Skip to main content
NCBI home page
Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology logoLink to Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology
. 2019 Sep 28;44(2):364–373. doi: 10.1007/s12639-019-01164-w

Detecting Fasciola hepatica and Fasciola gigantica microRNAs with loop-mediated isothermal amplification (LAMP)

Diem Hong Tran 1, Huong Thi Thu Phung 1,✉
PMCID: PMC7244643  PMID: 32508411

Abstract

Fascioliasis is a parasitic infection typically caused by two common parasites of class Trematodo, genus Fasciola, namely Fasciola hepatica and Fasciola gigantica. The widespread of these species in water and food makes fascioliasis become a global zoonotic disease that affects 2.4 million people in more than 75 countries worldwide. Typically, F. hepatica and F. gigantica can be recognized by parasitological techniques to detect Fasciola spp. eggs, immunological techniques to detect worm-specific antibodies, or by molecular techniques such as PCR to detect parasitic genomic DNA. Recently, miRNAs have been raised as a key regulator and potential diagnostic biomarkers of diseases, including parasitic infection. An isothermal PCR called loop-mediated isothermal amplification (LAMP) is rapid, sensitive, and its amplification process is so extensive that making LAMP well-suited for field diagnostics. LAMP reactions for miRNA detection have been introduced and were able to detect the target miRNA amounts in the wide range of 1.0 amol to 1.0 pmol, exhibiting high selectivity to differentiate one-base between miRNA sequences. Here, we introduced a modified LAMP to detect a species-specific miRNA of F. hepatica and F. gigantica. Our method did not demand an initial heating step and the reactions had a high sensitivity that greater than 1000 times in comparison to that reported in previous studies. Most importantly, the technique could perform well with parasitic miRNA presenting in bovine serum samples without sophisticated equipment required. These results create a promising technique basis for some novel and simple device to diagnose fascioliasis and other parasitic infection diseases at point-of-care.

Keywords: Biomarker, Fascioliasis, LAMP, miRNA

Introduction

Fascioliasis, a parasitic infection, is one of the major neglected tropical diseases caused by the flatworms Fasciola hepatica and Fasciola gigantica, two species of trematodes that mainly affect the liver, which is also known as “the common liver fluke” (de Waal 2016). Fascioliasis is waterborne and foodborne zoonotic disease that humans are incidental hosts and get infected by consuming contaminated water or water plants (de Waal 2016). This disease is found in all five continents, in over 75 countries and infects at least 2.4 million people worldwide (Tolan 2011). As a result, fascioliasis diagnostic methods have always been of interest and improvement. Normally, the infection confirmation abides by different ways of diagnostic techniques. The typical criteria to confidently confirm a person is infected with Fasciola spp. is by observing the parasite (de Waal 2016). This parasitological technique is set up to find Fasciola spp. eggs in fecal specimens (de Waal 2016). However, it can be hard to search for eggs in stool specimens from patients with light infections. Thus, the infection has to be diagnosed by alternative methods than by examining stool samples (de Waal 2016). Specific and sensitive molecular diagnostic methods, including polymerase chain reaction (PCR), enzyme-linked immunoelectrotransfer blot (EITB), and enzyme-linked immunosorbent assay (ELISA), have been developed for fascioliasis (Tolan 2011). However, these tests require advanced skills and equipment that are not readily available in resource-limited settings, especially in isolated areas where the disease is widespread.

Recently, the discovery of microRNA (miRNA), a short non-coding RNA molecular that has about 21–25 nucleotide in length in eukaryote cells, has expanded our understanding of the pathogen’s mechanisms (Schultz et al. 2014), and created new changes for developing novel techniques to detect them. Clearly, miRNAs play a pivotal role in regulator of pathogen gene expression with a variety of manners (Yyusnita et al. 2012; Schultz et al. 2014; Xin et al. 2017; Patnaik et al. 2017). The presence of miRNAs in serum has been proven to be an important biomarker for the diagnosis of certain diseases such as viral infections, cardiovascular and nervous system disorders, and diabetes (Schultz et al. 2014). The interest in the role of small RNAs in parasitic infections has been rapidly growing currently. Importantly, miRNAs are identified as one of the key regulators in nematode development (Brase et al. 2010). Parasitic circulating miRNAs have been shown to be detected in the biological fluids of infected hosts, such as serum, saliva and others (Chen et al. 2005; Mar-Aguilar et al. 2013; Hoy et al. 2014; Cai et al. 2015, 2016; Holz and Streit 2017). Although it is still unclear that the miRNAs deriving from parasites, which circulating in circulatory system of mammalian hosts, are from alive or dead organisms, miRNAs in serum are still promising diagnostic biomarkers of parasitic infection due to their strong stability and the high specificity and sensitivity of detection methods recently developed (Britton et al. 2015).

The extreme stability of secreted miRNAs is believed to be due to their release within micro-vesicles or exosomes or by forming a complex with special protein (Hoy et al. 2014). Studies on Heligmosomoides polygyrus excretory-secretory material have proved that certain miRNAs excreted by parasites were covered within the extracellular vesicles (Buck et al. 2014). Moreover, those parasitic miRNAs within the exosomes were also transported to host cells (Buck et al. 2014). Exosome-like vesicles containing miRNAs are reported to be released from the infective L3 stage of the human filarial parasite Brugia malayi (Zamanian et al. 2015). Importantly, the release of exosomes derived from F. hepatica has also been demonstrated (Marcilla et al. 2012). Despite that there was no mutuality between the microfilariae numbers and miRNA counts (Tritten et al. 2014), the gathering information significantly demonstrated that the particular parasitic miRNAs present in the host circulatory system advantageously appear as non-invasive markers for the detection of specific infections. Furthermore, the detailed profiles of miRNAs expression of parasitic helminths have recently been created including fluke, nematodes, and tapeworms such as F. gigantica and F. hepatica (Xu et al. 2012; Britton et al. 2014). The comparison of miRNA expression profiles of F. gigantica and F. hepatica was reported and revealed that there are 11 miRNAs shared by the two kinds of worm, including 8 conserved and 3 novel miRNAs (Xu et al. 2012). All the conserved miRNAs were the same as those from Schistosoma japonicum in the miRBase database. Besides, 8 and 5 miRNAs were identified as F. gigantica- and F. hepatica-, specific ones, respectively (Xu et al. 2012).

The fact that miRNAs are short and highly homologous, hence accurately detecting them is challenging (Leshkowitz et al. 2013). Different methods for detection of miRNAs have been developed including northern blotting (Válóczi et al. 2004), reverse transcription PCR (RT-PCR) (Chen et al. 2005), microarrays, and others, however, each method has its particular limitations. Currently, different detection methods have been developed, for example isothermal exponential amplification-based methods, cleavage-based methods, rolling cycle amplification-based methods, gold nanoparticles-based methods, quantum dot-based methods, capillary-electrophoresis-based assay (Tian et al. 2015). A shared idea between these recently developed methods is the combination of multistep signal enhancement and sensitive signal detection to accomplish great recognition efficiency. Among those, we are interested in isothermal nucleic acid amplification methods which are extremely fast and highly sensitive. Unlike conventional PCR-based methods, isothermal nucleic acid amplification methods do not require changes in temperature and can be performed without a thermocycler, allowing them to be used at resource-limited settings. Recently, a loop-mediated isothermal amplification (LAMP) to detect specific miRNA was introduced (Tian et al. 2015). LAMP can be accomplished with only one type of DNA polymerase without the requirement of any modified or labeled DNA probes that significantly decrease the cost and make the experimental procedure simpler. A conceivable disadvantage of the LAMP is the need of a template DNA, forward inner primer (FIP), backward inner primer (BIP), and backward outer primer B3 (Li et al. 2011). However, LAMP reactions merely need a little amount of primers and template, making this assay still cost-effective. Moreover, LAMP was demonstrated to be able to detect the target miRNA amounts in the wide range of 1.0 amol to 1.0 pmol, and displayed marked selectivity to distinctly distinguish one-base difference among miRNA sequences (Li et al. 2011). These properties make LAMP become outstanding isothermal nucleic acid amplification method that has been widely used recently. Besides, the LAMP reaction outcome can be read by the use of SyBr Green, a dye only fluoresces upon binding to double-stranded DNA molecules when exposed to a light source emitting around 470 nm. Alternatively, a pH-sensitive dye can be used to indicate the reaction result based on the pH deduction of LAMP reaction, and the change of color can be easily read by naked eyes (Tanner et al. 2015). The colorimetric detection enables the amplification product to be detected and analyzed immediately without the requirement of extended workflow time, specialized and expensive equipment (Tanner et al. 2015). Moreover, many designs of electricity-free and portable devices that provide constant heat source to allow amplification reactions occur have been introduced recently, making LAMP highly feasible for field diagnostics (Singleton et al. 2013, 2014; Shah et al. 2015; Buser et al. 2015). In this study, we have developed a modified LAMP method to sensitively and accurately detect the miRNA species-specific for Fasciola spp. By using this technique, we achieved to detect specific miRNA of F. hepatica and F. gigantica at the amount of 1 zmol in bovine serum in short time and simpler process at a constant temperature.

Materials and methods

Nucleotides, enzymes, and chemicals

The oligonucleotides used to perform LAMP reactions were synthesized commercially from IDT (Skokie, Illinois, USA). Isothermal Master Mix was purchased from OptiGene (Horsham, West Sussex, UK). Bovine serum was obtained from Sigma-Aldrich (St. Louis, Missouri, USA). Nucleic acid gel stain GelRed was provided by Biotium (Fremont, CA, USA). 10,000X SyBr Green I was purchased from Invitrogen (Carlsbad, CA, USA).

The LAMP reaction

The LAMP reaction consisted of FIP, BIP, and B3 primers that were designed as previously (Li et al. 2011). The template was also inherited from the previous study (Li et al. 2011) with a sequence modification which is complementary to the selected parasite miRNA. The RNA oligo which mimics the parasite miRNA was selected from the previous finding (Xu et al. 2012). The oligonucleotides used to perform LAMP reactions are listed in Table 1. LAMP was performed in a reaction mixture (15 µL) containing the indicated amount of miRNA and template, 6 pmol of FIP and BIP, 0.5 fmol of B3 (Li et al. 2011) and 9 µL of Isothermal Master Mix. Reactions were incubated at 60 °C for 90 min (min). The LAMP products were then subjected to 1.5% agarose gel electrophoresis, visualized by staining with GelRed and photographed under UV light.

Table 2.

Sequence of miRNAs used in the experiment examining LAMP reaction specificity

No. Nucleotide sequences (length in nt) Name Source
1 5′-AUGAAACAGCUGUACAGUGC-3′ (20) miR-novel-shared-02 Fasciola spp.
2 5′-GCCUCCAUAGCUCAGUGGUCAGA-3′ (23) miR-novel-shared-04 Fasciola spp.
3 5′-UGGAAGCACUGUAUAGCUGUUUU-3′ (23) miR-novel-shared-03U modified miRNA
4 5′-CGGAAGCACUGUACAGCUGUUUU-3′ (23) miR-novel-shared-03C modified miRNA
5 5′-AAAGCAGCUGUACCAUUUAC-3′ (20) bta-miR-562 Bos taurus (domestic cow)
6 5′-GGAGGUAGUUCGUUGUGUGGU-3′ (21) sja-let-7 Schistosoma japonicum
7 5′-CCAUUUUCCGCGAUUGCCUUGAUUU-3′ (25) sja-miR-124-5p Schistosoma japonicum
8 5′-UGAGAUCGCGAUUAAAGCUGGU-3′ (22) sma-bantam-3p Schistosoma mansoni
9 5′-AACCCUGUAGACCCGAGUUUGG-3′ (22) sma-miR-10-5p Schistosoma mansoni
Open in a new tab

Underlined letter in Nos. 3 and 4 denote the ribonucleotide replaced in miR-novel-shared-03 sequence

Table 1.

Oligonucleotides designed for LAMP reactions

No. Nucleotide sequences (length in nt) Name
1 5′-ACAACGTCGTGACTGGGAAAACCCTTTTTGTGCGGGCCTCTTCGCTATTAC-3′ (51) FIP
2 5′-CGACTCTAGAGGATCCCCGGGTACTTTTTGTTGTGTGGAATTGTGAGCGGAT-3′ (52) BIP
3 5′-ACTTTATGCTTCCGGCTCGTA-3′ (21) B3
4 5′-CTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAG Template
GAAACGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACAACGTCGT
GACTGGGAAAACCCTGGCGTTACCCAACTTAATCGGTAATAGCGAAGAGGCCCGCACAAA
ACAGCTGTACAGTGCTTCCA-3′ (199)
5 5′-UGGAAGCACUGUACAGCUGUUUU-3′ (23) miRNA-novel-shared-03
Open in a new tab

Underlined letters in No. 4 denote the sequence complementing to the sequence of miRNA-novel-shared-03

The LAMP reaction with miRNAs in bovine serum

The synthetic RNA oligo which serves as miRNA was diluted in bovine serum to produce different concentrations ranging from 1 zmol to 1 pmol. The LAMP reactions were performed as described above with the indicated amount of miRNAs.

Serum collection

Ten millilitre whole blood sample was collected from bovine liver into a specialized serum collection tube. The collection tubes were kept upright for 20–30 min at room temperature to form a blood clot. The tubes were centrifuged at 3000–4000 rpm in 30 min. After centrifugation, the yellow top layer contains serum was obtained. Serum samples were collected and preserved at − 20 °C.

Results

Selection of the species-specific miRNA of Fasciola spp. and designation of the LAMP reaction components

Based on the study establishing the miRNA expression profiles of F. gigantica and F. hepatica using a combined sequencing with bioinformatics approach and quantitative real-time PCR (Xu et al. 2012), the sequence of one Fasciola spp.-novel miRNA sharing between two kinds of worms was selected to serve as the biomarker for Fasciola spp. detection employing LAMP (Table 1). Also, we followed the LAMP components that were designed previously to conduct the LAMP reactions initiated by miRNAs (Li et al. 2011).

Performance of LAMP with synthetic miRNA

The LAMP reaction steps for the detection of miRNA are shown in Fig. 1. In this study, we used the synthetic RNA oligo to serve as miRNA specific for Fasciola spp. (Table 1). LAMP master mix was commercially provided by OptiGene (Horsham, West Sussex, UK). The LAMP reaction included 0.5 fmol of double-stranded (ds) DNA template, 6.0 pmol of FIP and BIP primers, and 0.5 fmol of B3 primer (Li et al. 2011). The amount of synthetic miRNA used was 10 fmol. Reactions were performed at 60 °C for 90 min. The results showed that only in the presence of miRNA, LAMP product of different size segments formed a long smear when analyzed on gel electrophoresis (Fig. 2, lane 2). As expected, when miRNA was absent, the product was not observed (Fig. 2, lane 3). These data prove that a positive signal of the LAMP reaction specifically corresponds to the presence of miRNA in the sample.

Fig. 1.

Fig. 1

Open in a new tab

LAMP reaction using single-stranded DNA template initiated by the target miRNA. FIP, Forward inner primer; BIP, backward inner primer; B3, outer primer. The DNA template contains the sequences of B1, B2, B3, F1c, F2c and M. The sequence of M is perfectly complementary to the target miRNA. FIP contains F1c, a TTTT spacer and the sequence F2 complementary to F2c. BIP contains the sequence B1c, a TTTT spacer and B2. B2c and B3c are complementary to B2 and B3, respectively. All the sequences of the DNA template, FIP primer, BIP primer, B3 primer and parasite miRNA are listed in Table 1

Fig. 2.

Fig. 2

Open in a new tab

The performance of LAMP with synthetic miRNA. Reaction mixture (15 µL) contained 10 fmol of miRNA, 0.5 fmol of ds DNA template, 6 pmol of FIP and BIP, 0.5 fmol of B3 and 9 µL of Isothermal Master Mix. Reactions were incubated at 60 °C for 90 min

The LAMP reactions with double-stranded and single-stranded DNA templates

Although the LAMP reactions to detect the presence of specific miRNA was performed efficiently as reported previously, the use of ds DNA template required the need of a first heating step for a period of 2–4 min at 96–98 °C to split the two circuits of DNA. LAMP utilizes only one enzyme Bst DNA polymerase which also possesses RNA polymerase (using a DNA template) and strand displacement activities. Hence, it is expected that without the pre-heating step, the LAMP reactions should still occur. However, we found that if using ds DNA template without heating first, the reaction could not succeed (data not shown). Accordingly, this step led to the conduct of experiments more complex and may be a constraint to future technical development at field study. To produce a simpler reaction preparation process, we utilized a single-stranded (ss) DNA template instead of the ds one. To prove that this modification does not affect the LAMP efficiency, the LAMP reactions were performed with two forms of DNA template and revealed that the efficiency of reactions was similar between two types of DNA template used (Fig. 3). Importantly, by using ss DNA template, the LAMP reactions could occur without the requirement of heat-up step which can interfere with the activity of other components in the reactions due to high temperature. Taken together, we demonstrated that the modification of using ss DNA instead of ds DNA template in the LAMP reactions led to the similar results with a marked advantage of the removal of the pre-heating step, enabling reaction preparation less complicated and quicker.

Fig. 3.

Fig. 3

Open in a new tab

The LAMP reactions with different concentrations of ds and ss DNA templates. Reaction mixture contained the indicated amount of ds and ss DNA template, 10 fmol of miRNA, 6 pmol of FIP and BIP, 0.5 fmol of B3 and 9 µL of Isothermal Master Mix

Sensitivity of the LAMP reactions using single-stranded DNA template

The LAMP sensitivity is one of the most important factors which decide the success of the method and its possible applicability in field study. As mentioned above, LAMP utilizing ds DNA template was shown to be capable of identifying the target miRNA in the ultrasensitive range of 1 amol to 1 pmol (Li et al. 2011). In our hand, the results were revealed the same where ds-DNA-template LAMP reactions were succeeded at the lowest amount of 1 amol of synthetic miRNA (Fig. 4, lanes 2–5). Markedly, the modified LAMP reactions with ss DNA template did perform efficiently at the significantly lower amount of miRNA, up to 1 zmol (Fig. 4, lanes 7–10). These data strongly prove the superiority of ss DNA template given in our design in comparison to the previous one (Li et al. 2011) regarding the complexity of reaction preparation, time, and sensitivity.

Fig. 4.

Fig. 4

Open in a new tab

The sensitivity of LAMP reaction to miRNA amount. Reaction mixture contained the indicated amount of miRNA, 0.5 fmol of ss DNA template, 6 pmol of FIP and BIP, 0.5 fmol of B3 and 9 µL of Isothermal Master Mix

Optimization of LAMP reaction components using single-stranded DNA template

LAMP reactions using ss DNA template were first performed with the condition similar to reactions using ds DNA template (Li et al. 2011). Next, the components of ss template reaction were then optimized and the results revealed that the required amount of both ss DNA template and B3 primer could be reduced to half, 0.25 fmol instead of 0.5 fmol as in the condition of ds template reaction (Fig. 5a and b). The lowest reaction time and temperature required were shown at 55 min and 59 °C, respectively (Fig. 5d and e). Therefore, temperature 60 °C was kept unchanged to perform ss LAMP reactions while the incubation time was decreased from 90 to 60 min. The performance of LAMP reaction of ss DNA template using newly optimized condition was then examined and still exhibited 1000 times more sensitive than the ds DNA template reaction (Fig. 5f). Accordingly, hereinafter ss LAMP reaction would be carried out with the newly defined condition.

Fig. 5.

Fig. 5

Open in a new tab

Optimization of LAMP reaction using ss DNA template. a Titration of ss DNA template. Reaction mixture contained the indicated amount of ss DNA template, 10 fmol of miRNA, 6 pmol of FIP and BIP, and 0.5 fmol of B3. b Titration of B3 primer. Reaction mixture contained the indicated amount of B3 primer, 0.5 fmol of ss DNA template, 10 fmol of miRNA, and 6 pmol of FIP and BIP. c Titration of FIP and BIP primers. Reaction mixture contained the indicated amount of FIP and BIP primers, 0.5 fmol of B3 primer, 0.5 fmol of ss DNA template, and 10 fmol of miRNA. d Time-course of LAMP reaction and e Thermometric titration of LAMP reaction. Reaction mixture contained 10 fmol of miRNA, 0.5 fmol of ss DNA template, 6 pmol of FIP and BIP, and 0.5 fmol of B3. f Comparison of LAMP sensitivity between reactions using ds DNA template condition and the newly optimized one. The new concentrations of ss DNA template and B3 primer were 0.25 fmol while the concentration of FIP and BIP primers were maintained at 6 pmol. Time and temperature in both conditions were set at 60 min and 60 °C, respectively

Specificity of LAMP reaction using single-stranded DNA template

The previous study reported that ds DNA template LAMP is capable of distinguishing miRNAs which are different in one base based on the real-time result (Li et al. 2011). Here, we also examined the specificity of our LAMP reaction using different synthetic miRNAs and found that the amplification product could only be observed in the presence of an accurate sequence of miRNA-novel-shared-03 (Fig. 6a, lane 2). Only one single ribonucleotide substitution in the sequence of miRNA-novel-shared-03 could lead to the failure of the LAMP reaction (Fig. 6a, lanes 5 and 6). Accordingly, other miRNAs of domestic cow or different parasites were unable to be amplified by our LAMP reactions (Fig. 6a, lanes 7–11). Moreover, when the reaction tubes were added of SyBr Green only the one containing miRNA-novel-shared-03 without sequence modified illuminated a green light when exposed to a blue light source (Fig. 6b, lane 2). The green light fluorescence corresponds to the formation of ds DNA products which are preferentially bound by SyBr Green. These results demonstrated that our LAMP method detecting the species-specific miRNA of Fasciola spp. has a high selectivity and is able to discriminate one-base difference among miRNAs. Besides, with the use of SyBr Green, the reaction results could be read immediately without the requirement of laborious electrophoresis, allowing LAMP method to be easily applied at the field.

Fig. 6.

Fig. 6

Open in a new tab

The specificity of LAMP reaction using ss DNA template. Reaction mixture contained 10 fmol of miRNA tested, 0.25 fmol of ss DNA template, 6 pmol of FIP and BIP, 0.25 fmol of B3 and 9 µL of Isothermal Master Mix. a LAMP reactions were examined by polyacrylamide gel electrophoresis. The order of miRNA presented from left to right, respectively: (2) miRNA-novel-shared-03, (3) miRNA-novel-shared-02 and (4) miRNA-novel-shared-04 from Fasciola spp.; (5) miR-novel-share-03U and (6) miR-novel-share-03C (modified sequence of miRNA-novel-shared-03); (7) bta-miR-562 from Bos taurus; (8) sja-let-7 and (9) sja-miR-124-5p from Schistosoma japonicum; (10) sma-bantam-3p and (11) sma-miR-10-5p from Schistosoma mansoni. The sequences of miRNA used were described in Table 2. b Amplification products were analyzed by directly adding of 1X SyBr Green I (final concentration) to the reaction tubes and illuminated by a 470 nm light source

Modified LAMP reaction with the synthetic miRNA in bovine serum

The ultimate purpose of using LAMP is to detect specific miRNA in serum sample of patients quickly. To do that, the LAMP reactions should first be shown to be able to identify synthetic miRNA presenting in serum. Here, we used the commercial bovine serum to serve as the matrix for diluting synthetic miRNA, and performed the LAMP reactions as described in Materials and Methods. The results indicated that the broad range amounts of synthetic miRNA from 1 fmol to 1 zmol dissolved in bovine serum was successfully detected by our modified LAMP technique (Fig. 7a). The analysis by SyBr Green fluorescence also revealed a similar result (Fig. 7b), implying that this is a very promising method for the development of diagnostic kit to detect species-specific miRNA of Fasciola spp. in patient blood samples.

Fig. 7.

Fig. 7

Open in a new tab

LAMP reaction with synthetic miRNA in commercial bovine serum. Reaction mixture contained the indicated amount of miRNA diluted in bovine serum, 0.25 fmol of ss DNA template, 6 pmol of FIP and BIP, 0.25 fmol of B3 and 9 µL of Isothermal Master Mix. a LAMP reactions were examined by polyacrylamide gel electrophoresis. b Amplification products were analyzed by directly adding of 1X SyBr Green I (final concentration) to the reaction tubes and illuminated by a 470 nm light source

Modified LAMP reaction with bovine serum collected from liver blood samples

We legitimately obtained 12 serum sampled from liver blood of 12 bovine individuals at a cattle slaughter facility licensed by the government in HCMC. Among that, there were 3 samples collected from 3 livers damaged with chronic fluke infection which contain sclerosis parts, white areas and fluke parasites could be seen. Next, collected bovine serum samples were tested for the presence of the parasitic miRNA utilizing our adjusted LAMP method. As was expected, 3 positive samples were successfully detected by LAMP (Fig. 8a, lanes 1–3). Most importantly, among 9 samples collected from the bovine livers not showing observable parasite infection, there were 2 samples giving the positive signal (Fig. 8a, lanes 6 and 10). These results were also in agreement with the observation by SyBr Green fluorescence (Fig. 8b). The extremely high specificity of the LAMP reaction observed above excluded a possibility that other miRNAs presenting in serum were detected unexpectedly, indicating that the amplified products obtained were corresponded the presence of Fasicola spp. miRNA-novel-shared-03. The findings proved that our modified LAMP method could identify the fluke parasite existence in serum at the early stage of disease when the liver infection has not progressed into the chronic condition.

Fig. 8.

Fig. 8

Open in a new tab

LAMP reaction with bovine serum collected from liver blood samples. Reaction mixture contained 1 µL of bovine serum sample, 0.25 fmol of ss DNA template, 6 pmol of FIP and BIP, 0.25 fmol of B3 and 9 µL of Isothermal Master Mix. P: positive control (synthetic miRNA, 10 fmol); N: negative control. The same results were obtained with the 1:10 diluted serum samples. a LAMP reactions were examined by polyacrylamide gel electrophoresis. b Amplification products were analyzed by directly adding of 1X SyBr Green I (final concentration) to the reaction tubes and photographed under a 470 nm light source

Discussion

Today, one of the most important missions in managing and monitoring of neglected tropical diseases is to produce highly sensitive and proper diagnostic methods which can replace the laborious and undependable procedures. Specific and sensitive techniques to detect the early stage of Fasciola spp. infections can preclude the irreversible pathological reactions, helping monitor and likely directing the basis for treatment failures. Fasciolosis is often prevalent in low-resource regions without proper laboratory equipment, thus, low-cost methods for practical diagnostics that do not need centralized laboratories are significantly required. Accordingly, researching new biomarkers for fast and accurately detecting the pathogen is highly demanded, and that can create new simpler and more appropriate techniques to diagnose diseases.

Molecular diagnostic examinations are currently well-considered as one of the gold standards due to their high sensitivity and specificity. The techniques can differentiate between many different pathogen species and strains and are likely facile to apply to new organisms. Recently, several PCR-based methods have been used to specifically amplify DNA of threats, generating promising results in early identify pathogen infection. However, PCR performance often demands highly trained personnel and high-cost instruments. Alternatively, LAMP amplifies DNA with a significantly sensitive, specific and rapid performance at isothermal conditions. There are some advantages of LAMP in comparison to PCR. Fist, the operational simplicity and isothermal setup cause LAMP preferably suitable for employing at point-of-care. Second, the high performance of sensitivity and specificity can be attained since the LAMP reaction consists of two specific sets of primers that complementary to distinct sites in the target sequence (Notomi et al. 2000). The basic LAMP technique was originally used to detect organism-specific DNA template, however, importantly, with the critical improved modifications, LAMP could now be applied to detect a new biomarker, namely miRNAs, using as an outer primer to initiate the reaction, creating new opportunities for rapid detection of pathogens (Li et al. 2011). miRNA plays an important role in regulating the metabolism and has been recently raising as the promising biomarker for identifying the pathogen infection (Manzano-Román and Siles-Lucas 2012; Zheng et al. 2013; Britton et al. 2014). As mentioned above, fascioliasis is a common disease in humans and animals, however, the current diagnosis methods are limited in many ways. Fortunately, the miRNAs profiles of F. hepatica and F. gigantica were well-studied (Xu et al. 2012), leading us to a chance to employ the parasitic miRNA as a marker by LAMP to detect the pathogen at early-stage of infection.

The LAMP method was used to detect miRNA in previous studied (Li et al. 2011), however, the results showed some technical limitations. One of the biggest restraints was the need for an initial heating step at high temperatures to separate the two circuits of the ds DNA template. The heat-up step could affect the enzyme activity as well as the other reaction components. Also, this step makes reaction preparation and control became more difficult. In our study, we changed the ds DNA to ss DNA template and hence, the reaction can occur without the initial heat-up step. The ability to allow LAMP reactions to be assembled at room temperature and initiated at only one constant temperature can offer an excellent advantage in resource-limited settings. MicroRNAs detected in serum or plasma were reported to be more stable than miRNAs in blood (Chim et al. 2008; Wang et al. 2012). Interestingly, it was observed that the miRNA concentrations in serum samples were higher compared to the corresponding plasma samples (Wang et al. 2012). However, miRNAs are present in serum at a very low amount and there are a number of factors that might affect the circulating miRNA concentration. Indeed, the concentrations of different parasitic miRNAs in host serum or plasma samples were investigated in some researches. However, the results presented a great variation between miRNAs and blood samples, for example mostly ranging from 105 to 107 copies per ml plasma (0.166–16.6 zmol per µL) (Tritten et al. 2014). Accordingly, our LAMP reactions could provide the high level of sensitivity required for diagnosis. When investigating a limited range of detectable miRNA levels, we succeeded in detecting as low as 1 zmol of the target miRNA. Compared with the previous report in which the minimum miRNA level detected was 1 amol (Li et al. 2011), our results demonstrated that the sensitivity of modified LAMP was 1000 times higher. This remarkable improvement in sensitivity significantly increases the probability and applicability of this method in real life.

There is always an urgent requirement for a rapid and reliable serum assay for the diagnosis of infectious diseases. Therefore, the success of detecting miRNAs presenting in the serum can boost up the feasibility of the method. Recently, there have been a number of statements strongly advocating the direct miRNA detection in clinical samples and possibly in serum samples (Asaga et al. 2011; Ren et al. 2013; Hong et al. 2013; Khan et al. 2016). With the marked selectivity of one-base discrimination specificity of our method, it is no doubt that the amplification of miRNA obtained in serum samples was exactly derived from the expected miRNA of F. hepatica and F. gigantica. Thus, the success of detection of Fasciola specific-miRNA in bovine serum collected from liver blood samples by our modified LAMP created an important precursor for the early diagnosis of the fasciolosis pathogens. The results of our study contributed to the development and improvement of the LAMP method, and could promisingly be applied effectively to detect new and emerging biomarker miRNAs for pathogens detection at point-of-care.

Acknowledgements

This research is funded by NTTU Foundation for Science and Technology Development under Grant Number 2018.01.13.

Compliance with ethical standards

Conflict of interest

The authors declare that there is no conflict of interest.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Asaga S, Kuo C, Nguyen T, et al. Direct serum assay for microRNA-21 concentrations in early and advanced breast cancer. Clin Chem. 2011;57:84–91. doi: 10.1373/clinchem.2010.151845. [DOI] [PubMed] [Google Scholar]
  2. Brase JC, Wuttig D, Kuner R, Sültmann H. Serum microRNAs as non-invasive biomarkers for cancer. Mol Cancer. 2010;9:306. doi: 10.1186/1476-4598-9-306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Britton C, Winter AD, Gillan V, Devaney E. microRNAs of parasitic helminths–identification, characterization and potential as drug targets. Int J Parasitol Drugs Drug Resist. 2014;4:85–94. doi: 10.1016/j.ijpddr.2014.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Britton C, Winter AD, Marks ND, et al. Application of small RNA technology for improved control of parasitic helminths. Vet Parasitol. 2015;212:47–53. doi: 10.1016/j.vetpar.2015.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Buck AH, Coakley G, Simbari F, et al. Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity. Nat Commun. 2014;5:5488. doi: 10.1038/ncomms6488. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Buser JR, Diesburg S, Singleton J, et al. Precision chemical heating for diagnostic devices. Lab Chip. 2015;15:4423–4432. doi: 10.1039/c5lc01053e. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cai P, Gobert GN, You H, et al. Circulating miRNAs: potential novel biomarkers for hepatopathology progression and diagnosis of schistosomiasis japonica in two murine models. PLoS Negl Trop Dis. 2015;9:e0003965. doi: 10.1371/journal.pntd.0003965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cai P, Gobert GN, McManus DP. MicroRNAs in parasitic helminthiases: current status and future perspectives. Trends Parasitol. 2016;32:71–86. doi: 10.1016/j.pt.2015.09.003. [DOI] [PubMed] [Google Scholar]
  9. Chen C, Ridzon DA, Broomer AJ, et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005;33:e179. doi: 10.1093/nar/gni178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chim SSC, Shing TKF, Hung ECW, et al. Detection and characterization of placental microRNAs in maternal plasma. Clin Chem. 2008;54:482–490. doi: 10.1373/clinchem.2007.097972. [DOI] [PubMed] [Google Scholar]
  11. de Waal T (2016) Diseases of dairy animals: parasites, internal: liver flukes. In: Reference module in food science. Elsevier
  12. Holz A, Streit A. Gain and loss of small RNA classes—characterization of small RNAs in the parasitic nematode family strongyloididae. Genome Biol Evol. 2017;9:2826–2843. doi: 10.1093/gbe/evx197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hong C-Y, Chen X, Liu T, et al. Ultrasensitive electrochemical detection of cancer-associated circulating microRNA in serum samples based on DNA concatamers. Biosens Bioelectron. 2013;50:132–136. doi: 10.1016/j.bios.2013.06.040. [DOI] [PubMed] [Google Scholar]
  14. Hoy AM, Lundie RJ, Ivens A, et al. Parasite-derived MicroRNAs in host serum as novel biomarkers of helminth infection. PLoS Negl Trop Dis. 2014;8:e2701. doi: 10.1371/journal.pntd.0002701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Khan N, Mironov G, Berezovski MV. Direct detection of endogenous MicroRNAs and their post-transcriptional modifications in cancer serum by capillary electrophoresis-mass spectrometry. Anal Bioanal Chem. 2016;408:2891–2899. doi: 10.1007/s00216-015-9277-y. [DOI] [PubMed] [Google Scholar]
  16. Leshkowitz D, Horn-Saban S, Parmet Y, Feldmesser E. Differences in microRNA detection levels are technology and sequence dependent. RNA N Y N. 2013;19:527–538. doi: 10.1261/rna.036475.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Li C, Li Z, Jia H, Yan J. One-step ultrasensitive detection of microRNAs with loop-mediated isothermal amplification (LAMP) Chem Commun. 2011;47:2595–2597. doi: 10.1039/C0CC03957H. [DOI] [PubMed] [Google Scholar]
  18. Manzano-Román R, Siles-Lucas M. MicroRNAs in parasitic diseases: potential for diagnosis and targeting. Mol Biochem Parasitol. 2012;186:81–86. doi: 10.1016/j.molbiopara.2012.10.001. [DOI] [PubMed] [Google Scholar]
  19. Mar-Aguilar F, Trevino V, Salinas-Hernández JE, et al. Identification and characterization of microRNAS from entamoeba histolytica HM1-IMSS. PLoS ONE. 2013;8:e68202. doi: 10.1371/journal.pone.0068202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Marcilla A, Trelis M, Cortés A, et al. Extracellular vesicles from parasitic helminths contain specific excretory/secretory proteins and are internalized in intestinal host cells. PLoS ONE. 2012;7:e45974. doi: 10.1371/journal.pone.0045974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Notomi T, Okayama H, Masubuchi H, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28:E63. doi: 10.1093/nar/28.12.e63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Patnaik SK, Kannisto ED, Mallick R, et al. Whole blood microRNA expression may not be useful for screening non-small cell lung cancer. PLoS ONE. 2017;12:e0181926. doi: 10.1371/journal.pone.0181926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ren Y, Deng H, Shen W, Gao Z. A highly sensitive and selective electrochemical biosensor for direct detection of microRNAs in serum. Anal Chem. 2013;85:4784–4789. doi: 10.1021/ac400583e. [DOI] [PubMed] [Google Scholar]
  24. Schultz NA, Dehlendorff C, Jensen BV, et al. MicroRNA biomarkers in whole blood for detection of pancreatic cancer. JAMA. 2014;311:392–404. doi: 10.1001/jama.2013.284664. [DOI] [PubMed] [Google Scholar]
  25. Shah KG, Guelig D, Diesburg S, et al. Design of a new type of compact chemical heater for isothermal nucleic acid amplification. PLoS ONE. 2015;10:e0139449. doi: 10.1371/journal.pone.0139449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Singleton J, Zentner C, Buser J, et al. Instrument-free exothermic heating with phase change temperature control for paper microfluidic devices. Proc SPIE Int Soc Opt Eng. 2013;8615:86150. doi: 10.1117/12.2005928. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Singleton J, Osborn JL, Lillis L, et al. Electricity-free amplification and detection for molecular point-of-care diagnosis of HIV-1. PLoS ONE. 2014;9:e113693. doi: 10.1371/journal.pone.0113693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Tanner NA, Zhang Y, Evans TC. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. Biotechniques. 2015;58:59–68. doi: 10.2144/000114253. [DOI] [PubMed] [Google Scholar]
  29. Tian T, Wang J, Zhou X. A review: microRNA detection methods. Org Biomol Chem. 2015;13:2226–2238. doi: 10.1039/C4OB02104E. [DOI] [PubMed] [Google Scholar]
  30. Tolan RW. Fascioliasis due to Fasciola hepatica and Fasciola gigantica infection: an update on this ‘Neglected’ neglected tropical disease. Lab Med. 2011;42:107–116. doi: 10.1309/LMLFBB8PW4SA0YJI. [DOI] [Google Scholar]
  31. Tritten L, Burkman E, Moorhead A, et al. Detection of circulating parasite-derived MicroRNAs in filarial infections. PLoS Negl Trop Dis. 2014;8:e2971. doi: 10.1371/journal.pntd.0002971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Válóczi A, Hornyik C, Varga N, et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 2004;32:e175. doi: 10.1093/nar/gnh171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang K, Yuan Y, Cho J-H, et al. Comparing the MicroRNA spectrum between serum and plasma. PLoS ONE. 2012;7:e41561. doi: 10.1371/journal.pone.0041561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Xin L, Gao J, Wang D, et al. Novel blood-based microRNA biomarker panel for early diagnosis of chronic pancreatitis. Sci Rep. 2017;7:40019. doi: 10.1038/srep40019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Xu M-J, Ai L, Fu J-H, et al. Comparative characterization of MicroRNAs from the liver flukes Fasciola gigantica and F. hepatica. PLoS ONE. 2012;7:e53387. doi: 10.1371/journal.pone.0053387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Yyusnita Y, Norsiah MD, Zakiah I. MicroRNA (miRNA) expression profiling of peripheral blood samples in multiple myeloma patients using microarray. Malays J Pathol. 2012;34:133–143. [PubMed] [Google Scholar]
  37. Zamanian M, Fraser LM, Agbedanu PN, et al. Release of small RNA-containing exosome-like vesicles from the human filarial parasite Brugia malayi. PLoS Negl Trop Dis. 2015;9:e0004069. doi: 10.1371/journal.pntd.0004069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zheng Y, Cai X, Bradley JE. microRNAs in parasites and parasite infection. RNA Biol. 2013;10:371–379. doi: 10.4161/rna.23716. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Parasitic Diseases: Official Organ of the Indian Society for Parasitology are provided here courtesy of Springer

RESOURCES