ABSTRACT
For the development of safe and effective EBV (Epstein-Barr virus) vaccines, the Ag85A signal peptide from M. tuberculosis H37Rv was used to construct a recombinant secretory BCG (Bacillus Chalmette-Guérin) plasmid. The Ag85A gene, fused to the EBV LMP2A (latent membrane protein) and hGM-CSF (human granulocyte/macrophage colony-stimulating factor) genes, was inserted into the pMV261 vector (secretory BCG plasmid). The expression levels of the hGM-CSF and LMP2A proteins in rBCG (recombinant BCG) were measured by Western blot analysis. Humoral immunity, cellular immunity, and antitumor effects were determined by a series of experiments. The recombinant pMVGCA plasmid effectively expressed GCA (hGM-CSF and LMP2A fusion protein) in BCG after transformation, and the rBCG proteins were recognized by antibodies against hGM-CSF and LMP2A. Six weeks after immunization, the maximum dose of rBCG resulted in antibody titers of 1:19,800 (hGM-CSF antibody) and 1:21,800 (LMP2A antibody). When the effector:target ratio was 40:1, specific lysis was maximal and approximately two times stronger than that in mice immunized with the control. Tumorigenicity was lower in the rBCG treatment group, with a tumor inhibition rate of 0.81 ± 0.09 compared with the control groups. EB virus-positive tumors are inhibited by rBCG expressing an hGM-CSF and LMP2A fusion protein.
KEYWORDS: LMP2A, hGM-CSF, Epstein-Barr virus, cytotoxic lymphocyte, mice
Introduction
EBV (Epstein-Barr virus) is human herpes virus type IV and was identified by Epstein and Barr in 1964 during the culture of Burkitt lymphoma cells. It’s a DNA virus that causes various cancers, including Hodgkin’s lymphoma, Burkitt’s lymphoma, nasopharyngeal carcinoma and nasopharyngeal carcinoma1. EBV is distributed worldwide, and more than 95% of adults have been infected by EBV. The virus mainly infects the mouth, throat epithelial cells and B lymphocytes of humans.2 If the virus is activated in vivo, it can cause tumors and a variety of other diseases. Therefore, the development of safe and effective EBV vaccines is a critically important global health priority. As a safe and strong adjuvant, the BCG attenuated vaccine has been administered for nearly 100 years.3 In many countries, BCG is an important attenuated vaccine for the prevention of tuberculosis, and its low toxicity, safety and effectiveness are important characteristics. rBCG (recombinant BCG) technology has been applied in the development of vaccines against various pathogenic organisms, including bacteria, viruses and parasites.4 As a vaccine vector, BCG has many advantages, including long-lasting induction of Th1 immunity, heat stability, the activation of CD8+ T cells, and the regulation of the proportion of Th1 and Th2 cells. Furthermore, BCG also induces an antitumor immune response, which plays an important role in some cancer treatments.5–7
hGM-CSF (human granulocyte-macrophage colony-stimulating factor) is the strongest regulatory cytokine of DCs (dendritic cells). It consists of 144 aa (amino acids), and the molecular weight of this glycoprotein is approximately 22 kDa. Not only does hGM-CSF promote DC proliferation and differentiation while maintaining cell viability, it also plays an important regulatory role in the distribution and antigen-presenting function of DCs.8 hGM-CSF is an important cytokine in the human body. If hGM-CSF is transferred into tumor cells, it can greatly enhance the immunogenicity of tumor cells, which improves the ability of the host to mount an antitumor response. hGM-CSF can significantly increase the numbers of DCs and CD8+ T cells as well as the expression of MHC-I on tumor cells and the immune costimulatory molecule B7-1 in tumor-bearing animal tumors in vivo. hGM-CSF can also significantly increase the number of tumor-specific CTLs (cytotoxic T lymphocytes) in the mouse spleen. Intratumoral injection of hGM-CSF, which can induce restructuring, has been shown to effectively enhance the body’s antitumor effects. The expression of hGM-CSF can activate or attract antigen-presenting cells to the tumor site, and these cells can then participate in the antitumor immune response.9
The EBV gene LMP2A encodes the EBV latent membrane protein. This protein can be recognized by cytotoxic T cells, which play an important role in the immune response. LMP2A itself is not a transforming gene and has been shown to be noncarcinogenic in vivo. Most importantly, it has potential T cell activation epitopes and the ability to activate CTLs.10 Redchenko11 used DC LMP2A epitope peptides to induce a strong, specific CTL immune response in an animal model. LMP2A contains MHC-restrictive virus-specific CTL recognition epitopes that can be recognized by cytotoxic T cells, which play an important role in the immune response.12 Studies have shown that LMP2A is expressed on the surface of EBV-associated gastric carcinoma cells. LMP2A is also consistently expressed on the surface of lymphoma, nasopharyngeal carcinoma, and other EBV-positive tumor cells.13 Thus, the LMP2A protein is an ideal target antigen for immune therapy for EBV-associated tumors.
In this study, the fusion gene GCA, which includes the LMP2A and hGM-CSF genes, was constructed and inserted into the pMV261 plasmid. After the recombinant plasmid was transformed into BCG, the GCA fusion gene was expressed as a secretory product of BCG, which could evoke a strong immune response and induce the lysis of tumor cells in C57BL/6J mice.
Results
Identification of the pMVGCA recombinant plasmid
After digestion with BamHI and EcoRI, pMVA plasmids were divided into two fragments and assessed by 1% agarose gel electrophoresis. After EcoRI and SalI were used to digest pMVGCA, the GCA fragment was obtained. The insertion of the fusion gene fragment GCA was detected by 1% agarosegel electrophoresis as a 1,970 bp band. The pMVGCA plasmid was digested with EcoRI and BamHI, and a 147-bp gene was observed. Using pMVGCA as a template, the fusion fragment GCA was amplified by PCR, and the 1,970 bp PCR product was confirmed by gel electrophoresis. The size of the pMV261+ GCA plasmid was approximately 6,561 (4,600 + 1,970) bp, which was consistent with the calculated value (Figure 1). These results showed that the pMVGCA recombinant plasmid was successfully constructed.
Figure 1.
Identification of the pMVGCA recombinant plasmid. A. Restriction enzyme analysis of pMVA. Lane 1 = DNA Marker VI; Lane 2 = The enzyme digestion of pMVA. B. Restriction enzyme analysis of pMVGCA. Lane 1 = pMVGCA cut with EcoRI and Sall; Lane 2 = DNA Marker VI; Lane 3 = pMVGCA digested with BamHI and EcoRI. C. PCR analysis of pMVGCA. Lane 1 = DL3000 DNA Marker. Lane 2, Lane 3 and Lane 4 = the fusion gene fragment GCA.
From the pMV261 physical map and restriction enzyme analysis, we confirmed that the 1970 bp gene fragment was inserted between the EcoRI and SalI restriction sites and that the 147 bp gene fragment was inserted between the EcoRI and BamHI sites. Further analysis of the pMVGCA plasmid by sequencing revealed that the full length of the insert was (147 + 1970) bp,which was consistent with the reported cDNA sequence of GCA and the signal peptide.
Detection of gene expression and the humoral immune response
Western blotting showed that the expression of the LMP2A and hGM-CSF proteins was detected in recombinant BCG (rBCG) but was not detected in rBCG containing the empty vector pMV261 (BCG+ pMV261) under the same conditions (Figure 2).
Figure 2.
Western blotting analysis of expressed proteins. Lane 1 = Western blotting for GM-CSF of the BCG control; Lane 2 = Western blotting for GM-CSF of rBCG; Lane 3 = Western blotting for GM-CSF of (BCG+pMV261); Lane 4 = Protein Markers; Lane 5 = Western blotting for LMP2A of the BCG control; Lane 6 = Western blotting for LMP2A of rBCG; Lane 7 = Western blotting for LMP2A of (BCG +pMV261); Lane 8 = Protein Markers.
Mice were injected with 5 × 107 or 1 × 108 cfu of rBCG, and ELISA was used to detect the antibody levels in the serum. The average levels of LMP2A and hGM-CSF antibodies were analyzed and assessed. At low doses, the production of these antibodies was relatively low, and the amounts of the antibodies increased in response to the high-dose rBCG immunization (Figure 3).
Figure 3.
Specific IgG antibody response of mice immunized with rBCG by intraperitoneal injection. BCG: Bacille Calmette-Guérin, rBCG: recombinant Bacille Calmette-Guérin. The maximum dose of rBCG was 5 × 108 cells/ml, and the lower dose of rBCG was 5 × 107 cells/ml. The control dose of BCG was 5 × 108 cells/ml. The rBCG concentration of 5 × 108 cells/ml exerted the greatest effect in terms of proliferation, and antibody titers peaked at week 5. A. ELISA results of hGM-CSF antibody titers. B. The ELISA results of LMP2A antibody titers.
One week after the first immunization, the maximum dose of rBCG resulted in an antibody titer of 1:6,000 (hGM-CSF antibody), while the lower dose resulted in a titer of 1:5,000. rBCG also quickly stimulated LMP2A and hGM-CSF antibody production. Six weeks after immunization, the maximum dose of rBCG resulted in antibody titers of 1:19,800 (hGM-CSF antibody) and 1:21,800 (LMP2A antibody). Seven weeks after immunization, the levels of LMP2A and hGM-CSF antibodies produced remained stable in the rBCG group, while the antibody titer from the control group, which received either PBS or BCG, remained close to 0. The difference between rBCG and the control groups was statistically significant (P ≤ 0.01).
CTL activation in immunized mice
The activation of CTLs was measured in the PBS control group, the BCG control group and the rBCG experimental group to determine whether rBCG could effectively stimulate a CTL response. Lactate dehydrogenase (LDH) release assays showed significant cytotoxicity of rBCG in EBV-positive tumor cells (NPRC18) compared with PBS or BCG (P < .01). When the effector:target ratio was 40:1, specific lysis was maximal and was approximately two times stronger than that in mice in the control groups. Moreover, no significant difference was observed between the PBS- and BCG-immunized groups (Figure 4). These results showed that rBCG could lead to the production of specific CTL cells, which then killed the EBV-positive gastric tumor cells (NPRC18) in immunized mice. These important data showed that rBCG resulted in obvious CTL activation in mice.
Figure 4.
CTLs induced in different experimental groups and the EBV-positive tumor cell killing rate(%). △P < .01 compared with PBS. *P < .01 compared with BCG alone. The target cells were EB virus-positive cells (NPRC18). The effector cells were splenic lymphocytes. Lactate dehydrogenase-release methods were used to assay the activity of CTLs. The CTL killing rate (%) = (experimental group release value-target cell natural release value-effector cell natural release value)/(target cell maximum release value -target cell natural release value) *100%.
Effect of rBCG on phagocytosis in mouse macrophages
The phagocytosis rate and phagocytic index of macrophages decreased compared with those of the control group after mice were inoculated with tumor cells to establish a transplanted tumor model (P < .05) (Figure 5A), and the phagocytic rate of macrophages increased in mice 8 days after injection of rBCG. The phagocytic index increased (P < .05) (Figure 5B) and was higher than the normal level. This difference was statistically significant.
Figure 5.
Effect of rBCG on macrophage phagocytosis in a mouse cancer model. A. The effect of rBCG on the macrophage phagocytosis rate in a mouse cancer model. B. The effect of rBCG on the macrophage phagocytic index in a mousecancer model. Compared with the control group, *P < .05. Compared with the model group, **P < .01.
Immunoprophylaxis experiments
In the rBCG group, the tumors grew more slowly than those in the control groups, as the tumor formation time was significantly delayed (Table 1). In addition, the tumor volume was significantly different (P < .05), with the rBCG group exhibiting the smallest tumor volume, followed by the BCG (hGM-CSF), BCG (LMP2A), BCG and empty vector BCG (pMV261+ BCG) groups. Two weeks after tumor inoculation, tumor growth was accelerated in the BCG, pMV261+ BCG, BCG (hGM-CSF), and BCG (LMP2A) groups. At 21 days after inoculation, tumor growth in the rBCG group remained significantly slower than that in the control group (P < .05). After the mice were sacrificed and the blood was removed, the tumor volume and weight were measured. Compared with those in the control group, the tumor volume and weight were decreased significantly in the rBCG group (P < .05). The tumor weight and volume in the BCG, pMV261+ BCG, BCG (hGM-CSF), and BCG (LMP2A) groups were also lower than those in the control group, but the reduction was not significant. These results indicated that rBCG could delay the growth of EB-positive tumor cells.
Table 1.
Time of tumor formation in all subcutaneous mice.
| Groups | Mean of tumor formation time (d) |
|---|---|
| PBS control | 6.72 ± 1.15 |
| BCG control | 9.12 ± 1.13 |
| pMV261+ BCG group | 10.43 ± 1.12 |
| BCG (LMP2A) | 10.86 ± 1.03 |
| BCG (hGM-CSF) | 12.11 ± 1.18 |
| rBCG therapy | 15.21 ± 1.22* |
Note: * compared with the control group, the difference was significant (P ≤ 0.05). The data represent the means ± SEM of at least four independent experiments.
Effect of rBCG on the growth of EBV-positive tumors in mice
The tumorigenicity in the rBCG treatment group was lower than that in the control group, and the tumor inhibition rate of rBCG was 0.81 ± 0.09. Compared with the BCG, pMV261+ BCG and PBS control groups, a statistically significant difference was observed (Table 2). Furthermore, the tumor volume of the control group (BCG, pMV261+ BCG and PBS) was significantly greater than that of the rBCG group (Figure 6).
Table 2.
Inhibitory effect of recombinant BCG on tumor.(P < .01).
| Groups | Numbers | Tumor weight(g) | Inhibition rate(X士S) |
|---|---|---|---|
| PBS | 5 | 7.49 ± 0.19 | |
| BCG | 5 | 6.37 ± 0.26 | 0.15 ± 0.07 |
| pMV261+ BCG | 5 | 6.44 ± 0.32 | 0.14 ± 0.05 |
| BCG(LMP2A) | 5 | 6.12 ± 0.25 | 0.18 ± 0.04 |
| BCG(hGM-CSF) | 5 | 4.23 ± 0.23 | 0.45 ± 0.06 |
| rBCG | 5 | 1.38 ± 0.45 | 0.81 ± 0.09** (*) |
Note: Six groups of C57BL/6 mice tumor model results.**Compared with the PBS control group (P ≤ 0.01), * Compared with the BCG control group, pMV261+ BCG control group (P ≤ 0.05).
Figure 6.
The tumors of the rBCG and control groups. Each mouse was injected with 5 × 108rBCG cells in 250 μL of PBS. The control groups were composed of mice injected with 250 μL of PBS, 5 × 108 BCG cells in 25 μL of PBS, 5 × 108 BCG (LMP2A) cells, 5 × 108 BCG (hGM-CSF) cells or 5 × 108 (BCG +pMV261) cells in 250 μL of PBS. Compared with the control group, *P < .05. Compared with the model group, **P < .01.
Analysis of the effect of rBCG on CD4 + T cell proliferation
CD4+ T lymphocyte proliferation in the tumor treatment groups was demonstrated by flow cytometric analysis and is shown in Figure 7, where the CD4+ T lymphocyte division index in the PBS group was very low, with a low split percentage (Figure 7 A). The division indices and split percentages of the BCG group, BCG+pMV261 group, BCG (LMP2A) group, BCG (hGM-CSF) group, and rBCG group are shown in Table 3. The results showed that the proliferation of CD4+ T cells in the rBCG group was significantly higher than that in the control group (P < .05).
Figure 7.
The proliferation of CD4+ T cells was detected by flow cytometry. %Divided (the percentage of divided cells) = Number of cells that have proliferated/Total number of cells before stimulation. Div. index (average number of cell divisions) = Total cell division times/Total number of cells before stimulation.
Table 3.
Analysis of the effect of rBCG on CD4 + T cell proliferation.（P < .01).
| Groups | Numbers | division indices | split percentages(%) |
|---|---|---|---|
| PBS | 5 | 0.038 ± 0.012 | 4.12 ± 0.913 |
| BCG | 5 | 0.046 ± 0.019 | 8.34 ± 0.982 |
| pMV261+ BCG | 5 | 0.058 ± 0.017 | 8.34 ± 0.859 |
| BCG(LMP2A) | 5 | 0.268 ± 0.065 | 26.8 ± 2.355 |
| BCG(hGM-CSF) | 5 | 0.67 ± 0.091 | 58 ± 4.017 |
| rBCG | 5 | 1.07 ± 0.114 | 68.7 ± 8.032** (*) |
Note: Six groups of C57BL/6 mice tumor model results.**Compared with the PBS control group (P ≤ 0.01), * Compared with the BCG control group, pMV261+ BCG control group (P ≤ 0.05).
The data represent the means ± SEM of at least four independent experiments.
Tumor tissue lymphocyte morphology
Mice immunized with PBS, BCG, BCG +pMV261, BCG (LMP2A), BCG (hGM-CSF), and rBCG were analyzed after H&E staining. rBCG-treated mice showed significant lymphocyte infiltration in local tumors, whereas the control PBS, BCG, and BCG+ pMV261 groups did not display obvious lymphocyte infiltration. Recombinant BCG exerted a significant effect on tumor cells, as shown in Figure 8 (arrow). BCG (LMP2A) and BCG (hGM-CSF) displayed lymphocyte infiltration to a certain degree, but it was weaker than that of the rBCG group (Table 4).
Figure 8.
Infiltration of lymphocytes in the rBCG treatment group. A. PBS. B. BCG. C. BCG + pMV261. D. BCG (LMP2A). E. BCG(hGM-CSF). F. rBCG. A comparison of the tumor cells in the rBCG group with those in the control group revealed that the necrotic area was larger and the area of lymphocyte infiltration was larger in the necrotic tissue; the BCG (LMP2A) and BCG (hGM-CSF) groups also contained some tumor tissue necrosis, but the area of necrotic tissue was smaller than that in the rBCG group. No significant difference was observed in the staining results of the BCG and BCG + pMV261 groups. The mice in the PBS group showed no tumor necrosis or lymphocytic infiltration.
Table 4.
Analyzation of lymphocyte infiltration in local tumors.
| Groups | Mean of lymphocyte infiltration cells/total cells (%) |
|---|---|
| PBS control | 1.42 ± 1.09 |
| BCG control | 9.73 ± 1.81 |
| pMV261+ BCG group | 9.38 ± 1.75 |
| BCG (LMP2A) | 21.96 ± 1.96 |
| BCG (hGM-CSF) | 24.91 ± 1.92 |
| rBCG therapy | 32.29 ± 2.83** (*) |
Note: **Compared with the PBS control group (P ≤ 0.01), * Compared with the BCG control group, pMV261+ BCG control group (P ≤ 0.05).Values represent the mean ± SEM of three independent experiments performed in triplicate.
Discussion
EBV is closely associated with the development of many tumors, including large-cell lymphomas. Vaccination for EBV can prevent infection and the development of these related diseases.14 Because of its ability to cause cancer, live attenuated vaccines and dead vaccines are not appropriate for preventing EBV infection. A subunit vaccine would be the best choice for use in humans.
Immunological methods have been widely used to prevent the occurrence of cancer.15 Subunit vaccination is an important form of immunoprophylaxis for the control of EBV infection. In this study, the EBV LMP2A and hGM-CSF genes were fused and inserted into the Escherichia coli-BCG shuttle vector pMV261. Then, the pMVGCA plasmids were transformed into BCG, and rBCG was subsequently expressed.
Initially, we constructed a recombinant adenovirus expression vector for the fusion gene. The recombinant adenovirus expression vector can express the fusion gene in animals and has preventive and therapeutic effects on EB virus-positive tumors in vivo. BCG can exist as intracellular bacteria in animals and may even be able to live for an extended period of time in vivo. BCG is a strong adjuvant in experimental animals and humans and can be used to regulate the ratio of Th1 and Th2 cells, induce humoral and cellular immunity, excite delayed hypersensitivity and stimulate T lymphocyte proliferation in vivo.16,17 BCG can also sensitize T lymphocytes to release cytokines and recruit macrophages to active sites of infection. The mitochondria, acid phosphatase, and ribosomes of activated macrophages increase significantly, which results in increased phagocytic ability; this in turn plays an important role in the inhibition of tumor cells.18 In this study, pMVGCA was successfully constructed. rBCG was able to produce the recombinant protein in vivo and in vitro and exerted a stronger antitumor effect than BCG, pMV261 + BCG and the PBS control. Moreover, ELISA, CTL activity, and Western blotting were used to analyze the function of rBCG.
GM-CSF is a key cytokine and immune system modulator and is responsible for the growth and differentiation of granulocytes and macrophages. In this regard, a supply of recombinant GM-CSF can enhance the ability of macrophages to phagocytose apoptotic cancer cells. However, delivery of this cytokine in vivo is associated with certain disadvantages, such as rapid depletion, poor stability and low targeting efficiency.19 In this study, an antibody response against hGM-CSF was induced in the mice that had received rBCG, which may have had a negative impact on the physiology of the immune response in those animals. However, we believe that the sustained and stable release of hGM-CSF can be improved through the secretion of rBCG. The hGM-CSF and LMP2A fusion gene (GCA) of EBV was successfully constructed for further exploration. The fusion gene GCA was constructed and inserted into pMV261, which was transformed into BCG. The results showed that the rBCG vaccine could induce a tumor-specific exclusion reaction and inhibit the growth of tumors. LMP2A induced a CTL response, while hGM-CSF effectively induced antitumor immunity, which could synergistically kill EBV-positive tumor cells. Lactate dehydrogenase releasing methods were used to assay the activity of CTLs. The effector cells were splenic lymphocytes. CTL induced in different experimental groups and the EBV-positive tumor cell killing rate(%) P < .01 compared with PBS or BCG alone. It showed that rBCG could induced a obvious CTL response. CD4+T cells not only play an important auxiliary role in CD8+T activation, but also can produce cytokines and chemokines to indirectly participate in anti-tumor immune effects. In addition, CD4+T cells can also directly kill tumor cells. In this experiment, CD4 + T cell expansion was assessed in-vitro after inoculation with tumor cells. This effect could protect animals from EBV-induced malignant transformation of tumor cells and effectively inhibit the growth of tumors in vivo. Finally, this process may result in the clearance of tumor cells.
The results of this study showed that BCG and pMV261 + BCG could inhibit EBV-positive tumor cells at an early stage, which may be related to the ability of BCG to activate cellular immunity and, to some extent, kill tumor cells.20 At the later stage of tumor growth, only the rBCG group exerted obvious inhibitory effects on tumor cells. At the same time, the results also suggested that BCG and BCG+ pMV261 alone can inhibit the division and growth of tumor cells through nonspecific immune responses at an early tumor stage. However, they cannot induce a specific immune response and thus have no significant effect on EBV-positive tumors. rBCG was superior to the BCG and pMV261 + BCG groups, which indicated that rBCG could induce a specific cellular immune response against EBV-positive tumor cells. The BCG (hGM-CSF) and BCG (LMP2A) groups were also significantly better than the BCG and pMV261+ BCG groups, but they were significantly inferior to rBCG. The mice treated with recombinant BCG exhibited obvious lymphocyte infiltration into the tumor tissue. The mice in the two control groups also showed slight lymphocyte infiltration, which may be due to the stimulation of the immune response by BCG itself. Other mechanisms test is still needed, pre-clinical experiments are effective and basically consistent with animal experiments, but further extensive clinical experiments are needed. This study established the foundation for the further study of rBCG and provided the basis for a clinical trial.
Methods
RT-PCR was used to clone the hGM-CSF and LMP2A cDNAs, and a polypeptide linker (Gly4Ser)3 was used to construct the fusion genes.20 Specific primers were designed for LMP2A, hGM-CSF and the fusion gene according to the open reading frame sequences of LMP2A and hGM-CSF.
The forward primer used for the hGM- CSF P1 sequence was 5′-GAGGATCCATGCACCCGCCCGCTCGCCCAG-3′. The sequence of the overlapping downstream primer P2 was 5′-GCTGCCGCCACCGCCGCTTCCGCCACCGCCGCTTCCACCGCCACCCTCCTGGACTG GCTCC CA-3′. The LMP2A overlapping upstream primer P3 sequence was 5′-GGTGGCGGTGGAAGCGGCG GTG GCGGAAGCGGCGGTGGCGGCAGCATGGGGTCCCTAGAAATGGTG-3′. The primer P4 sequence was 5′- GC GTCGACTACAGTGTTGCGATATGGGGT-3′.
The amplified product sizes were 1545 bp for LMP2A and 470 bp for hGM- CSF. A 1970 bp GCA fusion gene was subsequently generated (both LMP2A and hGM- CSF included a 45 bp complementary linker).
PCR amplification of the signal sequence of Ag85A
The signal sequence of Ag85A was amplified from Mycobacterium tuberculosis H37Rv genomic DNA by PCR. The primers used were as follows:
P1: 5′- GA GGATCCAGTCGGCCGCGGATTGCTTGAGAC-3′.
P2: 5ʹ- GCGAATTCGGACTTCAAGGTCCTACGCATGTTG-3
The EcoRI and BamHI restriction sites were introduced at the 5ʹ and 3ʹ ends of the primers, respectively.
Construction of the pMVA plasmid
The signal peptide gene Ag85A and the plasmid pMV261 (Figure 9) were digested using the restriction enzymes BamHI and EcoRI, respectively. The digested DNA fragments of the signal peptide gene and pMV261 were separated by gel electrophoresis. Then, the Ag85A gene and the digested fragment of pMV261 were ligated, and the pMVA plasmid was obtained. Competent E. coli DH5α cells were prepared, and the pMVA plasmid was transformed by heat shock at 42°C. The positive colonies were selected from a kanamycin-containing plate (containing 50 μg/ml kanamycin) and then cultured overnight in 5 ml LB liquid medium (containing 50 μg/ml kanamycin) at 37°C. The plasmids were purified from the cultured colonies using a TIANpure Mini Plasmid Kit (TIANGEN, Beijing, China). The extracted plasmid was digested, and the size was evaluated by gel electrophoresis. Sequencing was performed for further identification.
Figure 9.
The plasmid and the GCA fusion gene. A. The pMV261plasmid.The restriction endonuclease sites are shown in the pMV261 plasmid.The fused EBV LMP2A and hGM-CSF genes were amplified and inserted between the EcoRI and SalI restriction endonuclease sites of pMV261. B. The GCA fusion gene was generated by overlapping extension. The fusion genes (LMP2A-linker-hGM-CSF) were constructed using a polypeptide linker (Gly4Ser)3 with spliced overlap extensions. The polypeptide linker (Gly4Ser)3 was 15 amino acids long and encoded by a hydrophobic polypeptide DNA sequence. C. The sites of the Ag85A gene connected with the fusion gene GCA. The signal peptide gene Ag85A was amplified and inserted between the BamHI and EcoRI restriction endonuclease sites of pMV261.
Fusion of the GCA gene with the pMVA plasmid
BamHI and EcoRI were used to digest the pMVA plasmid and GCA, respectively. Then, the products were ligated at 16°C overnight and transformed into E. coli. Bacteria were cultured and selected from a kanamycin-containing plate. Plasmid extraction was performed and confirmed by double enzyme digestion. Gene sequencing was then performed for further identification (Figure 9).
Construction of recombinant BCG
BCG was cultured in M7H9 medium (BD, NJ, USA) at 37°C and shaken at 200 r/min. When the absorbance value of BCG reached 0.6 (OD600), BCG was incubated on ice for 2 hours. The culture was centrifuged at 4°C and 7200 g for 10 min to collect BCG cells. The BCG cells were then resuspended in 10% cold glycerol broth. This procedure was repeated 6 times, and the BCG cells were resuspended in a volume of 10% cold glycerol broth that was 30 times the initial pellet volume. The competent BCG cells were acquired and kept at 4°C.
Three micrograms of the pMVGCA plasmid was transformed into 200 μl of competent BCG cells by electrotransformation. The parameters for electroporation were as follows: 0.4 cm electroporation cuvette, capacitance 35 μF, voltage 3 KV, resistance 1000 Ω, and a reaction time of 15 ms. The transformed BCG cells were cultured for 16 hours at 37°C, and 150 μl of the culture was then inoculated on a kanamycin-containing plate with M7H10 solid medium (BD, NJ, USA) and incubated at 37°C. Positive colonies were selected and identified by anti-acid staining.
Western blotting
In M7H9 broth media (containing 50 μg/ml of kanamycin), rBCG was cultured with shaking (150 rpm) and incubated at 37°C. When the concentration of the rBCG cells reached an OD of 0.6, IPTG was added to induce protein expression. Then, the rBCG cells were cultured at 45°C. After 48 hours, rBCG cells were harvested and washed in PBS. The culture supernatant was analyzed by Western blotting with antibodies against GM-CSF or LMP2A (Sigma Chemical Co., Shanghai, China).
Antibody detection
Four-week-old, pathogen-free female C57BL/6J mice were provided by Beijing Vital River Co. (Beijing, China). Subcutaneous injection was used in every mouse. The mice were divided into 4 groups, each of which contained 10 mice. The mice in group 1 and group 2 were injected with 50 μl of a suspension at 1 × 108 and 1 × 107 rBCG cells/ml, respectively. The mice in group 3 and group 4 were injected with 50 μl of a suspension at 1 × 108 BCG cells/ml and 50 μl of sterile PBS, respectively. The mice were immunized twice a week for two weeks. Blood was obtained from the tail every week for 7 weeks after the initial immunization. The serum of each mouse was then obtained, and ELISA was used to measure the antibody concentrations. The antigens LMP2A and hGM-CSF were prepared at a concentration of 1 μg/ml. The reactions of the serially diluted mouse serum samples were then analyzed by ELISA according to the manufacturer’s protocol. Finally, the average values of the levels of LMP2A and hGM-CSF were analyzed and assessed.
CTL response in mice
Next, a solution of 3 × 108 recombinant BCG cells/100 μl was injected subcutaneously into 6-week-old mice. Mice injected with PBS or BCG alone served as controls. The mice were again immunized during the third and fifth weeks. After the seventh week, splenic lymphocytes were obtained from the mice. The Cyto Tox 96 Non-Radioactive Cytotoxicity Assay Kit (Invitrogen, Carlsbad, CA, USA) was used to determine the rate of CTL-associated death of EBV-positive nasopharyngeal carcinoma cells (NPRC18, preserved in our laboratory) using a previously published equation [14].
Detection of macrophage phagocytosis
Thirty minutes before the mice were sacrificed, a 1% CRBC (chicken red blood cell) suspension was injected into the abdominal cavity, and the abdomen was gently rubbed. The mouse’s peritoneal fluid was collected and smeared on the slide after the mice were sacrificed. Wright’s stain was used after natural air drying, and 100 macrophages were randomly observed using an oil microscope. Percentage of phagocytosis = (number of macrophages phagocytizing CRBC/100) x100%; phagocytic index = number of CRBCs engulfed by phagocytic cells/100.
Immunoprophylaxis experiments
Thirty female C57BL/6J mice were randomly divided into 6 groups. In the PBS (pH 7.4) group, each mouse was injected with 200 μl of PBS. In the BCG group, each mouse was injected with 200 μl of the BCG suspension (2.5 mg of BCG). In the pMV261+ BCG (empty vector BCG) group, each mouse was injected with 200 μl of the (pMV261+ BCG) suspension (pMV261 + 2.5 mg BCG). In the BCG (hGM-CSF) group, each mouse was injected with 200 μl of the BCG (hGM-CSF) suspension (2.5 mg of BCG that expresses hGM-CSF). In the BCG (LMP2A) group, each mouse was injected with 200 μl of the BCG (LMP2A) suspension (2.5 mg of BCG that expresses LMP2A). In the rBCG group, each mouse was injected with 200 μl of the rBCG suspension (2.5 mg of rBCG, with approximately 105/ml BCG cells). The mice were injected in the back of the neck via a subcutaneous multipoint injection. Three consecutive immunizations were performed, each separated by 7 days. On the 7th day after the third immunization, NPRC18 cells (2 × 108 cells/mouse) were inoculated into the left side of the mouse’s hind leg. The tumor size was measured every 3 days, and the tumor volume was calculated. After 4 weeks, which allowed the tumor to develop for 28 days, the mice were sacrificed, and the blood surrounding the tumors was removed by washing. The weight and volume of the tumors were measured and calculated.
Measurement of mouse tumor immunotherapy
NPRC18 cells were cultured in DMEM culture medium and centrifuged at 2000 g for 3 min. The collected cells were washed with PBS and counted under a microscope. The cell concentration was adjusted to 1 × 108 cells/ml with DMEM culture medium.
The cells were inoculated subcutaneously into twenty C57BL/6J female mice (100 μl/mouse). Ten days after inoculation, experimental mice with growing tumors were randomly divided into four groups. In each group, five experimental animals were injected with 5 × 108 rBCG cells in 250 μl of PBS. Mice in the control groups were injected with 5 × 108 (BCG + pMV261) cells in 250 μl of PBS, 5 × 108 BCG (hGM-CSF) cells in 250 μl of PBS, 5 × 108 BCG (LMP2A) cells in 250 μl of PBS, 5 × 108 BCG cells in 250 μl of PBS or 250 µl of PBS. The mice were injected again according to the same strategy seven days after the first immunization. The mice were observed 3 times a week, and their condition, weight, diet and coat color were monitored closely. All mice were sacrificed after 70 days. The tumors were harvested, and tumor weights were measured and calculated.
Flow cytometry
At the end of the tumor immunotherapy experiment, tumors were carefully removed from the mice in each group. Then, the tumors were lysed in 0.2% protease (37°C), and the cells were gently mixed every 3 min using a pipette; medium (90% RPMI 1640 + 10% FBS) (Gibco, CA, USA) was added to prevent cell death. The tumor tissue was reconstituted into a new protease solution, and this procedure was repeated 4 times. The cells were centrifuged (4,000 g), and the precipitated cells were resuspended in PBS (2 ml, pH 7.4). Then, the resuspended cells were filtered through a 200-mesh strainer. Filtered cells were collected by centrifugation, and 150 µl (3 µg/ml) of CD4+ cells (FITC, rabbit anti-rat, Boster, Wuhan, China) were incubated with the tumor cells for 1 hour at 4 °C. The cells were then washed 3 times with 1 ml of PBS. The tumor cells were resuspended in 85 µl of PBS, and flow cytometry was used to isolate and select CD4+ T cells. Next, CD4+ T cells were incubated with an anti-mouse CD3 antibody (5 g/ml) (eBioscience, CA, USA) and an anti-mouse CD28 antibody (3 g/ml) (eBioscience, CA, USA) at 4 °C for 12 hours. After washing in PBS, CD4+ T cells were cultured in culture medium (90% RPMI 1640 + 10% FBS + IL-2 (50 U/ml) (PeproTech, NJ, USA)) and CD4+ T cells were marked with eFluor 670 (10 µM, eBioscience, CA, USA). The labeled cells were counted and then adjusted to 1 × 106 cells/ml with medium; the EB-positive tumor cells (NPRC18) were also adjusted to 1 × 106 cells/ml with medium. CD4+ T cells were then mixed with inactivated virus-positive tumor cells at a ratio of 1:1 and cultured in a 24-well culture plate, with 1 ml of medium in each well. The cells were cultured for 72 hours, at which point they were collected, washed with PBS and detected by flow cytometry; the proliferation of eFluor 670 cells was also analyzed.
Observation of morphology
Tumor tissue from the rBCG mice was stained with H&E to observe lymphocyte infiltration into the tumor tissues of the immunized mice. The tissue was fixed in 4% paraformaldehyde, dehydrated in ethanol, made cleared in xylene, embedded in paraffin, and sectioned (the slice thickness was approximately 5 µm) in a 37°C dry box. Sections were then deparaffinized in xylene for 20 min and immersed in hematoxylin dye solution for 10 min after ethanol recovery. The cytoplasm was destained by hydrochloric acid in alcohol for 20 s, and 1% ammonia was used to increase the intensity of the blue color (2 min). The tissue was then dehydrated in graded ethanol solutions (65%, 75%, 85%, and 95% ethanol for 2 min). Then, the cells were incubated in 95% alcohol-eosin for 5 min. Finally, the tissue was clarified in xylene, and coverslips were used to seal and observe the tissue.
Statistical analysis
The Satterthwaite approximate t-test (SPSS 11.0) was used to confirm that the difference in tumor weight between the rBCG- and PBS-treated mice was statistically significant (t = 5.49, P = .0018, P < .01). The difference in tumor weight between the rBCG and BCG (pMV261+ BCG) control groups was also statistically significant (t = 5.87, P = .018, P < .05).
Funding Statement
This study was funded by the NSFC cultivation project of Jining Medical University (2016), the Supporting Fund for Teachers’ Research of Jining Medical University (2017), the Growth Program of Young Teachers in Shandong Province (2017), the Natural Science Foundation of Shandong Province [ZR2012HM037], the Shandong Medical and Health Technology Development Plan Project of Shandong Province [2017WS339], the Shandong Key Research and Development Plan project [2018GCF118137], the Science and Technology Project of Colleges in Shangdong Province [J12LK56, J17KB085], and the National Natural Science Foundation of China [81501018, 31500056].
Acknowledgments
The authors thank Hui Wang, Shuang Wang, and Yuanyuan Yang for their excellent technical assistance.
Authors’ contributions
Qingjie Xue, Ting Chen, Shigen Li designed and conceived the study. Ang Liu, Longyu Zhao, Xiuzhen Li and Yunqing Li performed the experiments. Xiuzhen Li integrated the data. Ying-chun Yan wrote the manuscript. All authors read and approved the final manuscript. All authors have been involved in revising the manuscript critically.
Abbreviations
- BCG
Bacillus Chalmette-Guérin
- GM-CSF
granulocyte/macrophage colony-stimulating factor
- rBCG
recombinant BCG
- GCA
GM-CSF and LMP2A fusion gene
Animal rights statement
All procedures performed in studies involving mice were in accordance with the ethical standards of the institutional and national research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards.
Consent for publication
All authors declare that they consent to publication of the research.
Disclosure of potential conflicts of interest
The authors declare that they have no conflicts of interest.
References
- 1.Long HM, Parsonage G, Fox CP, Lee SP.. Immunotherapy for Epstein-Barr virus-associated malignancies. Drug News Perspect. 2010;23(4):221–28. doi: 10.1358/dnp.2010.23.4.1439500. PMID: 20520851. [DOI] [PubMed] [Google Scholar]
- 2.Chen F, Liu C, Lindvall C, Xu D, Ernberg I. Epstein-Barr virus latent membrane 2A (LMP2A) down-regulates telomerase reverse transcriptase (hTERT) in epithelial cell lines. Int J Cancer. 2005;113:284–89. doi: 10.1002/ijc.20594. PMID:15389515. [DOI] [PubMed] [Google Scholar]
- 3.Dong Z, Xu L, Yang J, He Y, She Q, Wang J, Zhang Z, Feng X, Li D, Yang C. Primary application of PPE68 of mycobacterium tuberculosis. Hum Immunol. 2014;75(5):428–32. doi: 10.1016/j.humimm. PMID:24530747. [DOI] [PubMed] [Google Scholar]
- 4.Paterson AH, Willans DJ, Jerry LM, Hanson J, McPherson TA. Adjuvant BCG immunotherapy for malignant melanoma. Can Med Assoc J. 1984;131(7):744–48. PMID:6383591. [PMC free article] [PubMed] [Google Scholar]
- 5.Gunvén P, Klein G, Ziegler JL, Magrath IT, Olweny CL, Henle W, Henle G, Svedmyr A, Demissie A. Epstein-Barr virus-associated and other antiviral antibodies during intense BCG administration to patients with Burkitt’s lymphoma in remission. J Natl Cancer Inst. 1978;60:31–37. doi: 10.1093/jnci/60.1.31. PMID:203706. [DOI] [PubMed] [Google Scholar]
- 6.Sinn HW, Elzey BD, Jensen RJ, Zhao X, Zhao W, Ratliff TL. The fibronectin attachment protein of bacillus Calmette-Guerin (BCG) mediates antitumor activity. Cancer Immunol Immunother. 2008;57:573–79. doi: 10.1007/s00262-007-0397-x. PMID:17786441. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Rosevear HM, Lightfoot AJ, O’Donnell MA, Griffith TS. The role of neutrophils and TNF-related apoptosis-inducing ligand (TRAIL) in bacillus Calmette-Guérin (BCG) immunotherapy for urothelial carcinoma of the bladder. Cancer Metastasis Rev. 2009;28:345–53. doi: 10.1007/s10555-009-9195-6. PMID:19967427. [DOI] [PubMed] [Google Scholar]
- 8.Shannon MF, Himes SR, Coles LS. GM-CSF and IL-2 share common control mechanisms in response to costimulatory signals in T cells. J Leukoc Biol. 1995;57:767–73. doi: 10.1002/jlb.57.5.767. PMID:7759956. [DOI] [PubMed] [Google Scholar]
- 9.Cui H, Chang XH, Liu B. The antitumor immune responses induced by a fusion protein of ovarian carcinoma anti idiotypic antibody 6BllScFv and murine GM-CSF in BALB/c mice. Gynecol Cancer. 2004;14:234–41. doi: 10.1111/j.1048-891X.2004.014206.x. PMID:15086722. [DOI] [PubMed] [Google Scholar]
- 10.Liu G, Yao K, Wang B, Zhou F, Chen Y, Li L, Chi J, Peng G. Reconstituted complexes of mycobacterial HSP70 and EBV LMP2A-derived peptides elicit peptide-specific cytotoxic T lymphocyte responses and anti-tumor immunity. Vaccine. 2011;29(43):7414–23. doi: 10.1016/j.vaccine.2011.07.063. PMID:21807054. [DOI] [PubMed] [Google Scholar]
- 11.Redchenko IV, Rickinson AB. Accessing Epstein-Barr virus-specific T-cell memory with peptide-loaded dendritic cells. J Virol. 1999;73:334–42. PMID:9847337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Portis T, Longnecker R. Epstein-Barr virus LMP2A interferes with global transcription factor regulation when expressed during B-lymphocyte development. J Virol. 2003;77:105–14. doi: 10.1128/jvi.77.1.105-114.2003. PMID:12477815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Portis T, Longnecker R. Epstein-Barr virus (EBV) LMP2A alters normal transcriptional regulation following B-cell receptor activation. Virol. 2004;318:524–33. doi: 10.1128/jvi.77.1.105-114.2003. PMID:12477815. [DOI] [PubMed] [Google Scholar]
- 14.Hutajulu SH, Hoebe EK, Verkuijlen SA, Fachiroh J, Hariwijanto B, Haryana SM, Stevens SJ, Greijer AE, Middeldorp JM. Conserved mutation of Epstein-Barr virus-encoded BamHI-A rightward frame-1 (BARF1) gene in indonesian nasopharyngeal carcinoma. Infect Agents Cancer. 2010;5:16. doi: 10.1186/1750-9378-5-16. PMID:20849661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Lutzky VP, Corban M, Heslop L, Morrison LE, Crooks P, Hall DF, Coman WB, Thomson SA, Moss DJ. Novel approach to the formulation of an Epstein-Barr virus antigen-based nasopharyngeal carcinoma vaccine. J Virol. 2010;84:407–17. doi: 10.1128/JVI.01303-09. PMID:19846527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Ishii K, Kurita-Taniguchi M, Aoki M, Kimura T, Kashiwazaki Y, Matsumoto M, Seya T. Gene-inducing program of human dendritic cells in response to BCG cell-wall skeleton (CWS), which reflects adjuvancy required for tumor immunotherapy. Immunol Lett. 2005;98:280–90. [DOI] [PubMed] [Google Scholar]
- 17.Sixsmith JD, Panas MW, Lee S, Gillard GO, White K, Lifton MA, Balachandran H, Mach L, Miller JP, Lavine C, et al. Recombinant Mycobacterium bovis bacillus Calmette-Guérin vectors prime for strong cellular responses to simian immunodeficiency virus gag in rhesus macaques. Clin Vaccine Immunol. 2014;21:1385–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wang J, Qie Y, Zhu B, Zhang H, Xu Y, Wang Q, Chen J, Liu W, Wang H. Evaluation of a recombinant BCG expressing antigen Ag85B and PPE protein Rv3425 from DNA segment RD11 of Mycobacterium tuberculosis in C57BL/6 mice. Med Microbiol Immunol. 2009;198:5–11. [DOI] [PubMed] [Google Scholar]
- 19.Vanitha S, Chaubey N, Ghosh SS, Sanpui P. Recombinant human granulocyte macrophage colony stimulating factor (hGM-CSF): possibility of nanoparticle –mediated delivery in cancer immunotherapy. Bioengineered. 2016;26:1–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Xue Q, Li X, Yang C, Ji B, Li Y, Yan Y, Yang X, Wang C, Chen T. Efficacy of recombinant adenovirus expressing a fusion gene from GM-CSF and Epstein-Barr virus LMP2A in a mouse tumor model. Hum Vaccin Immunother. 2017;13(10):2260–68. doi: 10.1080/21645515.2017.1356521. PMID:28892414. [DOI] [PMC free article] [PubMed] [Google Scholar]