Abstract
Premise
Atractylodes japonica (Asteraceae) is endemic to East Asia, where its rhizomes are used in traditional medicine. To investigate the genetic diversity of this species, we developed polymorphic microsatellite markers.
Methods and Results
We obtained a total of 175,825 simple sequence repeat (SSR) loci using the Illumina HiSeq 2500 system. Eighteen polymorphic SSR primer pairs were selected to determine heterozygosity levels and allele numbers in 80 individuals from four A. japonica populations. The levels of observed and expected heterozygosity ranged from 0.000 to 1.000 and from 0.133 to 0.892, respectively. Cross‐amplification in the related species A. macrocephala and A. lancea was successful in 15 and 14 of the 18 markers, respectively.
Conclusions
These microsatellite markers will be useful for future studies involving A. japonica population genetics and breeding.
Keywords: Asteraceae, Atractylodes japonica, genetic diversity, microsatellite markers, population genetics, simple sequence repeat (SSR)
The genus Atractylodes DC., which consists of important medicinal plants in northeastern Asia, belongs to the Asteraceae and is generally known to consist of five species: A. japonica Koidz., A. macrocephala Koidz., A. lancea (Thunb.) DC., A. koreana (Nakai) Kitam., A. chinensis Koidz., and A. carlinoides (Hand.‐Mazz.) Kitam. (Shi, 1981; Kunio et al., 1997; Peng et al., 2012). There is considerable taxonomic debate regarding this; A. japonica has been treated as a synonym for A. lancea in some reports (Shi and Greuter, 2011; Peng et al., 2012). However, the Korean and Japanese Pharmacopoeia not only distinguish the two species but also treat them as distinct herbal medicines (Ministry of Food and Drug Safety, 2008; Pharmaceuticals and Medical Devices Agency of Japan, 2016). Among these, A. japonica and A. macrocephala produce the “white Atractylodes rhizomes” used in traditional medicine in Korea and Japan (Lee et al., 2002). Atractylodes japonica is a perennial herb that reaches 30–100 cm in height. Unlike A. macrocephala and A. lancea, which are native to China, A. japonica grows naturally in the Republic of Korea (Lee, 2006). Although the two species are similar in appearance, A. japonica is monoecious and produces a white flower, whereas A. macrocephala is gynodioecious and produces a claret flower (Peng et al., 2012; Jeong et al., 2018). The mass of a seed of A. japonica is half of that of A. macrocephala; thus, it takes longer for A. japonica seeds to germinate (Rural Development Administration, 2018). Despite challenges in its propagation and cultivation, A. japonica is of particular interest in medical applications. It has a high content of sesquiterpenoids, including atractylon and atractylenolides (Yun et al., 2013; Jeong et al., 2018), which are useful in the treatment of stomach disorders, inflammation, and obesity (Kim et al., 2011; Chen et al., 2016).
Compound simple sequence repeat (SSR) markers were previously developed from a related species, A. macrocephala (Zheng et al., 2012). However, this earlier study did not test the cross‐amplification in A. japonica. We initially tested these markers in A. japonica samples, but without much success. In this study, we developed 18 polymorphic SSR markers from the genome of A. japonica and tested them for analysis of genetic diversity in various populations and related species.
Methods and Results
We sampled four natural populations (80 individuals total) of A. japonica in Korea: Jeol Mountain (n = 21), Sageum Mountain (n = 20), Jiri Mountain (n = 18), and Cheonbul Mountain (n = 21) (Appendix 1). Voucher specimens were deposited at the Korea Medicinal Resources Herbarium, Eumseong, Korea (Appendix 1), and DNA was extracted from fresh leaves using the DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA).
Four A. japonica individuals collected from four different farms in Korea were used for sequencing. Sequencing libraries for genomic DNAs were prepared using a TruSeq Nano DNA Sample Prep Kit according to the manufacturer's instructions (Illumina, San Diego, California, USA). Sheared DNA fragments were subjected to end‐repairing, A‐tailing, adapter ligation, and amplification with clean‐up. The libraries were subjected to paired‐end sequencing with a 150‐bp read length using the Illumina HiSeq 2500 platform. The sequencing reads of the four plants, with sizes of 54.9 Gbp, 11.3 Gbp, 12.0 Gbp, and 11.5 Gbp, respectively, were deposited in the National Agricultural Biotechnology Information Center (NABIC) Sequence Read Archive (BioProject ID: NN‐5968, NN‐5970, NN‐5971, and NN‐5972). Short‐read correction was done with the SOAPec package of SOAPdenovo2 (version 2.04) (Luo et al., 2012), and genome assembly of the four plants was performed separately using SOAPdenovo2 (Luo et al., 2012) with the following parameters: pregraph ‐K 71 –d 0, contig –M 1, map –k 41, and scaff –F –b 1.5.
A total of 175,825 SSRs were identified using the stand‐alone version of SSRIT (Temnykh et al., 2001) with the following parameters: SSRs were defined as di‐, tri‐, tetra‐, penta‐, and hexanucleotide repeats with ≥4 repeats; and no variation (mutation) in repeat motifs was permitted. Forty‐eight polymorphic SSR loci with at least a 4‐bp motif containing a minimum of four repeats were selected by the comparison of the specific SSR loci of the four sequenced individuals using CLC Main Workbench (version 6.8.4, QIAGEN) according to Gil et al. (2017). SSR primers were designed using Primer3 (Untergasser et al., 2012) using the following conditions: length 18–26 bp, GC content 50–70%, and melting temperature 55–62°C. The PCR products ranged between 150 and 300 bp.
Preliminary PCR analysis of the 48 primers was performed on one A. japonica individual collected from the Jeol Mountain population. Forty‐four pairs of primers amplified the targets successfully. Four individuals per population were then tested with the selected primer sets and analyzed with the Fragment Analyzer Automated CE system (Advanced Analytical Technologies, Ankeny, Iowa, USA). Eighteen pairs of primers were selected based on the amplification efficiency and the number of alleles, and the forward primer of each set was labeled (Table 1). The PCR reaction mixture (total volume 25 μL) comprised 6 μL of distilled water, 12 μL of Inclone Exel TB 2× Taq Premix with dye (Inclone Biotech, Yongin, Korea), 1 μL of 10 μM of each forward and reverse primer, and 5 μL of gDNA. The PCR reaction conditions were: initial denaturation at 95°C for 5 min; 34 cycles at 95°C for 30 s, 55°C for 25 s, and 72°C for 1 min; and a final extension at 72°C for 30 min. The amplified DNA product (0.2 μL) was mixed with 9.8 μL of Hi‐Di formamide (Applied Biosystems, Foster City, California, USA) and 0.2 μL of GeneScan 500 LIZ size standard (Applied Biosystems). The mixture was denatured at 95°C for 5 min and kept on ice before being separated by capillary electrophoresis on an ABI 3730 DNA analyzer (Applied Biosystems). The amplified fragments were analyzed by size using GeneMapper version 4.1 software (Applied Biosystems). The allele count, levels of expected and observed heterozygosity, and Hardy–Weinberg equilibrium (Emigh, 1980) of each locus were calculated using PowerMarker software (version 3.23) (Liu and Muse, 2005).
Table 1.
Characteristics of the 18 SSRs developed for Atractylodes japonica.
| Locusa | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | Fluorescent labelb | GenBank accession no. |
|---|---|---|---|---|---|
| AJSSR001 | F: AACATCGATGAGTTGGACCA | (ATGT)5 | 157−189 | VIC | MN107252 |
| R: ATAGCAGGCTTTCGGAAAGA | |||||
| AJSSR002 | F: AGGAGGTAGGAGGCTTGTTA | (ACCAA)5 | 216−281 | FAM | MN107253 |
| R: GGCAATTGAGCATGCACATA | |||||
| AJSSR003 | F: CAAACTCCGTTGCATTTTGC | (GGTTT)6 | 261−291 | VIC | MN107254 |
| R: GAAGAGCGGAGTCGAGTTTA | |||||
| AJSSR004 | F: CAGGTTACGCCTCATAGTGA | (GAGAGG)5 | 118−161 | FAM | MN107255 |
| R: ACCTTCTCCCTGTAATCAACC | |||||
| AJSSR005 | F: ATGTGGGACAAGTTGGAAGT | (AAACC)5 | 220−250 | FAM | MN107256 |
| R: GGGGTAGAGGTAAAGGTGTG | |||||
| AJSSR006 | F: TTCAGCCGACCACATCAATA | (GTTTG)5 | 293−318 | VIC | MN107257 |
| R: GGCACCCAAGTTTGTCATTT | |||||
| AJSSR007 | F: TCTACGGACTCAGTCTCCTT | (GGTTT)7 | 270−295 | NED | MN107258 |
| R: TGACCTACCCAACAAACTTGT | |||||
| AJSSR008 | F: TGCTGTACCACCAACTTCAT | (AGGAGT)6 | 344−404 | VIC | MN107259 |
| R: CTGGTGTTGGTTGTTGTTGT | |||||
| AJSSR009 | F: TTTCCTTCGACTCCAACACA | (CTCTT)6 | 195−240 | PET | MN107260 |
| R: CAACCCAGATGCCAAAAACA | |||||
| AJSSR010 | F: CCTGTTGGTTTTCACAAGGT | (GGTTT)5 | 217−259 | NED | MN107261 |
| R:TGTAGTTTGACATTACGAGGGA | |||||
| AJSSR011 | F: GTCAGAACTTCCATGTCATGC | (AAACC)8 | 148−178 | PET | MN107262 |
| R: TAAGGCTGCGTACATCCTAC | |||||
| AJSSR012 | F: TGAGTGTTATACGCGGTTCA | (AATAAA)4 | 208−230 | FAM | MN107263 |
| R: TCCTGCACTTTACGGACAAT | |||||
| AJSSR013 | F: GCAATGGAGGCACTACTAGT | (GTTTG)5 | 380−405 | PET | MN107264 |
| R: AGCGTTCTCTCTACAAAGGG | |||||
| AJSSR014 | F: ATGTGATTGTGCTCCATCCT | (GGAA)4 | 238−262 | PET | MN107265 |
| R: GTTTTACTTGCTGGAGCTGG | |||||
| AJSSR015 | F: GGCTATTAGCATCTTCCCCA | (CATA)6 | 228−263 | VIC | MN107266 |
| R: CTCTGCCCTGTGACCTAAAA | |||||
| AJSSR016 | F: GATGCATTTTGCCCGTATCA | (CTTCTC)5 | 303−327 | NED | MN107267 |
| R: ATGTAATGGGAAGGTCGGTC | |||||
| AJSSR017 | F: GAGAATGATTCTGCTTCGGC | (ATGT)10 | 294−334 | FAM | MN107268 |
| R: TTTCACTGCATCCCAGGAAT | |||||
| AJSSR018 | F: TGAGTAGGTGGTTAAATGGCA | (AAACC)5 | 147−192 | NED | MN107269 |
| R: GAGATGAGGCCCATGCTTT |
Annealing temperature was 56°C for all loci.
Fluorescent labeling was applied to forward primers.
The 18 SSR primer pairs were then tested in all collected A. japonica individuals, and the genetic diversity was calculated for each, as described above. The number of alleles per locus varied from two to 14 (Table 2). The levels of observed and expected heterozygosity per locus ranged from 0.000 to 1.000 and from 0.133 to 0.892, respectively. Some markers showed significant deviation from Hardy–Weinberg equilibrium (Table 2). For the applicability test of the developed markers, we applied the markers to five individuals each of the related species A. macrocephala and A. lancea (Appendix 1), and 15 and 14 markers were successfully amplified, respectively (Table 3).
Table 2.
Genetic properties of 18 polymorphic SSR markers in four Atractylodes japonica populations.a
| Locus |
Jeol Mountain (n = 21) |
Sageum Mountain (n = 20) |
Jiri Mountain (n = 18) |
Cheonbul Mountain (n = 21) |
||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | H o | H e | A | H o | H e | A | H o | H e | A | H o | H e | |
| AJSSR001 | 3 | 0.476 | 0.381 | 3 | 0.333b | 0.634 | 5 | 0.571 | 0.511 | 3 | 0.191 | 0.176 |
| AJSSR002 | 4 | 0.619b | 0.552 | 5 | 0.471 | 0.543 | 4 | 0.381 | 0.354 | 4 | 0.750 | 0.529 |
| AJSSR003 | 8 | 0.714 | 0.796 | 6 | 0.529 | 0.630 | 7 | 0.810 | 0.726 | 7 | 0.810 | 0.727 |
| AJSSR004 | 5 | 0.905b | 0.638 | 4 | 0.500b | 0.532 | 5 | 0.952b | 0.720 | 5 | 0.952 | 0.736 |
| AJSSR005 | 5 | 1.000 | 0.728 | 5 | 0.944 | 0.674 | 6 | 0.952b | 0.689 | 6 | 1.000b | 0.694 |
| AJSSR006 | 5 | 0.333 | 0.434 | 3 | 0.278 | 0.332 | 3 | 0.316 | 0.277 | 3 | 0.150 | 0.185 |
| AJSSR007 | 5 | 0.235b | 0.786 | 5 | 0.267b | 0.684 | 3 | 0.444b | 0.656 | 3 | 0.222b | 0.607 |
| AJSSR008 | 8 | 0.810 | 0.813 | 7 | 0.500 | 0.730 | 9 | 0.895 | 0.769 | 11 | 0.619 | 0.858 |
| AJSSR009 | 11 | 0.905 | 0.829 | 9 | 0.833 | 0.798 | 14 | 0.857 | 0.892 | 13 | 0.857 | 0.835 |
| AJSSR010 | 7 | 0.762 | 0.621 | 6 | 0.529b | 0.505 | 8 | 0.700 | 0.734 | 8 | 0.667 | 0.720 |
| AJSSR011 | 6 | 0.667 | 0.734 | 5 | 0.611 | 0.679 | 6 | 0.571 | 0.630 | 5 | 0.700 | 0.749 |
| AJSSR012 | 5 | 0.333b | 0.736 | 3 | 0.083b | 0.531 | 5 | 0.000b | 0.703 | 3 | 0.066b | 0.354 |
| AJSSR013 | 6 | 0.810 | 0.659 | 6 | 0.667 | 0.688 | 5 | 0.667 | 0.612 | 4 | 0.476 | 0.659 |
| AJSSR014 | 2 | 0.143 | 0.133 | 7 | 0.444 | 0.426 | 6 | 0.429 | 0.438 | 5 | 0.571 | 0.492 |
| AJSSR015 | 8 | 0.450b | 0.836 | 3 | 0.222b | 0.569 | 9 | 0.286b | 0.730 | 6 | 0.191b | 0.756 |
| AJSSR016 | 4 | 0.154b | 0.524 | 7 | 0.143b | 0.765 | 7 | 0.200b | 0.729 | 8 | 0.688b | 0.809 |
| AJSSR017 | 6 | 0.381 | 0.528 | 5 | 0.444b | 0.651 | 5 | 0.550 | 0.669 | 7 | 0.429b | 0.721 |
| AJSSR018 | 6 | 0.667 | 0.692 | 7 | 0.563 | 0.647 | 7 | 0.524b | 0.780 | 7 | 0.619b | 0.812 |
| Mean | 5.78 | 0.576 | 0.634 | 5.33 | 0.465 | 0.612 | 6.33 | 0.561 | 0.646 | 6.00 | 0.553 | 0.634 |
A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; n = number of individuals.
Locality and voucher information are provided in Appendix 1.
Significant deviation from Hardy–Weinberg equilibrium at P < 0.05.
Table 3.
Cross‐amplification of microsatellite loci developed for Atractylodes japonica in two related species.a
| Locus | A. macrocephala (n = 5) | A. lancea (n = 5) | ||
|---|---|---|---|---|
| A | Allele size (bp) | A | Allele size (bp) | |
| AJSSR001 | 2 | 185−189 | 1 | 185 |
| AJSSR002 | 1 | 217 | 1 | 277 |
| AJSSR003 | 3 | 276−291 | 1 | 286 |
| AJSSR004 | 4 | 123−142 | 2 | 123−130 |
| AJSSR005 | 2 | 221−231 | 2 | 231−236 |
| AJSSR006 | 2 | 303−313 | 1 | 302 |
| AJSSR007 | — | — | — | — |
| AJSSR008 | — | — | — | — |
| AJSSR009 | — | — | — | — |
| AJSSR010 | 1 | 217 | 1 | 217 |
| AJSSR011 | 1 | 153 | 1 | 153 |
| AJSSR012 | 1 | 218 | 2 | 208−214 |
| AJSSR013 | 3 | 385−400 | 2 | 395−410 |
| AJSSR014 | 1 | 239 | 2 | 242−250 |
| AJSSR015 | 1 | 237 | 1 | 242 |
| AJSSR016 | 2 | 313−319 | 1 | 323 |
| AJSSR017 | 3 | 310−320 | 1 | 295 |
| AJSSR018 | 2 | 172−177 | — | — |
— = unsuccessful amplification; A = number of alleles; n = number of individuals.
Locality and voucher information are provided in Appendix 1.
Conclusions
We developed 18 polymorphic SSR markers from A. japonica and successfully used them to analyze genetic diversity in different populations and in two related species. These markers will be useful for the development of A. japonica cultivars and potentially for differentiation among Atractylodes species.
Acknowledgments
This study was supported by the Research Program for Agricultural Science and Technology Development (Project no. PJ014371032019), Rural Development Administration, Republic of Korea.
Appendix 1. Locality and voucher information for Atractylodes japonica and the two related species used in this study.
| Species | Collection localitya | Voucher no.b | Geographic coordinates | n |
|---|---|---|---|---|
| A. japonica Koidz. | Jeol Mountain, Hwacheon‐gun, Gangwon‐do | MPS005754 | 38°05′57.1″N, 127°44′57.1″E | 21 |
| A. japonica | Sageum Mountain, Samcheok‐si, Gangwon‐do | MPS005755 | 37°10′22.3″N, 129°10′56.6″E | 20 |
| A. japonica | Jiri Mountain, Gurye‐gun, Jeollanam‐do | MPS005756 | 35°20′14.4″N, 127°29′28.5″E | 18 |
| A. japonica | Cheonbul Mountain, Naju‐si, Jeollanam‐do | MPS005757 | 34°55′30.8″N, 126°52′11.0″E | 21 |
| A. macrocephala c Koidz. | Eumseong‐gun, Chungcheongbuk‐do | MPS004740 | 36°56′34.6″N, 127°45′02.5″E | 2 |
| A. macrocephala c | Mungyeong‐si, Gyeongsangbuk‐do | MPS004741 | 36°37′05.3″N, 127°59′54.3″E | 3 |
| A. lancea d (Thunb.) DC. | Eumseong‐gun, Chungcheongbuk‐do | MPS000723‐1 | 36°56′34.6″N, 127°45′02.5″E | 5 |
n = number of individuals sampled.
Locality and Korean province.
Vouchers deposited at the Korea Medicinal Resources Herbarium, Eumseong, Republic of Korea.
These samples represent cultivated materials in Korea without known geographical sources from China.
The sample was collected in a cultivation area.
Jeong, J.‐T. , Chung H., Ha B.‐K., Gil J., Lee J.‐H., Lee Y.‐J., Kim M. R., Oh M., Park C. G., Chang J. K., Hong C. P., Park S.‐G., and Lee Y.. 2020. Development of 18 microsatellite markers for Atractylodes japonica . Applications in Plant Sciences 8(5): e11350.
Data Availability
Sequencing reads have been deposited in the National Agricultural Biotechnology Information Center (NABIC) Sequence Read Archive (BioProject ID: NN‐5968, NN‐5970, NN‐5971, and NN‐5972). Primer sequences have been deposited to the National Center for Biotechnology Information's GenBank database; accession numbers are listed in Table 1.
Literature Cited
- Chen, L. G. , Jan Y. S., Tsai P. W., Norimoto H., Michihara S., Murayarna C., and Wang C. C.. 2016. Anti‐inflammatory and antinociceptive constituents of Atractylodes japonica Koidzumi. Journal of Agricultural and Food Chemistry 64: 2254–2262. [DOI] [PubMed] [Google Scholar]
- Emigh, T. H. 1980. A comparison of tests for Hardy–Weinberg equilibrium. Biometrics 36: 627–642. [PubMed] [Google Scholar]
- Gil, J. , Um Y., Kim S., Kim O. T., Koo S., Reddy C. S., Kim S.‐C., et al. 2017. Development of genome‐wide SSR markers from Angelica gigas Nakai using next generation sequencing. Genes 8: 238. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jeong, J. T. , Lee H. J., Lee J. H., Hong C. O., Lee Y. J., Jeong Y. S., Lee D. Y., et al. 2018. Comparison of growth characteristics and active ingredients in Atractylodes inter‐specific hybrid cultivars. Korean Journal of Medicinal Crop Science 26: 220–260. [Google Scholar]
- Kim, C. K. , Kim M., Oh S. D., Lee S. M., Sun B., Choi G. S., Kim S. K., et al. 2011. Effects of Atractylodes macrocephala Koidzumi rhizome on 3T3‐L1 adipogenesis and an animal model of obesity. Journal of Ethnopharmacology 137: 396–402. [DOI] [PubMed] [Google Scholar]
- Kunio, I. , Takasi Y., David E. B., and Hideaki O.. 1997. Flora of Japan. Kodansha, Tokyo, Japan. [Google Scholar]
- Lee, Y. N. 2006. New Flora of Korea. Kyo‐Hak Publishing Co., Seoul, Republic of Korea. [Google Scholar]
- Lee, J. H. , Kim Y. K., Hong S. P., and Kim C. S.. 2002. Studies of taxonomic origins of Atractylodis Rhizoma Alba and Atractylodis Rhizoma. Korean Journal of Oriental Medicine 8: 55–63. [Google Scholar]
- Liu, K. , and Muse S. V.. 2005. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 21: 2128–2129. [DOI] [PubMed] [Google Scholar]
- Luo, R. , Liu B., Xie Y., Li Z., Huang W., Yuan J., He G., et al. 2012. SOAPdenovo2: An empirically improved memory‐efficient short‐read de novo assembler. Gigascience 1: 18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ministry of Food and Drug Safety . 2008. The Korea pharmacopoeia, 9th ed., 929–930, 976 Ministry of Food and Drug Safety, Seoul, Korea. [Google Scholar]
- Peng, H. S. , Yuan Q. J., Li Q. Q., and Huang L. Q.. 2012. Molecular systematics of genus Atractylodes (Compositae, Cardueae): Evidence from internal transcribed spacer (ITS) and trnL‐F sequences. International Journal of Molecular Sciences 13: 14623–14633. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pharmaceuticals and Medical Devices Agency of Japan . 2016. The Japanese Pharmacopoeia, 17th ed., 1803–1804. Ministry of Health, Labour and Welfare of Japan, Tokyo, Japan. [Google Scholar]
- Rural Development Administration . 2018. Atractylodes rhizome white (Agricultural Technical Guide), 14–15. Rural Development Administration, Jeonju, Republic of Korea. [Google Scholar]
- Shi, Z. 1981. On the nomenclature of Chinese drug “Cangzhu”. Journal of Systematics and Evolution 19: 318–322. [Google Scholar]
- Shi, Z. , and Greuter W.. 2011. Carlineae, 39–41. In Wu Z. Y., Raven P. H., and Hong D. Y. [eds.], Flora of China, vols. 20–21. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Temnykh, S. , DeClerck G., Lukashova A., Lipovich L., Cartinhour S., and McCouch S.. 2001. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Research 11(8): 1441–1452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Untergasser, A. , Cutcutache I., Koressaar T., Ye J., Faircloth B. C., Remm M., and Rozen S. G.. 2012. Primer3—new capabilities and interfaces. Nucleic Acids Research 40: e115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yun, B. R. , Weon J. B., Lee B., Lee J., Eom M. R., and Ma C. J.. 2013. Quantitative analysis of atractylenolides I and III in Atractylodes japonica . Korean Journal of Pharmacognosy 44: 53–59. [Google Scholar]
- Zheng, L. , Shao Z. D., Wang Z. C., and Fu C. X.. 2012. Isolation and characterization of polymorphic microsatellite markers from the Chinese medicinal herb Atractylodes macrocephala (Asteraceae). International Journal of Molecular Sciences 13: 16046–16052. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Sequencing reads have been deposited in the National Agricultural Biotechnology Information Center (NABIC) Sequence Read Archive (BioProject ID: NN‐5968, NN‐5970, NN‐5971, and NN‐5972). Primer sequences have been deposited to the National Center for Biotechnology Information's GenBank database; accession numbers are listed in Table 1.