TGCTGTCCCAAAGCTTCACTAA 256 CT 7 21 0.7532 0.913 2.6479
Loci05 AGAGGAAGTGGAGGAAGAAGGA TGCCCTCATTTATCTCTCTCGC 168 AG 13 12 0.1101 0.1919 0.5557
Loci06 TCGAGTTGGCGAGTAATTGTCA TCTTTGTCGCTTTCTCTCCCTC 250 AG 14 21 0.573 0.9156 2.6439
Loci07 ATGTCCAGTCGTAGAAGGGAGA ATCTTACAAATTCCCCCTGGGC 280 TC 13 27 0.7733 0.9023 2.7063
Loci08 CCAAGACGAGAACGATCGATCT AAGTGAGAAAATGCACGTGGTG 157 TC 7 19 0.7113 0.8737 2.4331
Loci09 AGGGGATTACTGACGTCGAGTA GAGTATCATAGGCCCATTACCCT 260 AG 13 28 0.3486 0.9198 2.8313
Loci10 GGATTTAGTTCGGGGAAGACGT TAGGGCCGTTTGCAACATTTTT 236 CT 7 22 0.1972 0.9059 2.606
Loci11 CATGCCAGGCCTGTTAAAAGTC GCTAGCTCTGACAGGCTTCTAG 179 GT 7 25 0.7944 0.9034 2.5901
Loci12 GGCACAGATCAAAAATCGCACT CTTCCATGCCTCTCCGCCATTA 140 GA 18 24 0.7156 0.7804 1.9415
Loci13 CAACCTTCTCTGTCACCTCCG ATAAGTAGTGGAGAGCATGCGG 145 TC 14 26 0.486 0.9221 2.8333
Mean 21 0.4937 0.8095 2.3097

A number of alleles, Ho observed heterozygosity, He expected heterozygosity, H’ Shannon‐Wiener diversity

Discussion

Nuclear SSR markers developed by NGS

Recent developments in sequencing technologies and bioinformatic analysis have provided an unprecedented opportunity to discover SSR markers of high quality and effective cost/time in nonmodel organisms about which genomic information was lacking. Moreover, this approach is also rapid and more cost-effective than traditional SSR development methods and Sanger sequencing [37, 38]. In this study, we randomly obtained partition nuclear genome sequences, and this approach was sufficient for the development of 9155 SSR markers for L. chinense. The density of SSRs was 1 per 7.04 kb in the L. chinense chloroplast genome, while in the most plant genomes, every 6.8 kb has one SSR. This density was less than the density in coffee (1/2.16 kb), and Amorphophallus (1/3.63 kb) [39, 40], but it was higher than that of Arabidopsis (1/14 kb) [41]. The variable frequency of genic and genomic SSRs may reflect a difference in their distribution in coding sequences compared to the entire genome. In the L. tulipifera EST data, the average frequency of SSR was 1 per 8.5 kb, which was less frequent than the genomic data [42].

Among the selected genomic SSRs, dinucleotide repeats were the most abundant (70.09%), followed by trinucleotide motifs (23.10%). One of the 10 most abundant motif types in jujube was tetranucleotide motifs (ATTT/AAAT) which was not found in L. tulipifera [43]. The motif length frequency differences between genomic and genic SSRs are most likely due to selection pressure on genic SSRs which reduces the fixation of mutations leading to frameshifts. Among dinucleotide repeats, AG/CT was most frequently observed (33.51%), followed by AG/TC (25.53%) which is in agreement with Xu et al. [42], who reported that AG/CT was the most frequent genic dinucleotide (57.4%) in L. chinense.

Several studies used expressed sequence tags (ESTs) developing SSR markers [1, 6, 42]. Compared with this study, those SSRs had the lower variable, for example, the average effective number of alleles was 3.95 to 5.93 [38, 44]. Using the low- coverage whole genome sequencing method, we quickly obtained a number of nuclear SSRs with low costs.

Application of nuclear SSR markers

Nuclear microsatellite, with a mutation rate ranging from 10−6 to 10−2 [45], are highly polymorphic in comparison with other marker systems, which have been widely used in many living organisms including plant, insects, birds, humans and animals for different kinds of basic genetics research. There were many applications of nuclear SSR markers in plants, such as, genetic diversity and phylogenetic relationships, population and evolutionary studies, cultivar identification and marker-assisted selection, genome mapping [46].

SSR markers often are powerful system for revealing interspecific and/or intraspecific phylogenetic relationships. Several applications show nuclear SSRs have led to a better understanding of close relationships between species. Relationships among eight Actinidia species were resolved with SSRs [47]. The fragment length polymorphism of SSRs among the Cucumis accessions made it possible to distinguish three main groups [48]. The genetic diversity for germplasm collections have been assessed by SSR markers, such as apple [49], eggplant [50], walnut [51]. Belgj et al. examined the pattern of genetic variability and genetic relationships of wild olive populations in the north-western Mediterranean and indicated a degree of admixture in all the populations [52]. Evaluation of genetic diversity, genome mapping and phylogenetic relationships has resulted in information of the history process and will provide important information for breeding programs.

Chloroplast genome variation in L. chinense

The chloroplast genomes of plants are a valuable resource for developing molecular markers to study intraspecies and interspecies ecolution [15, 53]. Chloroplast genomic sequences are highly conserved within species; however, nucleotide substitutions, SSRs, indels, and other microstructure mutations within these sequences can be used to elucidate the genetic diversity and guide molecular breeding [54, 55]. However, few studies have used whole chloroplast genome data to examine intraspecific diversity. In this study, we assembled chloroplast genome sequences of four accession samples from wild L. chinense germplasm using low-coverage NGS data.

Comparative analysis of the four chloroplast genomes of L. chinense revealed 45 SNPs, 17 indels, 49 polymorphic SSR loci, and five small inversions. The abundant genetic diversity could be applied to phylogenetic analysis and development of molecular markers to verify the genetic diversity of L. chinense. Chloroplast genome sequence diversity in L. chinense is relatively high compared to that reported for other plant species including Scutellaria baicalensis (25 SNPs, 19 indels, two individuals) [56], Brachypodium distachyon (298 SNPs, 53 individuals) [20], Jacobaea vulgaris (32 SNPs, 17 individuals) [57] and Dioscorea polystachya (141 SNPs, 43 indels, 24 polymorphic SSRs, six individuals) [54].

Previously, trnH-psbA, trnL-F, rbcL, and matK genes were used in evolutionary studies, and which were reported to be variation hotspots [58, 59]. Of these genes, matK and rbcL were the core DNA barcodes in plants [60]. More studies have been shown that the mutation hotspot regions in the chloroplast genome are concentrated in noncoding regions. For example, Dong et al. identified 23 highly variable chloroplast markers (4 coding regions, 2 introns, and 17 intergenic spacers) that were used to resolve phylogenies and for DNA barcoding of closely related flowering plant species [61]. Regions of particularly high variability in L. chinense included the LSC intergenic spacer regions trnK-rps16 (five polymorphisms) and rps16-trnQ (five polymorphisms) followed by atpH-atpI, petA-psbJ, trnG intron and ycf1. trnK-rps16 and rps16-trnQ have been identified as variable and underutilized regions of the angiosperm chloroplast genome suitable for intraspecific phylogenetic studies [61, 62]. Ycf1 is the second longest gene and the most rapidly evolving chloroplast gene [63], the function of which is essential for plant viability and encodes Tic214, a vital component of the Arabidopsis TIC complex [64]. There were two highly variable regions (ycf1a and ycf1b) in the SSC of the ycf1 gene [61, 63].

The polymorphisms found in this study can be used to elucidate evolutionary history such as promoting practical applications for breeding new cultivars of L. chinense. Furthermore, chloroplast polymorphism markers will be useful in testing maternal inheritance of the chloroplast genome, in identifying genotype differentiation and even in developing breeding programs.

Conclusion

In this study, we obtained four chloroplast genomes of L. chinense from four genotypes, and identified SNPs indels, SSRs and small inversions in L. chinense by comparative analyses of chloroplast genomes. We also developed nuclear SSRs by low-coverage whole genome sequencing. These newly developed chloroplast genome resources and SSR markers will become useful tools for molecular genetics, genotype identification, genetic mapping, and molecular breeding of Chinese tulip tree.

Supplementary information

40659_2020_289_MOESM1_ESM.xlsx (12.2KB, xlsx)

Additional file 1: Table S1. Primers of SNP markers in the L. chinense chloroplast genome.

40659_2020_289_MOESM2_ESM.xlsx (11.1KB, xlsx)

Additional file 2: Table S2. Primers of Indels markers in the L. chinense chloroplast genome.

40659_2020_289_MOESM3_ESM.xlsx (14.1KB, xlsx)

Additional file 3: Table S3. SSRs identified from in silico comparative analysis of the chloroplast genomes of four L. chinense genotypes.

40659_2020_289_MOESM4_ESM.xlsx (9.5KB, xlsx)

Additional file 4: Table S4. Primers of small inversions.

40659_2020_289_MOESM5_ESM.xlsx (1.2MB, xlsx)

Additional file 5: Table S5. Nuclear SSRs identified in this study.

Acknowledgements

None.

Abbreviation

SSR

Simple sequence repeat

SNP

Single nucleotide polymorphisms

LSC

Large single copy

SSC

Small single copy

IR

Inverted repeat

Authors’ contributions

BL and YZ designed the experiment; BL, FL and PH, and WG collected samples and performed the experiment; BL analyzed the data and wrote the manuscript; All authors have read and approved the final manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (31570657) and National Forest and Grass Germplasm Resources Bank Program (2016–2020).

Availability of data and materials

The newly sequenced plastomes have been submitted to GenBank with Accession Numbers MK887904–MK887907.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no conflict of interest.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Bin Li and Furong Lin—co-first author

Supplementary information

Supplementary information accompanies this paper at 10.1186/s40659-020-00289-0.

References

  • 1.Yang AH, Zhang JJ, Tian H, Yao XH. Characterization of 39 novel EST-SSR markers for Liriodendron tulipifera and cross-species amplification in L. chinense (Magnoliaceae) Am J Bot. 2012;99(11):e460–e464. doi: 10.3732/ajb.1200154. [DOI] [PubMed] [Google Scholar]
  • 2.Yang Y, Xu M, Luo Q, Wang J, Li H. De novo transcriptome analysis of Liriodendron chinense petals and leaves by Illumina sequencing. Gene. 2014;534(2):155–162. doi: 10.1016/j.gene.2013.10.073. [DOI] [PubMed] [Google Scholar]
  • 3.He S, Hao R. Study on the natural population dynamics and the endangering habitat of Liriodendron chinense in China. Acta Phytoecologica Sinica. 1999;23(1):87–95. [Google Scholar]
  • 4.Li K, Chen L, Feng Y, Yao J, Li B, Xu M, Li H. High genetic diversity but limited gene flow among remnant and fragmented natural populations of Liriodendron chinense Sarg. Biochem Syst Ecol. 2014;54:230–236. [Google Scholar]
  • 5.Moon MK, Oh HM, Kwon BM, Baek NI, Kim SH, Kim JS, Kim DK. Farnesyl protein transferase and tumor cell growth inhibitory activities of lipiferolide isolated from Liriodendron tulipifera. Arch Pharm Res. 2007;30(3):299–302. doi: 10.1007/BF02977609. [DOI] [PubMed] [Google Scholar]
  • 6.Zhang X, Carlson A, Tian Z, Staton M, Schlarbaum SE, Carlson JE, Liang H. Genetic characterization of Liriodendron seed orchards with EST-SSR markers. J Plant Sci Mol Breeding. 2015 doi: 10.7243/2050-2389-4-1. [DOI] [Google Scholar]
  • 7.Li B, Li Y, Cai Q, Lin F, Meng Q, Zheng Y. The complete chloroplast genome of a Tertiary relict species Liriodendron chinense (Magnoliaceae) Conserv Genet Resour. 2016;8(3):279–281. [Google Scholar]
  • 8.Tian HL, Chen XQ, Wang JX, Xue JH, Wen J, Mitchell G, Zhou SL. Development and characterization of microsatellite loci for lotus (Nelumbo nucifera) Conserv Genet. 2008;9(5):1385–1388. [Google Scholar]
  • 9.Wang J, Xia T, Zhang J, Zhou S. Isolation and characterization of fourteen microsatellites from a tree peony (Paeonia suffruticosa) Conserv Genet. 2009;10(4):1029–1031. [Google Scholar]
  • 10.Yang T, Fang L, Zhang X, Hu J, Bao S, Hao J, Li L, He Y, Jiang J, Wang F, et al. High-throughput development of SSR markers from pea (Pisum sativum) based on next generation sequencing of a purified chinese commercial variety. PLOS ONE. 2015;10(10):e0139775. doi: 10.1371/journal.pone.0139775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Qi W, Lin F, Liu Y, Huang B, Cheng J, Zhang W, Zhao H. High-throughput development of simple sequence repeat markers for genetic diversity research in Crambe abyssinica. BMC Plant Biol. 2016;16(1):139. doi: 10.1186/s12870-016-0828-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kuroiwa T, Ogawa K, Nakamura S. Mechanisms of maternal inheritance—preferential destruction of chloroplast nuclei. Jpn J Genet. 1984;59(6):633–634. [Google Scholar]
  • 13.Rogalski M, do Nascimento Vieira L, Fraga HP, Guerra MP. Plastid genomics in horticultural species: importance and applications for plant population genetics, evolution, and biotechnology. Front Plant Sci. 2015;6:586. doi: 10.3389/fpls.2015.00586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lima MS, Woods LC, Cartwright MW, Smith DR. The (in)complete organelle genome: exploring the use and non-use of available technologies for characterizing mitochondrial and plastid chromosomes. Mol Ecol Resour. 2016;16:1279. doi: 10.1111/1755-0998.12585. [DOI] [PubMed] [Google Scholar]
  • 15.Dong W, Liu H, Xu C, Zuo Y, Chen Z, Zhou S. A chloroplast genomic strategy for designing taxon specific DNA mini-barcodes: a case study on ginsengs. BMC Genet. 2014;15(1):138. doi: 10.1186/s12863-014-0138-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Xu C, Dong W, Li W, Lu Y, Xie X, Jin X, Shi J, He K, Suo Z. Comparative analysis of six lagerstroemia complete chloroplast genomes. Front Plant Sci. 2017;8(15):15. doi: 10.3389/fpls.2017.00015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Li W, Liu Y, Yang Y, Xie X, Lu Y, Yang Z, Jin X, Dong W, Suo Z. Interspecific chloroplast genome sequence diversity and genomic resources in Diospyros. BMC Plant Biol. 2018;18(1):210. doi: 10.1186/s12870-018-1421-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Morris GP, Grabowski PP, Borevitz JO. Genomic diversity in switchgrass (Panicum virgatum): from the continental scale to a dune landscape. Mol Ecol. 2011;20(23):4938–4952. doi: 10.1111/j.1365-294X.2011.05335.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Huang DI, Hefer CA, Kolosova N, Douglas CJ, Cronk QCB. Whole plastome sequencing reveals deep plastid divergence and cytonuclear discordance between closely related balsam poplars, Populus balsamifera and P. trichocarpa (Salicaceae) New Phytol. 2014;204:693. doi: 10.1111/nph.12956. [DOI] [PubMed] [Google Scholar]
  • 20.Sancho R, Cantalapiedra CP, Lopez-Alvarez D, Gordon SP, Vogel JP, Catalan P, Contreras-Moreira B. Comparative plastome genomics and phylogenomics of Brachypodium: flowering time signatures, introgression and recombination in recently diverged ecotypes. New Phytol. 2018;218(4):1631–1644. doi: 10.1111/nph.14926. [DOI] [PubMed] [Google Scholar]
  • 21.Hohmann N, Wolf EM, Rigault P, Zhou W, Kiefer M, Zhao Y, Fu C-X, Koch MA. Ginkgo biloba’s footprint of dynamic Pleistocene history dates back only 390,000 years ago. BMC Genomics. 2018;19(1):299. doi: 10.1186/s12864-018-4673-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Cheng L, Nam J, Chu SH, Rungnapa P, Min MH, Cao Y, Yoo JM, Kang JS, Kim KW, Park YJ. Signatures of differential selection in chloroplast genome between japonica and indica. Rice. 2019;12(1):65. doi: 10.1186/s12284-019-0322-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Magdy M, Ou L, Yu H, Chen R, Zhou Y, Hassan H, Feng B, Taitano N, van der Knaap E, Zou X, et al. Pan-plastome approach empowers the assessment of genetic variation in cultivated Capsicum species. Horticult Res. 2019;6(1):108. doi: 10.1038/s41438-019-0191-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li J, Wang S, Jing Y, Wang L, Zhou S. A modified CTAB protocol for plant DNA extraction. Chin Bull Bot. 2013;48(1):72–78. [Google Scholar]
  • 25.Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for illumina sequence data. Bioinformatics. 2014;30(15):2114–2120. doi: 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19(5):455–477. doi: 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Dong W, Xu C, Cheng T, Lin K, Zhou S. Sequencing angiosperm plastid genomes made easy: a complete set of universal primers and a case study on the phylogeny of Saxifragales. Genome Biol Evol. 2013;5(5):989–997. doi: 10.1093/gbe/evt063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Huang DI, Cronk QCB. Plann: a command-line application for annotating plastome sequences. Appl Plant Sci. 2015;3(8):1500026. doi: 10.3732/apps.1500026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Conant GC, Wolfe KH. GenomeVx: simple web-based creation of editable circular chromosome maps. Bioinformatics. 2008;24(6):861–862. doi: 10.1093/bioinformatics/btm598. [DOI] [PubMed] [Google Scholar]
  • 30.Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30(4):772–780. doi: 10.1093/molbev/mst010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Se-Al: sequence alignment editor. version 2.0.
  • 32.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30(12):2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Beier S, Thiel T, Munch T, Scholz U, Mascher M. MISA-web: a web server for microsatellite prediction. Bioinformatics. 2017;33(16):2583–2585. doi: 10.1093/bioinformatics/btx198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. Primer3—new capabilities and interfaces. Nucleic Acids Res. 2012;40(15):e115–e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Blacket MJ, Robin C, Good RT, Lee SF, Miller AD. Universal primers for fluorescent labelling of PCR fragments–an efficient and cost-effective approach to genotyping by fluorescence. Mol Ecol Resour. 2012;12(3):456–463. doi: 10.1111/j.1755-0998.2011.03104.x. [DOI] [PubMed] [Google Scholar]
  • 36.Puyvelde VAN. A VANG, Triest L: atetra, a new software program to analyse tetraploid microsatellite data: comparison with tetra and tetrasat. Mol Ecol Resour. 2010;10(2):331–334. doi: 10.1111/j.1755-0998.2009.02748.x. [DOI] [PubMed] [Google Scholar]
  • 37.Xu M, Li HG, Zhang B. Fifteen polymorphic simple sequence repeat markers from expressed sequence tags of Liriodendron tulipifera. Mol Ecol Notes. 2006;6(3):728–730. [Google Scholar]
  • 38.Yao X, Zhang J, Ye Q, Huang H. Characterization of 14 novel microsatellite loci in the endangered Liriodendron chinense (Magnoliaceae) and cross-species amplification in closely related taxa. Conserv Genet. 2008;9(2):483–485. [Google Scholar]
  • 39.Zheng X, Pan C, Diao Y, You Y, Yang C, Hu Z. Development of microsatellite markers by transcriptome sequencing in two species of Amorphophallus (Araceae) BMC Genomics. 2013;14(1):490. doi: 10.1186/1471-2164-14-490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Aggarwal RK, Hendre PS, Varshney RK, Bhat PR, Krishnakumar V, Singh L. Identification, characterization and utilization of EST-derived genic microsatellite markers for genome analyses of coffee and related species. Theor Appl Genet. 2007;114(2):359. doi: 10.1007/s00122-006-0440-x. [DOI] [PubMed] [Google Scholar]
  • 41.Cardle L, Ramsay L, Milbourne D, Macaulay M, Marshall D, Waugh R. Computational and experimental characterization of physically clustered simple sequence repeats in plants. Genetics. 2000;156(2):847–854. doi: 10.1093/genetics/156.2.847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Xu M, Sun Y, Li H. EST-SSRs development and paternity analysis for Liriodendron spp. New Forest. 2010;40(3):361–382. [Google Scholar]
  • 43.Fu PC, Zhang YZ, Ya HY, Gao QB. Characterization of SSR genomic abundance and identification of SSR markers for population genetics in Chinese jujube (Ziziphus jujuba Mill.) PeerJ. 2016;4:e1735. doi: 10.7717/peerj.1735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Zhang H, Li H, Xu M, Feng Y. Identification of Liriodendron tulipifera, Liriodendron chinense and hybrid Liriodendron using species-specific SSR markers. Scientia Silvae Sinicae. 2010;46(1):36–39. [Google Scholar]
  • 45.Schlotterer C. Evolutionary dynamics of microsatellite DNA. Chromosoma. 2000;109(6):365–371. doi: 10.1007/s004120000089. [DOI] [PubMed] [Google Scholar]
  • 46.Wang ML, Barkley NA, Jenkins TM: Microsatellite Markers in Plants and Insects. Part I: Applications of Biotechnology. Genes, genomes and genomics 2009, v. 3(no. 1):pp. 54-67-2009 v.2003 no.2001.
  • 47.Korkovelos AE, Mavromatis AG, Huang WG, Hagidimitriou M, Giakoundis A, Goulas CK. Effectiveness of SSR molecular markers in evaluating the phylogenetic relationships among eight Actinidia species. Sci Hortic. 2008;116(3):305–310. [Google Scholar]
  • 48.Garcia-Mas J, Monforte AJ, Arús P. Phylogenetic relationships among Cucumis species based on the ribosomal internal transcribed spacer sequence and microsatellite markers. Plant Syst Evol. 2004;248(1):191–203. [Google Scholar]
  • 49.Lassois L, Denancé C, Ravon E, Guyader A, Guisnel R, Hibrand-Saint-Oyant L, Poncet C, Lasserre-Zuber P, Feugey L, Durel C-E. Genetic diversity, population structure, parentage analysis, and construction of core collections in the french apple germplasm based on SSR markers. Plant Mol Biol Rep. 2016;34(4):827–844. [Google Scholar]
  • 50.Liu J, Yang Y, Zhou X, Bao S, Zhuang Y. Genetic diversity and population structure of worldwide eggplant (Solanum melongena L.) germplasm using SSR markers. Genet Resour Crop Evol. 2018;65(6):1663–1670. [Google Scholar]
  • 51.Bernard A, Barreneche T, Lheureux F, Dirlewanger E. Analysis of genetic diversity and structure in a worldwide walnut (Juglans regia L.) germplasm using SSR markers. PLOS ONE. 2018;13(11):e0208021. doi: 10.1371/journal.pone.0208021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Belaj A, Muñoz-Diez C, Baldoni L, Porceddu A, Barranco D, Satovic Z. Genetic diversity and population structure of wild olives from the north-western Mediterranean assessed by SSR markers. Ann Bot. 2007;100(3):449–458. doi: 10.1093/aob/mcm132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Curci PL, De Paola D, Sonnante G. Development of chloroplast genomic resources for Cynara. Mol Ecol Resour. 2016;16(2):562–573. doi: 10.1111/1755-0998.12457. [DOI] [PubMed] [Google Scholar]
  • 54.Cao J, Jiang D, Zhao Z, Yuan S, Zhang Y, Zhang T, Zhong W, Yuan Q, Huang L. Development of chloroplast genomic resources in Chinese Yam (Dioscorea polystachya) Biomed Res Int. 2018;2018:6293847. doi: 10.1155/2018/6293847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Dong W, Xu C, Li W, Xie X, Lu Y, Liu Y, Jin X, Suo Z. Phylogenetic resolution in Juglans based on complete chloroplast genomes and nuclear DNA sequences. Front Plant Sci. 2017;8:1148. doi: 10.3389/fpls.2017.01148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Jiang D, Zhao Z, Zhang T, Zhong W, Liu C, Yuan Q, Huang L. The chloroplast genome sequence of Scutellaria baicalensis provides insight into intraspecific and interspecific chloroplast genome diversity in scutellaria. Genes. 2017;8(9):227. doi: 10.3390/genes8090227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Doorduin L, Gravendeel B, Lammers Y, Ariyurek Y, Chin AWT, Vrieling K. The complete chloroplast genome of 17 individuals of pest species Jacobaea vulgaris: sNPs, microsatellites and barcoding markers for population and phylogenetic studies. DNA Res. 2011;18(2):93–105. doi: 10.1093/dnares/dsr002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Pang X, Liu C, Shi L, Liu R, Liang D, Li H, Cherny SS, Chen S. Utility of the trnH-psbA intergenic spacer region and its combinations as plant DNA barcodes: a meta-analysis. PLoS ONE. 2012;7(11):e48833. doi: 10.1371/journal.pone.0048833. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Saarela JM, Sokoloff PC, Gillespie LJ, Consaul LL, Bull RD. DNA barcoding the Canadian Arctic flora: core plastid barcodes (rbcL + matK) for 490 vascular plant species. PLoS ONE. 2013;8(10):e77982. doi: 10.1371/journal.pone.0077982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Hollingsworth PM, Graham SW, Little DP. Choosing and using a plant DNA barcode. PLoS ONE. 2011;6(5):e19254. doi: 10.1371/journal.pone.0019254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Dong W, Liu J, Yu J, Wang L, Zhou S. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLoS ONE. 2012;7(4):e35071. doi: 10.1371/journal.pone.0035071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Shaw J, Lickey EB, Schilling EE, Small RL. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. Am J Bot. 2007;94(3):275–288. doi: 10.3732/ajb.94.3.275. [DOI] [PubMed] [Google Scholar]
  • 63.Dong W, Xu C, Li C, Sun J, Zuo Y, Shi S, Cheng T, Guo J, Zhou S. ycf1, the most promising plastid DNA barcode of land plants. Sci Rep. 2015;5:8348. doi: 10.1038/srep08348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Kikuchi S, Bedard J, Hirano M, Hirabayashi Y, Oishi M, Imai M, Takase M, Ide T, Nakai M. Uncovering the protein translocon at the chloroplast inner envelope membrane. Science. 2013;339(6119):571–574. doi: 10.1126/science.1229262. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

40659_2020_289_MOESM1_ESM.xlsx (12.2KB, xlsx)

Additional file 1: Table S1. Primers of SNP markers in the L. chinense chloroplast genome.

40659_2020_289_MOESM2_ESM.xlsx (11.1KB, xlsx)

Additional file 2: Table S2. Primers of Indels markers in the L. chinense chloroplast genome.

40659_2020_289_MOESM3_ESM.xlsx (14.1KB, xlsx)

Additional file 3: Table S3. SSRs identified from in silico comparative analysis of the chloroplast genomes of four L. chinense genotypes.

40659_2020_289_MOESM4_ESM.xlsx (9.5KB, xlsx)

Additional file 4: Table S4. Primers of small inversions.

40659_2020_289_MOESM5_ESM.xlsx (1.2MB, xlsx)

Additional file 5: Table S5. Nuclear SSRs identified in this study.

Data Availability Statement

The newly sequenced plastomes have been submitted to GenBank with Accession Numbers MK887904–MK887907.


Articles from Biological Research are provided here courtesy of BMC

RESOURCES