A novel assay for exosomal and cell-free miRNA isolation and quantification

ABSTRACT

The use of disease-specific signatures of microRNAs (miRNAs) in exosomes has become promising for clinical applications, either as biomarkers or direct therapeutic targets. However, a new approach for exosome enrichment and quantification of miRNAs is urgently needed for its clinical application, since the commercial techniques have shortcomings in quantity and quality. To overcome these deficiencies, we developed a new method for purification of exosomes with subsequent miRNA extraction, followed by quantitative reverse transcription polymerase chain reaction (RT-qPCR), and compared our assays with commercial techniques. For the establishment of these methods, numerous reagents, parameters, and combinations thereof were examined. Our new technique for exosome extraction is based on a mannuronate-guluronate polymer (MGP) which avoids co-precipitating plasma proteins. Quality, concentration and biological activity of the isolated exosomes were examined by Western blot, Nanoparticle Tracking Analysis (NTA), and confocal microscopy. A combination of chaotropic and non-chaotropic salts was used to extract miRNAs from plasma, serum, and exosomes, allowing the exclusion of hazardous components, such as phenol/chloroform. The performance of the miRNAs extraction was verified by RT-qPCR. The chemistry and TaqMan probe were also optimized for RT-qPCR. Sensitivity, efficiency, and linearity of RT-qPCR were tested on serial dilutions of synthetic miR-16 and miR-142. Our established procedure covers all steps of miRNA analyses, and measures the levels of either cell-free and exosomal miRNAs in plasma, serum and other body fluids with high performance.

Introduction

Exosomes are small heterogeneous membrane vesicles in size of about 100 nm and of endosomal origin [1]. They are actively released by all cell types and can be detected in all body fluids. Although at first, they were considered as cellular waste, nowadays it is known that cells release exosomes to transfer various molecules to recipient cells [2]. Thus, exosomes regulate an important event, namely the intercellular communication. Circulating exosomes can be up-taken by recipient cells at close or distant sites. In the host cell, they release their bioactive cargo, and consequently, influence the behaviour of the cell [3,4]. In this regard, they can spread their information throughout the body. Elevated levels of exosomes have been detected in various benign and malignant diseases. Since they are associated with tumour progression and metastasis, it is assumed that they propagate cancer by transferring their oncogenic cargo from cell to cell [5]. To date, various methods have been described to extract exosomes: Differential ultracentrifugation has been the most widely used laboratory technique. Other methods are ultrafiltration, size exclusion chromatography (SEC) and polyethylene glycol (PEG)-based precipitating agents, as well as affinity capture methods that use numerous exosomal surface proteins, such as tetraspanins (CD9, CD63, CD81, CD82) and heat-shock proteins (Hsp60, Hsp70, and Hsp90), as target molecules [6].

Apart from DNA, mRNA, lipid, and proteins, exosomes also contain microRNAs (miRNAs) which they transport from cell to cell [7]. It seems that packing of miRNAs into the exosomes is a selective process [8] since some miRNAs are preferentially packaged into exosomes to specifically influence the geno- and phenotype of the recipient cell, whereas other miRNAs are less enriched in exosomes [9]. In the recipient cell, these small non-coding RNAs (ncRNAs) with a length of approximately 24 nucleotides are then functional [10]. Their main action implicates the post-transcriptional inhibition of translation of their target mRNAs into protein. In this process, they bind to complementary sequences in the 3ʹ untranslated-region (3ʹUTR) of their target mRNAs [11], thereby modulating gene expression and cellular signal pathways [12]. MiRNAs are challenging molecules to quantify, mainly because of their very short length, their GC content, similarities in sequences among miRNAs of the same family and the low abundance in the body fluids and exosomes [13]. Moreover, miRNAs only represent a small part of total RNA, and exist in three forms: the short, linear mature miRNA, the hairpin pre-miRNA and the long pri-miRNA [14]. Currently, several techniques are used for quantifying mature miRNAs. For example, real-time PCR, the golden standard technique and digital droplet PCR (ddPCR) are applied for their quantification. Assays allowing the simultaneous quantification of multiple miRNAs are also available and include PCR-based microfluidic array cards, e.g. the Applied Biosystems TaqMan Advanced MicroRNA Human A and B Cards or the Qiagen miScript miRNA PCR Array. They offer the detection of more than 700 miRNAs and start from only 100 ng of input RNA [6,15].

In the present study, we developed a polymer-based method for the enrichment of exosomes with a subsequent extraction of miRNAs and amplification of miR-16 and miR-142 from exosomes, plasma and serum, and compared our method with commercial techniques. Our newly established method is also qualified for other miRNAs. We, therefore, developed new methods for exosome purification, miRNA extraction and exosomal miRNA quantification to create an overall package in which the individual methods are coordinated and independent of the sample used. Further reasons are as follows: 1^st, The most commonly used methods for these experiments are usually time-consuming and expensive. 2^nd, The main disadvantage of the different exosome isolation approaches is the co-precipitation of proteins of non-exosomal origin. 3^rd, The commercial miRNA isolation kits usually apply hazardous chemicals. And 4^th, The commercial stem-loop primer-based PCR assays produce an early rise of signal in no-template-controls, and dependent on the miRNA analysed, their efficiency is often out of accepted ranges. Here, we demonstrate that we could overcome these shortcomings with our newly established methods.

Results

Workflow of the project

Following preparation of plasma and serum and verification of haemolysis, real-time PCR for miRNA quantification was optimized. For this purpose, synthetic miR-16 and miR-142 target sequences were amplified with our newly generated TaqMan probe and master mix. Ten-fold serial dilutions of these sequences were used to determine method acceptance and performance parameters according to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines [16]. Then, a method for isolation of exosomes was developed and tested in diverse sources, such as plasma, serum, urine, cell culture supernatant and a sample of commercially available lyophilized exosome standards. Method efficiency, specificity, and integrity of isolated exosomes were verified by Western blot, Nanoparticle Tracking Analysis (NTA), confocal microscopy and SEC. A method for miRNA extraction from diverse sources was also developed. Quality and quantity of the extracted miRNAs were checked by a bioanalyzer, and their levels were verified by our newly established real-time PCR assay. Finally, the results obtained from our newly developed methods for exosome extraction, miRNA isolation, and RT-qPCR quantification were compared with those derived from commercial methods that are commonly used in research studies (Fig. 1).

Figure 1.

Workflow of the development and validation of assays for miRNA quantification, exosome extraction and miRNA isolation.

Establishment of a modified RT-qPCR for miRNA quantification

Based on the method established by Chen et al. from Applied Biosystems [17], we developed a new miRNA quantification procedure comprising reverse transcription and real-time PCR (RT-qPCR). For this purpose, we carried out several modifications. First, instead of using the chemicals from Applied Biosystems, we used the chemicals from Analytik Jena which improved the reaction performance. Then, we excluded the RNase inhibitor, which caused a rise in the signal of the negative control (without template). This can be explained by the contamination of the RNase inhibitor with nucleic acids originating from Escherichia coli used for the production of this enzyme. As observed by Aryani et al. [18] and our laboratory, miRNAs are resistant to RNase activity in contrast to other RNAs, therefore, the exclusion of the RNase inhibitor is rather advantageous than disadvantageous. Additionally, we used the innuTaq HOT-A DNA Polymerase (Analytik Jena) for our new method. This Hot-Start Taq polymerase is very quickly activated, within 2 min, and extremely efficient. Table 1 summarizes and compares our modifications with the protocol of Applied Biosystems. Moreover, we changed the sequences and labelling of the primers and probes. For miR-16 assay, we used the same sequences of (stem-loop and PCR) primers as published by Chen et al. [17], but we extended the TaqMan probe by adding several nucleotides at its 5´end and only labelled it with Black Hole Quencher 1 (BHQ-1) at its 3ʹ end, instead of labelling it with both BHQ-1 and Minor Groove Binder (MGB) (Table 2, Figure S1A). These modifications increased the probe melting temperature maintaining the reaction specificity. A convenient side effect is that the probe with BHQ-1 alone is approximately 15-times cheaper than the probe with BHQ-1 plus MGB. The core (stem and loop) sequence of the stem-loop primer is the same for miR-16 and miR-142. For the miR-142 assay, we newly designed the 3´sticky end of the stem-loop primer which is specific for miRNA binding to create complementarity to the miR-142 sequence. The TaqMan probe was also only labelled with BHQ-1. The sequence of the probe and PCR forward primers were newly designed, too, as described in Table 2 and Figure S1B.

Table 1.

Comparison between the parameters of miRNA amplification developed by Chen et al. from Applied Biosystems (reference method) and our optimized miRNA amplification method (modified method).

		Amount/concentration per reaction
	Parameter	Reference method by Chen et al. from Applied Biosystems	Modified method
Reverse transcription (7.5 µl)	miRNA	2.5 µl	2.5 µl
	Primer	50 nM stem-loop	250 nM stem-loop
	Buffer	1x RT buffer	1x RT-Buffer plus 9.35 mM DTT
	dNTPs	0.25 mM	0.25 mM
	Reverse transcriptase	25 U MultiScribe reverse transcriptase	9.375 U RT-Enzyme
	RNase inhibitor	1.9 U RNase inhibitor	excluded
	Procedure conditions	16°C for 30 min 42°C for 30 min 85°C for 5 min	16°C for 30 min 42°C for 30 min 95°C for 5 min
Real-time PCR (10 µl)	Template	0.67 µl RT product	0.67 µl RT product
	Master mix	1x TaqMan Universal PCR Master Mix	1x SpeedAmp Optimization Buffer No. 5, pH 9, 0.25 mM each inNucleotide Mix, 0.75 U innuTaq HOT-A DNA Polymerase
	Probe	0.2 µM TaqMan FAM-BHQ-1-MGB probe	0.17 µM TagMan FAM-BHQ1 probe
	Forward primer	1.5 µM	0.33 µM
	Reverse primer	0.7 µM	0.17 µM
	Real-time PCR	95°C for 10 min 40 cycles: 95°C for 15 s, 60°C for 1 min	95°C for 2 min 40 cycles: 95°C for 5 s, 64°C for 40 s

Table 2.

Sequences of the primers and probes of our modified RT-qPCR.

Assay	Primer/Probe	Sequence
miR-16	Reverse transcription stem loop primer	5ʹ-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACC GCC AA-3’
	PCR forward primer	5ʹ-CGC GCT AGC AGC ACG TAA AT-3’
	PCR reverse primer	5‘-GTG CAG GGT CCG AGG T-3‘
	PCR TaqMan probe	5ʹ-FAM-TCG CAC TGG ATA CGA CCG CCA ATA T -BHQ1-3’
miR-142	Reverse transcription stem loop primer	5ʹ-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACT CCA TA-3’
	PCR forward primer	5ʹ-GCC GCT GTA GTG TTT CCT ACT-3’
	PCR reverse primer	5‘-GTG CAG GGT CCG AGG T-3‘
	PCR TaqMan probe	5ʹ-FAM-CG CAC TGG ATA CGA CTC CAT AAA G -BHQ1-3’

The sequences (black) were published by Chen et al. (Applied Biosystems). Our modifications are in blue. The sequences of the stem and loop of the stem-loop primer are the same for miR-16 and miR-142 and were published by Chen et. al. Only the sequences of 3ʹ sticky ends differ for both miRNAs. The sequences of miR-16 and miR-142 probes were extended at their 5ʹ ends (blue) while the miR-142 probe sequence was also modified at its 3ʹ end (blue) as shown in Figure S1. The sequence of miR-16 forward primer was published by Chen et al. while the sequence of miR-142 forward primer was changed to create the complementarity to the miR-142 cDNA.

Verification of our optimized miRNA quantification technique

To determine the sensitivity and efficiency of our optimized real-time PCR, a 10-fold dilution series of synthetic miR-16 and miR-142 target sequences was prepared, reversed transcribed and amplified using the protocols, chemicals, primers, and probes as described in our optimized assay (Tables 1 and 2). Its sensitivity for miRNA quantification was tested by the limit of quantification (LOQ). LOQ is defined as the lowest amount of the target in a sample that can be quantitatively determined [19]. LOQ for both, miR-16 and miR-142 targets, was 6.7 × 10⁻⁸ fM. Both amplified targets showed a dynamic range of over 7 orders of magnitude, and a correlation coefficient of the standard curve (R²) of 0.999 (Fig. 2) which was higher than the minimal value of 0.980, as suggested by Broeders et al. [20], and near the optimal R² value of 1.000. The PCR efficiency (E) is calculated by the formula E = 100*(10^^−1/slope-1), in which the slope range should be between −3.1 and −3.6. Ideally, the efficiency should be 100% corresponding to a Cq difference between two dilution steps (slope) of −3.3 for a 10-fold target dilution. A lower efficiency means that not all molecules are doubled in a cycle, whereas a higher efficiency points to the formation of unspecific products or primer-dimers. Generally, an efficiency between 90 and 110% is accepted [20]. The efficiency of our optimized real-time PCR was between 97.1% and 95.5% for miR-16 and miR-142, respectively (Fig. 2).

Figure 2.

Representative amplifications of miR-16 and miR-142.

Amplification curves of a 10-fold serial dilution of synthetic miR-16 and miR-142 target sequences which ranged from 6.7 × 10⁻⁸ to 6.7 × 10⁻¹ fM (black to blue curves) and were amplified with our designed primers/probe sets shown in Table 1. Pink curves, negative control.

Establishment of a new exosome isolation technique

For the creation of a new exosome extraction method, we used the Mannuronate-Guluronate Polymer (MGP) because of its particular characteristics. It is composed of ß-D-mannuronate (M) and α-L-guluronate (G), forming homopolymeric MM- and GG-blocks, or heteropolymeric MG- and GM-blocks. GG-blocks contain a special niche to incorporate calcium ions creating a hydrogel. We utilized this phenomenon to capture exosomes into the MGP structure. Explicitly, MGP was added to plasma, serum, urine, cell culture supernatant and lyophilized exosome standards, and then, calcium ions were added to the diverse mixtures. The reactions led to zipping of MGP sequences in the area of GG-blocks by calcium ions, and entrapping of exosomes by MG- and GM-blocks.

As shown in Table 3, we examined and compared numerous reagents and parameters as well as combinations thereof to develop the most promising combination for an efficient exosome enrichment method (marked with 3 stars in Table 3). For these investigations, we quantified miR-16 and miR-142 in exosomes derived from plasma using our optimized real-time PCR assay (Tables 1 and 2). We partly verified these analyses for serum which displayed similar Cq values (data not shown). Based on the lowest Cq data, the exosome extraction protocol was established as follows: First, 30 µl MGP is added to 500 µl of plasma or another cell-free fluid, followed by addition of 150 µl 1 M calcium chloride solution. After 10 min incubation at room temperature to allow creating the complex between exosomes and MGP, the reaction tube is centrifuged at 16,000 g for 30 min. The supernatant is removed. The pellet containing the extracted exosomes is centrifuged at 16,000 g for 10 s to collect and remove the residuals of the supernatant.

Table 3.

Reagents and parameters tested for enrichment of exosomes.

Tested reagents and parameters*	Variations	Mean real-time data of miR-16 as Cq difference(CD) between the variants**
Type of enrichment reagent 1	MGP 1***	0
	MGP 2	1.48
	MGP 3	1.48
	MGP 4	1.60
	MGP 5	0.56
Volume of enrichment reagent 1	20 µl	0.25
	30 µl***	0
	40 µl	0.83
	50 µl	0.52
	60 µl	3.07
	90 µl	8.35
	100 µl	4.02
Incubation time using enrichment reagent 1	None***	0
	1 min	−0.03****
	10 min	0.20
	30 min	0.10
	60 min	1.13
Incubation temperature using enrichment reagent 1	4°C	0.23
	Room temperature***	0
	50°C	7.94
Incubation with enrichment reagent 1 on a Thermoshaker	No shaking***	0
	400 rpm	0.69
Type of enrichment reagent 2	Calcium chloride***	0
	Calcium acetate	0.51
	Ammonium chloride	1.64
	Zinc chloride	3.10
	Manganese (II) chloride	2.11
Volume of enrichment reagent 2	100 µl	0.11
	150 µl***	0
	300 µl	0.89
	450 µl	1.19
Incubation time using enrichment reagent 2	1 min	0.80
	3 min	0.45
	10 min***	0
	30 min	0.44
	60 min	0.62
Incubation temperature using enrichment reagent 2	4°C	0.59
	Room temperature***	0
	50°C	0.04*****
Incubation with enrichment reagent 2 on a Thermoshaker	No shaking***	0
	400 rpm	0.74
Time and speed of centrifugation	1 min, 8,000 g	1.31
	1 min, 10,000 g	1.57
	1 min, 16,000 g	1.37
	2 min, 5,000 g	1.79
	3 min 10,000 g	1.59
	3 min, 16,000 g	1.25
	10 min, 500 g	2.33
	15 min, 5,000 g	0.99
	15 min 16,000 g	0.29
	30 min, 3,000 g	1.25
	30 min 5,000 g	0.44
	30 min, 10,000 g	0.36
	30 min 16,000 g***	0
	60 min, 16,000 g	−0.13*****
Removal of residuals of supernatant	Washing with 1 ml RNase-free H2O	3.50
	No washing	0.53
	Spin down for 10 s***	0
Dissolving of the pellet for direct downstream applications	D1 (ddH2O)	n.d.
	D2 (PBS)	n.d.
	D3 (RIPA)	n.d.
	D4 (50 mM tri-natriumcitrat)	n.d.
	D5 (100 mM tri-natriumcitrat)	n.d.
	D6 (150 mM tri-natriumcitrat)	n.d.
	D7 (200 mM tri-natriumcitrat)	n.d.
	D8 (50 mM EDTA)***	n.d.
	D9 (100 mM EDTA)	n.d.
	D10 (500 mM EDTA)	n.d.
	D11 (1 M EDTA)	n.d.
	D12 (PBS + 50 mM EDTA)	n.d.

*For the development of an improved exosome enrichment method, a plasma volume of 500 µl was used. **CD values were calculated from the formula: C_q(x)-C_q(y), in which x is any variant tested and y is the best variant within the subgroup of the tested reagents and parameters (single boxes). The difference shows the magnitude of the aberrance of a variant from the best variant. The lower the CD value is the better is the quantity and quality of the PCR product. Hence, 0 means the best value. ***The selected best variations of reagents and parameters are in bold. Variations of results similar to the best variation that ****showed a minimal data improvement but were not confirmed by a further intensification of the parameter, or *****significantly increased the experiment duration/complexity, were not chosen for further testing. n.d., not determinable.

Verification of the new exosome isolation technique

To test if our newly established MGP-based method isolates exosomes from different sources, such as blood plasma, serum, and urine, Western blot was carried out using a monoclonal antibody specific for the exosomal marker CD63. As shown, the molecular weight of the prominent bands containing the exosomal CD63 protein, isolated from 500 µl plasma and serum, corresponds to that of the exosome standard used as a positive control, whereas, as expected, the negative control (MGP enrichment from exosome-free PBS) does not exhibit any band (Fig. 3A). The molecular weight of these bands observed in both plasma and serum samples and even in the positive control is at 43 kDa which does not conform with the predicted weight of CD63 (63 kDa). However, the molecular weight of CD63 varies between 25 and 65 kDa, caused by numerous post-translational modifications (e.g. glycosylation patterns), and cleavages, as well as relative charges and different experimental conditions. In contrast, the use of 10 ml urine shows a smear, suggesting the particular conditions in urine with its protease activity. Thus, urine seems to be not qualified for the extraction of exosomes (Fig. 3A).

Figure 3.

Verification of isolation and biological activity of exosomes.

Western Blot analysis of enriched exosomes using an antibody specific for the exosome marker CD63. Molecular size protein marker, M; positive control, pos; plasma, P; serum, S; urine, U; negative control, neg. (A). Enriched exosomes were visualized by confocal microscopy. Red points indicate exosomes, blue arrows point to exosome agglomerates, and scale bar corresponds to 10 µm (B). Exosomes isolated from 2 ml plasma and serum. The membrane of MDA-MB-468 cells was stained in green, while exosomes were stained in red. Accumulation of exosomes in the cells and different phases of the cell cycle can be seen. The lower scale bar corresponds to 10 µm (C).

To visualize the extracted exosomes by confocal microscopy, they were stained with Exo-Red. Fig. 3B shows individual exosomes and exosome agglomerates as red dots. To avoid such agglomerates in the following experiments, the exosome/MGP pellet was dissolved in 50 mM EDTA instead of PBS which in combination with MGP promotes such a formation. To examine their biological activity, the exosomes extracted from plasma and serum were also stained with the red fluorescence dye PKH26 and added to the breast cancer cell line MDA-MB-468 stained with a green fluorescent antibody specific for the epithelial membrane marker EpCAM. Fig. 3C shows that nearly all exosomes accumulate in MDA-MB-468 cells.

The size distribution of exosomes and their concentration were determined by NTA. The size range of majority of the measured particles was between 20 and 300 nm demonstrating that the samples contained exosomes and bigger microvesicles or exosome aggregates. Since it is well known that exosomes tend to agglomerate during the exosome extraction [21,22], these bigger vesicles seem to be exosome agglomerates. Besides, to eliminate the bigger microvesicles, all samples were filtrated through a 0.22-µm Whatman filter prior to the MGP-based isolation and NTA analysis. Hence, the main size (mode) of isolated particles ranged between 94.2 and 125.9 nm, indicating that most of the isolated vesicles were exosomes. The concentration of particles increased along with the volume of plasma (Figure S2A), serum (B) and cell culture supernatant (C). To check the efficiency of our MGP-based method, the isolation of a known number of exosomes derived from the dilutions of lyophilized exosome standards was performed by the MGP-based technique and compared with that of ultracentrifugation. Both techniques revealed a mode and a number of vesicles similar to the starting dilution of lyophilized exosome standards (Figure S2D), demonstrating the high efficiency of exosome recovery of both methods.

In addition, we carried out SEC to test if our established method can also isolate exosomes from highly diluted samples, and if contaminating plasma proteins are co-isolated. Five-hundred µl plasma and serum were fractionated in 25 1-ml fractions by a self-made SEC column. The MGP protocol for isolation of exosomes was performed on 500 µl of each fraction, followed by the isolation of miRNAs and RT-qPCR for miR-16 and miR-142 using our self-developed and optimized methods. Moreover, the protein concentration in each fraction was measured with the Bradford protein assay. The portion of total miR-16 (blue), miR-142 (red) and protein (black) in each fraction are represented by the graphs of Fig. 4A. Finally, gel electrophoresis of total protein content was carried out in each fraction. The majority of miRNAs were found in the early fractions from 7 to 14 for plasma and from 8 to 15 for serum, while most of proteins were found in the late fractions from 14 to 20 and from 15 to 22 for plasma and serum, respectively (Fig. 4A,B). Ours findings demonstrate that our MGP-based technique efficiently enriches exosomes from even highly diluted samples without co-precipitating proteins of non-exosomal origin.

Figure 4.

Determination of the RNA and protein content in SEC fractions.

Using our newly established methods, miRNAs were quantified in 25 SEC fractions derived from 500 µl plasma or serum. In both, plasma and serum, miR-16 and miR-142 extracted and amplified by our methods were found in the early fractions, whereas proteins measured by the Bradford assay were detected in the late fractions (A). SDS-PAGE of total proteins in 25 SEC fractions of plasma or serum. The samples on all gels are derived from the same experiment and all gels were processed in parallel. (B).

Establishment of a new miRNA isolation technique

Different variations of reagents and parameters were tested for the isolation of miRNAs from 500 µl of plasma (Table 4). To test the extraction efficiency, miR-16 and miR-142 were amplified by our modified RT-qPCR.

Table 4.

Reagents and parameters tested for the establishment of miRNA isolation.

Tested reagents and parameters	Variations	Mean real-time data as Cq difference (CD) between the variants*
Lysis solutions
Solutions	SE (PME free-circulating DNA Extraction Kit, Analytik Jena)	6.80
	GS (PME free-circulating DNA Extraction Kit, Analytik Jena)	5.57
	SEP (innuCONVERT Bisulfite Body Fluids Kit, Analytik Jena)	4.70
	RLM (Analytik Jena)	5.43
	OPT (innuPREP Plant DNA Kit, Analytik Jena)	0.49
	QPT (innuPREP Tissue DNA Kit, Analytik Jena)	1.03
	QPS (innuPREP FFPE DNA Kit – IPC16, Analytik Jena)	0.44
	BLB (innuPREP Blood DNA MIDI Direct Kit, Analytik Jena)	12.33
	BC (innuCONVERT Bisulfite All-in-One Kit, Analytik Jena)	4.69
	CLS (Instant Virus RNA/DNA Kit, Analytik Jena)	6.86
	SLS (innuPREP Blood DNA Mini Kit, Analytik Jena)	8.12
	TLS (innuPREP Blood DNA Midi Kit, Analytik Jena)	0.83
	RL (innuPREP RNA mini Kit, Analytik Jena)	4.49
	Ery Lysis solution A (innuPREP Blood DNA Midi Kit, Analytik Jena)	6.95
	SLB (innuPREP Stool DNA Kit, Analytik Jena)	7.33
	ELS (innuSPEED Soil DNA Kit, Analytik Jena)	3.72
	WB (innuPREP Plant DNA/RNA Virus Kit – KFFLX, Analytik Jena)	1.48
	PL (innuPREP Plant RNA Kit, Analytik Jena)	5.52
	MA (innuPREP FFPE total RNA Kit, Analytik Jena)	2.56
	CBV (innuPREP Virus DNA/RNA Kit, Analytik Jena)	0.27
Solutions created	L1 (10% SDS, 2.6 M Tris-HCl pH 8.0, 0.6M urea, 10mM EDTA, 1mM CaCl2)	0.90
	L2 (5% SDS, 1.3 M Tris-HCl pH 8.0, 0.3M urea, 10mM EDTA, 1mM CaCl2)	0.13
	L3 (5% SDS, 1.3 M Tris-HCl pH 8.0, 0.3M urea, 25mM EDTA, 1mM CaCl2)	7.04
	L4 (5% SDS, 1.3 M Tris-HCl pH 8.0, 0.3M urea, 50mM EDTA, 1mM CaCl2)	6.29
	L5 (5% SDS, 1.3 M Tris-HCl pH 8.0, 0.3M urea, 100mM EDTA, 1mM CaCl2)	5.99
	L6 (5% SDS, 1.3 M Tris-HCl pH 8.0, 0.3M urea, 5mM Na-citrate, 1mM CaCl2)**	0
	L7 (5% SDS, 1.3 M Tris-HCl pH 8.0, 0.3M urea, 50mM Na-citrate, 1mM CaCl2)	7.66
	L8 (5% SDS, 1.3 M Tris-HCl pH 8.0, 0.3M urea, 5mM Na-acetate, 1mM CaCl2)	2.51
	L9 (5% SDS, 1.3 M Tris-HCl pH 8.0, 0.3M urea, 50mM Na-acetate, 1mM CaCl2)	2.65
	L10 (5% SDS, 1.3 M Tris-HCl pH 8.0, 0.3M urea)	2.86
	L11 (5% SDS, 50 mM Tris-HCl pH 8.0, 0.3M urea, 10mM Na-citrate)	0.10
	L12 (5% SDS, 50 mM Tris-HCl pH 8.0, 0.3M urea, 15mM Na-citrate)	0.31
	L13 (5% SDS, 50 mM Tris-HCl pH 8.0, 0.3M urea, 20mM Na-citrate)	1.32
	L14 (5% SDS, 50 mM Tris-HCl pH 8.0, 0.3M urea, 5mM Na-citrate, 1M GSCN)	4.86
	L15 (5% SDS, 50 mM Tris-HCl pH 8.0, 0.3M urea, 5mM Na-citrate, 0.5% NLS)	0.71
	L16 (50 mM Tris-HCl pH 8.0, 95mM urea, 0.5% Tween 20, 1mM EDTA)	13.72
	L17 (1% SDS, 50 mM Tris-HCl pH 8.0, 95mM urea, 0.5% Tween 20)	4.93
	L18 (1% SDS, 95 mM urea, 0.5% Tween 20, 1mM EDTA)	6.45
	L19 (1% SDS, 50 mM Tris-HCl pH 8.0, 0.5% Tween 20, 1mM EDTA)	5.08
	L20 (1% SDS, 5 0mM Tris-HCl pH 8.0, 95mM urea, 1mM EDTA)	4.96
	L21 (4 M GSCN)	5.41
	L22 (4 M GSCN, 100 mM Tris-HCl pH 8.0)	3.77
	L23 (5 M GSCN)	10.22
	L24 (5 M GSCN, 100 mM Tris-HCl pH 8.0)	7.61
Lysis solution volume	200 µl	1.56
	300 µl	1.21
	400 µl**	0
	500 µl	0.22
	600 µl	1.03
Proteinase K treatment
Volume of proteinase K 20 mg/ml (innuPREP Proteinase K, Analytik Jena)	10 µl	0.25
	20 µl **	0
	30 µl	0.45
	40 µl	0.09***
	50 µl	0.32
Lysis conditions
Lysis time and temperature	5 min, RT	1.22
	10 min, 70°C	0.22
	15 min 70°C	0.33
	20 min, 55°C**	0
	20 min, 70°C	0.34
	20 min, 85°C	0.46
	30 min, 70°C	0.49
Centrifugation
Post-lysis centrifugation for removal of MGP residuals	none	1.72
	1 min, 16,000 g	1.48
	2 min, 16,000 g	0.24
	3 min, 16,000 g	0.26
	5 min, 16,000 g**	0
	10 min, 16,000 g	−0.08***
Binding buffer
Type and volume of binding buffer	400 µl 100% EtOH	2.46
	600 µl 100% EtOH	0.79
	800 µl 100% EtOH**	0
	400 µl 100% isopropanol	3.44
	600 µl 100% isopropanol	1.53
	800 µl 100% isopropanol	1.06
	400 µl 55% tetrahydrofuran	10.46
	600 µl 100% tetrahydrofuran	5.62
	600 µl 55% tetrahydrofuran	9.25
	400 µl RBF (innuPREP DNA Sizing Kit, Analytik Jena)	13.23
	200 µl VL (Analytik Jena)	11.75
	400 µl SBS (innuPREP Plant DNA Kit, Analytik Jena)	12.44
Spin columns
Type of filter material	SC1 (innuPREP Virus RNA Kit, Analytik Jena)**	0
	SC2 (innuPREP Blood DNA Midi Kit, Analytik Jena)	0.31
	SC3 (innuPREP TCM DNA Extraction Kit, Analytik Jena)	0.27
	SC4 (innuPREP Plasmid Mini Kit 2.0, Analytik Jena)	0.22
	SC5 (innuPREP RNA mini Kit, Analytik Jena)	0.35
	SC6 (innuCONVERT Bisulfite Body Fluids Kit, Analytik Jena)	0.23
	SC7 (innuPREP Gel Extraction Kit, Analytik Jena)	0.30
	SC8 (Analytik Jena)	1.45
	SC9 (Analytik Jena)	0.83
	SC10 (Analytik Jena)	2.12
	SC11 (Analytik Jena)	1.50
Washing solutions
Washing solutions, combinations and volumes	500 µl C (blackPREP FFPE DNA Kit, Analytik Jena) + 650 µl BS (blackPREP FFPE DNA Kit, Analytik Jena) + 2x 650 µl 100% EtOH	0.80
	650 µl BS + 2 × 650 µl 100% EtOH	0.18
	500 µl C + 2 × 650 µl 100% EtOH	0.48
	650 µl BS + 650 µl 100% EtOH	0.50
	200 µl BS + 650 µl 100% EtOH + 200 µl 100% EtOH (in combination with columns SC8-SC11)	0.33
	100 µl BS + 500 µl 100% EtOH + 200 µl 100% EtOH (in combination with columns SC8-SC11)	0.41
	200 µl HS (innuPREP DNA Mini Kit, Analytik Jena) + 650 µl LS (innuPREP Blood RNA Kit, Analytik Jena) + 200 µl LS (in combination with columns SC8-SC11)	0.08***
	500 µl HS + 650 µl LS**	0
	300 µl HS + 500 µl LS	0.24
	500 µl HS + 2 × 650 µl LS	0.08***
	500 µl HS + 650 µl LS + 650 µl 100% EtOH	0.01***
	500 µl GS (innuCONVERT Bisulfite Body Fluids Kit, Analytik Jena) + 650 µl LS	1.63
Elution
Combination of elution volume, time and temperature	50 µl Elution Buffer (innuPREP Blood DNA Mini Kit, Analytik Jena), 2 min at RT	0.89
	50 µl H2O, 2 min at RT	0.25
	100 µl H2O, 1 min at RT	0.61
	100 µl H2O, 10 min at RT	0.22
	100 µl H2O, 1 min at RT + 1x re-elution (1 min, RT) with flow-through	0.53
	100 µl H2O, 1 min at RT + 2x re-elution (1 min, RT) with flow-through	0.72
	100 µl H2O, 10 min at RT + 1x re-elution (10 min, RT) with flow-through**	0
	100 µl H2O, 20 min at RT + 1x re-elution (20 min, RT) with flow-through	0.17
	100 µl H2O at 70°C, 20 min at 40°C + 1x re-elution (20 min, 40°C) with flow-through	0.57

*CD values were calculated from the formula: C_q(x)-C_q(y), in which x is any variant tested and y is the best variant within the subgroup of the tested reagents and parameters (single boxes). The difference shows the magnitude of the aberrance of a variant from the best variant. The lower the CD value is the better is the quantity and quality of the PCR product. Hence, 0 means the best value. **The selected best variations of reagents and parameters are in bold. ***Variations of results similar to the best variation that showed a minimal data improvement but significantly increased the experiment duration, complexity or quantity of buffers used, were not chosen for further testing. Kits, solutions, spin columns, and proteinase K are from Analytik Jena. GSCN, guanidinium thiocyanate; NLS, N-Lauroylsarcosine sodium salt; RT, room temperature; H₂O, RNase-free water.

Our optimized protocol for the isolation of exosome-derived miRNAs is as follows: Exosomes are extracted by our MGB-based method. The exosome pellet is dissolved in 400 µl lysis buffer L6 supplemented with 20 µl proteinase K. The mixture is incubated on a thermoshaker at 55°C and 1,000 rpm for 20 min to lyse the MGP-trapped exosomes. After lysis, the sample is centrifuged at 16,000 g for 5 min to remove the residues of the polymer. The supernatant is mixed with 800 µl absolute ethanol to create binding conditions, and loaded twice on the spin column to bind miRNAs to the filter material. The spin column is washed with 500 µl Washing Solution HS followed by 650 µl of Washing Solution LS. After each binding and washing step, the spin column is centrifuged at 11,000 g for 1 min. Following centrifugation at 16,000 g for 3 min to remove the residuals of ethanol, 100 µl of RNase-free water is added to the filter material. Then, the spin column is incubated at room temperature for 10 min, and centrifuged for 1 min at 11,000 g. The flow-through (eluate) is re-loaded onto the same filter material, and incubation and centrifugation steps are repeated. The final eluate contains the exosomal miRNAs.

The protocol for isolation of cell-free miRNAs from supernatant, plasma or serum is similar. The differences are that 1,200 µl of absolute ethanol is used for 200 µl starting material, and the step of centrifugation for 5 min at 16,000 g is excluded since there are no residuals of MGP to remove.

Verification of the new miRNA isolation technique

To check the applicability of our developed miRNA extraction method and its scalability, we extracted miRNAs from exosomes which were isolated by our MGB-based method from different volumes of plasma and serum, and amplified miR-16 (Fig. 5A) and miR-142 (Fig. 5B) by our modified RT-qPCR. Increasing exosomal miRNA amounts correlated with increasing plasma and serum volumes. To test if our miRNA extraction method is independent of the sample type, we also compared the miRNA isolation efficiency of exosomal miRNAs isolated from MGP-derived pellets and cell-free miRNAs extracted from supernatants of 500 µl plasma EDTA, plasma CPD, and serum (Fig. 5C).

Figure 5.

Amplification of miRNAs isolated from different sample types and volumes.

MiRNAs were extracted from MGP-derived exosomes of increasing plasma (EDTA) and serum volumes by our newly established miRNA isolation method and amplified by our modified RT-q PCR. The Cq values derived from the real-time PCR are shown in the tables for miR-16 (A) and miR-142 (B). In addition, the Cq values of exosomal (MGP-isolated pellet) and cell-free (supernatant) miR-16 and miR-142 derived from 500 µl of plasma (EDTA and CPD) and serum are compared (C).

Comparative analyses of RT-qPCR

To check the performance of our optimized RT-qPCR, 10-fold serial dilutions of synthetic miR-16 and miR-142 target sequences were prepared, reverse transcribed and amplified with our established assays and our designed miR-16 and miR-142 primers/probe set. The obtained data were compared with the data of the commonly used and commercial TaqMan miRNA assay (Applied Biosystems). Both methods were checked for their efficiency and slope, linearity and sensitivity (Fig. 6).

Figure 6.

Comparison of miR-16 real-time PCR performed by our modified assay with a commercial assay.

Real-time PCR curves of serial dilutions from 4 × 10⁹ to 4 x 10² copies of synthetic miR-16 target sequence performed by our optimized method (A) and the TaqMan miRNA assay from Applied Biosystems (B). Gel electrophoresis of the PCR products (C) amplified by our established method (lanes 3–5) and the TaqMan miRNA assay from Applied Biosystems (lanes 8–10). Lanes 1, 6 and 11 represent the DNA ladder with the lowest band of 100 bp. Negative controls (lanes 2 and 7) and PCR products obtained from amplification of 6.7 × 10⁻⁸ (lanes 3, 8), 6.7 × 10⁻⁷ (lanes 4, 9) and 6.7 × 10⁻⁶ fM (lanes 5,10) of the synthetic miR-16 target sequence. E, efficiency; R^2, linearity.

The highest concentration of miR-16 sequences (4x10⁹) used as starting material for the Applied Biosystems assay led to an over-amplification – a PCR artefact which is possibly caused by an exhaustion of some essential PCR components, e.g. primers, and a self-amplification of the target sequences. Next, the RT-qPCR efficiency, slope, and linearity of the serial dilutions from 4 × 10² up to 4 × 10⁸ copies per PCR reaction were calculated for both assays. The amplification of miR-16 with our optimized method exhibited a better efficiency of 99.7% and a slope of −3.33 (Fig. 6A) than the TaqMan miRNA assay with an efficiency of 119.1% and slope of −2.936 (Fig. 6B). The TaqMan miRNA assay efficiency was much higher than expected which could be caused by the presence of unspecific products or the formation of primer-dimers. However, both assays presented equal linearity of R² = 0.997 and sensitivity of LOD = 4 × 10² (Fig. 6A,B). Similar data were obtained when miR-142 was amplified (data not shown). Incidentally, the moment of a rising signal in the miR-16 negative control was early using the TaqMan miRNA assay from Applied Biosystems, and it was already detected at Cq<35 for some PCR runs, while it was later at Cq>38 using our optimized method (data not shown).

In addition, gel electrophoresis of the PCR products was carried out (Fig. 6C). There are prominent bands of the PCR products of miR-16 derived from both methods (lanes 3–5, our assay and 8–10, assay from Applied Biosystems) on the gel. However, a weak band of a size similar to the size of the miR-16 amplicon appears in the negative control (lane 7) when the commercial kit was used, while in the negative control of our optimized method a band corresponding to the primer-dimers is present (lane 2).

Comparative analyses of exosome extraction

We compared our MGB-based exosome extraction method with that of the Total Exosome Isolation Reagent kit (Invitrogen). The exosome extraction of several plasma and serum samples showed that exosome pellets isolated by the Total Exosome Isolation kit were bigger and more yellow than pellets derived from our optimized MGP-based method suggesting an excess of plasma proteins in exosome pellets isolated by the Total Exosome Isolation kit. Gel electrophoresis confirmed that these pellets contained much more proteins than MGP-derived pellets (data not shown). To further confirm these findings, the protein concentration in both pellets and corresponding supernatants derived from 500 µl plasma and serum were measured by the Bradford assay. The protein content was 5.1 and 2.3 times higher in pellets isolated by the Total Exosome Isolation kit than in MGP-derived exosome pellets isolated from plasma and serum, respectively. In contrast, MGP-derived supernatants contained more proteins than supernatants isolated by the Total Exosome Isolation kit (Figure S3). These results indicate that exosome pellets prepared by the Invitrogen kit are enriched with proteins of non-exosomal origin.

Comparative analyses of exosomal and cell-free mirR16 and miR-142 extraction

To compare the yields of exosomal and cell-free miRNAs prepared with our established MGP-based method with those isolated by the Total Exosome Isolation kit, we extracted miRNAs from pellets and supernatants derived from 500 µl of the same sample using our newly developed miRNA isolation method and the Total Exosome RNA and Protein Isolation kit (Invitrogen). Following reverse transcription and real-time PCR using our established methods for both miRNA extractions, the quantification showed that the levels of miR-16 were significantly higher in the plasma supernatant (p = 0.0001) than in the exosomes when the MGP-based technique was used, while the assay of the both Invitrogen kits showed similar levels of miR-16 in both fractions (p = 0.758, Fig. 7A). However, the plasma data derived from our MGP-based method were also confirmed when serum was used. Here, both (our and Invitrogen) extraction methods showed that the levels of miR-16 were significantly higher in the cell-free serum fraction than in the exosomes (p = 0.004, MGP; p = 0.009, Invitrogen kit; B). However, the upregulation of miR-16 in the serum cell-free fraction contradicted the similar levels in plasma cell-free and exosomal fractions, as measured by the Invitrogen method. Conversely, the miRNA isolation from plasma by our MGP-based method (p = 0.0001) as well as by the Invitrogen kit (p = 0.028, but weaker pronounced) showed that the levels of miR-142 were significantly higher in the exosomes than in the supernatant (C). Similar observations were made in serum (p = 0.0001, D). To conclude, both methods provided similar miRNA levels in serum, but not in plasma (Fig. 7).

Figure 7.

Levels of exosomal and cell-free miR-16 and miR-142 in plasma and serum, isolated by our MGP-based techniques and the Invitrogen kits.

Distribution of miRNAs in exosomes and exosome-/cell-free supernatants as derived from the data of our new MGP-based exosome extraction method followed by our established miRNAs isolation technique are depicted as dark blue boxes and of the Total Exosome RNA and Protein Isolation and Invitrogen Total Exosome RNA & Protein Isolation kits are depicted as light blue boxes. For both assays, miR-16 and miR-142 were amplified with our modified RT-qPCR. Plasma (A) and serum (B) levels of miR-16 as well as plasma (C) and serum (D) levels of miR-142 (B) in pellets (exosomes) and supernatants (cell-free fraction) are shown. Beside the box blots, the tables of the p-values calculated by the ANOVA with Tukey’s HSD test are shown.

Discussion

The deregulation of miRNA expression has been linked with the pathogenesis of benign and malignant diseases [23,24]. To better understand the association between miRNAs and human disease and their potential as non-invasive disease biomarkers, a variety of techniques have been used to quantify miRNAs in body tissues and fluids [25,26]. In particular, methods for quantification of circulating, cell-free and exosomal miRNAs frequently disclose technical problems, resulting in an inconsistency of the reported results [27], and complicating the establishment of a non-invasive consensus biomarker that could be implicated in clinical use.

In the current study, we developed new coordinated assays for the measurement of cell-free and exosomal miRNAs in plasma and serum, to overcome the shortcomings of the commonly used assays. This approach covers three main steps: a new exosome extraction method using MGP, a miRNA isolation based on the chemicals of Analytik Jena and a modified miRNA quantification by RT-qPCR based on the excellent assay by Chen et al. (Applied Biosystems) [17]. In our experiments, we examined numerous reagents and varied multiple parameters as well as combinations thereof. We chose the most promising combinations and verified them for the establishment of our exosome and miRNA extraction methods by real-time PCR using our newly established RT-qPCR method with the designed miR-16 and miR-142 primers/probe set.

In 2005, Chen et al. [17] published the method of miRNAs amplification comprising reverse transcription using a stem-loop primer followed by TaqMan PCR. These assays were then included in the Applied Biosystems kits. We used this protocol and carried out several changes to improve the miRNA RT-qPCR technique. We also applied a stem-loop primer in our modified reverse transcription. Advantage of the use of a stem-loop primer is the fact that it provides a better specificity and efficiency of reverse transcription than linear primers and allows reducing the amplification of pre- and pri-miRNAs [28]. Moreover, the stem-loop approach is able to discriminate among iso-miRNAs that differ by only one nucleotide and is also not influenced by the presence of genomic DNA [17]. Our modifications in the real-time PCR assay include, e.g., the exclusion of the RNase inhibitor, the extension of the TaqMan probe for miR-16 and its labelling with only BHQ-1 at the 3ʹ end, a newly designed TaqMan probe for miR-142 as well as the use of another Taq polymerase which is more quickly activated. Together with the optimized chemistry of master mix and primer concentration, our method allows reducing the qPCR time for nearly half an hour. More importantly, the amplification of miR-16 and miR-142 with our optimized quantification method exhibits a better efficiency and slope than the Applied Biosystems TaqMan miRNA assay, but both assays exhibit equal linearity and sensitivity. For both miRNAs miR-16 and miR-142, our optimized RT-qPCR shows a dynamic range of seven orders of magnitude.

Commonly used exosome isolation techniques include ultracentrifugation, density gradient separation, immunoaffinity assays, filtration or polymeric methods [26,29]. Among the extraction methods, ultracentrifugation is the most used technology for exosome concentration. To get a relatively pure exosome pellet, ultracentrifugation requires differential centrifugation steps with ultrahigh speeds up to 200,000 g. The performance of this procedure is time-consuming and requires an expensive ultracentrifuge [30]. Polyethylene glycol (PEG), a water-soluble polymer, is the second method of choice after the ultracentrifugation to isolate exosomes. However, it is known that PEG-based polymeric reagents also co-purify protein complexes along with exosomes that can influence downstream RNA profiling [31]. Considering these shortcomings, we developed a polymer-based method that bypasses the precipitation but entraps exosomes into a polymeric net. The MGP-based technique is easy, fast and non-laborious, involving only 3 main steps: mixing the polymer with the sample, a short incubation step at room temperature, and low-speed centrifugation. We tested our MGP-based method for its efficiency and quality of exosome extraction by Western blot, confocal microscopy, SEC and NTA. Our findings showed that MGP efficiently isolated exosomes from different types of samples (serum, plasma, urine, cell culture supernatant, lyophilized exosome standards). In addition, the exosome yield increased in parallel with the sample volume. As shown by the performance of SEC, the MGP-based method is highly effective to isolate exosomes even from extremely diluted samples. The co-isolation of plasma proteins by MGP is narrow, as observed in the low miRNA concentrations in fractions enriched with proteins. The MGP-isolated exosomes are also biologically active. Finally, we compared our MGP-based method with the PEG-based Total Exosome Isolation Reagent kit from Invitrogen since Nath Neerukonda et al. [32] showed that this reagent is more efficient to isolate exosomes than ultracentrifugation. Using NTA and transmission electron microscopy, these authors found that although both, the Total Exosome Isolation Reagent kit and ultracentrifugation successfully isolated exosomes with an acceptable size range and morphology, the use of the Total Exosome Isolation Reagent kit to purify exosomes from serum was more efficient, quick and isolated a slightly higher exosome number than ultracentrifugation [32]. Using SDS-PAGE and Bradford assay, we found that the protein content was much higher in exosomes isolated by the Total Exosome Isolation Reagent kit than by our MGP-based method for both plasma and serum, but somewhat less than the protein concentration detected in unprocessed plasma and serum samples. The Total Exosome Isolation Reagent kit co-isolated almost all proteins that are also present in plasma and serum, with the exception of the smaller ones. Likewise, Van Deun et al. found that the Total Exosome Isolation Reagent kit isolated 8 times more protein than ultracentrifugation by calculating the concentration of proteins per number of exosomes isolated by each method [31]. Interestingly, another study disclosed that the presence of proteins in the sample is necessary for the Total Exosome Isolation Reagent kit to precipitate exosomes and that along with exosomes this kit co-isolates a material of similar physical properties [33].

For the development of the miRNA isolation method, we also examined numerous compositions of reagents, notably from Analytik Jena, and procedure parameters. Our final protocol covers the composition of agents that efficiently lyse exosomes, as well as digest proteins and MGP, leading to the release of nucleic acids which then easily bind to the filter material. For our assay, we used chaotropic and non-chaotropic salts like urea and calcium chloride, respectively. Urea is a deactivator of RNases [34] and reduces the hydrophobic behaviour of proteins by disrupting the hydrogen binding among amino acids in hydrophobic regions [35,36]. Calcium chloride reinforces the lysis of the sample, and therefore, allows reducing the urea concentration and using proteinase K. By applying this combination of non-chaotropic and chaotropic chemistry, the overall salt concentration is reduced and the extensive washing steps are not necessary any more. Moreover, the miRNA purification by phenol/chloroform extraction is no longer required. These modifications deliver an improved protocol without using substances that are harmful to health and the environment.

Finally, the final protocol for miRNA isolation from exosome pellet and supernatant was examined by our optimized RT-qPCR assays for miR-16 and miR-142. Our method could efficiently isolate miRNAs from different types and volumes of samples. Furthermore, there was a positive correlation between sample volume used for miRNA isolation and yield of isolated miRNAs.

The application of the whole package of our newly established assays (exosome extraction, miRNA isolation, reverse transcription and qPCR) showed that the levels of miR-16 were significantly higher in the plasma supernatant than in the exosomes, while the Total Exosome Isolation Reagent and Total Exosome RNA and Protein Isolation assays from Invitrogen followed by our modified qPCR showed similar levels of miR-16 in both fractions. However, the plasma data derived from the whole package of our assays were confirmed if serum was used. In contrast to the plasma data derived from the Invitrogen assays, these kits also showed that the levels of miR-16 were significantly higher in the serum supernatant than in the exosomes. These findings demonstrate that the Invitrogen assays deliver different data for plasma and serum, whereas our method provides congruent data. The discrepant results derived from the Invitrogen assays might be due to the fact that plasma contains more proteins than serum [37], and that the Total Exosome Isolation Reagent co-isolates much more plasma proteins which influence the downstream quantification of miR-16 than the MGB-based assay. The detection that miR-16 rather circulates in a cell-/exosome-free form than in exosomes is in line with the observations by previous studies [38–42]. The quantification of miR-142 provided similar data between the two methods. Here, using both methods, higher levels of exosomal than cell-free miR-142 were observed in plasma and serum. These findings are also in line with earlier observations [38–41].

There are numerous assays for exosome extraction and miRNA isolation and quantification on the market. In particular, the stem-loop-based RT-qPCR assay from Applied Biosystems is qualified for the quantification of miRNAs from plasma and serum. However, each technique may demand for optimization. Here, we presented an improved procedure beginning from the MGP-based exosome extraction over miRNA isolation and ending with RT-qPCR. Our assay system is a promising sensitive and specific technical approach. It is easier in the performance than commonly used procedures and is not influenced by the source (plasma or serum) used for the analysis.

Materials and methods

Preparation of plasma, serum and urine

Blood samples were obtained from UKE Transfusion Medicine, namely from volunteers who signed donor informed consent. For preparation of serum, plasma EDTA and plasma CPD, blood was collected by S-Monovette Z, S-Monovette K3E (Sarstedt, Nümbrecht, Germany) and CB (Collect Fresenius Kabi, Bad Homburg, Germany), respectively. For preparation of serum and plasma, all samples were centrifuged at 300 g for 10 min. To remove cell debris and apoptotic bodies, the samples were again centrifuged at 2,000 g and 10,000 g, each for 10 min. The supernatants were filtrated through Whatman Puradisc 25 syringe filters (GE Healthcare Life Sciences, Chicago, IL, USA), to remove extracellular vesicles (EVs) bigger than 0.2 µm in diameter.

Verification of haemolysis

To prevent the measurement of miRNAs of cellular origin, all plasma and serum samples were measured for haemolysis according to the method previously established in our lab [43]. Briefly, blood cells of 7 ml whole blood were lysed by erythrocyte lysis buffer containing 0.3 M sucrose, 10 mM Tris pH 7.5, 5 mM MgCl₂ and 1% Triton X100. A serial dilution of lysed blood cells was used to prepare a standard curve that was used for measurement of haemolysis in all plasma and serum samples. Fifty µl of all samples, including standard and samples of interest, were measured in duplicate on a Microplate reader (Tecan, Männerdorf, Switzerland). The average values and standard deviations were calculated from the duplicates. Free haemoglobin resulted in the highest absorbance at 414 and two additional peaks at 541 and 576 nm. The absorbance value is directly proportional to the level of haemolysis. Samples of interest with absorbance exceeding 0.25 were excluded from the experiment [43].

Cell line culture

The breast cancer cell line MDA-MB-468 was cultured at 37°C, 10% CO₂, in a humidified atmosphere, in DMEM with 10% exosome-depleted FBS, supplemented with 200 U/ml of streptomycin/penicillin and 200 mM L-glutamine. For preparation of cell-culture supernatant, the same centrifugation and filtration protocol were used as showed for plasma and serum preparation.

Isolation of exosomes from plasma and serum using the Invitrogen Total Exosome Isolation Reagent (Invitrogen, Carlsbad, CA, USA)

The Total Exosome Isolation Reagent, a polyethylene glycol- (PEG-) based kit, was used as a reference technique for our comparative analyses. Exosomes were isolated according to the manufacturer’s instructions. Briefly, 500 µl plasma was mixed with 250 µl PBS and 150 µl Total Exosome Isolation Reagent (for plasma). After 10 min incubation at room temperature, the sample was centrifuged at 10,000 g for 5 min. In contrast, 500 µl serum was directly mixed (without PBS) with 100 µl Total Exosome Isolation Reagent (for serum), incubated at 4°C for 30 min, and centrifuged at 10,000 g for 10 min at room temperature. The pellets were then centrifuged for 30 sec to remove the residual supernatant and dissolved up to 200 µl in PBS.

Re-isolation of exosomes by ultracentrifugation

One ml of lyophilized exosome standards (>3 x 10⁹ exosomes/ml, HansaBioMed Life Sciences, Tallinn, Estonia) solved in PBS was centrifuged at 100,000 g and 21°C for 1 hour in an Optima LE-80K ultracentrifuge (Beckman Coulter, Brea, CA, USA).

Size exclusion chromatography

Twenty-four ml Sephacryl S-500 High Resolution resin (GE Healthcare) was washed five times with 0.2 µm filtrated PBS, diluted to form 60% slurry, and filled in a modified 25-ml serological pipette (Sarstedt) which served as a column. Then, the column was filled up with PBS, and the resins were allowed to sediment for 10 min. Afterwards, a constant flow of PBS was allowed until the bed was completely packed. The final bed height was 14 cm with a volume of 19 ml and an elution speed of ~0.5 ml/min. The quality of the packing was checked with 0.5 ml of 0.124% (w/v) dilution of blue-dyed Uniform Dyed Microspheres with a mean diameter of 53 nm (Bang Laboratories, Technology Drive Fishers, IN, USA), mixed with 50 µl glycerol. Following washing of the column with PBS for 3 times, 500 µl serum or plasma samples supplemented with 50 µl glycerol were added to the column, and the column was filled up with PBS. Twenty-five fractions of 1 ml were collected from each sample.

Bradford assay, SDS-PAGE and Western blotting

The protein concentrations were measured corresponding to the Bradford method [44] using the Roti-Quant (Carl Roth, Karlsruhe, Germany) and ScanDrop spectrophotometer (Analytik Jena, Jena, Germany). Proteins were separated on SDS-PAGE gels composed of a 5% stacking gel and a 12% resolving gel at 100 V and 150 V on the PAGE Eco-Mini System EBC (Biometra, Göttingen, Germany), and stained with Coomassie Blue (Roti-Blue, Carl Roth) at room temperature for 1 hour.

For Western blot, 30 µg proteins and 4 µg exosome standards (HansaBioMed) were electrophoretically separated and blotted onto a PVDF (polyvinylidene difluoride) membrane (Merck, Darmstadt, Germany) The membrane was incubated with an antibody specific for the exosomal marker CD63 (Novus Biologicals, Centennial, CO, USA) which was labelled with a horseradish peroxidase (HRP; Abcam, Cambridge, Great Britain) according to the manufacturer’s instructions. After incubation of the membrane with 7 µl of the HRP-conjugated antibody (~1:1,000 dilution) supplemented with 1% BSA at 4°C, overnight, detection of the proteins was carried out using Roti-Lumin solutions (Carl Roth). The membrane was exposed for 5 min, and the image was captured at manual exposure with a 100% focus, aperture f1.2, and 4 × 4 bin on the ChemStudio SA² imager (Analytik Jena).

Visualization and biological activity of exosomes using confocal microscopy

Exosomes from 500 µl plasma isolated by our established MGP-based method and resuspended in PBS up to a final volume of 150 µl were labelled using the Exo-Glow Exosome Labelling kit (System Biosciences, Palo Alto, CA, USA). Briefly, 7.5 µl 10x Exo-Red was added to 75 µl exosome suspension. The mixture was incubated at 37°C for 10 min, and the reaction was stopped by incubating it with 16.5 µl ExoQuick-TC reagent for 30 min on ice. After centrifugation at 16,000 g for 3 min, the labelled exosome pellet was dissolved in 50 µl PBS and visualized under a confocal microscope Leica TCS SP5 (Leica, Wetzlar, Germany) with a 63x NA = 1.4 oil objective lens.

The PKH26 Red Fluorescent Cell Linker kit (red fluorescence, Sigma Aldrich, St. Louis, MO, USA) was used to dye exosomes for life imaging. Briefly, exosomes isolated from 2 ml plasma or serum by the MGP-based method were dissolved with 50 mM EDTA up to a final volume of 200 µl. After adding 1.2 µl PKH26 and incubation at room temperature for 5 min, the reaction was stopped by 1 ml of exosome-depleted FCS. Samples were then centrifuged at 100,000 g for 1 hour in an Optima LE-80K ultracentrifuge (Beckman Coulter), to remove an excess of the fluorescent dye. The PKH26-stained exosomes were added to MDA-MB-468 cells which were previously stained with 50 µl of 1:50 diluted FITC-conjugated EpCAM monoclonal antibody (green fluorescence, BioLegend, San Diego, CA, USA) at room temperature for 1 hour. After incubation at 37°C, 10% CO₂ for 1.5 hours, the mixture of stained cells and exosomes were shot under the Leica TCS SP8 confocal microscope with a 63x NA = 1.4 oil objective lens. The 488 nm and 561 nm lasers were used for excitation of the green (FITC) and red (PKH26) dye, respectively. The image pixel size ranged between 120 and 190 nm, the interplane distance was set to be 500 nm, and the acquisition speed was between 2.6 and 2.8 frames per s.

Nanoparticle tracking analysis

NTA was performed on the NanoSight LM 10 instrument using the NTA 3.0 software (Malvern Panalytical, Malvern, Great Britain). For each sample, 10 videos with a duration of 10 s were recorded at 23.5°C and with a camera level of 16, a minimum track length, minimal expected particle size and all blur settings set to automatic. The 10 videos were analysed in the batch-processing mode.

Isolation of microRNAs using the Invitrogen Total Exosome RNA and Protein Isolation kit

Total Exosome RNA and Protein Isolation kit was used to isolate miRNAs as a reference kit. Briefly, 200 µl of dissolved exosomes from plasma or serum, supplemented with 200 µl Denaturation Buffer was incubated on ice for 5 min. Following the manufacturer’s instructions, the miRNAs were precipitated and purified by phenol:chloroform and a filter cartridge. The extracted miRNAs were eluted in 100 µl Elution Buffer. For the isolation of miRNAs from the exosome-depleted supernatant, the volumes of Denaturation Buffer and phenol:chloroform were increased proportionally to the volume of the supernatant.

Targets, primers and probes

Synthetic miR-16 (uagcagcacguaaauauuggcg) and miR-142 (uguaguguuuccuacuuuaugga) target sequences, as well as sequences of the primers and probes of our modified RT-qPCR (Table 2) were purchased from Metabion (Planegg/Steinkirchen, Germany).

Reverse transcription of microRNAs using the Applied Biosystems kit

TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) was used as a reference technique for our optimized method. The 15-µl reaction contained 0.15 µl 100 mM dNTPs (with dTTP), 1.0 µl (50 U/μl) MultiScribe Reverse Transcriptase, 1.5 µl 10xRT Buffer, 0.19 µl (20 U/μl) RNase Inhibitor, 3.0 µl 5X RT primer (TaqMan MicroRNA Assays for miR-16 or miR-142, Applied Biosystems) and 5 µl miRNAs. To avoid false-positive results, a negative control containing nuclease-free water instead of the template miRNA was also prepared. The reactions were carried out at 16°C for 30 min, 42°C for 30 min and 85°C for 5 min on an MJ Research PTC-200 Peltier Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA). Synthetic target sequences of miR-16 and miR-142 (Metabion) were also used as a template.

qPCR using Applied Biosystems kits

TaqMan MicroRNA assays for miR-16 and miR-142 and TaqMan Universal PCR Master Mix II, no UNG (Applied Biosystems) were used as reference techniques. In a 20-μl reaction, 1.33 µl cDNA was mixed with 10.0 µl 2x TaqMan Universal PCR Master Mix II, no UNG and 1.0 µl 20x TaqMan MicroRNA Assay (for miR-16 or miR-142). qPCR reaction was performed at 95°C for 10 min and for 40 cycles at 95°C for 15 s and 60°C for 60 s, on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Fluorescence data were collected at 60°C and analysed by the Bio-Rad CFX Manager 3.1 software. The PCR products were verified on a 2% w/v agarose gel.

Statistical analysis

The statistical analyses were performed using the SPSS software package, version 22.0 (SPSS Inc, Chicago, IL, USA). Statistical differences of miRNA levels were calculated using the ANOVA with Tukey´s HSD test for all pairwise comparisons that correct for experiment-wise error rate. A p-value <0.05 was considered as statistically significant. All p-values are two-sided.

Funding Statement

This work was supported by the Wilhelm Sander Stiftung, Munich, Germany under Grant No. 2016.049.1 and Walter Schulz Stiftung, Planegg/Martinsried, Germany under Grant of 22.08.2016; Walter Schulz Stiftung [22.08.2016]; Wilhelm Sander-Stiftung [2016.049.1].

Acknowledgments

We thank Dr. Elmara Graser, Mr. Vipulkumar Patel and Ms. Bettina Steinbach for their excellent technical assistance, and Dr. Tanja Zeller´s lab for using the PCR block.

Disclosure statement

No potential conflict of interest was reported by the authors.

Supplementary material

Supplemental data for this article can be accessed here.