Skip to main content
PLOS One logoLink to PLOS One
. 2020 May 20;15(5):e0233518. doi: 10.1371/journal.pone.0233518

Rough-type and loss of the LPS due to lpx genes deletions are associated with colistin resistance in multidrug-resistant clinical Escherichia coli isolates not harbouring mcr genes

Mojtaba Moosavian 1,2,#, Nasrin Emam 1, Daniel Pletzer 3, Mohammad Savari 1,2,*
Editor: Iddya Karunasagar4
PMCID: PMC7239443  PMID: 32433662

Abstract

The emergence of multidrug-resistant Escherichia coli has become a great challenge in treating nosocomial infections. The polymyxin antibiotic colistin is used as a ‘last-line’ therapy for such strains, but resistance to colistin is increasingly emerging all over the world. In this study, we investigated lipopolysaccharides (LPS) of colistin-resistant isolates and examined mutations in lpx genes in strains not harbouring mcr genes. We examined 351 clinical E. coli isolates with 38 showing reduced susceptibility to colistin. These isolates were collected from different clinical specimens including blood, urine, and wounds, but no stool. After confirmation of the isolates via a BD Phoenix-100 system (Becton Dickinson, USA), we performed antimicrobial susceptibility tests to characterize the resistance pattern of these isolates to different classes of antibiotics, using the disk diffusion test. The Minimum Inhibitory Concentration (MIC) of colistin was determined using E-test strips. The presence of mobile colistin resistance (mcr-1 and mcr-2) genes was tested for all isolates. LPS (including lipid A) were extracted from all isolates and associated lpx genes analyzed by PCR and sequencing. Among the 38 clinical E. coli isolates with reduced susceptibility to colistin, 52% were resistant to colistin. The MICs of colistin ranged from 0.5 μg/ml to ˃256 μg/ml. Within the 20 colistin-resistant strains, six isolates carried the mcr-1 gene, but not mcr-2. Heterologous expression of the mcr-1 gene in susceptible E. coli DH5α increased the MIC of colistin by eight-fold. The remaining 14 isolates, were negative for both mcr genes. Six isolates were further negative for LPS production and five showed rough LPS phenotypes. Here we present evidence that loss of LPS or lipid A-deficiency can lead to colistin-resistance in clinical E. coli isolates not harbouring mcr genes.

Introduction

Multidrug-resistant (MDR) Enterobacteriaceae such as Escherichia coli are associated with life-threating infections, particularly in hospitalized and immunocompromised patients. Those suffering from urinary tract infections, bacteremia, or lung infections are especially at risk [1, 2].

The first treatment choice of infections caused by MDR Gram-negative bacteria are carbapenem antibiotics (i.e., antibiotics inhibiting cell wall synthesis) [35]. However, resistance to this class of antimicrobials is steadily increasing [6]. The antibiotic Colistin (polymyxin E) is a 60-years old antibiotic that is considered a "last resort" antibiotic used for infections caused by MDR Gram-negative bacteria including the Carbapenem resistant strains [7]. Polymyxin antibiotics interact with the lipopolysaccharides (LPS) of the outer membrane of Gram-negative bacteria to displace the divalent cations; especially Ca2+ and Mg2+ through a competitive process [8]. LPS is typically composed of three distinct regions: the lipid A (toxic component), the core oligosaccharide, and the O-antigen polysaccharide (serotype component), forming so-called smooth LPS (sLPS). In contrast, rough LPS (rLPS) producing strains lack or have reduced O-antigens [9, 10].

Lipid A is the main target of polymyxin antibiotics. Lipid A biosynthesis in E. coli involves several different genes: lpxA (encoding a UDP-N-acetylglucosamine acyltransferase) catalyzes the first reaction of lipid A biosynthesis, lpxB (encoding a lipid-A-disaccharide synthase) catalyzes the fifth step in lipid A biosynthesis, lpxC (encoding a UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase) catalyzes the second reaction and the first committed step in lipid A biosynthesis and lpxD (encoding a UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase) catalyzes the third step of lipid A biosynthesis [11]. Furthermore, lpxH (encoding a UDP-2,3-diacylglucosamine hydrolase) catalyzes the fourth step in lipid A synthesis [12], lpxK (encoding a Tetraacyldisaccharide 4’-kinase) catalyzes the sixth step in lipid A biosynthesis [13], lpxL (encoding a lauroyl acyltransferase) incorporates a laurate residue into KDO2-lipid IVA from lauroyl-ACP [14] and lpxM (encoding a myristoyl-acyl carrier protein-dependent acyltransferase) [15].

The general mechanisms behind colistin resistance include LPS modifications, LPS removal [16], and uptake of plasmids carrying mcr genes [17]. In many Gram-negative bacteria, modifications of lipid A by addition of 4-amino-4-deoxy-L-arabinose (L-Ara4N) and/or phosphoethanolamine (PEtn) act to reduce the net LPS negative charge, thereby increasing resistance to colistin [18]. The complete loss of LPS due to lpx gene(s) interruption or deletion, also causes colistin resistance [18]. In addition, strains acquiring plasmids that carry mcr genes (i.e., mobilized colistin resistance genes), encoding phosphatidylethanolamine transferase that can modify the LPS by adding a phosphatidylethanolamine residue to lipid A component, have been emerging globally [19]. To date, nine mobilized colistin resistance genes (mcr-1 to mcr-9) have been identified. They are homologous to each other and work in similar ways and among these, mcr-1 and mcr-2 are the most prevalent genes [2022].

Enterobacteriaceae strains with single mutation in genes associated with colistin resistance remain susceptible to the Colistin. However, the MICs of the Colistin for these strains are markedly increased (i.e., they have reduced susceptibility) [23].

Previously, we reported on the emergence of clinical, colistin-resistant E. coli isolates which some were harbouring and some not harbouring mcr-1 genes [24]. Here, we further investigated the LPS structure of colistin-resistant isolates and examined mutations in lpx genes in strains not harboring mcr genes.

Materials and methods

Bacterial isolates

A total of 351 isolates of E. coli were detected in infectious-associated Enterobacteriaceae spp. [23] isolated from different clinical specimens such as blood, urine, or wounds. These isolates were collected from the laboratories of the teaching hospitals (Golestan, Aboozar and Razi) related to Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran from April to June 2017. This study was approved by the Institutional Review Board (IRB) and Ethics Committee of the Ahvaz Jundishapur University of Medical Sciences. Bacterial isolates were collected as a part of routine patient care, and all patient data were anonymized before the researchers gained access. Species identification was performed using a BD Phoenix-100 system (Becton Dickinson, USA) and confirmed by 16S rRNA gene sequencing.

Drug Susceptibility Testing (DST)

DST was performed using the disk diffusion method (Kirby-Bauer) on Mueller-Hinton agar (Merck, Germany) plates according to the Clinical and Laboratory Standards Institute (CLSI) guidelines [25]. The tested antibiotic disks were: colistin (COL, 10μg), ciprofloxacin (CIP, 5μg), tetracycline (T, 30μg), imipenem (IMI, 10μg), ceftazidime (CAZ, 30μg), azithromycin (AT, 15μg), and amikacin (AK, 30μg) (MAST Co., UK). The phenotype of E.coli was defined as MDR according to the International Expert proposal for Interim Standards Guidelines [26]. Minimum Inhibitory Concentration (MIC) of colistin (Sigma-Aldrich, USA) was determined using the E-test strips (Mast, UK) method according to CLSI guidelines.

DNA extraction

The DNA was extracted using the High Pure PCR Template Preparation Kit (Roche Inc., Mannheim, Germany) following the manufacturer’s instruction.

Detection of mcr-1 gene

mcr-1 was amplified using the primers, mcr-1F: CGGTCAGTCCGTTTGTTC and mcr-1R: CTTGGTCGGTCTGTAGGG [24], and the following conditions: The master mix was prepared in a final volume of 25 μL containing 10× PCR buffer, 50 mM MgCl2, 10 mM dNTPs, 10 μM of each primer, 5 U/μL of Taq DNA polymerase and 5 μL of extracted DNA as a template. The DNA amplification was performed based on the following program: initial denaturation at 94°C for 5 mins, 25 cycles of denaturation at 94°C for 1 min, annealing at 51°C for 30 s, extension at 72°C for 30 s and a final extension at 72°C for 5 mins. DNA from E. coli KP81 and KP37 strains harbouring mcr-1 and mcr-2, respectively, were used as the positive controls. Genomic DNA from colistin-susceptible E. coli ATCC 25922 was used as a negative control. The PCR products were separated by electrophoresis on a 1.5% agarose gel containing 0.5 μg/ml ethidium bromide. The bands were visualized under UV light using a gel documentation system (Protein Simple, Santa Clara, CA, USA). All PCR products were sequenced and compared the strain information from GenBank. The partial sequence of mcr-1 from E. coli strain ECajums9 have been deposited to the GenBank under the accession number of MH627973.

Cloning

To evaluate the role of mcr-1 in colistin resistance, we heterologously expressed this gene in a colistin-susceptible E. coli strain. For this purpose, the coding sequence of the mcr-1 gene (MF084991.1 (was synthesized and cloned under the lac promoter into pBluescript (GenScript). The pBluescript.mcr-1 recombinant plasmid was transformed into E. coli DH5α and clones selected on LB agar plates containing 50 μg/ml ampicillin and 2 μg/ml colistin. Functional expression of the cloned mcr-1 gene in E. coli DH5α was further verified via MIC experiments. E. coli DH5α carrying the pBluescript vector without the mcr-1 genes was used as a control.

Extraction of LPS

The LPS from colistin-resistant isolates and a colistin susceptible standard strain (E. coli strain ATCC 25922) was extracted using the LPS Extraction Kit (iNtRON Biotechnology, South Korea) according to the manufacturer’s instructions. The purity of extracted LPS was evaluated by silver staining of SDS-PAGE gels and HPLC analysis. Limulus Amebocyte Lysate (LAL) and rabbit pyrogen tests were done to evaluate the functionality of the purified LPS.

SDS-PAGE and silver nitrate staining

The purified LPS was solubilized in a sample buffer to the desired concentration (1 mg/mL). 10 μL/well from each sample was separated on a 12% resolving gel with a 4% stacking gel under reducing condition at 100 mA for 2 h using mini-PROTEAN electrophoresis instrument (Bio-Rad Laboratories, California, USA). Silver staining of the gels was performed according to the standard protocol [13].

lpx genes operon analysis

lpx genes were amplified using a Thermocycler (Eppendorf, Germany) and the primers listed in Table 1.

Table 1. Sequences of primers used for detection of lpxA, lpxB, lpxC and lpxD genes.

Target gene Primer sequence (5’ 3’) Size (bp) Annealing Temperature (°C) Ref.
lpxA-F ACCATTCATCGTGGCACAGT 356 54 This study
lpxA-R ATAGCGGTAATCGCCTCACG
lpxB-F AAAGAACATGTGCCCAACGC 458 54 This study
lpxB-R CGGGCGGCATTTTTATCTGG
lpxC-F TACCGGCAAGAAAGTCACCC 689 54 This study
lpxC-R TGAACAAGTCACCGATCGCA
lpxD-F TGATTGAGTCCGGCGTTGAA 574 54 This study
lpxD-R CGCCAGACTTTGTTGGGTTG

The Master mix was prepared in a final volume of 25 μl containing 10X PCR Buffer, 50 mM MgCl2, 10 mM dNTPs, 10 μM of each primer, 5 U/μl of Taq DNA Polymerase, 10 ng of the genomic DNA was used as the template. The amplification was performed with the following program: initial denaturation at 94°C for 5 min, 25 cycles of denaturation at 94°C for 1 minute, annealing at 54°C for 30 seconds, extension at 72°C for 30 seconds and a final extension at 72°C for 5 minutes. Genomic DNA from E. coli ATCC 25922 was used as control. The PCR products were separated by electrophoresis on a 1.5% agarose gel containing 0.5 μg/ml Sybr Safe DNA Gel staizn (Thermo Fisher, USA). The bands were visualized under UV light using a gel documentation system (Protein Simple, USA). The partial sequence of lpxA, lpxB, lpxC,and lpxD from E. coli strain ECajums1, ECajums9, ECajums26 and ECajums30 have been deposited to the GenBank under the accession number of. Multiple Sequence Alignment (MSA) was done using the MEGA-X software.

Construction of genetic maps

Two genetic maps; the lpx genes cluster (lpxA, lpxB, lpxC, lpxD, lpxM, lpxL, lpxK, and lpxH) and the adjacent genes between lpxA, lpxB, lpxC, lpxD genes were constructed using the SnapGene software (version 3.2.1) and the data from Genbank (NZ_CP032667.1) and shown in Figs 3 and 4.

Fig 3. Analysis of the lpx coding cluster genes using data from E. coli K-12 substr.

Fig 3

MG1655 (NCBI Reference Sequence: NZ_CP032667.1). A: The molecular size of the lpx coding cluster genes, B: The lpx coding cluster genes, their arrangement and directions, C: The lpx coding cluster genes NCBI code and their exact positions in the genome.

Fig 4. Analysis of the lpxA, lpxB, lpxC, and lpxD genes and the associated adjacent genes using data from E. coli K-12 substr.

Fig 4

MG1655 (NCBI Reference Sequence: NZ_CP032667.1). The purple circle is showing the data from NZ_CP032667.1, and the gray circle is presenting data obtained from culture collection. The outer black circle is showing the exact positions of the lpxA, lpxB, lpxC, and lpxD genes among NZ_CP032667.1 genome (Yellow: lpxC, Blue: lpxB, Red: lpxA, Green: lpxD).

Statistical analysis

Statistical analysis was performed using the “IBM SPSS statistics 22” software (IBM analytics; USA). Statistical significance of variables determined by chi-square and Fisher’s exact tests and statistical significance determined with a p-value ≤ 0.05.

Results and discussion

We previously identified 351 clinical E. coli strains where 10.8% (n = 38) showed reduced susceptibility to colistin based on a disk diffusion assay. Antibiotics resistance profiles showed that 84.2% of the isolates (n = 32) were MDR (Table 2).

Table 2. The characteristics of colistin resistant E. coli clinical isolates tested in this study.

E. coli isolates Colistin MIC (μg/ml) LPS type lpxA gene lpxB gene lpxC gene lpxD gene mcr-1 Resistance pattern (Kirby-Bauer)
ECajums1 1.5 S + + + + - T, CIP,CAZ
ECajums2 1.5 S + + + + - AT
ECajums3 6 S + + + + - CAZ
ECajums4 0.5 S + + + + - -
ECajums5 0.75 S + + + + - AK, CIP, T, CAZ, AT
ECajums6 0.25 S + + + + - AK, CIP, T, CAZ, AT
ECajums7 0.75 S + + + + - T, AT, CAZ
ECajums8 0.75 S + + + + - CAZ
ECajums9 2.5 S + + + + + T, AT, CAZ
ECajums10 4 S + + + + + T, CAZ
ECajums11 ˃256 R - + - - - AK, CIP, T, CAZ, IMI, AT
ECajums12 ˃256 ND - - - - - AK, CIP, T, CAZ, AT
ECajums13 1.5 ND - - - - - AT, CIP, CAZ
ECajums14 1 S + + + + - T, AK, CIP, CAZ
ECajums15 8 ND - - - - - AT, T, CAZ, IMI
ECajums16 ˃256 ND - - - - + AT, T, CAZ, IMI
ECajums17 ˃256 R - - - - - CAZ, IMI
ECajums18 ˃256 R - - - - - T, AT, CAZ, IMI
ECajums19 1.5 ND - - - - - T, AT, CAZ, IMI
ECajums20 1.5 S + + + + - T, CIP, IMI, CAZ
ECajums21 32 S + + + + + CAZ, IMI
ECajums22 3 ND - - - - - AK, T, CAZ, IMI
ECajums23 ˃256 R - + + + - CAZ, IMI
ECajums24 1 S + + + + - T, AT, CIP, CAZ, IMI
ECajums25 2 R - - - - + T, CIP, CAZ, IMI
ECajums26 ˃256 S + + + + + AT, T, CAZ, IMI, CIP
ECajums27 1.5 S + + + + - CAZ
ECajums28 1 S + + + + - T, CIP, CAZ
ECajums29 2.5 S + + + + - T, CIP, CAZ
ECajums30 4 S + + + + - AT, IMI, CIP
ECajums31 2.5 S + + + + - T, CIP, IMI, CAZ
ECajums32 6 S + + + + - T, CAZ
ECajums33 0.75 S + + + + - AT, T, CAZ
ECajums34 1 S + + + + - AT, CIP
ECajums35 1.5 S + + + + - AT
ECajums36 0.5 S + + + + - T, CIP, CAZ
ECajums37 12 S + + + + - AK, CIP, T, CAZ, IMI, AT
ECajums38 2 S + + + + - AT, CIP

Abbreviations: S: smooth-LPS, R: rough-LPS, ND: none detected, CAZ: ceftazidime, T: tetracycline, AT: azithromycin, CIP: ciprofloxacin, IMI: imipenem, AK: amikacin.

Here, we further studied colistin resistance of these 38 isolates and found that only 52.6% (n = 20) were indeed colistin-resistant according to the CLSI breakpoint (MIC ≥ 2 μg/ml). The 18 colistin-susceptible isolates were further investigated regarding the presence of smooth or rough LPS (Fig 1).

Fig 1. LPS structure analysis of E. coli wild type and mutants.

Fig 1

SDS-PAGE analysis of the LPS fractions from Lane 1: positive control with sLPS (E. coli type strain ATCC 25922); Lane 2: colistin-susceptible clinical isolate (ECajums5, which shows sLPS); Lane 3, 4, 6, 7, 9: rLPS (ECajums11, ECajums17, ECajums18 and ECajums23); Lane 5, 8: colistin-resistant clinical isolates without LPS (ECajums12 and ECajums15); Lane 10: molecular mass markers. sLPS: smooth LPS, rLPS: rough LPS.

Intriguingly, none of the 18 investigated strains presented rLPS or deletion in the according lpx genes (lpxA, lpxB, lpxC and lpxD) (Fig 2).

Fig 2. Gel electrophoresis of lpx genes.

Fig 2

A: lpxA gene (356bp). M: DNA marker, 1–10: ECajums1-10, 11 and 12: ECajums 12 and 15, 13: negative control: A. baumannii type strain ATCC 19606, 14: Positive control: E. coli type strain ATCC 25922. B: lpxB gene (458bp). M: DNA marker, 1: Positive control: E. coli type strain ATCC 25922, 2–11: ECajums1-10, 12 and 13: ECajums 12 and 15, 14: negative control: A. baumannii type strain ATCC 19606. C: lpxC gene (689bp). M: DNA marker, 1–10: ECajums1-10, 11 and 12: ECajums 12 and 15, 13: negative control: A. baumannii type strain ATCC 19606, 14: Positive control: E. coli ATCC 25922. D: lpxD gene (574bp). M: DNA marker, 1–10: ECajums1-10, 11 and 12: ECajums 12 and 15, 13: negative control: A. baumannii type strain ATCC 19606, 14: Positive control: E. coli ATCC 25922.

The lipid A coding cluster genes are concentrated in two distinct region of the genome (Fig 3), separated by 349kb. The second region was evaluated in this study.

The genes lpxB, lpxA, and lpxD are near each other while, lpxC is in a significant distance from the other three family members and separated by 71 genes including 93kb (Fig 4).

By using the online Operon mapper (http://biocomputo.ibt.unam.mx/operon_mapper/) [27], it was determined that the genes lpxB, lpxA, and lpxD are functioning as an operon along with other 11 adjacent genes including fabZ which separate the lpxB and lpxA genes. By using the Tandem Repeats Finder online tool [28], we detected two regions for variable number tandem repeats (VNTRs) among these adjacent genes. The first was located between the positions 74637–74857 which it had a period size of 96 bp and copy number of 2.3. The second tandem repeat region was detected in the positions 78039–78781 which its period size was 309 bp and it had a copy number of 2.4.

By analyzing the lpx genes (lpxA, lpxB, lpxC, and lpxD) sequences using the MSA, we found multiple single nucleotide polymorphisms (SNPs). In lpxA, 7 SNPs were observed which led to only one amino acid substitution (I119L). In lpxB, only 1 SNP was detected, while no amino acid substitution was observed. In lpxC, 9 SNPs were detected but no amino acid substitution was occurred. In lpxD, we observed 28 SNPs, which led to only one amino acid substitution (I224V). Partial sequences of lpx genes from four colistin resistant E. coli isolates (ECajums1, ECajums9, ECajums26 and ECajums30) were deposited to the GenBank under the subsequent accession numbers: lpxA (MT196001-MT196004), lpxB (MT195997-MT196000), lpxC (MT195993-MT195996), and lpxD (MT195989-MT195992).

In regards to the colistin-resistant strains, we found that six out of the 20 resistant isolates (30%) were harbouring mcr-1 but not mcr-2. Two of these six isolates, ECajums16 and ECajums25 with an MIC for colistin of ˃256 μg/ml and 2 μg/ml, respectively, had lost their LPS biosynthesis cluster (lpxA, lpxB, lpxC and lpxD) (Table 2). However, they harbored the mcr-1 gene, but it appeared that colistin resistance was due to the loss of the cellular target in these isolates. The other four isolates, ECajums9, ECajums10, ECajums21, and ECajums26 had an MIC of 2.5, 4, 32, and ˃256 μg/ml, respectively, and showed intact sLPS (Table 2). Further investigation of the lpx genes revealed that these four isolates had no mutation in the lpx biosynthetic cluster (lpxA, lpxB, lpxC and lpxD). Next, we examined the role of mcr-1 in resistance against colistin in these isolates. Heterologous expression of mcr-1 in E. coli DH5α increased the MIC from 0.25 μg/ml to 2.5 μg/ml, conferring the role of mcr-1 in resistance to colistin among these four isolates. Intriguingly, from the 14 colistin-resistant isolates not harbouring mcr genes, six presented no LPS and were disrupted in the lpx biosynthetic cluster. The colistin MICs ranged from 2 μg/ml to ˃256μg/ml. Three isolates had deletions in lpx genes, but not all of them showed the rLPS. The other five isolates showed sLPS types and no mcr gene (Table 2). Overall, we found five isolates with rLPS and six isolates were negative for LPS production. Both phenotypes were statistically significant related to the colistin resistance (P-value ≤ 0.05).

The occurrence of colistin-resistant strains has severe consequences for its clinical suitability [29]. There are increasing reports of colistin resistance among Gram-negative bacteria [30]. A study conducted by Rossia et al. in Brazil showed that within five years, 4% (n = 1346) of Gram-negative bacteria became colistin-resistant. Among these, Enterobacteriaceae were the most frequent (86.1%) pathogens [31]. In Iran, several reports presented colistin resistance among Enterobacteriaceae; an alarming situation for the health care system [24, 32]. In Europe, colistin resistance rates appear to be much lower than in developing countries. A study in Italy showed that among 3,902 clinical isolates of E. coli, only 0.5% were resistant to colistin [33]. There is no report on the resistance rate of Gram negative bacteria against Colistin from USA.

Resistance to colistin can occur via chromosomal mutations or the uptake of exogenous DNA, such as plasmids carrying colistin resistance genes (mcr). Indeed, there are emerging reports of plasmid-borne mcr genes, which provide a mechanism for rapid dissemination [34]. The first occurrence of the mcr-1 gene was reported in China in 2015 [35]; the first report in the United States in 2016 [36]. In Iran, Moosavian and Emam reported that among 64 colistin-resistant Enterobacteriaceae, 1.7% (n = 8) of the isolates were already harbouring the mcr-1 gene [24]. These reports indicating a global spread, and a new massive challenge for the health systems around the world. The mcr-2 gene is a rare variant of mcr-1 and is found only in Belgium. The less-related mcr-3, mcr-4, and mcr-5 were identified in E. coli and Salmonella [2022].

Interestingly, there have been other reports showing colistin-resistant isolates not harbouring mcr genes. In the study by Manohar et al., 24 colistin-resistant Klebsiella pneumoniae isolates were investigated and none of them carried mcr-1 or mcr-2 [37]. Potentially, this could be due to the loss of LPS as recently shown by mutations in lipid A biosynthesis genes in E. coli [38]. This strongly indicates that the interaction of colistin with LPS is critical for the bactericidal action of colistin against E. coli.

Colistin resistance due to the loss of LPS increases the susceptibility to other antibiotics. This could be applied in combined antibiotic-therapy regimens containing colistin and a second antibiotic effective against colistin-resistant, LPS-deficient Gram-negative bacteria and such a method may develop the employment of colistin as a good antimicrobial against MDR Enterobacteriaceae [39].

In summary, LPS derived from clinical E. coli isolates showed the rough type (sLPS) and was associated with a colistin-resistant phenotype. However, other resistant isolates had deletions in lpx genes and showed no LPS production. This is in accordance with other reports, where insertions such as ISAba11 were shown to be associated with colistin resistance and loss of the LPS in other Gram-negative bacteria [40]. The detection of SNPs and VNTRs in lpx and adjacent genes confirmed the hyper-mutability within these regions [41].

Conclusions

The complete loss of the LPS and/or production of the rLPS could lead to colistin resistance among E. coli clinical isolates not harbouring the mcr-1 gene. It is due to the loss of the "lipid A", which is the molecular target for this antibiotic. Another reason could be the reduced affinity of the drug to its molecular target as a results of decreased net negative charge because of deletion of AgO chains in the rLPS.

Supporting information

S1 Table. Demographic data of 38 Escherichia coli clinical isolates used in this study.

(DOCX)

S2 Table. Distribution of absolute and relative frequency of 351 Escherichia coli clinical isolates from Ahvaz teaching hospitals used in this study.

(DOCX)

S3 Table. Absolute and relative abundance of 351 Escherichia coli clinical isolates used in this study based on isolation from different clinical specimens.

(DOCX)

S1 File. lpxA genes annotation file.

(TXT)

S2 File. lpxB genes annotation file.

(TXT)

S3 File. lpxC genes annotation file.

(TXT)

S4 File. lpxD genes annotation file.

(TXT)

S1 Data

(PDF)

S1 Fig. Distribution of absolute and relative abundance of 351 Escherichia coli clinical isolates used in this study based on gender pf patients.

(DOCX)

S2 Fig. Distribution of relative frequency of 351 Escherichia coli isolates used in this study based on isolation from different wards of hospitals.

(DOCX)

S3 Fig. Antibiotic resistance pattern of 351 Escherichia coli isolates used in this study.

(DOCX)

S4 Fig

(TIF)

S5 Fig

(TIF)

S6 Fig

(TIF)

S7 Fig

(TIF)

S8 Fig

(TIF)

S9 Fig

(TIF)

S10 Fig

(TIF)

S11 Fig

(TIF)

S12 Fig

(TIF)

S13 Fig

(TIF)

S14 Fig

(TIF)

Acknowledgments

The authors would like to thank Prof. Surbhi Malhotra (Department of Medical Microbiology, University of Antwerp, Belgium), and Prof. Ágnes Sonnevend (College of Medicine, Department of Medical Microbiology and Immunology, United Arab Emirates University) for kindly providing us with the E.coli KP81 and E.coli KP37 strains (as mcr-1 and mcr-2 positive control strains respectively).

Data Availability

All relevant data are within the paper and supporting information files.

Funding Statement

This study is a part of MSc thesis (by Nasrin Emam) which was approved as a research plan (Grant No: 96109) and was financially supported by the Deputy Vice-Chancellor for Research Affair and Infectious & Tropical Diseases Research Center, Ahvaz Jundishapur University of Medical Sciences (AJUMS), Ahvaz, Iran. The authors gratefully acknowledge all of them.

References

  • 1.Liu L, Feng Y, Zhang X, McNally A, Zong Z. New variant of mcr-3 in an extensively drug resistant Escherichia coli clinical isolate carrying mcr-1 and blaNDM-5. Antimicrob Agents Chemother. 2017; 61: e01757–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ripabelli G, Sammarco ML, Scutellà M, Felice V, Tamburro M. Carbapenem-Resistant KPC- and TEM-Producing Escherichia coli ST131 Isolated from a Hospitalized Patient with Urinary Tract Infection: First Isolation in Molise Region, Central Italy, July 2018. Microb Drug Resist. 2020. January; 26(1):38–45. 10.1089/mdr.2019.0085 [DOI] [PubMed] [Google Scholar]
  • 3.Di Tella D, Tamburro M, Guerrizio G, Fanelli I, Sammarco ML, Ripabelli G. Molecular Epidemiological Insights into Colistin-Resistant and Carbapenemases-Producing Clinical Klebsiella pneumoniae Isolates. Infect Drug Resist. 2019. December 3; 12:3783–3795. 10.2147/IDR.S226416 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Nørgaard SM, Jensen CS, Aalestrup J, Vandenbroucke-Grauls CMJE, de Boer MGJ, Pedersen AB. Choice of therapeutic interventions and outcomes for the treatment of infections caused by multidrug-resistant gram-negative pathogens: a systematic review. Antimicrob Resist Infect Control. 2019. November 4; 8:170 10.1186/s13756-019-0624-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Savari M, Ekrami A, Shoja S, Bahador A. Plasmid borne Carbapenem-Hydrolyzing Class D β-Lactamases (CHDLs) and AdeABC efflux pump conferring carbapenem-tigecycline resistance among Acinetobacter baumannii isolates harboring TnAbaRs. Microbial Pathogenesis. 2017; 104: 310–317. 10.1016/j.micpath.2017.01.045 [DOI] [PubMed] [Google Scholar]
  • 6.Centers for Disease Control and Prevention (CDC). Vital signs: carbapenem-resistant Enterobacteriaceae. MMWR Morb Mortal Wkly Rep. 2013; 62:165.. [PMC free article] [PubMed] [Google Scholar]
  • 7.Forde BM, Zowawi HM, Harris PNA, Roberts L, Ibrahim E, Shaikh N, et al. Discovery of mcr-1-Mediated Colistin Resistance in a Highly Virulent Escherichia coli Lineage. mSphere. 2018. October 10; 3(5):e00486–18. 10.1128/mSphere.00486-18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Nation RL and Li J. Colistin in the 21st century. Curr Opin Infect Dis. 2009. December; 22(6): 535–43. 10.1097/QCO.0b013e328332e672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Maldonado RF, Sá-Correia I, Valvano MA. Lipopolysaccharide modification in Gram-negative bacteria during chronic infection. FEMS Microbiol Rev. 2016. April 12; 40(4): 480–493. 10.1093/femsre/fuw007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Stenutz R, Weintraub A, Widmalm G. The structures of Escherichia coli O-polysaccharide antigens. FEMS Microbiol Rev. 2006; 30(3): 382–403. 10.1111/j.1574-6976.2006.00016.x [DOI] [PubMed] [Google Scholar]
  • 11.Klein G and Raina S. Regulated Assembly of LPS, Its Structural Alterations and Cellular Response to LPS Defects. Int J Mol Sci. 2019; 20: 356.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Bohl TE, Ieong P, Lee JK, Lee T, Kankanala J, Shi K, et al. The substrate-binding cap of the UDP-diacylglucosamine pyrophosphatase LpxH is highly flexible, enabling facile substrate binding and product release. J Biol Chem. 2018. May 25; 293(21):7969–7981. 10.1074/jbc.RA118.002503 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Garrett TA, Kadrmas JL, Raetz CR. Identification of the gene encoding the Escherichia coli lipid A 4’-kinase. Facile phosphorylation of endotoxin analogs with recombinant LpxK. J Biol Chem. 1997. August 29; 272(35):21855–64. 10.1074/jbc.272.35.21855 [DOI] [PubMed] [Google Scholar]
  • 14.Six DA, Carty SM, Guan Z, Raetz CR. Purification and mutagenesis of LpxL, the lauroyltransferase of Escherichia coli lipid A biosynthesis. Biochemistry. 2008; 47(33):8623–8637. 10.1021/bi800873n [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Xu H, Ling J, Gao Q, He H, Mu X, Yan Z, et al. Role of the lpxM lipid A biosynthesis pathway gene in pathogenicity of avian pathogenic Escherichia coli strain E058 in a chicken infection model. Vet Microbiol. 2013. October 25; 166(3–4):516–26. 10.1016/j.vetmic.2013.05.030 [DOI] [PubMed] [Google Scholar]
  • 16.Poirel L, Jayol A, Nordmann P. Polymyxins: Antibacterial Activity, Susceptibility Testing, and Resistance Mechanisms Encoded by Plasmids or Chromosomes. Clin Microbiol Rev. 2017; 30(2):557–596. 10.1128/CMR.00064-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Bialvaei AZ, Samadi Kafil H. Colistin, mechanisms and prevalence of resistance. Curr Med Res Opin. 2015; 31(4): 707–721. 10.1185/03007995.2015.1018989 [DOI] [PubMed] [Google Scholar]
  • 18.Snesrud E, Ong AC, Corey B, Kwak YI, Clifford R, Gleeson T, et al. Analysis of Serial Isolates of mcr-1-Positive Escherichia coli reveals a Highly Active ISApl1 Transposon. Antimicrob Agents Chemother. 2017. April 24; 61(5): e00056–17. 10.1128/AAC.00056-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Moffatt JH, Harper M, Harrison P, Hale JD, Vinogradov E, Seemann T, et al. Colistin resistance in Acinetobacter baumannii is mediated by complete loss of lipopolysaccharide production. Antimicrob agents chemother. 2010; 54(12): 4971–4977. 10.1128/AAC.00834-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Carroll LM, Gaballa A, Guldimann C, Sullivan G, Henderson LO, Wiedmann M. Identification of Novel Mobilized Colistin Resistance Gene mcr-9 in a Multidrug-Resistant, Colistin-Susceptible Salmonella enterica Serotype Typhimurium Isolate. mBio. 2019; 10 (3): e00853–19. 10.1128/mBio.00853-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sun J, Zhang H, Liu YH, Feng Y. Towards Understanding MCR-like Colistin Resistance. Trends Microbiol. 2019. September; 26 (9): 794–808. [DOI] [PubMed] [Google Scholar]
  • 22.Xu Y, Wei W, Lei S, Lin J, Srinivas S, Feng Y. An Evolutionarily Conserved Mechanism for Intrinsic and Transferable Polymyxin Resistance. mBio. 2018. April 10; 9 (2): e02317–17. 10.1128/mBio.02317-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Sun S, Negrea A, Rhen M, Andersson DI. Genetic analysis of colistin resistance in Salmonella enterica serovar Typhimurium. Antimicrob Agents Chemother. 2009;53(6):2298–2305. 10.1128/AAC.01016-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Moosavian M, Emam N. The first report of emerging mobilized colistin-resistance (mcr) genes and ERIC-PCR typing in Escherichia coli and Klebsiella pneumoniae clinical isolates in southwest Iran. Infect Drug Resist. 2019. April 29; 12:1001–1010. 10.2147/IDR.S192597 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.CLSI. 2018. Performance standards for antimicrobial susceptibility testing; 25th informational supplement. CLSI document M100-S26. Clinical and Laboratory Standards Institute, Wayne, PA.
  • 26.Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012. March; 18(3):268–281. j.1469-0691.2011.03570.x 10.1111/j.1469-0691.2011.03570.x [DOI] [PubMed] [Google Scholar]
  • 27.Taboada B, Estrada K, Ciria R, Merino E. Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes. Bioinformatics. 2018. December 1; 34 (23): 4118–4120. 10.1093/bioinformatics/bty496 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999; 27 (2): 573–580. 10.1093/nar/27.2.573 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Akajagbor DS, Wilson SL, Shere-Wolfe KD, Dakum P, Charurat ME, Gilliam BL. Higher incidence of acute kidney injury with intravenous colistimethate sodium compared with polymyxin B in critically ill patients at a tertiary care medical center. Clin Infect Dis. 2013. November; 57 (9):1300–3. 10.1093/cid/cit453 [DOI] [PubMed] [Google Scholar]
  • 30.Simpson RJ. Staining proteins in gels with silver nitrate. CHS protoc. 2007 July 1: 2007:pdb.prot4727. [DOI] [PubMed] [Google Scholar]
  • 31.Falagas ME, Grammatikos AP, Michalopoulos A. Potential of old-generation antibiotics to address current need for new antibiotics. Expert Rev Anti Infect Ther. 2018; 6(5): 593–600. [DOI] [PubMed] [Google Scholar]
  • 32.Rossia F, Raquel Girardello R, Curya AP, Di Gioia TS, Almeida JN Jr, Duarte AJ. Emergence of colistin resistance in the largest university hospital complex of São Paulo, Brazil, over five years. Braz j infect dis. 2017; 21(1): 98–101. 10.1016/j.bjid.2016.09.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Aghapour Z, Gholizadeh P, Ganbarov K, Zahedi Bialvaei A, Mahmood SS, Tanomand A, et al. Molecular mechanisms related to colistin resistance in Enterobacteriaceae. Infect Drug Resist. 2019; 12: 965–975. 10.2147/IDR.S199844 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Principe L, Piazza A, Mauri C, Anesi A, Bracco S, Brigante G, et al. Multicenter prospective study on the prevalence of colistin resistance in Escherichia coli: relevance of mcr-1-positive clinical isolates in Lombardy, Northern Italy. Infect Drug Resist. 2018. March 9; 11: 377–385. 10.2147/IDR.S160489 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016. February; 16 (2): 161–168. 10.1016/S1473-3099(15)00424-7 [DOI] [PubMed] [Google Scholar]
  • 36.McGann P, Snesrud E, Maybank R, Corey B, Ong AC, Clifford R, et al. Escherichia coli Harboring mcr-1 and blaCTX-M on a Novel IncF Plasmid: First Report of mcr-1 in the United States. Antimicrob Agents Chemother. 2016. June 20; 60(7):4420–4421. 10.1128/AAC.01103-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Manohar P, Shanthini T, Ekta P, Mahesan J B, Gothandam KM, Bozdogan B, et al. Colistin-Resistant Klebsiella pneumoniae: Prevalence of Integrons and Synergistic Out Turn for Colistin-Meropenem. Arch Clin Infect Dis. 2018, 13(1): e55099. [Google Scholar]
  • 38.Trebosc V, Gartenmann S, Tötzl M, Lucchini V, Schellhorn B, Pieren M, et al. Dissecting Colistin Resistance Mechanisms in Extensively Drug-Resistant Acinetobacter baumannii Clinical Isolates. MBio. 2019; 10(4): e01083–19. 10.1128/mBio.01083-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.MacNair CR, Stokes JM, Carfrae LA, Fiebig-Comyn AA, Coombes BK, Mulvey MR, et al. Overcoming mcr-1 mediated colistin resistance with colistin in combination with other antibiotics. Nat Commun. 2018. January 31;9(1):458 10.1038/s41467-018-02875-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Moffatt JH, Harper M, Adler B, Nation RL, Li J, Boyce JD. Insertion sequence ISAba11 is involved in colistin resistance and loss of lipopolysaccharide in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2011; 55:3022–3024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Zhou K, Aertsen A, Michiels CW. The role of variable DNA tandem repeats in bacterial adaptation, FEMS Microbiol Rev. 2014. January; 38 (1): 119–141. 10.1111/1574-6976.12036 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. Demographic data of 38 Escherichia coli clinical isolates used in this study.

(DOCX)

S2 Table. Distribution of absolute and relative frequency of 351 Escherichia coli clinical isolates from Ahvaz teaching hospitals used in this study.

(DOCX)

S3 Table. Absolute and relative abundance of 351 Escherichia coli clinical isolates used in this study based on isolation from different clinical specimens.

(DOCX)

S1 File. lpxA genes annotation file.

(TXT)

S2 File. lpxB genes annotation file.

(TXT)

S3 File. lpxC genes annotation file.

(TXT)

S4 File. lpxD genes annotation file.

(TXT)

S1 Data

(PDF)

S1 Fig. Distribution of absolute and relative abundance of 351 Escherichia coli clinical isolates used in this study based on gender pf patients.

(DOCX)

S2 Fig. Distribution of relative frequency of 351 Escherichia coli isolates used in this study based on isolation from different wards of hospitals.

(DOCX)

S3 Fig. Antibiotic resistance pattern of 351 Escherichia coli isolates used in this study.

(DOCX)

S4 Fig

(TIF)

S5 Fig

(TIF)

S6 Fig

(TIF)

S7 Fig

(TIF)

S8 Fig

(TIF)

S9 Fig

(TIF)

S10 Fig

(TIF)

S11 Fig

(TIF)

S12 Fig

(TIF)

S13 Fig

(TIF)

S14 Fig

(TIF)

Data Availability Statement

All relevant data are within the paper and supporting information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES