Skip to main content
Molecular Medicine Reports logoLink to Molecular Medicine Reports
. 2020 Apr 30;22(1):77–86. doi: 10.3892/mmr.2020.11100

Low penetrance of hearing loss in two Chinese families carrying the mitochondrial tRNASer(UCN) mutations

Wei Peng 1,, Yi Zhong 1, Xueyan Zhao 1, Jie Yuan 1
PMCID: PMC7248462  PMID: 32377700

Abstract

Mutations in mitochondrial DNA (mtDNA), especially in mitochondrial 12S rRNA and transfer RNA(tRNA)Ser(UCN) genes, are important causes of non-syndromic hearing loss. However, the molecular mechanism underlying mt-tRNA mutations in clinical hearing impairment are not fully understood. The present study assessed the molecular characterization of two Chinese families with non-syndromic hearing loss, who both exhibited very low penetrance of deafness (9.1 and 12.5% for Family 1 and 2, respectively). Mutational analysis of the complete mtDNA genes identified the presence of cytochrome c oxidase 1/tRNASer(UCN) G7444A and tRNASer(UCN) C7492T mutations, together with polymorphisms belonging to human mitochondrial haplogroup D4 and G2b, respectively. Moreover, the G7444A and C7492T mutations occurred at highly conserved tRNASer(UCN) nucleotides and may cause tRNA metabolism failure, which is involved in mitochondrial translation defects. Therefore, the G7444A and C7492T mutations may lead to the mitochondrial dysfunction that responsible for deafness. However, the absence of any functional variants in Gap junction β-2, Solute Carrier Family 26 Member 4 and TRNA 5-methylaminomethyl-2-thiouridylate methyltransferase suggested that nuclear genes may not play active roles in the occurrence of deafness. In the present study, the observed incomplete penetrance of hearing loss and mild mitochondrial dysfunction indicated that mtDNA G7444A and C7492T mutations are insufficient to produce the deafness phenotype. Therefore, other risk factors such as environmental factors and epigenetic regulation may be involved in the pathogenesis of hearing loss in the families recruited in the present study.

Keywords: hearing loss, mitochondrial DNA-transfer RNASer(UCN), G7444A, C7492T, mutations, Chinese families

Introduction

Hearing loss is a common communication disorder, affecting 1–3 newborns out of every 1,000 live births globally (1). Survey data from the World Health Organization (http://www.who.int) indicates that 32 million individuals out of 360 million with hearing loss are pediatric patients (2,3). Hearing loss can be caused by gene alterations and environmental factors, including ototoxic drugs such as aminoglycoside antibiotics (AmAn) (4). Genetic alterations in human mitochondrial DNA (mtDNA) are also associated with deafness (5). Moreover, A1555G and C1494T mtDNA mutations have been implicated in both AmAn-induced and non-syndromic hearing loss in patients worldwide (68). mt-transfer RNA(tRNA)Ser(UCN) gene pathogenic mutations are associated with hearing loss (9) and include A7445G (10), 7472insC (11), T7510C (12) and T7511C (13). Furthermore, mt-tRNA mutations may have structural and functional implications, such as affecting the processing of RNA precursors, nucleotide modification and aminoacylation (14). However, the molecular mechanism underlying mt-tRNASer(UCN) mutations and deafness are not fully understood.

To investigate the association between mt-tRNASer(UCN) mutations and non-syndromic hearing loss, and to facilitate early diagnosis and prevention of mitochondrial-associated deafness, the present study performed genetic analyses for deafness-associated mtDNA mutations. The clinical and molecular features of two Chinese families with hearing impairment were assessed. PCR and Sanger sequencing analyses results suggested the presence of cytochrome c oxidase 1 (CO1)/tRNASer(UCN) G7444A and tRNASer(UCN) C7492T mutations in these families. Mutations in gap junction β-2 (GJB2), solute Carrier Family 26 Member 4 (SLC26A4) and TRNA 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU) genes are the most prevalent deafness causing genetic modifications worldwide (1517). To examine the potential role of GJB2, SLC26A4 and TRMU in deafness, mutational analyses of these genes were performed in the matrilineal relatives in the two Chinese families.

Materials and methods

Subjects and clinical examinations

In the present genetic screening program for deafness-associated mt-tRNASer(UCN) mutations, two Chinese families with hearing loss were recruited from The Union Hospital, Tongji Medical College, Huazhong University of Science and Technology between January 2018 and January 2019 (Fig. 1). There were 11 matrilineal relatives in Family 1 (5 males and 6 females), one of them (III-12) was the deaf patient. There were 8 matrilineal relatives in Family 2 (3 males and 5 females), one of them (II-9) was the deaf patient. Comprehensive medical histories and physical examination were assessed to identify any syndromic findings, history of AmAn use and genetic factors related to hearing impairment. An age-appropriate audiological examination was performed by an experienced audiologist, including pure-tone audiometry (PTA) and/or auditory brainstem response (ABR), immittance testing and distortion product otoacoustic emissions. PTA was calculated from the average of the audiometric thresholds at 500, 1,000, 2,000, 4,000 and 8,000 Hz. The severity of hearing impairment was classified into five grades: i) Normal, <26 decibel (dB); ii) mild =26–40 dB; iii) moderate =41–70 dB; iv) severe =71–90 dB; and v) profound >90 dB (18). The study was approved by the Ethics Committee of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology. Signed written informed consent was obtained from the participants or their guardians. Control subjects (n=455; men, 200; women, 255; age, 20–45 years) were enrolled in the present study. The healthy subjects had normal hearing and did not have any mitochondrial disorders such as vision loss, neurological disorders, cancer or cardiovascular diseases. Subjects who had a family history of mitochondrial diseases or ongoing infectious disease, neoplastic disease, major surgery, severe liver dysfunction and inflammatory disease were excluded. Written informed consent was also provided by the control subjects.

Figure 1.

Figure 1.

Pedigree chart of two Chinese families with hearing loss. The arrows indicate the probands and the open and filled symbols indicate unaffected and affected respectively.

Genetic screening for mtDNA mutations or variants

PCR and direct sequence analysis were performed to detect deafness related mtDNA mutations or variants. Blood samples (5 ml) from the family members (II-10, II-8 and II-5 in Family 1; I-2, II-6 and II-8 in Family 2; Fig. 1), as well as from 455 controls were collected. Genomic DNA was isolated from probands from the two families (III-12 and II-9) using the Puregene DNA Isolation kits (Gentra Systems, Inc.). DNA was preserved at 20°C. Amplification of complete mtDNA genes was performed as previously described (19). A PCR mixture containing 200 µM dNTPs, 10X buffer, Taq DNA polymerase and 15 mmol/l Mg2+ (Takara Biotechnology Co., Ltd.) was used for PCR, the primers' sequences are listed in Table I. The following PCR thermocycling conditions were used: Initial denaturation at 95°C for 5 min; 30 cycles of 94°C for 10 sec, 60°C for 30 sec and 72°C for 1 min; and a final extension at 72°C for 5 min. Subsequently, the 24 PCR products were purified and analyzed using Sanger sequence technology as previously described (20). The complete mtDNA genes of the matrilineal relatives from the two families (II-10, II-8 and II-5 in Family 1; I-2, II-6 and II-8 in Family 2) were also amplified by PCR and sequenced as above. Data were then compared with the revised Cambridge Reference sequences (rCRS) from GenBank database to detect mtDNA mutations (GenBank accession no. NC_001807) (21).

Table I.

Primer sequence information for amplification of complete mitochondrial genome.

Primer name Direction Primer Sequence (5′-3′) Target region (bp) Tm (°C)
Mit-1 F CTCCTCAAAGCAATACACTG 592-1430 59.7
R TGCTAAATCCACCTTCGACC
Mit-2 F CGATCAACCTCACCACCTCT 1226-2026 59.7
R TGGACAACCAGCTATCACCA
Mit-3 F GGACTAACCCCTATACCTTCTGC 1930-2688 58
R GGCAGGTCAATTTCACTGGT
Mit-4 F AAATCTTACCCCGCCTGTTT 2480-3365 58
R AGGAATGCCATTGCGATTAG
Mit-5 F TACTTCACAAAGCGCCTTCC 3150-3980 58
R ATGAAGAATAGGGCGAAGGG
Mit-6 F TGGCTCCTTTAACCTCTCCA 3777-4679 59
R AAGGATTATGGATGCGGTTG
Mit-7 F ACTAATTAATCCCCTGGCCC 4466-5443 59
R CCTGGGGTGGGTTTTGTATG
Mit-8 F CTAACCGGCTTTTTGCCC 5238-6050 56
R ACCTAGAAGGTTGCCTGGCT
Mit-9 F GAGGCCTAACCCCTGTCTTT 5835-6661 59
R ATTCCGAAGCCTGGTAGGAT
Mit-10 F CTCTTCGTCTGATCCGTCCT 6450-7334 59
R AGCGAAGGCTTCTCAAATCA
Mit-11 F ACGCCAAAATCCATTTCACT 7129-8114 59.7
R CGGGAATTGCATCTGTTTTT
Mit-12 F ACGAGTACACCGACTACGGC 7908-8816 59.7
R TGGGTGGTTGGTGTAAATGA
Mit-13 F TTTCCCCCTCTATTGATCCC 8602-9416 59
R GTGGCCTTGGTATGTGCTTT
Mit-14 F CCCACCAATCACATGCCTAT 9211-10149 58
R TGTAGCCGTTGAGTTGTGGT
Mit-15 F TCTCCATCTATTGATGAGGGTCT 9967-10858 58
R AATTAGGCTGTGGGTGGTTG
Mit-16 F GCCATACTAGTCTTTGCCGC 10653-11511 59
R TTGAGAATGAGTGTGAGGCG
Mit-17 F TCACTCTCACTGCCCAAGAA 11295-12095 59
R GGAGAATGGGGGATAGGTGT
Mit-18 F TATCACTCTCCTACTTACAG 11929-12793 54
R AGAAGGTTATAATTCCTACG
Mit-19 F AAACAACCCAGCTCTCCCTAA 12551-13526 59
R TCGATGATGTGGTCTTTGGA
Mit-20 F ACATCTGTACCCACGCCTTC 13319-14287 55
R AGAGGGGTCAGGGTTCATTC
Mit-21 F GCATAATTAAACTTTACTTC 14081-15017 55
R AGAATATTGAGGCGCCATTG
Mit-22 F TGAAACTTCGGCTCACTCCT 14837-15997 58
R AGCTTTGGGTGCTAATGGTG
Mit-23 F TCATTGGACAAGTAGCATCC 15792-31 59.7
R GAGTGGTTAATAGGGTGATAG
Mit-24 F CACCATTCTCCGTGAAATCA 16401-794 59.7
R AGGCTAAGCGTTTTGAGCTG

F, forward; R, reverse; Tm, Annealing Temperature.

Conservation assessments

The sequence alignment was performed by using the ClustalW program version 2.0 (http;//www.ebi.ac.uk/Tools/msa/clustalw2/) (22). The conservation index (CI) of each mtDNA variants or mutations identified in these two families were analyzed as previously described (23). The CI was determined as the percentage of the sequence, from a list of 16 different vertebrates that possessed the wild-type nucleotide at the same position (24), these species included Bos Taurus, Cebus albifrons, Gorilla gorilla, Homo sapiens, Hylobates lar, Lemur catta, Macaca mulatta, Macaca sylvanus, Mus musculus, Nycticebus coucang, Pan paniscus, Pan troglodytes, Pongo pygmaeus, Pongo abelii, Papio hamadryas and Tarsius bancanus.

Screening for the GJB2, SLC26A4 and TRMU mutations

Mutations in GJB2, SLC26A4 and TRMU are associated with hearing impairment (1517). To assess whether these nuclear genes play important roles in the clinical manifestation of hearing loss, a mutational screening for GJB2, SLC26A4 and TRMU was performed in the probands from these families (III-12 and II-9; Fig. 1). The primers used were as described previously (17,19,20). The primers for PCR amplification of GJB2 were: Forward, 5′-TATGACACTCCCCAGCACAG-3′ and reverse, 5′-GGGGCAATGCTTAAACTGGC-3′. The five primer sequences for SLC26A4 were: Forward, 5′-CGTGTAGCAGCAGGAAGTAT-3′ and reverse, 5′-TTAAATAAAAAAGACTGACT-3′; forward, 5′-TGGGGAAAAAGGATGGTGGT-3′ and reverse, 5′-CCAACCCCTTCTTTAGCTGA-3′; forward, 5′-GCAGGATAGCTCAAGGAATT-3′ and reverse, 5′-TCATCAGGGAAAGGAAATAA-3′; forward, 5′-TCTCCTTGATGTCTTGCTTA-3′ and reverse, 5′-CCCATGTATTTGCCCTGTTG-3′; and forward, 5′-CTGGGCAATAGAATGAGACT-3′ and reverse, 5′-ATCTGTAGAAAGGTTGAATA-3′. The primers for TRMU amplification were: Forward, 5′-ACAGCGCAGAAGAAGAGCAGT-3′ and reverse, 5′-ACAACGCCACGACGGACG-3′. The PCR products were analyzed by direct Sanger sequencing as mentioned in a previous study (19). The data were compared with published National Center for Biotechnology Information database sequences (https://www.ncbi.nlm.nih.gov/pubmed; GJB2, NM_004004; SLC26A4, NM_000441.1; TRMU, AF448221).

Assessment of pathogenicity

The updated pathogenicity scoring system (25) was used to assess the pathogenic status of CO1/tRNASer(UCN) G7444A and tRNASer(UCN) C7492T mutations. Using this approach, a mutation was classified as a ‘neutral polymorphism’ with a score ≤6, as ‘possibly pathogenic’ with a score from 7–10 and ‘definitely pathogenic’ with a score ≥11. The status of G7444A and C7492T mutations were also searched on the MITOMAP database (www.mitomap.org) to confirm their pathogenicity (26).

Results

Clinical presentation of two families with hearing loss

The present study investigated deafness related mt-tRNASer(UCN) polymorphisms in two Chinese families with hearing impairment (Fig. 1). In Family 1, the proband (III-12) was a 15-year-old female patient who began to suffer bilateral hearing impairment at the age of 10 years old. No family members in Family 1 had a history of using AmAn. Audiological evaluation indicated that the 15-year-old female had profound hearing loss (118 and 110 dB for right and left ears, respectively; Fig. 2; Table II). Furthermore, clinical examination identified that no other matrilineal relatives in Family 1, including the mother of the patient (II-10), had hearing loss.

Figure 2.

Figure 2.

Air conduction audiogram of probands in the two Chinese families. X, left ear; O, Right ear.

Table II.

Summary of the clinical data for probands in two Chinese families.

Proband Sex Age at audiological test, year Age at onset, year Use of AmAn PTA, dB Right ear PTA, dB Left ear Level of hearing loss
III-12 Female 15 10 No 118 110 Profound
II-9 Female 38 20 No 103   99 Profound
III-4 Female 10 No   21   19 Normal

AmAn, aminoglycoside antibiotics.

In Family 2, the proband (II-9) was a 38-year-old female who was treated at the Otology Clinic of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology for deafness. A comprehensive history and physical examination indicated that the proband (II-9) suffered bilateral hearing impairment at the age of 20 years old. Furthermore, the proband had profound hearing loss (103 and 99 dB for right and left ears, respectively; Table II). However, all matrilineal relatives in Family 2 had normal hearing and none had a history of AmAn use (Fig. 1).

Mitochondrial genome analysis

To investigate the molecular basis of hearing loss, mutational screening of mtDNA genes was performed in these families. First, the present study amplified the complete mitochondrial genomes of the probands in the families (III-12 and II-9) and the corresponding matrilineal relatives (II-10, II-8 and II-5 in Family 1; I-2, II-6 and II-8 in Family 2; Fig. 1). The resultant 24 PCR products were sequenced as previously described (20). By comparing the present results with previous data from the rCRS (21), a number of genetic variants were identified, in addition to the CO1/tRNASer(UCN) G7444A and tRNASer(UCN) C7492T mutations (Fig. 3; Table III). Moreover, ten variants were identified in the D-loop region, four known variants in 12S rRNA, four known variants in 16S rRNA and one 9-bp deletion in the non-coding region located between the CO2 and tRNALys genes (21). In addition, 26 variants were found in protein coding genes. These included five missense mutations: A8701G (Thr→Ala), A8860G (Thr→Ala) in ATP synthase membrane subunit 6, A10398G (Thr→Ala) in NADH-ubiquinone oxidoreductase chain 3 (ND3), C14766T (Thr→Ile) and A15326G (Thr→Ala) in Cytochrome B. Only the CO1/tRNASer(UCN) G7444A and tRNASer(UCN) C7492T mutations are highly conserved in various species, including humans (21), bovines (27), mice (28) and Xenopus laevis (29). The present phylogenetic analysis results indicated that none of the other identified variants were conserved, suggesting that the G7444A and C7492T mutations may have functional significance in deafness phenotype expression (Figs. 3 and 4). In addition, G7444A and C7492T mutations were not detected in 455 control subjects. Moreover, these mt-tRNASer(UCN) mutations were not found in the matrilineal relatives (II-10, II-8 and II-5 in Family 1; I-2, II-6 and II-8 in Family 2).

Figure 3.

Figure 3.

Sequence analysis of mitochondrial G7444A and C7492T mutations.

Table III.

MtDNA mutations in the two Chinese families with hearing loss.

Gene Position Mutation Conservation (H/B/M/X) rCRS Family 1 Family 2 Previously reporteda
D-Loop 73 A to G A G Yes
150 C to T C Yes
263 A to G A G Yes
310 T to CTC T CTC CTC Yes
489 T to C T C Yes
16093 T to C T C Yes
16111 C to T C T Yes
16189 T to C T C Yes
16362 T to C T C Yes
16519 T to C T C C Yes
12S rRNA 750 A to G A/A/G/- A G G Yes
827 A to G A G Yes
1048 C to T C T Yes
1438 A to G A/A/A/G A G G Yes
16S rRNA 2706 A to G A/G/A/A A G G Yes
3010 G to A G/G/A/A G A Yes
3107 delN N delN Yes
3206 C to T C T Yes
ND1 3759 A to G A G Yes
3771 A to G A G Yes
3970 C to T C T T Yes
ND2 4685 A to G A G Yes
4769 A to G A G Yes
4883 C to T C T Yes
CO1 6284 A to G A G Yes
7028 C to T C T Yes
7066 C to T C T Yes
CO1/tRNASer(UCN) 7444 G to A (Ser to Lys) G/G/G/G G A Yes
tRNASer(UCN) 7492 C to T C/C/C/C C T Yes
CO2 7976 G to A G A Yes
8080 C to G C G Yes
NC7 8271-8279 9-bp del T/S/L/Q 9-bp 9-bp del Yes
ATP6 8701 A to G (Thr to Ala) M/M/M/F A G G Yes
8725 A to G A G Yes
8860 A to G (Thr to Ala) T/A/A/T A G G Yes
9128 T to C T C Yes
CO3 9540 T to C T C Yes
ND3 10398 A to G (Thr to Ala) T/T/T/A A G Yes
ND4L 10493 T to C T C Yes
ND4 10873 T to C T C Yes
11440 G to A G A Yes
ND5 12705 C to T C T Yes
ND6 14455 C to T C T Yes
CytB 14766 C to T (Thr to Ile) T/S/T/S C T Yes
15301 G to A G A A Yes
15326 A to G (Thr to Ala) T/M/I/I A G G Yes
15784 T to C T C C Yes
a

Human MITOMAP database (www.mitomap.org). H, human; B, bovine; M, mouse; X, Xenopus laevis; rCRS, revised Cambridge Reference Sequences; ND, NADH-ubiquinone oxidoreductase chain; CO, cytochrome c oxidase; CytB, Cytochrome B; ATP6, ATP synthase membrane subunit 6; tRNA, transfer RNA; Lys, lysine; Thr, threonine; Ala, alanine; Ile, isoleucine; del, deletion.

Figure 4.

Figure 4.

Locations of mitochondrial G7444A and C7492T mutations. tRNA, transfer RNA; WT, wild-type; MT, mutant.

In fact, the C7492T mutation occurred at position 26 in the anticodon stem of tRNASer(UCN), nucleotide at that position was very conserved from different species (21), while the G7444A mutation was localized at the conjunction between CO1 and tRNASer(UCN) (21).

Genotyping analysis of GJB2, SLC26A4 and TRMU genes

Previous studies showed that GJB2 (15), SCL26A4 (17) and TRMU (16) gene mutations are important causes of hereditary hearing loss. To investigate whether these nuclear genes played active roles in the phenotypic expression of deafness, mutational screening was performed. The present results suggested that no functional variants were identified in these nuclear genes.

G7444A and C7492T are ‘possibly pathogenic’ mutations associated with deafness

A pathogenicity scoring system (25) was used to evaluate the status of CO1/tRNASer(UCN) G7444A and tRNASer(UCN) C7492T mutations (Table IV). It was found that the total scores of G7444A and C7492T mutations were each nine points, and that these variants were ‘possibly pathogenic’ changes associated with hearing impairment.

Table IV.

Pathogenicity scoring system for G7444A and C7492T mutations.

Scoring criteria G7444A mutation Score/20 C7492T mutation Score/20
>1 independent report Yes 2 Yes 2
Evolutionary conservation of the base pair No changes 2 No changes 2
Variant heteroplasmy No 0 No 0
Segregation of the mutation with disease Yes 2 Yes 2
Histochemical evidence of mitochondrial disease No evidence 0 No evidence 0
Biochemical defect in complex I, III or IV No 0 No 0
Evidence of mutation segregation with biochemical defect from single-fiber studies No 0 No 0
Mutant mt-tRNA steady-state level or evidence of pathogenicity in trans-mitochondrial cybrid studies Weak evidence 3 Weak evidence 3
Maximum score Possibly pathogenic 9 Possibly pathogenic 9

Classification: ≤6 points: ‘neutral polymorphisms’; 7–10 points: ‘possibly pathogenic’; 11–13 points (not including evidence from single fiber, steady-state level or trans-mitochondrial cybrid studies): ‘probably pathogenic’; ≥11 points (including evidence from single fiber, steady-state level or trans-mitochondrial cybrid studies): ‘definitely pathogenic’. mt-tRNA, mitochondrial DNA-transfer RNA.

Discussion

The present study investigated the molecular and genetic features of two Chinese family with deafness related mt-tRNASer(UCN) gene mutations. The mt-tRNASer(UCN) gene has been implicated as a key site for mutations and variants associated with hearing impairment (3032). In a previous genetic screening program for mt-tRNASer(UCN) variants in 2,651 patients with deafness, the incidence rate of T7511C, T7505C and A7445C mutations were all 0.04% (9). It has been suggested that the primary defect in mt-tRNASer(UCN) mutations is tRNA metabolism failure, which affects mitochondrial translation and respiratory chain function (33).

Using PCR and direct sequencing analysis, the present results identified two potential pathogenic mutations in the two families with hearing loss; G7444A and C7492T. The CO1/tRNASer(UCN) G7444A mutation is on the mtDNA heavy strand and causes a read-through of the AGA stop codon in the CO1 gene. The CO1/tRNASer(UCN) G7444A mutation adds three amino acids, Lys-Gln-Lys, to the C-terminus of the polypeptide (34). In addition, the G7444A mutation is adjacent to the 3′ terminal endonucleolytic processing site of the L-strand RNA precursor, spanning tRNASer(UCN) and ND6 mRNA (35). Moreover, the deafness-associated A7445G mutation causes a significant decrease in the steady-state level of tRNASer(UCN) and ND6 mRNA (35,36). Thus, the G7444A mutation, which is similar to the A7445G mutation, may also cause impaired tRNASer(UCN) metabolism, which plays an important role in deafness (37). Kokotas et al (38) investigated a Greek family with hearing loss and identified the co-existence of the G7444A mutation and the GJB2 c.35delG mutation.

Furthermore, in the present study, the homoplasmic C7492T mutation was identified in Family 2. Structurally, this mutation is located at position 26 of the tRNASer(UCN) gene anticodon stem (39). The nucleotide at this position is highly conserved between species, indicating that it plays a critical role in tRNA stability and normal function. Moreover, the heteroplasmic T4295C mutation, located at the same position in the tRNAIle gene, is a pathogenic mutation causing chronic progressive external ophthalmoplegia (40). In addition, the C7492T mutation disrupts conserved base-pairing (A26-U44) and may cause the tRNA metabolism failure. The C7492T mutation is also associated with polycystic ovary syndrome (PCOS) (41) and hypertension (42). Thus, the present study hypothesized that the C7492T mutation may lead to mitochondrial dysfunction and may be involved in the pathogenesis of hearing loss. However, sequence analysis results for the complete mtDNA genes from the matrilineal relatives (II-10, II-8 and II-5 in Family 1; I-2, II-6 and II-8 in Family 2) indicated that the G7444A and C7492T mutations were only presented in the probands (III-12 in Family 1; II-9 in Family 2), but were absent in matrilineal relatives. Therefore, the present results suggested that G7444A and C7492T may be de novo mutations.

In total >130 genes have been associated with hearing loss (43). GJB2 encodes a gap junction protein that is expressed in the cochlea and is thought to be important for recycling potassium ions that flow into sensory hair cells as part of the transduction current (44). Mutations in the GJB2 gene are a major cause of non-syndromic hearing loss (45). Among these mutations, c.235delC and c.167delT are the most frequent variants among Eastern Asian populations (46). Furthermore, SLC26A4 mutations contribute to non-syndromic enlarged vestibular aqueduct (MIM 600791) and Pendred syndrome (MIM 274600) (47). Moreover, c.919>2A>G is the most frequent SLC26A4 gene mutation associated with non-syndromic hearing loss (48). The TRMU gene, which encodes the mitochondrial tRNA-specific 2-thiouridylase, is regarded as a nuclear modified gene for the phenotypic manifestation of deafness-associated 12S rRNA mutations (16). In a previous study, the A10S mutation in TRMU exon 1 was found to modulate the clinical expression of deafness related A1555G mutation in an Arab-Israel family (16). However, in the present study, the absence of GJB2, SLC26A4 and TRMU variants in the two families suggested that these genes may not play a role in the clinical expression of hearing impairments.

Mitochondrial haplogroups may influence the phenotypic expression of hearing loss associated with mtDNA pathogenic mutations (49). Mitochondrial haplogroup B may increase the risk for hearing impairment among patients with the A1555G mutation (50). In addition, mitochondrial haplogroup specific variants including G15927A of haplogroup B5b, T12338C of haplogroup F2, T5802C, T10454C, C12224T and G11696A of haplogroup D4, G5821A of haplogroup C, A14693G of haplogroups Y2 and F, and T15908C of haplogroup Y2 may enhance the penetrance of hearing loss carrying the 12S rRNA A1555G mutation (51). Sequence characterization of mitochondrial genomes in the present study identified sets of genetic polymorphisms belonging to the D4 and G2b Eastern Asian haplogroups (52). However, phylogenetic conservation analysis showed that, except for the G7444A and C7492T mutations, the variants were not conserved. Collectively, the present results suggested that the mitochondrial genetic background may not play a significant role in the expression of deafness-associated pathogenic mtDNA mutations. Moreover, the pathogenicity scoring system indicated that the total scores of G7444A and C7492T mutations were both nine points, and belonged to the ‘possibly pathogenic’ classification associated with deafness; however, scoring needs to be examined using cybrid cells carrying the G7444A or C7492T mutation in future studies. Furthermore, data from the MITOMAP suggested that the C7492T mutation was likely benign. However, MITOMAP reports the published data on human mtDNA mutations or variants and does not analyze functions (53). The C7492T mutation had been reported to be associated with PCOS (41) and hypertension (42), thus C7492T is a disease-associated mutation. However, in the present study, the incomplete penetrance of hearing loss and mild mitochondrial dysfunction indicated that G7444A and C7492T mutations are insufficient to produce the observed clinical phenotypes. Therefore, environmental factors and epigenetic modification may contribute to the expression of the deafness phenotype.

There are several limitations in the present study. Functional analysis was not performed for the C7492T and G7444A mutations, and the small sample size is major limitation. Further studies, including more patients with deafness and using trans-mitochondrial cybrid cells are required to investigate the present results in more depth.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

WP and YZ designed the studies, XZ collected the samples and performed the clinical analysis of two pedigrees, JY performed the molecular analysis of mitochondrial genomes. WP and YZ wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology. Signed written informed consent was obtained from the participants or their guardians.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

  • 1.Kral A, O'Donoghue GM. Profound deafness in childhood. N Engl J Med. 2010;363:1438–1450. doi: 10.1056/NEJMra0911225. [DOI] [PubMed] [Google Scholar]
  • 2.Humes LE. Examining the validity of the world health organization's long-standing hearing impairment grading system for unaided communication in age-related hearing loss. Am J Audiol. 2019;28:810–818. doi: 10.1044/2018_AJA-HEAL18-18-0155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kenna MA. Acquired hearing loss in children. Otolaryngol Clin North Am. 2015;48:933–953. doi: 10.1016/j.otc.2015.07.011. [DOI] [PubMed] [Google Scholar]
  • 4.Morton CC. Genetics, genomics and gene discovery in the auditory system. Hum Mol Genet. 2002;11:1229–1240. doi: 10.1093/hmg/11.10.1229. [DOI] [PubMed] [Google Scholar]
  • 5.Fischel-Ghodsian N. Genetic factors in aminoglycoside toxicity. Pharmacogenomics. 2005;6:27–36. doi: 10.1517/14622416.6.1.27. [DOI] [PubMed] [Google Scholar]
  • 6.Ou YH, Chen AW, Fan JY, Cheng WL, Lin TT, Chen MK, Liu CS. Aminoglycoside-associated nonsyndromic deafness and speech disorder in mitochondrial A1555G mutation in a family: A case report. Medicine (Baltimore) 2018;97:e12878. doi: 10.1097/MD.0000000000012878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhao H, Li R, Wang Q, Yan Q, Deng JH, Han D, Bai Y, Young WY, Guan MX. Maternally inherited aminoglycoside-induced and nonsyndromic deafness is associated with the novel C1494T mutation in the mitochondrial 12S rRNA gene in a large Chinese family. Am J Hum Genet. 2004;74:139–152. doi: 10.1086/381133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wu L, Li R, Chen J, Chen Y, Yang M, Wu Q. Analysis of mitochondrial A1555G mutation in infants with hearing impairment. Exp Ther Med. 2018;15:5307–5313. doi: 10.3892/etm.2018.6078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Tang X, Zheng J, Ying Z, Cai Z, Gao Y, He Z, Yu H, Yao J, Yang Y, Wang H, et al. Mitochondrial tRNA(Ser(UCN)) variants in 2651 Han Chinese subjects with hearing loss. Mitochondrion. 2015;23:17–24. doi: 10.1016/j.mito.2015.05.001. [DOI] [PubMed] [Google Scholar]
  • 10.Reid FM, Vernham GA, Jacobs HT. A novel mitochondrial point mutation in a maternal pedigree with sensorineural deafness. Hum Mutat. 1994;3:243–247. doi: 10.1002/humu.1380030311. [DOI] [PubMed] [Google Scholar]
  • 11.Jacobs HT, Hutchin TP, Kappi T, Gillies G, Minkkinen K, Walker J, Thompson K, Rovio AT, Carella M, Melchionda S, et al. Mitochondrial DNA mutations in patients with postlingual, nonsyndromic hearing impairment. Eur J Hum Genet. 2005;13:26–33. doi: 10.1038/sj.ejhg.5201250. [DOI] [PubMed] [Google Scholar]
  • 12.Hutchin TP, Parker MJ, Young ID, Davis AC, Pulleyn LJ, Deeble J, Lench NJ, Markham AF, Mueller RF. A novel mutation in the mitochondrial tRNA(Ser(UCN)) gene in a family with non-syndromic sensorineural hearing impairment. J Med Genet. 2000;37:692–694. doi: 10.1136/jmg.37.9.692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Sue CM, Tanji K, Hadjigeorgiou G, Andreu AL, Nishino I, Krishna S, Bruno C, Hirano M, Shanske S, Bonilla E, et al. Maternally inherited hearing loss in a large kindred with a novel T7511C mutation in the mitochondrial DNA tRNA(Ser(UCN)) gene. Neurology. 1999;52:1905–1908. doi: 10.1212/WNL.52.9.1905. [DOI] [PubMed] [Google Scholar]
  • 14.Suzuki T, Nagao A, Suzuki T. Human mitochondrial diseases caused by lack of taurine modification in mitochondrial tRNAs. Wiley Interdiscip Rev RNA. 2011;2:376–386. doi: 10.1002/wrna.65. [DOI] [PubMed] [Google Scholar]
  • 15.Dai P, Yu F, Han B, Liu X, Wang G, Li Q, Yuan Y, Liu X, Huang D, Kang D, et al. GJB2 mutation spectrum in 2,063 Chinese patients with nonsyndromic hearing impairment. J Transl Med. 2009;7:26. doi: 10.1186/1479-5876-7-26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Guan MX, Yan Q, Li X, Bykhovskaya Y, Gallo-Teran J, Hajek P, Umeda N, Zhao H, Garrido G, Mengesha E, et al. Mutation in TRMU related to transfer RNA modification modulates the phenotypic expression of the deafness-associated mitochondrial 12S ribosomal RNA mutations. Am J Hum Genet. 2006;79:291–302. doi: 10.1086/506389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wang QJ, Zhao YL, Rao SQ, Guo YF, Yuan H, Zong L, Guan J, Xu BC, Wang DY, Han MK, et al. A distinct spectrum of SLC26A4 mutations in patients with enlarged vestibular aqueduct in China. Clin Genet. 2007;72:245–254. doi: 10.1111/j.1399-0004.2007.00862.x. [DOI] [PubMed] [Google Scholar]
  • 18.Oosterloo BC, Homans NC, Baatenburg de Jong RJ, Ikram MA, Nagtegaal AP, Goedegebure A. Assessing hearing loss in older adults with a single question and person characteristics; Comparison with pure tone audiometry in the rotterdam study. PLoS One. 2020;15:e0228349. doi: 10.1371/journal.pone.0228349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ding Y, Teng YS, Zhuo GC, Xia BH, Leng JH. The mitochondrial tRNAHis G12192A mutation may modulate the clinical expression of deafness-associated tRNAThr G15927A mutation in a Chinese pedigree. Curr Mol Med. 2019;19:136–146. doi: 10.2174/1566524019666190308121552. [DOI] [PubMed] [Google Scholar]
  • 20.Zhang J, Lu B, Xia WW, Fang B, Ding XX, Hu GW. The mitochondrial transfer RNAAsp A7551G mutation may contribute to the clinical expression of deafness associated with the A1555G mutation in a pedigree with hearing impairment. Mol Med Rep. 2019;19:1797–1802. doi: 10.3892/mmr.2018.9790. [DOI] [PubMed] [Google Scholar]
  • 21.Andrews RM, Kubacka I, Chinnery PF, Lightowlers RN, Turnbull DM, Howell N. Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat Genet. 1999;23:147. doi: 10.1038/13779. [DOI] [PubMed] [Google Scholar]
  • 22.Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
  • 23.Ding Y, Xia BH, Liu Q, Li MY, Huang SX, Zhuo GC. Allele-specific PCR for detecting the deafness-associated mitochondrial 12S rRNA mutations. Gene. 2016;591:148–152. doi: 10.1016/j.gene.2016.07.013. [DOI] [PubMed] [Google Scholar]
  • 24.Zarrouk-Mahjoub S, Mehri S, Ouarda F, Finsterer J, Boussaada R. Mitochondrial tRNA glutamine variant in hypertrophic cardiomyopathy. Herz. 2015;40:436–441. doi: 10.1007/s00059-013-3950-8. [DOI] [PubMed] [Google Scholar]
  • 25.Yarham JW, Al-Dosary M, Blakely EL, Alston CL, Taylor RW, Elson JL, McFarland R. A comparative analysis approach to determining the pathogenicity of mitochondrial tRNA mutations. Hum Mutat. 2011;32:1319–1325. doi: 10.1002/humu.21575. [DOI] [PubMed] [Google Scholar]
  • 26.Brandon MC, Lott MT, Nguyen KC, Spolim S, Navathe SB, Baldi P, Wallace DC. MITOMAP: A human mitochondrial genome database-2004 update. Nucleic Acids Res. 2005;33:D611–D613. doi: 10.1093/nar/gki079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gadaleta G, Pepe G, De Candia G, Quagliariello C, Sbisà E, Saccone C. The complete nucleotide sequence of the Rattus norvegicus mitochondrial genome: Cryptic signals revealed by comparative analysis between vertebrates. J Mol Evol. 1989;28:497–516. doi: 10.1007/BF02602930. [DOI] [PubMed] [Google Scholar]
  • 28.Bibb MJ, Van Etten RA, Wright CT, Walberg MW, Clayton DA. Sequence and gene organization of mouse mitochondrial DNA. Cell. 1981;26:167–180. doi: 10.1016/0092-8674(81)90300-7. [DOI] [PubMed] [Google Scholar]
  • 29.Roe BA, Ma DP, Wilson RK, Wong JF. The complete nucleotide sequence of the Xenopus laevis mitochondrial genome. J Biol Chem. 1985;260:9759–9774. [PubMed] [Google Scholar]
  • 30.Ding Y, Leng J, Fan F, Xia B, Xu P. The role of mitochondrial DNA mutations in hearing loss. Biochem Genet. 2013;51:588–602. doi: 10.1007/s10528-013-9589-6. [DOI] [PubMed] [Google Scholar]
  • 31.Rydzanicz M, Wróbel M, Cywińska K, Froehlich D, Gawecki W, Szyfter W, Szyfter K. Screening of the general Polish population for deafness-associated mutations in mitochondrial 12S rRNA and tRNA Ser(UCN) genes. Genet Test Mol Biomarkers. 2009;13:167–172. doi: 10.1089/gtmb.2008.0098. [DOI] [PubMed] [Google Scholar]
  • 32.Jin L, Yang A, Zhu Y, Zhao J, Wang X, Yang L, Sun D, Tao Z, Tsushima A, Wu G, et al. Mitochondrial tRNASer(UCN) gene is the hot spot for mutations associated with aminoglycoside-induced and non-syndromic hearing loss. Biochem Biophys Res Commun. 2007;361:133–139. doi: 10.1016/j.bbrc.2007.06.171. [DOI] [PubMed] [Google Scholar]
  • 33.Boczonadi V, Ricci G, Horvath R. Mitochondrial DNA transcription and translation: Clinical syndromes. Essays Biochem. 2018;62:321–340. doi: 10.1042/EBC20170103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Liu Q, Liu P, Ding Y, Dong XJ, Wang ZX, Qian YE, Wang Q, Yang GC. Mitochondrial COI/tRNASer(UCN) G7444A mutation may be associated with aminoglycoside-induced and non-syndromic hearing impairment. Mol Med Rep. 2015;12:8176–8178. doi: 10.3892/mmr.2015.4484. [DOI] [PubMed] [Google Scholar]
  • 35.Guan MX, Enriquez JA, Fischel-Ghodsian N, Puranam RS, Lin CP, Maw MA, Attardi G. The deafness-associated mitochondrial DNA mutation at position 7445, which affects tRNASer(UCN) precursor processing, has long-range effects on NADH dehydrogenase subunit ND6 gene expression. Mol Cell Biol. 1998;18:5868–5879. doi: 10.1128/MCB.18.10.5868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Li X, Zhang LS, Fischel-Ghodsian N, Guan MX. Biochemical characterization of the deafness-associated mitochondrial tRNASer(UCN) A7445G mutation in osteosarcoma cell cybrids. Biochem Biophys Res Commun. 2005;328:491–498. doi: 10.1016/j.bbrc.2005.01.006. [DOI] [PubMed] [Google Scholar]
  • 37.Yuan H, Chen J, Liu X, Cheng J, Wang X, Yang L, Yang S, Cao J, Kang D, Dai P, et al. Coexistence of mitochondrial 12S rRNA C1494T and CO1/tRNA(Ser(UCN)) G7444A mutations in two Han Chinese pedigrees with aminoglycoside-induced and non-syndromic hearing loss. Biochem Biophys Res Commun. 2007;362:94–100. doi: 10.1016/j.bbrc.2007.07.161. [DOI] [PubMed] [Google Scholar]
  • 38.Kokotas H, Grigoriadou M, Yang L, Lodahl M, Rendtorff ND, Gyftodimou Y, Korres GS, Ferekidou E, Kandiloros D, Korres S, et al. Homoplasmy of the G7444A mtDNA and heterozygosity of the GJB2 c.35delG mutations in a family with hearing loss. Int J Pediatr Otorhinolaryngol. 2011;75:89–94. doi: 10.1016/j.ijporl.2010.10.016. [DOI] [PubMed] [Google Scholar]
  • 39.Pütz J, Dupuis B, Sissler M, Florentz C. Mamit-tRNA, a database of mammalian mitochondrial tRNA primary and secondary structures. RNA. 2007;13:1184–1190. doi: 10.1261/rna.588407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Silvestri G, Servidei S, Rana M, Ricci E, Spinazzola A, Paris E, Tonali P. A novel mitochondrial DNA point mutation in the tRNA (Ile) gene is associated with progressive external ophtalmoplegia. Biochem Biophys Res Commun. 1996;220:623–627. doi: 10.1006/bbrc.1996.0453. [DOI] [PubMed] [Google Scholar]
  • 41.Ding Y, Xia BH, Zhang CJ, Zhuo GC. Mutations in mitochondrial tRNA genes may be related to insulin resistance in women with polycystic ovary syndrome. Am J Transl Res. 2017;9:2984–2996. [PMC free article] [PubMed] [Google Scholar]
  • 42.Liu Y, Li Y, Wang X, Ma Q, Zhu C, Li Z, Yin T, Yang J, Chen Y, Guan M. Mitochondrial tRNA mutations in Chinese hypertensive individuals. Mitochondrion. 2016;28:1–7. doi: 10.1016/j.mito.2016.02.007. [DOI] [PubMed] [Google Scholar]
  • 43.Ouyang XM, Yan D, Yuan HJ, Pu D, Du LL, Han DY, Liu XZ. The genetic bases for non-syndromic hearing loss among Chinese. J Hum Genet. 2009;54:131–140. doi: 10.1038/jhg.2009.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Cohn ES, Kelley PM. Clinical phenotype and mutations in connexin 26 (DFNB1/GJB2), the most common cause of childhood hearing loss. Am J Med Genet. 1999;89:130–136. doi: 10.1002/(SICI)1096-8628(19990924)89:3<130::AID-AJMG3>3.0.CO;2-M. [DOI] [PubMed] [Google Scholar]
  • 45.Mishra S, Pandey H, Srivastava P, Mandal K, Phadke SR. Connexin 26 (GJB2) mutations associated with non-syndromic hearing loss (NSHL) Indian J Pediatr. 2018;85:1061–1066. doi: 10.1007/s12098-018-2654-8. [DOI] [PubMed] [Google Scholar]
  • 46.Zheng J, Ying Z, Cai Z, Sun D, He Z, Gao Y, Zhang T, Zhu Y, Chen Y, Guan MX. GJB2 mutation spectrum and genotype-phenotype correlation in 1067 han Chinese subjects with non-syndromic hearing loss. PLoS One. 2015;10:e0128691. doi: 10.1371/journal.pone.0128691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Wu CC, Tsai CY, Lin YH, Chen PY, Lin PH, Cheng YF, Wu CM, Lin YH, Lee CY, Erdenechuluun J, et al. Genetic epidemiology and clinical features of hereditary hearing impairment in the Taiwanese population. Genes (Basel) 2019;10:E772. doi: 10.3390/genes10100772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Adhikary B, Ghosh S, Paul S, Bankura B, Pattanayak AK, Biswas S, Maity B, Das M. Spectrum and frequency of GJB2, GJB6 and SLC26A4 gene mutations among nonsyndromic hearing loss patients in eastern part of India. Gene. 2015;573:239–245. doi: 10.1016/j.gene.2015.07.050. [DOI] [PubMed] [Google Scholar]
  • 49.Kato T, Fuku N, Noguchi Y, Murakami H, Miyachi M, Kimura Y, Tanaka M, Kitamura K. Mitochondrial DNA haplogroup associated with hereditary hearing loss in a Japanese population. Acta Otolaryngol. 2012;132:1178–1182. doi: 10.3109/00016489.2012.693624. [DOI] [PubMed] [Google Scholar]
  • 50.Ying Z, Zheng J, Cai Z, Liu L, Dai Y, Yao J, Wang H, Gao Y, Zheng B, Tang X, et al. Mitochondrial haplogroup B increases the risk for hearing loss among the Eastern Asian pedigrees carrying 12S rRNA 1555A>G mutation. Protein Cell. 2015;6:844–848. doi: 10.1007/s13238-015-0203-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Lu J, Qian Y, Li Z, Yang A, Zhu Y, Li R, Yang L, Tang X, Chen B, Ding Y, et al. Mitochondrial haplotypes may modulate the phenotypic manifestation of the deafness-associated 12S rRNA 1555A>G mutation. Mitochondrion. 2010;10:69–81. doi: 10.1016/j.mito.2009.09.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Kong QP, Bandelt HJ, Sun C, Yao YG, Salas A, Achilli A, Wang CY, Zhong L, Zhu CL, Wu SF, et al. Updating the East Asian mtDNA phylogeny: A prerequisite for the identification of pathogenic mutations. Hum Mol Genet. 2006;15:2076–2086. doi: 10.1093/hmg/ddl130. [DOI] [PubMed] [Google Scholar]
  • 53.Bandelt HJ, Salas A, Taylor RW, Yao YG. Exaggerated status of ‘novel’ and ‘pathogenic’ mtDNA sequence variants due to inadequate database searches. Hum Mutat. 2009;30:191–196. doi: 10.1002/humu.20846. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.


Articles from Molecular Medicine Reports are provided here courtesy of Spandidos Publications

RESOURCES