The Dynamin-Like GTPase FgSey1 Plays a Critical Role in Fungal Development and Virulence in Fusarium graminearum

Xuefa Chong; Chenyu Wang; Yao Wang; Yixiao Wang; Liyuan Zhang; Yuancun Liang; Lei Chen; Shenshen Zou; Hansong Dong

doi:10.1128/AEM.02720-19

. 2020 May 19;86(11):e02720-19. doi: 10.1128/AEM.02720-19

The Dynamin-Like GTPase FgSey1 Plays a Critical Role in Fungal Development and Virulence in Fusarium graminearum

Xuefa Chong ^a,^#, Chenyu Wang ^a,^#, Yao Wang ^a, Yixiao Wang ^a, Liyuan Zhang ^a,^b, Yuancun Liang ^a, Lei Chen ^b,^✉, Shenshen Zou ^a,^✉, Hansong Dong ^a,^b

Editor: Isaac Cann^c

PMCID: PMC7237792 PMID: 32220839

Fusarium graminearum is a major plant pathogen that causes Fusarium head blight (FHB) of wheats worldwide. In addition to reducing the plant yield, F. graminearum infection of wheats also results in the production of deoxynivalenol (DON) mycotoxins, which are harmful to humans and animals and therefore cause great economic losses through pollution of food products and animal feed. At present, effective strategies for controlling FHB are not available. Therefore, understanding the regulation mechanisms of fungal development, pathogenesis, and DON biosynthesis is important for the development of effective control strategies of this disease. In this study, we demonstrated that a dynamin-like GTPase protein Sey1/atlastin homologue, FgSey1, is required for vegetative growth, DON production, and pathogenicity in F. graminearum. Our results provide novel information on critical roles of FgSey1 in fungal pathogenicity; therefore, FgSey1 could be a potential target for effective control of the disease caused by F. graminearum.

KEYWORDS: Fusarium graminearum, FgSey1, endoplasmic reticulum, lipid droplets, dynamin-like GTPase, pathogenesis

ABSTRACT

Fusarium graminearum, the main pathogenic fungus causing Fusarium head blight (FHB), produces deoxynivalenol (DON), a key virulence factor, which is synthesized in the endoplasmic reticulum (ER). Sey1/atlastin, a dynamin-like GTPase protein, is known to be required for homotypic fusion of ER membranes, but the functions of this protein are unknown in pathogenic fungi. Here, we characterized Sey1/atlastin homologue FgSey1 in F. graminearum. Like Sey1/atlastin, FgSey1 is located in the ER. The FgSEY1 deletion mutant exhibited significantly reduced vegetative growth, asexual development, DON biosynthesis, and virulence. Moreover, the ΔFgsey1 mutant was impaired in the formation of normal lipid droplets (LDs) and toxisomes, both of which participate in DON biosynthesis. The GTPase, helix bundle (HB), transmembrane segment (TM), and cytosolic tail (CT) domains of FgSey1 are essential for its function, but only the TM domain is responsible for its localization. Furthermore, the mutants FgSey1^K63A and FgSey1^T87A lacked GTPase activity and failed to rescue the defects of the ΔFgsey1 mutant. Collectively, our data suggest that the dynamin-like GTPase protein FgSey1 affects the generation of LDs and toxisomes and is required for DON biosynthesis and pathogenesis in F. graminearum.

IMPORTANCE Fusarium graminearum is a major plant pathogen that causes Fusarium head blight (FHB) of wheats worldwide. In addition to reducing the plant yield, F. graminearum infection of wheats also results in the production of deoxynivalenol (DON) mycotoxins, which are harmful to humans and animals and therefore cause great economic losses through pollution of food products and animal feed. At present, effective strategies for controlling FHB are not available. Therefore, understanding the regulation mechanisms of fungal development, pathogenesis, and DON biosynthesis is important for the development of effective control strategies of this disease. In this study, we demonstrated that a dynamin-like GTPase protein Sey1/atlastin homologue, FgSey1, is required for vegetative growth, DON production, and pathogenicity in F. graminearum. Our results provide novel information on critical roles of FgSey1 in fungal pathogenicity; therefore, FgSey1 could be a potential target for effective control of the disease caused by F. graminearum.

INTRODUCTION

Fusarium graminearum is a toxigenic wheat pathogen that causes Fusarium head blight (FHB), one of the most destructive diseases affecting the yield and quality of wheat on a global scale (1, 2). The pathogen produces deoxynivalenol (DON), a mycotoxin that inhibits protein synthesis in eukaryotic organisms by binding to the ribosome (3) and is harmful to humans and animals (4). The control of FHB currently relies on fungicides that have some negative effects (5). Therefore, the identification of molecular mechanisms of pathogenicity in F. graminearum may provide novel and effective strategies for the control of FHB (6).

During plant infection, DON is an important virulence factor for F. graminearum (7 –9). Biosynthesis of DON is regulated by the TRI gene cluster, including TRI1, TRI4, TRI5, TRI6, TRI10, and other TRI genes (10, 11). Among them, TRI6 and TRI10 encode two major transcription factors that regulate the expression of TRI genes (12). Tri5 is a trichodiene synthase, which catalyzes the first key step in DON biosynthesis (13). Tri1 and Tri4, two cytochrome P450 oxygenases, are involved in toxisome formation (14, 15). The toxisome, which may have developed from reorganized endoplasmic reticulum (ER), plays an important role in DON biosynthesis (16 –18).

The ER is a large organelle with a variety of critical functions in eukaryotic cells. Besides DON synthesis, protein translocation, and modification, lipid synthesis and the regulation of intracellular calcium homeostasis involve the ER, and normal ER morphology is needed to maintain these physiological processes (19 –23). In eukaryotic cells, the ER is not in a static state but in dynamic fusion and disintegration. Sey1 (yeast name) and its orthologs (atlastin Atl1/2/3 in animals and Rhd3 in plants) are dynamin-related GTPases that bind to ER membranes to mediate the fusion of ER membranes. In Saccharomyces cerevisiae, the lack of Sey1 results in the ER undergoing delayed fusion approximately 21 min late but has no effect on vegetative growth (24, 25). In addition, Sey1 mediates nuclear fusion during yeast mating (26). In animals, atlastins are reportedly required for homotypic ER fusion and thereby generate the tubular ER network (27 –29). In addition to this function, Atl1 is also involved in regulating the size of lipid droplets (LDs) and neuronal defects in mammalian cells and Drosophila (20, 30). In Arabidopsis, the absence of Rhd3 causes defective root hairs (31 –33). However, the functions of Sey1 in pathogenic fungi have not been thoroughly documented.

LDs are ubiquitous organelles in prokaryotes and eukaryotes that play an essential role in sustaining life (34). The generation and expansion of LDs in ER membrane is well documented (20, 35). In F. graminearum, the formation of DON toxisomes is related to the generation of a large number of LDs during plant infection (36, 37), and the FgNem1/Spo7-FgPah1 cascade is involved in fungal development and pathogenicity through regulating the biogenesis of LDs (37). The accumulation of LDs plays a key role in fungal pathogenicity. However, the regulatory network of LDs is still not clearly defined in pathogenic fungi.

In this study, we identified a dynamin-related GTPase FgSey1 in F. graminearum as a homologue of yeast Sey1 protein. We show that FgSey1 is required for hyphal growth, asexual development, pathogenicity, and DON production. In addition, deletion of FgSEY1 affected the formation of LDs and toxisomes. Therefore, our data suggest that FgSey1 is involved in development and virulence in F. graminearum by participating in the generation of LDs.

RESULTS

Identification of FgSEY1 in F. graminearum.

One dynamin-like GTPase Sey1 in F. graminearum (FGSG_00833, designated FgSey1) was detected by a BLAST search of the NCBI with the Saccharomyces cerevisiae Sey1 (YOR165W) as a query. The FgSEY1 nucleotide sequence is 2,764 bp in length and encodes a polypeptide of 859 amino acids. The amino acid sequence of FgSey1 showed 94% identity to the homolog of Fusarium oxysporum, 75% to Neurospora crassa, 78% to Magnaporthe oryzae, 66% to Aspergillus oryzae, 35% to Saccharomyces cerevisiae, and 37% to Candida albicans (see Fig. S1 in the supplemental material). The alignment analysis showed that both of these proteins (Sey1 and FgSey1) contain the two predicted GTP-binding motifs GXXXXGKS and DXXG near the N terminus. Furthermore, phylogenetic analysis revealed closely related homologs of Sey1 in filamentous fungi (Fig. 1A).

FIG 1 — Identification of the Sey1 protein in *F. graminearum*. (A) Phylogenetic analysis of Sey1 proteins. All amino acid sequences were aligned using the CLUSTALW program, and the phylogenetic tree was generated by MEGA 7.0. (B) FgSey1 localizes to the endoplasmic reticulum. PH-1 strain coexpressing FgSey1-GFP and FgKar2-mCherry was treated as described in Materials and Methods. Bar, 10 μm. DIC, differential interference contrast.

The Sey1 protein is localized to the endoplasmic reticulum (ER) in eukaryotes. To detect whether FgSey1 has a similar subcellular localization in F. graminearum, we tagged the C terminus of FgSey1 with green fluorescent protein (GFP) and expressed an ER marker, FgKar2-mCherry, in the wild-type PH-1 strain to detect the colocalization of FgSey1 and FgKar2. As shown in Fig. 1B, FgSey1-GFP colocalized with FgKar2-mCherry, suggesting that the FgSey1 protein is located in the ER, consistent with the subcellular localization in other species.

FgSey1 plays a crucial role in vegetative growth.

Although the dynamin-like GTPase protein Sey1 is highly conserved in eukaryotes, growth phenotypes caused by the loss of Sey1 are not consistent among different species. Previous studies have found that deleting the SEY1 gene in S. cerevisiae (ScSEY1) did not affect cellular growth (24), and the absence of the AtRHD3 gene (root hair defective 3, Sey1 ortholog in Arabidopsis) caused short root hairs in Arabidopsis (31). Vegetative growth is the basis for development, reproduction, and pathogenesis. To determine if the F. graminearum gene FgSEY1 is required for those processes, we generated an FgSEY1 deletion mutant by homologous recombination. The deletion of FgSEY1 was further confirmed by Southern blotting (see Fig. S2). Furthermore, we complemented the ΔFgsey1 mutant with FgSEY1-GFP under the native promoter (ΔFgsey1/FgSEY1).

The wild type PH-1, ΔFgsey1 mutants, and the complemented strain were cultured on potato-dextrose agar (PDA) plates for growth assays. After growth at 25°C for 3 days, the radial growth of the ΔFgsey1 mutant was drastically reduced on PDA (Fig. 2A). Also, the ΔFgsey1 mutant produced tufted aerial hyphae compared to those of the wild-type or complemented strain (Fig. 2A). The height of aerial hyphae of the ΔFgsey1 mutant also was drastically reduced on PDA (Fig. 2B). Microscopic examination revealed extensive branching of the ΔFgsey1 hyphae not commonly observed in the wild-type and complemented strains (Fig. 2C).

FIG 2 — FgSey1 plays an important role in vegetative growth. (A) The growth of PH-1, Δ*Fgsey1* (numbers [no.] 1 and 2), and Δ*Fgsey1/FgSEY1* strains on PDA medium. Strains were cultured at 25°C for 3 days and photographed. Statistical analysis was of colony diameters of all strains. The graphs represent the averages from three experiments. Bars with the same lowercase letters (a or b) have no statistically significant difference between their means (± SDs); a significant difference (P < 0.01) is present between bars with different letters. (B) Heights of aerial mycelia of the indicated strains in test tubes containing PDA medium at 25°C for 3 days. Statistical analysis was of colony height. The graphs represent the averages from three experiments. Different letters indicate a significant difference (P < 0.01). (C) Hyphal growth of PH-1, Δ*Fgsey1* (no. 1 and 2), and Δ*Fgsey1/FgSEY1* colonies. Bar, 100 μm.

FgSey1 is required for asexual development but not for sexual reproduction.

In the FHB disease cycle, asexual and sexual reproduction of F. graminearum play essential roles during plant infection (38, 39). First, to assess whether FgSey1 is required for asexual development, we examined conidial production of the wild-type (WT) PH-1, ΔFgsey1, and ΔFgsey1/FgSEY1 strains in carboxymethyl cellulose (CMC) medium. As shown in Fig. 3A, the number of conidia in the ΔFgsey1 mutant was decreased significantly compared with that of the WT PH-1 and ΔFgsey1/FgSEY1 strains. To further examine conidial morphology, conidia of each strain were stained with calcofluor white. As expected, the majority of conidia produced by the wild-type (73%) and ΔFgsey1/FgSEY1 (65%) strains had a normal number of septa (4 to 7 septa) (Fig. 3B). In contrast, 53% of the conidia had only three septa (47%) or two septa (6%) in the ΔFgsey1 mutant (Fig. 3B). Second, we examined whether FgSey1 is involved in sexual reproduction. We found that the WT PH-1, ΔFgsey1, and ΔFgsey1/FgSEY1 strains produced abundant perithecia and normal ascospores on carrot agar plates by 2 weeks postfertilization (Fig. 3C). These results indicate that FgSey1 is involved in asexual development but not sexual reproduction in F. graminearum.

FIG 3 — Asexual development, but not sexual reproduction, is defective in the Δ*Fgsey1* mutant. (A) Quantification of conidia produced by PH-1, Δ*Fgsey1* (no. 1 and 2), and Δ*Fgsey1/FgSEY1* strains. Error bars represent the SDs from three independent experiments. Different lowercase letters indicate significant difference (P < 0.05). (B) Conidium morphology of the indicated strains cultured in carboxymethyl cellulose (CMC) medium for 5 days. The septa were stained with calcofluor white and visualized by fluorescence microscopy. Quantification of the percentages of spores with the number of septa in three categories: ≤2, 3, and 4 to 7. At least 300 spores were counted in at least three fields for each strain. Error bars represent standard deviations. Bar, 10 μm. (C) Assays for sexual reproduction of the indicated strains. Perithecia of all strains formed on carrot agar plates 14 days after sexual induction (left). Ascospores observed under a microscope after extrusion from perithecia (right).

FgSey1 is involved in pathogenicity and DON production.

To determine whether FgSey1 is essential for plant infection, we inoculated wheat heads with conidia of WT PH-1, ΔFgsey1, and ΔFgsey1/FgSEY1 strains. The WT and complementation strains caused obvious head blight symptoms 14 days postinoculation (Fig. 4A), suggesting full virulence. In contrast, the ΔFgsey1 mutant failed to spread to adjacent neighboring spikelets and caused no symptoms (Fig. 4A), representing attenuated virulence. To extend our analysis, we used another infection assay with wheat coleoptiles by droplet inoculation. As expected, compared with the obvious lesion development in the WT and complemented strains, the ΔFgsey1 mutant caused only limited lesion development at the inoculation sites (Fig. 4B). These data suggest that FgSey1 is important for full virulence in F. graminearum during plant infection.

FIG 4 — FgSey1 is important for full virulence of *F. graminearum*. (A) Flowering wheat heads were inoculated with conidial suspensions of PH-1, Δ*Fgsey1* (no. 1 and 2), and Δ*Fgsey1/FgSEY1* strains and examined at 14 dpi. Disease index was determined from the number of symptomatic spikelets per wheat head. At least 30 wheat heads infected with each strain were counted for each strain. Mean (± SD) values with the same lowercase letters (a or b) are not statistically different; a significant difference (P < 0.01) is present between those with different letters. (B) Wheat coleoptiles were inoculated with 2 μl of conidial suspension (2 × 10⁵ spores/ml) and examined at 10 dpi. At least 30 wheat coleoptiles inoculated with each strain were examined. Different letters indicate a significant difference (P < 0.01). (C) DON production in wheat seeds infected with the indicated strains after 20 days of incubation. (D) Relative expression levels of *TRI1*, *TRI4*, *TRI5*, *TRI6*, and *TRI10* in the PH-1 and Δ*Fgsey1* mutant strains by quantitative real-time PCR. The GAPDH gene was used as an internal control. Different letters indicate a significant difference (P < 0.01).

Previous work showed that DON is essential for virulence in F. graminearum (8, 40, 41). Therefore, we assayed DON production in the WT PH-1, ΔFgsey1, and ΔFgsey1/FgSEY1 strains on autoclaved rice grains in flasks. DON production in the ΔFgsey1 mutant was very low, with DON levels at only 0.01 mg/mg of ergosterol. However, DON production in WT (4.16 mg/mg of ergosterol) and complemented (4.08 mg/mg of ergosterol) strains was considerably greater than in the ΔFgsey1 mutant (Fig. 4C). Furthermore, we used quantitative real-time (qRT)-PCR to determine the transcription levels of the DON biosynthesis-related genes TRI1, TRI4, TRI5, TRI6, and TRI10. The expression levels of the five genes in the ΔFgsey1 mutant were decreased remarkably (Fig. 4D). Collectively, these results suggest that FgSey1 is required for TRI gene expression and DON production and are consistent with a significant reduction in virulence in the ΔFgsey1 mutant.

FgSey1 controls pigment metabolism.

In addition to DON, the pigment aurofusarin is an important secondary metabolite in F. graminearum (42). Therefore, we tested whether FgSey1 is required for pigment metabolism. When WT PH-1, the ΔFgsey1 mutant, and the ΔFgsey1/FgSEY1 complemented strain were cultured in potato-dextrose broth for 3 days, the ΔFgsey1 mutant exhibited a yellowish pigment, which is different from the pigment in the WT and complement strains, suggesting that FgSey1 is involved in pigment metabolism (Fig. 5A). We further detected the expression levels of five aurofusarin biosynthetic-related genes by qRT-PCR. The results confirmed that GIP1, GIP2, PKS12, AURJ, and AURF were significantly downregulated in the ΔFgsey1 mutant. These results indicate that FgSey1 is involved in pigment biosynthesis in F. graminearum.

FIG 5 — Defective pigmentation of the Δ*Fgsey1* mutant. (A) Comparison of pigmentation of the indicated strains inoculated in flasks containing 100 ml liquid PDB medium for 3 days at 25°C. (B) Transcription levels of aurofusarin biosynthesis-related genes *GIP1*, *GIP2*, *PKS12*, *AURJ*, and *AURF* in the PH-1 strain and the Δ*Fgsey1* mutant. The GAPDH gene was used as an internal control. Different letters indicate a significant difference (P < 0.05).

FgSey1 is essential for response to various stressors.

The resistance to environmental stresses is critical for plant infection by F. graminearum. We examined the response of the ΔFgsey1 mutant to various environmental stresses. First, The WT PH-1, the ΔFgsey1 mutant, and the complemented strain were cultured on complete medium (CM) plates with osmotic (sorbitol, NaCl, KCl, and CaCl₂) and oxidative (H₂O₂) stresses, respectively. The inhibition rates of the ΔFgsey1 mutant increased significantly compared with that of the WT, except for cultures treated with KCl (Fig. 6A, B, E, and F), suggesting that FgSey1 may play a role in osmoregulation and tolerance to oxidative stress. Second, to determine the effect of FgSey1 on cell wall integrity, the same strains were cultured on CM plates with cell wall stressors (SDS and Congo red [CR]). The results showed that the ΔFgsey1 mutant expressed increased resistance to cell wall stressors (Fig. 6C and G), suggesting the cell wall integrity of the ΔFgsey1 mutant is increased. Third, as the function of FgSey1 is related to the ER, we determined the sensitivity of mutants to ER stress (dithiothreitol [DTT]). Surprisingly, the ΔFgsey1 mutant expressed increased resistance to DTT-induced ER stress compared to that of the WT and complemented strains (Fig. 6D and H), indicating that FgSey1 is involved in responses to ER stress.

FIG 6 — Vegetative growth of PH-1, Δ*Fgsey1*, and Δ*Fgsey1/FgSEY1* strains under different stress conditions. (A) The PH-1, Δ*Fgsey1*, and Δ*Fgsey1/FgSEY1* strains were inoculated on CM containing sorbitol, NaCl, KCl, or CaCl₂. (B) The indicated strains were inoculated on CM with 2.5 mM or 5 mM H₂O₂. (C) Cultures of all strains grown on CM with SDS or Congo red (CR). (D) The indicated strains were grown on CM with 5 mM or 10 mM DTT. (E to H). Statistical analyses of inhibition based on colony diameters after incubation for 3 days. Means and standard deviations were calculated from three replicates. Different letters indicate significant differences (P < 0.05).

The final ER morphology is normal in the ΔFgsey1 mutant.

DON biosynthesis is dependent on the formation of toxisomes, which require ER remodeling under toxin-inducing conditions (17). Because Sey1/atlastin mediates ER membrane fusion in yeast and mammalian cells, we examined ER morphology to detect possible defects under toxin-inducing conditions. The results showed that the ER morphology was normal in the ΔFgsey1 mutant compared with that of WT PH-1 (see Fig. S3). Therefore, like the function of ScSey1 in yeast, the absence of FgSey1 may result in delayed ER fusion but does not affect the ultimate ER morphology (24).

FgSey1 is involved in formation of lipid droplets and toxisomes.

During plant infection, a large number of LDs, which are associated with toxisome formation, are synthesized in F. graminearum (37). In eukaryotes, LDs are synthesized on endoplasmic reticulum, while the mammalian dynamin-like GTPase protein atlastin, ATL1 (the ortholog of FgSey1), is involved in the regulation of normal LD formation (20). Therefore, we further examined whether FgSey1 regulates the biosynthesis of LDs in F. graminearum. To directly monitor LD formation, we detected LDs by Nile red staining of the WT, ΔFgsey1 mutant, and complemented strains grown in CM and trichothecene biosynthesis induction (TBI) liquid medium. As shown in Fig. 7A, LDs were synthesized in large quantities in the WT and complemented strains under toxin-inducing conditions compared with the quantity of LDs produced in CM. However, in the ΔFgsey1 mutant, only a few LDs formed under toxin-inducing conditions. These data suggest that FgSey1 participates in the formation of LDs in F. graminearum under toxin-inducing conditions. To extend our analysis, we visualized the localization of Tri4-GFP in all strains to directly monitor toxisome formation. Under toxin-inducing conditions, most of the Tri4-GFP signals accumulated in a crescent-shaped structure in the WT and complemented strains, indicating normal toxisome formation (Fig. 7B). In contrast, no Tri4-GFP signals were detected in the ΔFgsey1 mutant, indicating a defect in toxisome formation (Fig. 7B). This result is consistent with the defective LDs synthesized in the ΔFgsey1 mutant.

FIG 7 — FgSey1 is essential for LD biogenesis and toxisome formation. (A) Abnormal LD biogenesis in the Δ*Fgsey1* mutant. The PH-1 and Δ*Fgsey1* strains were inoculated in CM and toxin-inducing medium (TBI) for 2 days at 25°C. The LD patterns in hyphae were stained with Nile red. Bar, 10 μm. (B) Toxisome formation in the PH-1 and Δ*Fgsey1* strains. WT and mutant strains were tagged with Tri4-GFP plasmids and incubated in CM and TBI for 3 days at 25°C. Bar, 10 μm.

In S. cerevisiae, ScSec22, a SNARE protein, is required for Sey1p-mediated ER fusion (43). A recent study showed that FgSec22 also regulates plant infection in F. graminearum but is not involved in toxisome formation (44). Therefore, we examined whether FgSec22, as coregulator with FgSey1 in ER fusion, is involved in the biosynthesis of LDs. Under toxin-inducing conditions, a large number of LDs were generated in both the WT PH-1 and the ΔFgsec22 mutant (see Fig. S4). This phenotype is consistent with the conclusion that toxisome formation is normal in the ΔFgsec22 mutant (44). However, the phenotype of the ΔFgsec22 mutant was different from that of the ΔFgsey1 mutant. This different phenotype suggests that FgSey1 is involved in LD formation regulated in some way other than Sey1p-mediated ER fusion.

Functional analysis of FgSey1 domains.

Protein sequence analysis indicated that FgSey1 was 35% homologous with ScSey1 (Fig. S1). The Phyre2 protein fold recognition server (45) predicted that both FgSey1 and ScSey1 are structured with four tandemly arranged domains and have more than 90% similarity (Fig. 8A) (25, 46), suggesting that FgSey1 and ScSey1 have similar structures and functions. Consistent with ScSey1, FgSey1 has a conserved domain structure: a GTPase domain, helix bundle domain, two transmembrane segments, and a cytosolic tail domain (Fig. 8B). We cloned FgSEY1 lacking GTPase, helix bundles (HBs), transmembrane segments (TMs), or a cytosolic tail (CT) domain (FgSey1^ΔGTPase, FgSey1^ΔHBs, FgSey1^ΔTMs, and FgSey1^ΔCT, respectively). Then, we transformed FgSey1^ΔGTPase, FgSey1^ΔHBs, FgSey1^ΔTMs, and FgSey1^ΔCT separately into the ΔFgsey1 mutant. The results indicated that the absence of any of the FgSey1 domains reduced the vegetative growth and pathogenicity of F. graminearum (Fig. 8C). We also examined the effect of different FgSey1 domains on LD formation. The results showed that the absence of any of the four domains of FgSey1 blocked LD synthesis in F. graminearum under toxin-inducing conditions (Fig. 8D). This result is consistent with the defects in pathogenicity. Furthermore, we visualized the localization of FgSey1 mutants that lack one of the four domains. Except for the TM domain, removal of other domains did not affect FgSey1 localization in the ER (Fig. 8E). This observation suggests that the TM domain is required for normal localization of FgSey1, while GTPase, HB, and CT domains are important for FgSey1 function in the ER.

K63 and T87 of FgSey1 may play important roles in vegetative growth, pathogenesis, and LD biosynthesis.

The GTPase domain of FgSey1 folds in a similar manner as other dynamin-like proteins (Fig. 8A). FgSey1 also contains a phosphate binding loop (P-loop) GTP-binding motif at amino acids 57 to 64 in the sequence GXXXXGKS and a Walker A motif at amino acids 71 to 79 in the sequence XXXXTXXXX. In yeast cells, mutant K50A (equivalent to FgSey1 K63A) or T75A (equivalent to FgSey1 T87A) of ScSey1 reduces the enzymatic activity of the GTPase (25). Furthermore, creating the A592V mutation of ScSey1 (equivalent to FgSey1 A644V) causes defects in ER morphology but does not affect the enzymatic activity of the GTPase (24). To determine the roles of K63, T87, and A644, we created the FgSey1^K63A, FgSey1^T87A, and FgSey1^A644V mutants and transformed them into the ΔFgsey1 mutant. FgSey1^K63A and FgSey1^T87A both failed to rescue the defects in vegetative growth, pathogenesis, and LD biosynthesis of the ΔFgsey1 mutant. In contrast, FgSey1^A644V suppressed the phenotypic defects in the ΔFgsey1 mutant (Fig. 9A and B). These results indicate that the GTPase activity of FgSey1 is essential for vegetative growth, pathogenicity, and LD formation.

FIG 9 — Characterization of FgSey1 mutants. (A) Vegetative growth of PH-1, Δ*Fgsey1*, Δ*Fgsey1/FgSEY1^K63A*, Δ*Fgsey1/FgSEY1^T87A*, and Δ*Fgsey1/FgSEY1^A644V* strains. Pathogenicity of the indicated strains on wheat coleoptiles; more than 30 inoculated wheat heads were counted for each strain. Mean (± SD) values with different lowercase letters (a and b) are significantly different (P < 0.01). (B) The LD patterns in hyphae were stained with Nile red in CM and TBI medium. Bar, 10 μm.

DISCUSSION

The ER is an essential organelle involved in the formation of toxisomes, which play a key role in plant infection by F. graminearum (11, 17, 18). In yeast and mammalian cells, Sey1/atlastin, an ER-associated protein, has been shown to participate in ER fusion, the size of LDs, and store-operated calcium entry (20, 23, 24, 28, 29). To our knowledge, the role of the Sey1 protein in the pathogenicity of pathogenic fungi is unknown. In this study, we characterized the functions of FgSey1, a homolog of the yeast ScSey1 protein, in F. graminearum. Our data demonstrate that FgSey1 functions not only in vegetative growth but also in plant infection.

In eukaryotes, Sey1/atlastin is generally accepted to be located in the ER and to play an important role in the fusion of ER membranes (27, 47). In S. cerevisiae, fusion of the ER requires 4 min in the WT and 25 min in ScSey1 deletion mutants (24). But the absence of ScSey1 does not affect the final ER morphology or the vegetative growth in yeast (26, 28). We predicted and analyzed the protein structure of FgSey1 in F. graminearum and found that it is very similar to that of ScSey1. We speculated that FgSey1 may have functions analogous to those of yeast ScSey1. As expected, FgSey1 is also located in the ER, and the final ER morphology is normal in the ΔFgsey1 mutant, consistent with ScSey1 in S. cerevisiae. However, the FgSey1 deletion mutants displayed a reduced hyphal growth rate, in contrast to the function of ScSey1 in S. cerevisiae. The red pigment aurofusarin is a secondary naphthoquinone metabolite of phytopathogenic species of Fusarium (48). Our results showed that the ΔFgsey1 mutant displays reduced accumulation of red pigment, indicating that FgSey1 affects aurofusarin biosynthesis. Conidia and perithecia are essential for development and pathogenesis in F. graminearum. We have shown here that the formation of conidia is reduced in the ΔFgsey1 mutant, but sexual reproduction is normal.

Physiological processes in fungi are often regulated by many environmental factors. In this study, we showed that absence of the FgSey1 gene resulted in increased tolerance to cell wall stressors and DTT-induced ER stress. In contrast, the ΔFgsey1 mutant was more sensitive to osmotic and oxidative stresses. Biosynthesis of pigments in filamentous fungi may reduce the consequences of excessive oxidation stress (49). We conclude that due to the decrease of pigments, the ability of the ΔFgsey1 mutant to eliminate H₂O₂ was reduced. Taken together, our results indicate that FgSey1 is important for response to various stresses.

DON, an important virulence factor in F. graminearum, is synthesized during plant infection. Compared with that in WT PH-1, the production of DON was decreased significantly in the ΔFgsey1 mutant. DON biosynthesis depends on the TRI gene cluster, and our qRT-PCR assays confirmed that FgSey1 positively affected the expression of trichothecene biosynthesis genes TRI5, TRI6, and TRI10. Therefore, FgSey1 is required for virulence in F. graminearum.

The ER plays a role in the biosynthesis of DON, which requires the formation of toxisomes on the ER (11), a large organelle with various key functions. Recent studies have shown that the formation of toxisomes is related to the generation of LDs during DON biosynthesis in vitro and in planta (37). LDs are also produced in the ER, and Atl1, as an ER-associated protein, has been shown to regulate the size of LDs in mammalian cells (20). Deletion of FgSey1 resulted in significant defects in LD and toxisome generation under toxin-inducing conditions, suggesting that FgSey1 positively regulates the formation of LDs and toxisomes. The conclusion that Sey1/atlastin mediates the fusion of ER membranes is generally accepted. In S. cerevisiae, the SNARE protein Sec22 participates in the Sey1-mediated ER fusion (43). Recently, it was reported that FgSec22 is also involved in DON biosynthesis and pathogenicity in F. graminearum (44). We found that LDs were normally generated in the ΔFgsec22 mutant, and this result is consistent with the observation that FgSec22 is not involved in toxisome formation (44), suggesting that regulation of pathogenicity by FgSec22 and FgSey1 involves different mechanisms. In S. cerevisiae, mutant A592V of ScSey1 (equivalent to FgSey1 A644V) impaired normal ER fusion. However, our data showed that in the ΔFgsey1 mutant, defective vegetative growth, pathogenicity, and generation of LDs were rescued by FgSey1^A644V. These data suggest that LD and toxisome generation depends on FgSey1 but not FgSey1-mediated ER fusion.

Four domains of Sey1 are highly conserved in fungi. An N-terminal dynamin-related GTPase domain of Sey1/atlastin forms a dimer upon GTP binding (50). Sey1/atlastin has a fully folded 3-helix bundle, docks to its own GTPase domain, and connects to the GTPase domain via a short linker (46, 51). Sey1/atlastin possesses two closely spaced transmembrane helices which cannot be replaced by the TM domains from other proteins (21, 52). The lack of the C-terminal tail with an amphipathic helix reduces the activity of Sey1/atlastin (52). In yeast and mammalian cells, the absence of the GTPase, HB, or TM domain results in the loss of all Sey1/atlastin functions. In contrast, absence of only the CT domain reduced Sey1/atlastin activity. Our data showed that absence of any of the four domains impaired normal vegetative growth, pathogenicity, and LD formation induced by toxins of F. graminearum, and these defective phenotypes are not different in the ΔFgsey1 mutant, indicating that the absence of any domain resulted in the complete loss of function of FgSey1. GTP-binding motifs and the Walker A motif play a key role in the enzymatic activity of the GTPase domain. Mutant FgSey1^K63A or FgSey1^T87A lost all FgSey1 functions. These results indicate that the enzymatic activity of GTPase is required for growth, pathogenicity, and LD formation in F. graminearum.

In summary, we demonstrated that FgSey1 is involved in asexual reproduction, vegetative growth, TRI gene expression, DON production, stress response, and pathogenicity. In addition, FgSey1 participates in the generation of LDs and toxisomes, which play a key role in plant infection. The GTPase activity of FgSey1 is required to maintain its own function.

MATERIALS AND METHODS

Fungal strains and culture conditions.

The F. graminearum wild-type strain PH-1 was used as the parental strain in this study. The WT (PH-1) and its generated mutants were grown on potato-dextrose agar (PDA) and complete medium (CM) at 26°C for hyphal examination. Carboxymethyl cellulose (CMC) liquid medium was used to analyze induction of asexual reproduction (53). For testing growth under various stress conditions, mycelial growth was assayed on CMC agar plates supplemented with 1 M sorbitol, 0.7 M NaCl, 0.7 M KCl, 0.2 M CaCl₂, 0.2 g/liter Congo red (CR), 0.05% SDS, 2.5 mM, and 5 mM H₂O₂ or 5 mM and 10 mM dithiothreitol (DTT). TB3 medium (6 g yeast extract, 6 g acid-hydrolyzed casein, 200 g of sucrose per liter) was used for recovery of fungal protoplasts and selection of transformants. LB medium (10 g NaCl, 5 g yeast extract, 10 g tryptone per liter and adjusted to pH 7.0) was used for growing competent bacterial cells after transformation (54). Mycelia were grown in potato-dextrose broth (PDB) and used for extraction of genomic DNA and total RNA. Each experiment was repeated at least three times.

Phylogenetic analysis, sequence alignment, and domain architecture.

The phylogenetic tree and amino acid sequence comparison were generated with Mega 7.0 and ClustalW, respectively. The determination of functional domains of FgSey1 was based on the previously reported C. albicans Sey1p (CaSey1) and S. cerevisiae Sey1p (ScSey1) (25). Modeling and prediction of the protein structure of FgSey1 were finished on the Web portal of protein modeling, prediction, and analysis (Phyre²; http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index).

Gene deletion and complementation.

The gene knockout strains in the PH-1 background were performed with the split-marker approach (55). For the FgSEY1 gene disruptions, the entire coding regions were replaced with the hygromycin resistance cassette (HPH). The deletion mutants were identified by PCR and further confirmed by Southern blotting. For complementation assays, the open reading frame (ORF) of FgSEY1 with 1,500 bp of the 5′ promoter region but without the stop codon was amplified from the F. graminearum genome and cloned by gap repair into the pFL2 vector (2 μM, neomycin resistance) harboring green fluorescent protein (GFP). The FgSEY1-GFP complemented strains were screened by PCR and GFP signals. Different FgSey1 domain deletions and point mutation constructs were generated by overlap PCR (56), and the PCR products were cloned into the pFL2 vector. These plasmids were transformed into protoplasts of the ΔFgsey1 mutant, and the resulting transformants were screened by PCR and GFP signals. Primers used for these experiments are listed in Table 1.

TABLE 1.

Primers used in this study

Primer name	Oligonucleotide sequence (5′→3′)	Remark
FgSey1-1F	TCAGTGGAGGATGGATTAGGTAGA	For FgSEY1 5′ flank sequence amplification
FgSey1-2R	TTGACCTCCACTAGCTCCAGCCAAGCCAGGAGAAAGAAAGAATGAACCACA	For FgSEY1 5′ flank sequence amplification
FgSey1-3F	GAATAGAGTAGATGCCGACCGCGGGTTAAAGTTCCAATAACAAAAGTCCCAT	For FgSEY1 3′ flank sequence amplification
FgSey1-4R	CTTCAACCAACCGACCCTTC	For FgSEY1 3′ flank sequence amplification
FgSey1-5F	AAGGAAAGACGCACGCATAG	For FgSEY1 gene probe amplification
FgSey1-6R	GTAGCCACCGTTGAAGCAG	For FgSEY1 gene probe amplification
FgSey1-MF	GCCAGACCATCCACAGTAGC	For identification of FgSEY1 deletion transformants
FgSey1-MR	GTCAGGCAGAACAGTTGGAA
FgSey1-K1F	ACAGTGGCATACGAATCAGC
FgSey1-K1R	ATGTTGGCGACCTCGTATTGG
FgSey1-K2F	ACCTATTCTACCCAAGCATCCAA
FgSey1-K2R	GTCAAGGGATTTTAGCCGTG
HYG/F	GGCTTGGCTGGAGCTAGTGGAGGTCAA	For HPH-N sequence amplification
HY/R	GTATTGACCGATTCCTTGCGGTCCGAA	For HPH-N sequence amplification
YG/F	GATGTAGGAGGGCGTGGATATGTCCT	For HPH-C sequence amplification
HYG/R	AACCCGCGGTCGGCATCTACTCTATTC	For HPH-C sequence amplification
FgSey1-CF	ATCGTGGTTCTCATCACCATCACCATCACTCGAGCTGTGCAAGTGGGAAGTGAGAG	For FgSEY1 complementation and subcellular localization
FgSey1-CR	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGCTGGCTCAATATGGAGCCAC	For FgSEY1 complementation and subcellular localization
FgSey1-GFP-1F	ATCGTGGTTCTCATCACCATCACCATCACTCGAGCTGTGCAAGTGGGAAGTGAGAG	For FgSey1-GFP fusion construct generation
FgSey1-GFP-2R	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGAATGTCATCAATGTCGTCCTTCTC	For FgSey1-GFP fusion construct generation
FgSey1^ΔGTPase-1F	ATCGTGGTTCTCATCACCATCACCATCACTCGAGCTGTGCAAGTGGGAAGTGAGAG	For FgSEY1 GTPase domain deletion construct generation
FgSey1^ΔGTPase -2R	AGATCCAGATCCTTGTTGTTCACGATATGCGATTGTGGTATATATCGAAAAGT
FgSey1^ΔGTPase-3F	ACTTTTCGATATATACCACAATCGCATATCGTGAACAACAAGGATCTGGATCTGC
FgSey1^ΔGTPase-4R	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGAATGTCATCAATGTCGTCCTTCTC
FgSey1^ΔHBs-1F	ATCGTGGTTCTCATCACCATCACCATCACTCGAGCTGTGCAAGTGGGAAGTGAGAG	For FgSEY1 HB domain deletion fusion construct generation
FgSey1^ΔHBs-2R	GAAGTACCACGGAATCTGGGCAACTCCGCCGGTGGGCAGATCCAGATCC
FgSey1^ΔHBs-3F	GGATCTGGATCTGCCCACCGGCGGAGTTGCCCAGATTCCGTGGTACTTC
FgSey1^ΔHBs-4R	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGAATGTCATCAATGTCGTCCTTCTC
FgSey1^ΔTMs-1F	ATCGTGGTTCTCATCACCATCACCATCACTCGAGCTGTGCAAGTGGGAAGTGAGAG	For FgSEY1 TM domain deletion fusion construct generation
FgSey1^ΔTMs-2R	GGCAGCATTGCTCATTGAAAGCATGGGACCAAGCAGTCCGCCAATGGCTCCACG
FgSey1^ΔTMs-3F	GTATACGTCGAAGCTAAGCGTGGAGCCATTGGCGGACTGCTTGGTCCCATGCTTTC
FgSey1^ΔTMs-4R	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGAATGTCATCAATGTCGTCCTTCTC
FgSey1^ΔCT-1F	ATCGTGGTTCTCATCACCATCACCATCACTCGAGCTGTGCAAGTGGGAAGTGAGAG	For FgSEY1 CT domain deletion fusion construct generation
FgSey1^ΔCT-2R	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGACCAAGCAGGTTAAGTGTGTATG	For FgSEY1 CT domain deletion fusion construct generation
EF1α-F	CAAGATTGGCGGTATTGGAAC	For identification of cDNA
EF1α-R	AGGAGGGTAGTCGGTGAAAGC	For identification of cDNA
GAPDH-F	CTTACTGCCTCCACCAACTG	For qRT-PCR analysis
GAPDH-R	TGACGTTGGAAGGAGCGAAG	For qRT-PCR analysis
TRI1-QF	TTGAACACTACCTCGGTGCT	For FgTRI1 qRT-PCR analysis
TRI1-QR	AGTTCGCGAGCATTCTTGAC	For FgTRI1 qRT-PCR analysis
TRI4-QF	CCTGGTCTGGTCACCATTCT	For FgTRI4 qRT-PCR analysis
TRI4-QR	ATGGCCAGTGTCCTTGAAGT	For FgTRI4 qRT-PCR analysis
TRI5-QF	GAGTGTTTCATGCATGGCTACGTC	For FgTRI5 qRT-PCR analysis
TRI5-QR	CTGAGCCTCCTTCACATCGTCC	For FgTRI5 qRT-PCR analysis
TRI6-QF	CTGAGGGCATTCTGAGTAGCGACA	For FgTRI6 qRT-PCR analysis
TRI6-QR	CGTTATGTTTATCGGCACTTTG	For FgTRI6 qRT-PCR analysis
TRI10-QF	GCGACAGGAGCAAGAACATAA	For FgTRI10 qRT-PCR analysis
TRI10-QR	GGCGGCGTAAATCTGAGTG	For FgTRI10 qRT-PCR analysis
GIP1-QF	TGCGGTATCAGGTCACAAA	For FgGIP1 qRT-PCR analysis
GIP1-QR	ATCAAAGTCTCCCACCGTGAA	For FgGIP1 qRT-PCR analysis
GIP2-QF	CACCAGCCCTACACCATCTAA	For FgGIP2 qRT-PCR analysis
GIP2-QR	TTTCCAAAGCGAGAAACAGC	For FgGIP2 qRT-PCR analysis
PKS12-QF	TGGTGTAGATGCTGTTCGTGT	For FgPKS12 qRT-PCR analysis
PKS12-QR	TGAACTTTTCGAGGACGGAT	For FgPKS12 qRT-PCR analysis
AURJ-QF	AAAAAGCAGCCAAGGAGCAT	For FgAURJ qRT-PCR analysis
AURJ-QR	TTCTGATGACACGCTCCCGTA	For FgAURJ qRT-PCR analysis
AURF-QF	ATCTTCAGTCTTGACCATCCC	For FgAURF qRT-PCR analysis
AURF-QR	TACCCAAGATGTTCTGGCAA	For FgAURF qRT-PCR analysis
FgSey1^K63A-1F	ATCGTGGTTCTCATCACCATCACCATCACTCGAGCTGTGCAAGTGGGAAGTGAGAG	For FgSEY1^K63A point mutation
FgSey1^K63A-2R	ACTCGGTACCAAAGAGGTTGTTGAGCAGGGTGGACGCTCCGGTGGACT
FgSey1^K63A-3F	AGTCCACCGGAGCGTCCACCCTGCTCAACAACCTCTTTGGTACCGAGT
FgSey1^K63A-4R	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGAATGTCATCAATGTCGTCCTTCTC
FgSey1^T87A-1F	ATCGTGGTTCTCATCACCATCACCATCACTCGAGCTGTGCAAGTGGGAAGTGAGAG	For FgSEY1^T87A point mutation
FgSey1^T87A-2R	ACATCCAGATACCCTTTGCGGTTTGCC
FgSey1^T87A-3F	GCGTCGGCAAACCGCAAAGGGTAT
FgSey1^T87A-4R	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGAATGTCATCAATGTCGTCCTTCTC
FgSey1^A644V-1F	ATCGTGGTTCTCATCACCATCACCATCACTCGAGCTGTGCAAGTGGGAAGTGAGAG	For FgSEY1^A644V point mutation
FgSey1^A644V-2R	GTGAGAGTAGACTCTCTCACCTTGG
FgSey1^A644V-3F	CGAGGGAATTTATACCAAGGTGAGAG
FgSey1^A644V-4R	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGAATGTCATCAATGTCGTCCTTCTC
mcherry-1F	CAGGATGACAACATCCACGACGAGTTGATGTTGAGCAAGGGCGAG	For FgKAR2-mCherry fusion construct generation
mcherry-2R	AATGTTGAGTGGAATGATGGGATCCAAGCTCGAGTTACTTGTACAGCTCGTCCATGCC
FgKar2-mcherry-3F	CTCATCACCATCACCATCACTCGAGTCCAAGCCGGTACAGACG
FgKar2-mcherry-4R	GTTATCCTCCTCGCCCTTGCTCAACATCAACTCGTCGTGGATGTTGTC
GFP-1F	ATGGTGAGCAAGGGCGAG	For FgSEY1-GFP fusion construct generation
GFP-2R	TTACTTGTACAGCTCGTCCATGC	For FgSEY1-GFP fusion construct generation
Tri4-GF	ATCGTGGTTCTCATCACCATCACCATCACTCGAGTCCCGACGATGTGGTTATAT	For FgTRI4-GFP fusion construct generation
Tri4-GR	GGTGAACAGCTCCTCGCCCTTGCTCACCTCGAGCAAAGCCTTGAGAACCTTGA	For FgTRI4-GFP fusion construct generation

Open in a new tab

Sexual reproduction assays.

For sexual reproduction assays, 7-day-old aerial hyphae were gently pressed down on carrot agar (CA) plates after the addition of 2.5% Tween 20 solution (57). The experiment was repeated at least three times.

Plant infection and DON production assays.

Virulence assays on flowering wheat heads were performed as previously described (58). Briefly, a 10-μl aliquot of conidial suspension (2 × 10⁵ spores/ml in sterile distilled water) was injected into a floret of the flowering wheat head of Triticum aestivum L. cv. Jimai 22. Disease index was determined and photographs were taken at 14 days postinoculation (dpi).

For wheat coleoptile infection assays, a 2.5-μl aliquot of conidial suspension (2 × 10⁶ spores/ml in sterile distilled water) was applied, and symptoms were observed 8 dpi (59). At least 10 plants were inoculated with each strain.

For DON production assays, three mycelial plugs of each strain were inoculated with 5 g of autoclaved rice grains. After 20 days of incubation at 25°C, DON was extracted, and concentrations were determined by a high-performance liquid chromatography tandem mass spectrometry (HPLC-MS/MS) system (AB Sciex, 5500) (59). Each experiment was repeated at least three times.

Quantitative RT-PCR analysis.

Total RNA of F. graminearum from DON induction medium was extracted with the RNAiso reagent (TaKaRa Biotechnology Co., Dalian, China). cDNA synthesis was performed using the oligonucleotide primers and M-MLV reverse transcriptase (Invitrogen). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as the internal control. Quantitative real-time reverse transcriptase PCR (qRT-PCR) calculations analyzing the relative gene expression levels were performed according to the threshold cycle (2^−ΔΔ^CT) method described previously (60). The primers for qRT-PCR are presented in Table 1. The experiment was repeated at least three times.

Fluorescence microscopy observations.

For live-cell fluorescence microscopy, conidia and fresh mycelia expressing fluorescent proteins or stained with calcofluor white (CFW) or Nile red were examined by Nikon fluorescence microscopy (Nikon Eclipse Ni) or by confocal microscopy (Zeiss LSM 880 NLO system). Each experiment was repeated at least three times.

For histochemical analysis of lipid droplets, mycelial agar blocks were inoculated in 100 ml of CM or TBI liquid medium (30 g sucrose, 800 mg putrescine, 1 g KH₂PO₄, 0.5 g MgSO₄·7H₂O, 0.5 g KCl, 10 mg FeSO₄·7H₂O, 200 μl trace elements [per 100 ml: 5 g citric acid, 5 g ZnSO₄, 0.25 g CuSO₄·5H₂O, 0.05 g MnSO₄·H₂O, 0.05 g H₃BO₃, 0.05 g Na₂MoO₄·2H₂O], double distilled water [ddH₂O] up to 1 liter and adjusted to pH 4.5 with NaOH). Cultures were grown at 25°C for 2 days in a shaker (200 rpm) in the dark, and freshly harvested mycelia were stained on a slide with 50 mg/ml Nile red for 5 to 10 min. Lipid droplets were observed with a confocal microscope.

Construction of Tri4-GFP expression vectors and analysis of their subcellular localization.

The sequences of Tri4 were amplified by PCR and cloned into pFL2-GFP vector using the One Step cloning kit (Vazyme Biotech Co., Ltd.). This construct was later verified by sequencing. Tri4-GFP constructs were then transformed into PH-1 and ΔFgsey1 mutant protoplasts separately, followed by subcellular localization analyses. Similarly, transformants were screened by PCR and further confirmed by detection of fluorescence signals.

Statistical analyses.

All the experimental data were collected from three independent samples to ensure reproducibility of the trends and relationships observed in the cultures. Each error bar indicates the standard deviation (SD) from the mean obtained from triplicate samples. The sample means were analyzed with Student's t tests. Differences in mean values between groups were analyzed by one-way analyses of variance (ANOVAs) followed by Duncan’s multiple range tests.

Data availability.

Accession numbers of the sequences are as follows: FgSey1 (XP_011316549.1) from F. graminearum; FoSey1 (XP_018233087.1) from F. oxysporum; MoSey1 (XP_003709728.1) from M. oryzae; CaSey1 (XP_712426.1) from C. albicans; NcSey1 (XP_963374.1) from N. crassa; Atl1 (NP_056999.2), Atl2 (NP_001129145.1), and Atl3 (NP_056274.3) from Homo sapiens; and AtRhd3 (NP_188003.1) from Arabidopsis thaliana.

Supplementary Material

Supplemental file 1

AEM.02720-19-s0001.pdf^{(5.2MB, pdf)}

ACKNOWLEDGMENTS

This work was supported by grants from the Natural Science Foundation of China (31301173 to S.Z. and 31772247 to H.D.), China National Key Research and Development Plan (2017YFD0200901 to H.D.), Shandong Agricultural University Talent Introduction Funding (20171226 to H.D.), and Shandong Province Key Research and Development Plan (2019NC106094 to Y.L.).

Footnotes

Supplemental material is available online only.

REFERENCES

1.Xu X, Nicholson P. 2009. Community ecology of fungal pathogens causing wheat head blight. Annu Rev Phytopathol 47:83–103. doi: 10.1146/annurev-phyto-080508-081737. [DOI] [PubMed] [Google Scholar]
2.Dean R, Van Kan JA, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD, Rudd JJ, Dickman M, Kahmann R, Ellis J, Foster GD. 2012. The top 10 fungal pathogens in molecular plant pathology. Mol Plant Pathol 13:414–430. doi: 10.1111/j.1364-3703.2011.00783.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Pestka JJ. 2010. Deoxynivalenol: mechanisms of action, human exposure, and toxicological relevance. Arch Toxicol 84:663–679. doi: 10.1007/s00204-010-0579-8. [DOI] [PubMed] [Google Scholar]
4.Desjardins AE, Proctor RH. 2007. Molecular biology of Fusarium mycotoxins. Int J Food Microbiol 119:47–50. doi: 10.1016/j.ijfoodmicro.2007.07.024. [DOI] [PubMed] [Google Scholar]
5.Paul PA, Lipps PE, Hershman DE, McMullen MP, Draper MA, Madden LV. 2008. Efficacy of triazole-based fungicides for fusarium head blight and deoxynivalenol control in wheat: a multivariate meta-analysis. Phytopathology 98:999–1011. doi: 10.1094/PHYTO-98-9-0999. [DOI] [PubMed] [Google Scholar]
6.Li Y, Li B, Liu L, Chen H, Zhang H, Zheng X, Zhang Z. 2016. FgMon1, a guanine nucleotide exchange factor of FgRab7, is important for vacuole fusion, autophagy and plant infection in Fusarium graminearum. Sci Rep 5:18101. doi: 10.1038/srep18101. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Desjardins AE, Hohn TM, McCormick SP. 1993. Trichothecene biosynthesis in Fusarium species: chemistry, genetics, and significance. Microbiol Rev 57:595–604. doi: 10.1128/MMBR.57.3.595-604.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Proctor RH, Hohn TM, McCormick SP. 1995. Reduced virulence of Gibberella zeae caused by disruption of a trichothecene toxin biosynthetic gene. Mol Plant Microbe Interact 8:593–601. doi: 10.1094/MPMI-8-0593. [DOI] [PubMed] [Google Scholar]
9.Yin T, Zhang Q, Wang J, Liu H, Wang C, Xu JR, Jiang C. 2018. The cyclase-associated protein FgCap1 has both protein kinase A-dependent and -independent functions during deoxynivalenol production and plant infection in Fusarium graminearum. Mol Plant Pathol 19:552–563. doi: 10.1111/mpp.12540. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Brown DW, Dyer RB, McCormick SP, Kendra DF, Plattner RD. 2004. Functional demarcation of the Fusarium core trichothecene gene cluster. Fungal Genet Biol 41:454–462. doi: 10.1016/j.fgb.2003.12.002. [DOI] [PubMed] [Google Scholar]
11.Chen Y, Kistler HC, Ma Z. 2019. Fusarium graminearum trichothecene mycotoxins: biosynthesis, regulation, and management. Annu Rev Phytopathol 57:15–39. doi: 10.1146/annurev-phyto-082718-100318. [DOI] [PubMed] [Google Scholar]
12.Seong KY, Pasquali M, Zhou X, Song J, Hilburn K, McCormick S, Dong Y, Xu JR, Kistler HC. 2009. Global gene regulation by Fusarium transcription factors Tri6 and Tri10 reveals adaptations for toxin biosynthesis. Mol Microbiol 72:354–367. doi: 10.1111/j.1365-2958.2009.06649.x. [DOI] [PubMed] [Google Scholar]
13.Desjardins AE, Bai G, Plattner RD, Proctor RH. 2000. Analysis of aberrant virulence of Gibberella zeae following transformation-mediated complementation of a trichothecene-deficient (Tri5) mutant. Microbiology 146:2059–2068. doi: 10.1099/00221287-146-8-2059. [DOI] [PubMed] [Google Scholar]
14.McCormick SP, Harris LJ, Alexander NJ, Ouellet T, Saparno A, Allard S, Desjardins AE. 2004. Tri1 in Fusarium graminearum encodes a P450 oxygenase. Appl Environ Microbiol 70:2044–2051. doi: 10.1128/AEM.70.4.2044-2051.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Tokai T, Koshino H, Takahashi-Ando N, Sato M, Fujimura M, Kimura M. 2007. Fusarium Tri4 encodes a key multifunctional cytochrome P450 monooxygenase for four consecutive oxygenation steps in trichothecene biosynthesis. Biochem Biophys Res Commun 353:412–417. doi: 10.1016/j.bbrc.2006.12.033. [DOI] [PubMed] [Google Scholar]
16.Boenisch MJ, Broz KL, Purvine SO, Chrisler WB, Nicora CD, Connolly LR, Freitag M, Baker SE, Kistler HC. 2017. Structural reorganization of the fungal endoplasmic reticulum upon induction of mycotoxin biosynthesis. Sci Rep 7:44296. doi: 10.1038/srep44296. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Tang G, Chen Y, Xu JR, Kistler HC, Ma Z. 2018. The fungal myosin I is essential for Fusarium toxisome formation. PLoS Pathog 14:e1006827. doi: 10.1371/journal.ppat.1006827. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Flynn CM, Broz K, Jonkers W, Schmidt-Dannert C, Kistler HC. 2019. Expression of the Fusarium graminearum terpenome and involvement of the endoplasmic reticulum-derived toxisome. Fungal Genet Biol 124:78–87. doi: 10.1016/j.fgb.2019.01.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Daumke O, Praefcke GJ. 2011. Structural insights into membrane fusion at the endoplasmic reticulum. Proc Natl Acad Sci U S A 108:2175–2176. doi: 10.1073/pnas.1019194108. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Klemm RW, Norton JP, Cole RA, Li CS, Park SH, Crane MM, Li L, Jin D, Boye-Doe A, Liu TY, Shibata Y, Lu H, Rapoport TA, Farese RV Jr, Blackstone C, Guo Y, Mak HY. 2013. A conserved role for atlastin GTPases in regulating lipid droplet size. Cell Rep 3:1465–1475. doi: 10.1016/j.celrep.2013.04.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Hu J, Rapoport TA. 2016. Fusion of the endoplasmic reticulum by membrane-bound GTPases. Semin Cell Dev Biol 60:105–111. doi: 10.1016/j.semcdb.2016.06.001. [DOI] [PubMed] [Google Scholar]
22.Sugiura S, Mima J. 2016. Physiological lipid composition is vital for homotypic ER membrane fusion mediated by the dynamin-related GTPase Sey1p. Sci Rep 6:20407. doi: 10.1038/srep20407. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Li J, Yan B, Si H, Peng X, Zhang SL, Hu J. 2017. Atlastin regulates store-operated calcium entry for nerve growth factor-induced neurite outgrowth. Sci Rep 7:43490. doi: 10.1038/srep43490. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Anwar K, Klemm RW, Condon A, Severin KN, Zhang M, Ghirlando R, Hu J, Rapoport TA, Prinz WA. 2012. The dynamin-like GTPase Sey1p mediates homotypic ER fusion in S. cerevisiae. J Cell Biol 197:209–217. doi: 10.1083/jcb.201111115. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Yan L, Sun S, Wang W, Shi J, Hu X, Wang S, Su D, Rao Z, Hu J, Lou Z. 2015. Structures of the yeast dynamin-like GTPase Sey1p provide insight into homotypic ER fusion. J Cell Biol 210:961–972. doi: 10.1083/jcb.201502078. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Rogers JV, Arlow T, Inkellis ER, Koo TS, Rose MD. 2013. ER-associated SNAREs and Sey1p mediate nuclear fusion at two distinct steps during yeast mating. Mol Biol Cell 24:3896–3908. doi: 10.1091/mbc.e13-08-0441. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Hu X, Wu F, Sun S, Yu W, Hu J. 2015. Human atlastin GTPases mediate differentiated fusion of endoplasmic reticulum membranes. Protein Cell 6:307–311. doi: 10.1007/s13238-015-0139-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Hu J, Shibata Y, Zhu PP, Voss C, Rismanchi N, Prinz WA, Rapoport TA, Blackstone C. 2009. A class of dynamin-like GTPases involved in the generation of the tubular ER network. Cell 138:549–561. doi: 10.1016/j.cell.2009.05.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Orso G, Pendin D, Liu S, Tosetto J, Moss TJ, Faust JE, Micaroni M, Egorova A, Martinuzzi A, McNew JA, Daga A. 2009. Homotypic fusion of ER membranes requires the dynamin-like GTPase atlastin. Nature 460:978–983. doi: 10.1038/nature08280. [DOI] [PubMed] [Google Scholar]
30.Summerville JB, Faust JF, Fan E, Pendin D, Daga A, Formella J, Stern M, McNew JA. 2016. The effects of ER morphology on synaptic structure and function in Drosophila melanogaster. J Cell Sci 129:1635–1648. doi: 10.1242/jcs.184929. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Galway ME, Heckman JW Jr, Schiefelbein JW. 1997. Growth and ultrastructure of Arabidopsis root hairs: the rhd3 mutation alters vacuole enlargement and tip growth. Planta 201:209–218. doi: 10.1007/BF01007706. [DOI] [PubMed] [Google Scholar]
32.Chen J, Stefano G, Brandizzi F, Zheng H. 2011. Arabidopsis RHD3 mediates the generation of the tubular ER network and is required for Golgi distribution and motility in plant cells. J Cell Sci 124:2241–2252. doi: 10.1242/jcs.084624. [DOI] [PubMed] [Google Scholar]
33.Ueda H, Yokota E, Kuwata K, Kutsuna N, Mano S, Shimada T, Tamura K, Stefano G, Fukao Y, Brandizzi F, Shimmen T, Nishimura M, Hara-Nishimura I. 2016. Phosphorylation of the C terminus of RHD3 has a critical role in homotypic er membrane fusion in Arabidopsis. Plant Physiol 170:867–880. doi: 10.1104/pp.15.01172. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.van Zutphen T, Todde V, de Boer R, Kreim M, Hofbauer HF, Wolinski H, Veenhuis M, van der Klei IJ, Kohlwein SD. 2014. Lipid droplet autophagy in the yeast Saccharomyces cerevisiae. Mol Biol Cell 25:290–301. doi: 10.1091/mbc.e13-08-0448. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Hariri H, Rogers S, Ugrankar R, Liu YL, Feathers JR, Henne WM. 2018. Lipid droplet biogenesis is spatially coordinated at ER-vacuole contacts under nutritional stress. EMBO Rep 19:57–72. doi: 10.15252/embr.201744815. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Yu F, Gu Q, Yun Y, Yin Y, Xu JR, Shim WB, Ma Z. 2014. The TOR signaling pathway regulates vegetative development and virulence in Fusarium graminearum. New Phytol 203:219–232. doi: 10.1111/nph.12776. [DOI] [PubMed] [Google Scholar]
37.Liu N, Yun Y, Yin Y, Hahn M, Ma Z, Chen Y. 2019. Lipid droplet biogenesis regulated by the FgNem1/Spo7-FgPah1 phosphatase cascade plays critical roles in fungal development and virulence in Fusarium graminearum. New Phytol 223:412–429. doi: 10.1111/nph.15748. [DOI] [PubMed] [Google Scholar]
38.McMullen M, Jones R, Gallenberg D. 1997. Scab of wheat and barley: a re-emerging disease of devastating impact. Plant Dis 81:1340–1348. doi: 10.1094/PDIS.1997.81.12.1340. [DOI] [PubMed] [Google Scholar]
39.Francl L, Shaner G, Bergstrom G, Gilbert J, Pedersen W, Dill-Macky R, Sweets L, Corwin B, Jin Y, Gallenberg D, Wiersma J. 1999. Daily inoculum levels of Gibberella zeae on wheat spikes. Plant Dis 83:662–666. doi: 10.1094/PDIS.1999.83.7.662. [DOI] [PubMed] [Google Scholar]
40.Seong KY, Zhao X, Xu JR, Guldener U, Kistler HC. 2008. Conidial germination in the filamentous fungus Fusarium graminearum. Fungal Genet Biol 45:389–399. doi: 10.1016/j.fgb.2007.09.002. [DOI] [PubMed] [Google Scholar]
41.Hallen-Adams HE, Wenner N, Kuldau GA, Trail F. 2011. Deoxynivalenol biosynthesis-related gene expression during wheat kernel colonization by Fusarium graminearum. Phytopathology 101:1091–1096. doi: 10.1094/PHYTO-01-11-0023. [DOI] [PubMed] [Google Scholar]
42.Westphal KR, Wollenberg RD, Herbst FA, Sorensen JL, Sondergaard TE, Wimmer R. 2018. Enhancing the production of the fungal pigment aurofusarin in Fusarium graminearum. Toxins (Basel) 10:485. doi: 10.3390/toxins10110485. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Lee M, Ko YJ, Moon Y, Han M, Kim HW, Lee SH, Kang K, Jun Y. 2015. SNAREs support atlastin-mediated homotypic ER fusion in Saccharomyces cerevisiae. J Cell Biol 210:451–470. doi: 10.1083/jcb.201501043. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Adnan M, Fang W, Sun P, Zheng Y, Abubakar YS, Zhang J, Lou Y, Zheng W, Lu GD. 2020. R-SNARE FgSec22 is essential for growth, pathogenicity and DON production of Fusarium graminearum. Curr Genet 66:421–435. doi: 10.1007/s00294-019-01037-y. [DOI] [PubMed] [Google Scholar]
45.Kelley LA, Sternberg MJ. 2009. Protein structure prediction on the Web: a case study using the Phyre server. Nat Protoc 4:363–371. doi: 10.1038/nprot.2009.2. [DOI] [PubMed] [Google Scholar]
46.Bian X, Klemm RW, Liu TY, Zhang M, Sun S, Sui X, Liu X, Rapoport TA, Hu J. 2011. Structures of the atlastin GTPase provide insight into homotypic fusion of endoplasmic reticulum membranes. Proc Natl Acad Sci U S A 108:3976–3981. doi: 10.1073/pnas.1101643108. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Winsor J, Machi U, Han Q, Hackney DD, Lee TH. 2018. GTP hydrolysis promotes disassembly of the atlastin crossover dimer during ER fusion. J Cell Biol 217:4184–4198. doi: 10.1083/jcb.201805039. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Frandsen RJ, Nielsen NJ, Maolanon N, Sorensen JC, Olsson S, Nielsen J, Giese H. 2006. The biosynthetic pathway for aurofusarin in Fusarium graminearum reveals a close link between the naphthoquinones and naphthopyrones. Mol Microbiol 61:1069–1080. doi: 10.1111/j.1365-2958.2006.05295.x. [DOI] [PubMed] [Google Scholar]
49.Rangel DE, Alder-Rangel A, Dadachova E, Finlay RD, Kupiec M, Dijksterhuis J, Braga GU, Corrochano LM, Hallsworth JE. 2015. Fungal stress biology: a preface to the fungal stress responses special edition. Curr Genet 61:231–238. doi: 10.1007/s00294-015-0500-3. [DOI] [PubMed] [Google Scholar]
50.Praefcke GJ, McMahon HT. 2004. The dynamin superfamily: universal membrane tubulation and fission molecules? Nat Rev Mol Cell Biol 5:133–147. doi: 10.1038/nrm1313. [DOI] [PubMed] [Google Scholar]
51.Byrnes LJ, Sondermann H. 2011. Structural basis for the nucleotide-dependent dimerization of the large G protein atlastin-1/SPG3A. Proc Natl Acad Sci U S A 108:2216–2221. doi: 10.1073/pnas.1012792108. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Liu TY, Bian X, Sun S, Hu X, Klemm RW, Prinz WA, Rapoport TA, Hu J. 2012. Lipid interaction of the C terminus and association of the transmembrane segments facilitate atlastin-mediated homotypic endoplasmic reticulum fusion. Proc Natl Acad Sci U S A 109:E2146–E2154. doi: 10.1073/pnas.1208385109. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Hou Z, Xue C, Peng Y, Katan T, Kistler HC, Xu JR. 2002. A mitogen-activated protein kinase gene (MGV1) in Fusarium graminearum is required for female fertility, heterokaryon formation, and plant infection. Mol Plant Microbe Interact 15:1119–1127. doi: 10.1094/MPMI.2002.15.11.1119. [DOI] [PubMed] [Google Scholar]
54.Yang P, Chen Y, Wu H, Fang W, Liang Q, Zheng Y, Olsson S, Zhang D, Zhou J, Wang Z, Zheng W. 2018. The 5-oxoprolinase is required for conidiation, sexual reproduction, virulence and deoxynivalenol production of Fusarium graminearum. Curr Genet 64:285–301. doi: 10.1007/s00294-017-0747-y. [DOI] [PubMed] [Google Scholar]
55.Catlett NL, Lee BN, Yoder OC, Turgeon BG. 2003. Split-marker recombination for efficient targeted deletion of fungal genes. Fungal Genet Rep 50:9–11. doi: 10.4148/1941-4765.1150. [DOI] [Google Scholar]
56.Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59. doi: 10.1016/0378-1119(89)90358-2. [DOI] [PubMed] [Google Scholar]
57.Cavinder B, Sikhakolli U, Fellows KM, Trail F. 2012. Sexual development and ascospore discharge in Fusarium graminearum. J Vis Exp 61:3895. doi: 10.3791/3895. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.Tang L, Yu X, Zhang L, Zhang L, Chen L, Zou S, Liang Y, Yu J, Dong H. 2020. Mitochondrial FgEch1 is responsible for conidiation and full virulence in Fusarium graminearum. Curr Genet 66:361–371. doi: 10.1007/s00294-019-01028-z. [DOI] [PubMed] [Google Scholar]
59.Fan X, He F, Ding M, Geng C, Chen L, Zou S, Liang Y, Yu J, Dong H. 2019. Thioredoxin reductase is involved in development and pathogenicity in Fusarium graminearum. Front Microbiol 10:393. doi: 10.3389/fmicb.2019.00393. [DOI] [PMC free article] [PubMed] [Google Scholar]
60.Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2^−ΔΔCT method. Methods 25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental file 1

AEM.02720-19-s0001.pdf^{(5.2MB, pdf)}

Data Availability Statement

[B1] 1.Xu X, Nicholson P. 2009. Community ecology of fungal pathogens causing wheat head blight. Annu Rev Phytopathol 47:83–103. doi: 10.1146/annurev-phyto-080508-081737. [DOI] [PubMed] [Google Scholar]

[B2] 2.Dean R, Van Kan JA, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD, Rudd JJ, Dickman M, Kahmann R, Ellis J, Foster GD. 2012. The top 10 fungal pathogens in molecular plant pathology. Mol Plant Pathol 13:414–430. doi: 10.1111/j.1364-3703.2011.00783.x. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3.Pestka JJ. 2010. Deoxynivalenol: mechanisms of action, human exposure, and toxicological relevance. Arch Toxicol 84:663–679. doi: 10.1007/s00204-010-0579-8. [DOI] [PubMed] [Google Scholar]

[B4] 4.Desjardins AE, Proctor RH. 2007. Molecular biology of Fusarium mycotoxins. Int J Food Microbiol 119:47–50. doi: 10.1016/j.ijfoodmicro.2007.07.024. [DOI] [PubMed] [Google Scholar]

[B5] 5.Paul PA, Lipps PE, Hershman DE, McMullen MP, Draper MA, Madden LV. 2008. Efficacy of triazole-based fungicides for fusarium head blight and deoxynivalenol control in wheat: a multivariate meta-analysis. Phytopathology 98:999–1011. doi: 10.1094/PHYTO-98-9-0999. [DOI] [PubMed] [Google Scholar]

[B6] 6.Li Y, Li B, Liu L, Chen H, Zhang H, Zheng X, Zhang Z. 2016. FgMon1, a guanine nucleotide exchange factor of FgRab7, is important for vacuole fusion, autophagy and plant infection in Fusarium graminearum. Sci Rep 5:18101. doi: 10.1038/srep18101. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7.Desjardins AE, Hohn TM, McCormick SP. 1993. Trichothecene biosynthesis in Fusarium species: chemistry, genetics, and significance. Microbiol Rev 57:595–604. doi: 10.1128/MMBR.57.3.595-604.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8.Proctor RH, Hohn TM, McCormick SP. 1995. Reduced virulence of Gibberella zeae caused by disruption of a trichothecene toxin biosynthetic gene. Mol Plant Microbe Interact 8:593–601. doi: 10.1094/MPMI-8-0593. [DOI] [PubMed] [Google Scholar]

[B9] 9.Yin T, Zhang Q, Wang J, Liu H, Wang C, Xu JR, Jiang C. 2018. The cyclase-associated protein FgCap1 has both protein kinase A-dependent and -independent functions during deoxynivalenol production and plant infection in Fusarium graminearum. Mol Plant Pathol 19:552–563. doi: 10.1111/mpp.12540. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10.Brown DW, Dyer RB, McCormick SP, Kendra DF, Plattner RD. 2004. Functional demarcation of the Fusarium core trichothecene gene cluster. Fungal Genet Biol 41:454–462. doi: 10.1016/j.fgb.2003.12.002. [DOI] [PubMed] [Google Scholar]

[B11] 11.Chen Y, Kistler HC, Ma Z. 2019. Fusarium graminearum trichothecene mycotoxins: biosynthesis, regulation, and management. Annu Rev Phytopathol 57:15–39. doi: 10.1146/annurev-phyto-082718-100318. [DOI] [PubMed] [Google Scholar]

[B12] 12.Seong KY, Pasquali M, Zhou X, Song J, Hilburn K, McCormick S, Dong Y, Xu JR, Kistler HC. 2009. Global gene regulation by Fusarium transcription factors Tri6 and Tri10 reveals adaptations for toxin biosynthesis. Mol Microbiol 72:354–367. doi: 10.1111/j.1365-2958.2009.06649.x. [DOI] [PubMed] [Google Scholar]

[B13] 13.Desjardins AE, Bai G, Plattner RD, Proctor RH. 2000. Analysis of aberrant virulence of Gibberella zeae following transformation-mediated complementation of a trichothecene-deficient (Tri5) mutant. Microbiology 146:2059–2068. doi: 10.1099/00221287-146-8-2059. [DOI] [PubMed] [Google Scholar]

[B14] 14.McCormick SP, Harris LJ, Alexander NJ, Ouellet T, Saparno A, Allard S, Desjardins AE. 2004. Tri1 in Fusarium graminearum encodes a P450 oxygenase. Appl Environ Microbiol 70:2044–2051. doi: 10.1128/AEM.70.4.2044-2051.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B15] 15.Tokai T, Koshino H, Takahashi-Ando N, Sato M, Fujimura M, Kimura M. 2007. Fusarium Tri4 encodes a key multifunctional cytochrome P450 monooxygenase for four consecutive oxygenation steps in trichothecene biosynthesis. Biochem Biophys Res Commun 353:412–417. doi: 10.1016/j.bbrc.2006.12.033. [DOI] [PubMed] [Google Scholar]

[B16] 16.Boenisch MJ, Broz KL, Purvine SO, Chrisler WB, Nicora CD, Connolly LR, Freitag M, Baker SE, Kistler HC. 2017. Structural reorganization of the fungal endoplasmic reticulum upon induction of mycotoxin biosynthesis. Sci Rep 7:44296. doi: 10.1038/srep44296. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17.Tang G, Chen Y, Xu JR, Kistler HC, Ma Z. 2018. The fungal myosin I is essential for Fusarium toxisome formation. PLoS Pathog 14:e1006827. doi: 10.1371/journal.ppat.1006827. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B18] 18.Flynn CM, Broz K, Jonkers W, Schmidt-Dannert C, Kistler HC. 2019. Expression of the Fusarium graminearum terpenome and involvement of the endoplasmic reticulum-derived toxisome. Fungal Genet Biol 124:78–87. doi: 10.1016/j.fgb.2019.01.006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] 19.Daumke O, Praefcke GJ. 2011. Structural insights into membrane fusion at the endoplasmic reticulum. Proc Natl Acad Sci U S A 108:2175–2176. doi: 10.1073/pnas.1019194108. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20.Klemm RW, Norton JP, Cole RA, Li CS, Park SH, Crane MM, Li L, Jin D, Boye-Doe A, Liu TY, Shibata Y, Lu H, Rapoport TA, Farese RV Jr, Blackstone C, Guo Y, Mak HY. 2013. A conserved role for atlastin GTPases in regulating lipid droplet size. Cell Rep 3:1465–1475. doi: 10.1016/j.celrep.2013.04.015. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B21] 21.Hu J, Rapoport TA. 2016. Fusion of the endoplasmic reticulum by membrane-bound GTPases. Semin Cell Dev Biol 60:105–111. doi: 10.1016/j.semcdb.2016.06.001. [DOI] [PubMed] [Google Scholar]

[B22] 22.Sugiura S, Mima J. 2016. Physiological lipid composition is vital for homotypic ER membrane fusion mediated by the dynamin-related GTPase Sey1p. Sci Rep 6:20407. doi: 10.1038/srep20407. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23.Li J, Yan B, Si H, Peng X, Zhang SL, Hu J. 2017. Atlastin regulates store-operated calcium entry for nerve growth factor-induced neurite outgrowth. Sci Rep 7:43490. doi: 10.1038/srep43490. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B24] 24.Anwar K, Klemm RW, Condon A, Severin KN, Zhang M, Ghirlando R, Hu J, Rapoport TA, Prinz WA. 2012. The dynamin-like GTPase Sey1p mediates homotypic ER fusion in S. cerevisiae. J Cell Biol 197:209–217. doi: 10.1083/jcb.201111115. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25.Yan L, Sun S, Wang W, Shi J, Hu X, Wang S, Su D, Rao Z, Hu J, Lou Z. 2015. Structures of the yeast dynamin-like GTPase Sey1p provide insight into homotypic ER fusion. J Cell Biol 210:961–972. doi: 10.1083/jcb.201502078. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B26] 26.Rogers JV, Arlow T, Inkellis ER, Koo TS, Rose MD. 2013. ER-associated SNAREs and Sey1p mediate nuclear fusion at two distinct steps during yeast mating. Mol Biol Cell 24:3896–3908. doi: 10.1091/mbc.e13-08-0441. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27.Hu X, Wu F, Sun S, Yu W, Hu J. 2015. Human atlastin GTPases mediate differentiated fusion of endoplasmic reticulum membranes. Protein Cell 6:307–311. doi: 10.1007/s13238-015-0139-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28.Hu J, Shibata Y, Zhu PP, Voss C, Rismanchi N, Prinz WA, Rapoport TA, Blackstone C. 2009. A class of dynamin-like GTPases involved in the generation of the tubular ER network. Cell 138:549–561. doi: 10.1016/j.cell.2009.05.025. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29.Orso G, Pendin D, Liu S, Tosetto J, Moss TJ, Faust JE, Micaroni M, Egorova A, Martinuzzi A, McNew JA, Daga A. 2009. Homotypic fusion of ER membranes requires the dynamin-like GTPase atlastin. Nature 460:978–983. doi: 10.1038/nature08280. [DOI] [PubMed] [Google Scholar]

[B30] 30.Summerville JB, Faust JF, Fan E, Pendin D, Daga A, Formella J, Stern M, McNew JA. 2016. The effects of ER morphology on synaptic structure and function in Drosophila melanogaster. J Cell Sci 129:1635–1648. doi: 10.1242/jcs.184929. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B31] 31.Galway ME, Heckman JW Jr, Schiefelbein JW. 1997. Growth and ultrastructure of Arabidopsis root hairs: the rhd3 mutation alters vacuole enlargement and tip growth. Planta 201:209–218. doi: 10.1007/BF01007706. [DOI] [PubMed] [Google Scholar]

[B32] 32.Chen J, Stefano G, Brandizzi F, Zheng H. 2011. Arabidopsis RHD3 mediates the generation of the tubular ER network and is required for Golgi distribution and motility in plant cells. J Cell Sci 124:2241–2252. doi: 10.1242/jcs.084624. [DOI] [PubMed] [Google Scholar]

[B33] 33.Ueda H, Yokota E, Kuwata K, Kutsuna N, Mano S, Shimada T, Tamura K, Stefano G, Fukao Y, Brandizzi F, Shimmen T, Nishimura M, Hara-Nishimura I. 2016. Phosphorylation of the C terminus of RHD3 has a critical role in homotypic er membrane fusion in Arabidopsis. Plant Physiol 170:867–880. doi: 10.1104/pp.15.01172. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34.van Zutphen T, Todde V, de Boer R, Kreim M, Hofbauer HF, Wolinski H, Veenhuis M, van der Klei IJ, Kohlwein SD. 2014. Lipid droplet autophagy in the yeast Saccharomyces cerevisiae. Mol Biol Cell 25:290–301. doi: 10.1091/mbc.e13-08-0448. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35.Hariri H, Rogers S, Ugrankar R, Liu YL, Feathers JR, Henne WM. 2018. Lipid droplet biogenesis is spatially coordinated at ER-vacuole contacts under nutritional stress. EMBO Rep 19:57–72. doi: 10.15252/embr.201744815. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B36] 36.Yu F, Gu Q, Yun Y, Yin Y, Xu JR, Shim WB, Ma Z. 2014. The TOR signaling pathway regulates vegetative development and virulence in Fusarium graminearum. New Phytol 203:219–232. doi: 10.1111/nph.12776. [DOI] [PubMed] [Google Scholar]

[B37] 37.Liu N, Yun Y, Yin Y, Hahn M, Ma Z, Chen Y. 2019. Lipid droplet biogenesis regulated by the FgNem1/Spo7-FgPah1 phosphatase cascade plays critical roles in fungal development and virulence in Fusarium graminearum. New Phytol 223:412–429. doi: 10.1111/nph.15748. [DOI] [PubMed] [Google Scholar]

[B38] 38.McMullen M, Jones R, Gallenberg D. 1997. Scab of wheat and barley: a re-emerging disease of devastating impact. Plant Dis 81:1340–1348. doi: 10.1094/PDIS.1997.81.12.1340. [DOI] [PubMed] [Google Scholar]

[B39] 39.Francl L, Shaner G, Bergstrom G, Gilbert J, Pedersen W, Dill-Macky R, Sweets L, Corwin B, Jin Y, Gallenberg D, Wiersma J. 1999. Daily inoculum levels of Gibberella zeae on wheat spikes. Plant Dis 83:662–666. doi: 10.1094/PDIS.1999.83.7.662. [DOI] [PubMed] [Google Scholar]

[B40] 40.Seong KY, Zhao X, Xu JR, Guldener U, Kistler HC. 2008. Conidial germination in the filamentous fungus Fusarium graminearum. Fungal Genet Biol 45:389–399. doi: 10.1016/j.fgb.2007.09.002. [DOI] [PubMed] [Google Scholar]

[B41] 41.Hallen-Adams HE, Wenner N, Kuldau GA, Trail F. 2011. Deoxynivalenol biosynthesis-related gene expression during wheat kernel colonization by Fusarium graminearum. Phytopathology 101:1091–1096. doi: 10.1094/PHYTO-01-11-0023. [DOI] [PubMed] [Google Scholar]

[B42] 42.Westphal KR, Wollenberg RD, Herbst FA, Sorensen JL, Sondergaard TE, Wimmer R. 2018. Enhancing the production of the fungal pigment aurofusarin in Fusarium graminearum. Toxins (Basel) 10:485. doi: 10.3390/toxins10110485. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B43] 43.Lee M, Ko YJ, Moon Y, Han M, Kim HW, Lee SH, Kang K, Jun Y. 2015. SNAREs support atlastin-mediated homotypic ER fusion in Saccharomyces cerevisiae. J Cell Biol 210:451–470. doi: 10.1083/jcb.201501043. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B44] 44.Adnan M, Fang W, Sun P, Zheng Y, Abubakar YS, Zhang J, Lou Y, Zheng W, Lu GD. 2020. R-SNARE FgSec22 is essential for growth, pathogenicity and DON production of Fusarium graminearum. Curr Genet 66:421–435. doi: 10.1007/s00294-019-01037-y. [DOI] [PubMed] [Google Scholar]

[B45] 45.Kelley LA, Sternberg MJ. 2009. Protein structure prediction on the Web: a case study using the Phyre server. Nat Protoc 4:363–371. doi: 10.1038/nprot.2009.2. [DOI] [PubMed] [Google Scholar]

[B46] 46.Bian X, Klemm RW, Liu TY, Zhang M, Sun S, Sui X, Liu X, Rapoport TA, Hu J. 2011. Structures of the atlastin GTPase provide insight into homotypic fusion of endoplasmic reticulum membranes. Proc Natl Acad Sci U S A 108:3976–3981. doi: 10.1073/pnas.1101643108. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B47] 47.Winsor J, Machi U, Han Q, Hackney DD, Lee TH. 2018. GTP hydrolysis promotes disassembly of the atlastin crossover dimer during ER fusion. J Cell Biol 217:4184–4198. doi: 10.1083/jcb.201805039. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B48] 48.Frandsen RJ, Nielsen NJ, Maolanon N, Sorensen JC, Olsson S, Nielsen J, Giese H. 2006. The biosynthetic pathway for aurofusarin in Fusarium graminearum reveals a close link between the naphthoquinones and naphthopyrones. Mol Microbiol 61:1069–1080. doi: 10.1111/j.1365-2958.2006.05295.x. [DOI] [PubMed] [Google Scholar]

[B49] 49.Rangel DE, Alder-Rangel A, Dadachova E, Finlay RD, Kupiec M, Dijksterhuis J, Braga GU, Corrochano LM, Hallsworth JE. 2015. Fungal stress biology: a preface to the fungal stress responses special edition. Curr Genet 61:231–238. doi: 10.1007/s00294-015-0500-3. [DOI] [PubMed] [Google Scholar]

[B50] 50.Praefcke GJ, McMahon HT. 2004. The dynamin superfamily: universal membrane tubulation and fission molecules? Nat Rev Mol Cell Biol 5:133–147. doi: 10.1038/nrm1313. [DOI] [PubMed] [Google Scholar]

[B51] 51.Byrnes LJ, Sondermann H. 2011. Structural basis for the nucleotide-dependent dimerization of the large G protein atlastin-1/SPG3A. Proc Natl Acad Sci U S A 108:2216–2221. doi: 10.1073/pnas.1012792108. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B52] 52.Liu TY, Bian X, Sun S, Hu X, Klemm RW, Prinz WA, Rapoport TA, Hu J. 2012. Lipid interaction of the C terminus and association of the transmembrane segments facilitate atlastin-mediated homotypic endoplasmic reticulum fusion. Proc Natl Acad Sci U S A 109:E2146–E2154. doi: 10.1073/pnas.1208385109. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B53] 53.Hou Z, Xue C, Peng Y, Katan T, Kistler HC, Xu JR. 2002. A mitogen-activated protein kinase gene (MGV1) in Fusarium graminearum is required for female fertility, heterokaryon formation, and plant infection. Mol Plant Microbe Interact 15:1119–1127. doi: 10.1094/MPMI.2002.15.11.1119. [DOI] [PubMed] [Google Scholar]

[B54] 54.Yang P, Chen Y, Wu H, Fang W, Liang Q, Zheng Y, Olsson S, Zhang D, Zhou J, Wang Z, Zheng W. 2018. The 5-oxoprolinase is required for conidiation, sexual reproduction, virulence and deoxynivalenol production of Fusarium graminearum. Curr Genet 64:285–301. doi: 10.1007/s00294-017-0747-y. [DOI] [PubMed] [Google Scholar]

[B55] 55.Catlett NL, Lee BN, Yoder OC, Turgeon BG. 2003. Split-marker recombination for efficient targeted deletion of fungal genes. Fungal Genet Rep 50:9–11. doi: 10.4148/1941-4765.1150. [DOI] [Google Scholar]

[B56] 56.Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59. doi: 10.1016/0378-1119(89)90358-2. [DOI] [PubMed] [Google Scholar]

[B57] 57.Cavinder B, Sikhakolli U, Fellows KM, Trail F. 2012. Sexual development and ascospore discharge in Fusarium graminearum. J Vis Exp 61:3895. doi: 10.3791/3895. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B58] 58.Tang L, Yu X, Zhang L, Zhang L, Chen L, Zou S, Liang Y, Yu J, Dong H. 2020. Mitochondrial FgEch1 is responsible for conidiation and full virulence in Fusarium graminearum. Curr Genet 66:361–371. doi: 10.1007/s00294-019-01028-z. [DOI] [PubMed] [Google Scholar]

[B59] 59.Fan X, He F, Ding M, Geng C, Chen L, Zou S, Liang Y, Yu J, Dong H. 2019. Thioredoxin reductase is involved in development and pathogenicity in Fusarium graminearum. Front Microbiol 10:393. doi: 10.3389/fmicb.2019.00393. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B60] 60.Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2^−ΔΔCT method. Methods 25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

PERMALINK

The Dynamin-Like GTPase FgSey1 Plays a Critical Role in Fungal Development and Virulence in Fusarium graminearum

Xuefa Chong

Chenyu Wang

Yao Wang

Yixiao Wang

Liyuan Zhang

Yuancun Liang

Lei Chen

Shenshen Zou

Hansong Dong

Roles

ABSTRACT

INTRODUCTION

RESULTS

Identification of FgSEY1 in F. graminearum.

FIG 1.

FgSey1 plays a crucial role in vegetative growth.

FIG 2.

FgSey1 is required for asexual development but not for sexual reproduction.

FIG 3.

FgSey1 is involved in pathogenicity and DON production.

FIG 4.

FgSey1 controls pigment metabolism.

FIG 5.

FgSey1 is essential for response to various stressors.

FIG 6.

The final ER morphology is normal in the ΔFgsey1 mutant.

FgSey1 is involved in formation of lipid droplets and toxisomes.

FIG 7.

Functional analysis of FgSey1 domains.

FIG 8.

K63 and T87 of FgSey1 may play important roles in vegetative growth, pathogenesis, and LD biosynthesis.

FIG 9.

DISCUSSION

MATERIALS AND METHODS

Fungal strains and culture conditions.

Phylogenetic analysis, sequence alignment, and domain architecture.

Gene deletion and complementation.

TABLE 1.

Sexual reproduction assays.

Plant infection and DON production assays.

Quantitative RT-PCR analysis.

Fluorescence microscopy observations.

Construction of Tri4-GFP expression vectors and analysis of their subcellular localization.

Statistical analyses.

Data availability.

Supplementary Material

ACKNOWLEDGMENTS

Footnotes

REFERENCES

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases