Skip to main content
Vector Borne and Zoonotic Diseases logoLink to Vector Borne and Zoonotic Diseases
. 2020 May 26;20(6):427–431. doi: 10.1089/vbz.2019.2544

Detection of Leptospira interrogans in Hedgehogs from Central China

Xiao-Juan Ma 1, Xiao-Qing Gong 1, Xiao Xiao 1,2, Jian-Wei Liu 1, Hui-Ju Han 1, Xiang-Rong Qin 1, Si-Cong Lei 1, Xiao-Lan Gu 1, Hao Yu 1, Xue-Jie Yu 1,
PMCID: PMC7249457  PMID: 32155388

Abstract

Background: Leptospira is the causative agent of leptospirosis, a zoonotic disease of global importance. To have a better understanding on the host species of Leptospira, we investigated the prevalence of Leptospira species in hedgehogs in Central China.

Materials and Methods: Hedgehogs were captured in Hubei Province, China in May and October, 2018. Total DNA was extracted from the kidney tissues of hedgehogs for determining the Leptospira species by PCR amplification of the rrs2, secY, and flaB genes with genus-specific primers.

Results: PCR amplification indicated that the positive rate of hedgehogs to the rrs2, secY, and flaB genes were 19.5% (8/41), 12.2% (5/41), and 9.8% (4/41), respectively. The homology of the partial sequence of rrs2, secY, and flaB genes were 99.0–100% among the Leptospira strains from hedgehogs. Phylogenetic analysis revealed that Leptospira species detected in this study clustered together with Leptospira interrogans.

Conclusions: We detected L. interrogans from hedgehogs in Central China, suggesting hedgehogs are the hosts of L. interrogans.

Keywords: hedgehogs, China, Leptospira

Introduction

Leptospira is one of the two genera in the family Leptospiraceae and is the causative agent of leptospirosis, a zoonotic disease of global importance (Bharti et al. 2003). In recent decades, leptospirosis has been recognized as one of the most widespread zoonosis emerging worldwide, although previously it is considered to be prevalent mainly in urban regions of tropical and subtropical countries, including those located in Latin America, the Middle East, Europe, Africa, Australia, and Asia (Bharti et al. 2003, Cox et al. 2005, Victoriano et al. 2009, Lagadec et al. 2012, Adler 2015, Dietrich et al. 2015). Studies led by the World Health Organization on the global burden of human leptospirosis estimated >1 million severe cases with >60,000 deaths annually (Mwachui et al. 2015, Torgerson et al. 2015). In China, leptospirosis is also a common and widespread zoonotic disease reported in 29 out of 34 provinces (Zhang et al. 2012), and is listed as a class B notifiable infectious disease (Hu et al. 2014).

Leptospira interrogans and L. borgpetersenii are the predominant pathogenic species causing leptospirosis (Zhang et al. 2012), and at least 75% of leptospirosis cases are caused by L. interrogans (Hu et al. 2014). Numerous studies indicated that rodents and insectivora are the important reservoirs of Leptospira (Rahelinirina et al. 2010, Ayral et al. 2016), whereas other small mammals such as bats are reported to carry Leptospira as well (Han et al. 2018, Zhao et al. 2019). Leptospira serovars usually do not cause disease in reservoir hosts (Ko et al. 2009), but humans can acquire infections by contact with infected animals, animal tissue, animal excretions, or by having abrasions, cuts in the skin, or conjunctiva coming into contact with contaminated water and food (Waitkins 1985).

Hedgehogs have been studied for their association with zoonotic pathogens in Europe (Kozuch et al. 1967, Majeed et al. 1989). However, hedgehogs as the natural reservoir of zoonotic-borne pathogens have been largely neglected in China. In this study, we determined the infection rate of hedgehogs with Leptospira to evaluate the role of hedgehogs in the epidemiology of Leptospira in Xianning City, Hubei Province of China, which is an endemic area of leptospirosis with incidence of leptospirosis 0.038/100,000 in 2011 (NBS of Xianning City, 2011).

Materials and Methods

Sample collection

Hedgehogs were captured during May and October of 2018 in forested sites near cesspools from Xianning City (29°53′N 114°13′E), which is located in Central China. Hedgehogs were identified through morphological observation. Hedgehogs were euthanized with an overdose of chloral hydrate and their kidneys were collected.

DNA extraction and PCR amplification

Total DNA was extracted from kidney tissues of hedgehogs using QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer's instructions. Leptospira in hedgehogs were amplified with nested PCR by using the 16S ribosomal RNA gene (rrs2), the flagellin B gene (flaB), and preprotein translocase gene (secY) primers (Table 1). Nuclease-free water was used as a negative control in each set of PCR. Both primary and nested PCRs were performed under the following conditions: 1 denaturing cycle for 5 min at 95°C followed by 35 cycles of denaturation for 30 s at 95°C, annealing for 30 s at 55°C, extension for 90 s (primary PCR) or 1 min (nested PCR) at 72°C and an additional final extension for 10 min at 72°C.

Table 1.

PCR Primers Used for Amplification of Leptospira interrogans

Primer Sequences (5′→3′) Product length (bp) Target gene Reference
Leptorrs1st-F CAAGTCAAGCGGAGTAGCAATAC 642 rrs2 Ogawa et al. (2015)
Leptorrs1st-R CAACTGGTAGACAACGTTTAGGGC      
Leptorrs2nd-F AATCTTCCTYYGAGTCTGGGATAAC      
Leptorrs2nd-R TTCACTACCCACGCTTTCGTGCCTC      
G1-1st GAGAACCSGGACGAATTCCTGGAATG 285 secY Ogawa et al. (2015)
G2-1st GGTTCAACTTTTCTCYACCGAYACRATGG      
G1-2nd CTGAATCGCTGTATAAAAGT      
G2-2nd GGAAAACAAATGGTCGGAAG      
G1-1st-k GTATGAGAACCSGGACGAATTCCTGG 329 secY Ogawa et al. (2015)
G2-1st-k GGTTCAACTTTTCTCYACCGAYACRATGG      
G1-k GCTAAYTCYGCAGGRTTRAACTGAAT      
G2-k GTGAGAAAGGTTCCTCTRCAGTA      
LEPflaBF1 TCTCACCGTTCTCTAAAGTTCAAC 732 flaB Koizumi et al. (2008)
LEPflaBR1 CTGAATTCGGTTTCATATTTGCC      
LEPflaBF2 TGTGCACAAGACGATGAAAGC      
LEPflaBR2 AACATTGCCGTACCACTCTG      

PCR products were analyzed using 1.2% agarose gel electrophoresis and detected with ethidium bromide under UV light. PCR products with expected sizes were excised from gels with a Gel Extraction Kit (TSINGKE, Beijing, China) and cloned into pMD19-T vectors (TaKaRa, Kusatsu, Shiga, Japan). Leptospira DNA in plasmid was sequenced on both directions.

Phylogenetic analysis

Sequences of rrs2, flab, and secY genes were searched using BLAST in the GenBank database (www.ncbi.nlm.nih.gov/BLAST). After alignment by ClustalW with MEGA 7.0 (http://megasoftware.net/), phylogenetic trees were constructed with maximum likelihood method of MEGA 7.0, and bootstrap values were calculated with 1000 replicates.

Ethical approval

This study was approved by the Ethics Committee of Wuhan University (2018010). Hedgehogs were handled in accordance with good animal practices required by the Animal Ethics Procedures and Guidelines of the People's Republic of China.

Results

Hedgehog collection

A total of 41 hedgehogs were collected from Xianning City, of which 22 were collected in May and 19 were collected in October. Hedgehogs were identified through morphological observation as Erinaceus amurensis.

Detection of Leptospira spp. in hedgehogs by PCR

Leptospira species were tested by PCR using kidney specimens from 41 hedgehogs. In total, 19.5% (8/41) of hedgehogs were positive to Leptospira with one of three genes and the positive rate of all hedgehogs to rrs2, secY, and flaB genes were 19.5% (8/41), 12.2% (5/41), and 9.8% (4/41), respectively. Among the eight positive samples, three hedgehogs were positive for all three genes.

Sequencing and phylogenetic analysis

BLAST analysis showed that the homology of the partial sequences of rrs2, secY, and flaB genes were 99.0–100% among the Leptospira strains from hedgehogs, respectively. Phylogenetic analysis revealed that the Leptospira spp. detected in this study clustered together with L. interrogans (Figs. 13).

FIG. 1.

FIG. 1.

Phylogenetic tree based on rrs2 gene of Leptospira. The tree was constructed by using maximum likelihood method with MEGA 7.0 (www.megasoftware.net). Bootstrap values were performed with 1000 replicates. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Sequences of Leptospira were shown with the GenBank accession number. The sequences obtained in this study were shown with the corresponding hedgehog number and marked by black dots. Scale bar indicates nucleotide substitutions per site.

FIG. 2.

FIG. 2.

Phylogenetic tree based on flaB gene of Leptospira. The tree was constructed by using maximum likelihood method with MEGA 7.0 (www.megasoftware.net). Bootstrap values were performed with 1000 replicates. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Sequences of Leptospira were shown with the GenBank accession number. The sequences obtained in this study were shown with the corresponding hedgehog number and marked by black dots. Scale bar indicates nucleotide substitutions per site.

FIG. 3.

FIG. 3.

Phylogenetic tree based on secY gene of Leptospira. The tree was constructed by using maximum likelihood method with MEGA 7.0 (www.megasoftware.net). Bootstrap values were performed with 1000 replicates. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Sequences of Leptospira were shown with the GenBank accession number. The sequences determined in this study were shown with the corresponding hedgehog number and marked by black dots. Scale bar indicates nucleotide substitutions per site.

Sequences from this study were deposited in GenBank with accession numbers: MK396786-MK396793 (rrs2gene), MK403978-MK403982 (secY gene), and MK403983-MK403986 (flaB gene).

Discussion

China is heavily affected by leptospirosis with several pandemics in the past (Shi and Jiang 2000). Since leptospirosis became a reportable disease in 1955 in China, >2.4 million cases have been documented nationwide (Shi et al. 1995, Shi 1999). More than 200 animal species, including Pisces, Amphibia, Reptilia, and Avesand Mammalia, have been found to be carriers of Leptospira worldwide (Adler et al. 1980, Anon 1999). Rodents and some domestic animals such as pigs, cattle, and dogs are the most important hosts that carry and spread this disease (Li et al. 2012, Zhang et al. 2012). In China, 67 species of wild and domesticated animal species have been confirmed as hosts of Leptospira (Zhang et al. 2012). Our study confirms that the hedgehog is highly positive to Leptospira, suggesting that hedgehogs could serve as an important source of Leptospira that infects humans and domesticated animals. These findings highlight the importance of Leptospira surveillance in hedgehogs.

The infection rates of Leptospira in wild and domesticated animals are varied in different places around the world. In Bangladesh, 13.1% (61/465) of trapped rodents were infected with pathogenic Leptospira (Krijger et al. 2019); in Cambodia, the infection rate of Leptospira in rodents was 11.1% (n = 642) (Ivanova et al. 2012); in Malaysia, the infection rate in rodents was 11.0% (n = 357) (Benacer et al. 2016); in China, it was 56.7% (34/60) in bats (Zhao et al. 2019) and 4.4% (3/69) in flying squirrels (Xiao et al. 2019). Previously Leptospira has been isolated from hedgehogs in several European countries, including France, Italy, The Netherlands, and Scotland, Israel, and New Zealand (Vander Hoeden 1958, Broom and Coghlan 1960, Babudieri and Farina 1964, Wolff and Bohlander 1965, Brockie and Till 1977, Ayral et al. 2016). Our study found that hedgehogs were heavily infected with Leptospira in Central China, which is consistent with previous reports on other animals in China. All Leptospira spp. detected in this study were L. interrogans. At least 75% of Chinese leptospirosis patients were caused by serovars of L. interrogans (Ren et al. 2003, Hu et al. 2014).

In China, most leptospirosis cases (80.3%) typically occur in the summer and early autumn. All hedgehogs in our study were collected in May and October, which is consistent with reports from countries in both temperate and tropical zones (Slack et al. 2006, Topic et al. 2010). We found that the infection does not seem to harm adult hedgehogs as even animals with active infections appeared to be in good health, consistent with the report that Leptospira serovars usually do not cause disease in their natural host (Ko et al. 2009). Hedgehogs are considered to be a tonic in traditional Chinese medicine, thus this species is frequently taken from the wild and eaten across Central China, and people may be infected in the process of capturing or slaughtering hedgehogs (Krijger et al. 2019). Therefore, increased awareness and protective measures are needed to prevent Leptospira infections.

Conclusions

Our study indicated that hedgehogs were heavily infected with Leptospira, suggesting that hedgehogs are the reservoir of Leptospira in China, and people who capture and handle wild hedgehogs are at risk of becoming infected by Leptospira.

Author Disclosure Statement

No conflicting financial interests exist.

Funding Information

This study was supported by the National Natural Science Funds of China (Nos. 31570167 and 81971939).

References

  1. Adler B. History of leptospirosis and Leptospira. Curr Top Microbiol Immunol 2015; 387:1–9 [DOI] [PubMed] [Google Scholar]
  2. Adler B, Faine S, Muller HK, Green DE. Maturation of humoral immune response determines the susceptibility of guinea-pigs to leptospirosis. Pathology 1980; 12:529–538 [DOI] [PubMed] [Google Scholar]
  3. Anon. Leptospirosis worldwide, 1999. Wkly Epidemiol Rec 1999; 74:237–242 [PubMed] [Google Scholar]
  4. Ayral F, Djelouadji Z, Raton V, Zilber A, et al. Hedgehogs and Mustelid species: Major carriers of pathogenic Leptospira, a survey in 28 animal species in France. PLoS One 2016; 11:0162549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Babudieri B, Farina R. The leptospirae of the Italian hedgehog. Pathol Microbiol 1964; 27:103–116 [DOI] [PubMed] [Google Scholar]
  6. Benacer D, Mohd ZS, Sim SZ, Mohd KM, et al. Determination of Leptospira borgpetersenii serovar Javanica and Leptospira interrogans serovar Bataviae as the persistent Leptospira serovars circulating in the urban rat populations in Peninsular Malaysia. Parasit Vectors 2016; 9:117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bharti AR, Nally JE, Ricaldi JN, Matthias MA, et al. Leptospirosis: A zoonotic disease of global importance. Lancet Infect Dis 2003; 3:757–771 [DOI] [PubMed] [Google Scholar]
  8. Brockie RE, Till DG. Leptospira ballum isolated from hedgehogs. N Z Vet J 1977; 25:28–30 [DOI] [PubMed] [Google Scholar]
  9. Broom JC, Coghlan JD. Leptospira bratislava isolated from a hedgehog in Scotland. Lancet 1960; 1:1326–1327 [DOI] [PubMed] [Google Scholar]
  10. Cox TE, Smythe LD, Leung LK. Flying foxes as carriers of pathogenic Leptospira species. J Wildl Dis 2005; 41:753–757 [DOI] [PubMed] [Google Scholar]
  11. Dietrich M, Muhldorfer K, Tortosa P, Markotter W. Leptospira and Bats: Story of an emerging friendship. PLoS Pathog 2015; 11:e1005176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Han HJ, Liu JW, Qin XR, Zhao M, et al. Pathogenic Leptospira species in insectivorous bats, China, 2015. Emerg Infect Dis 2018; 24:1123; –1126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hu W, Lin XA, Yan J. Leptospira and leptospirosis in China. Curr Opin Infect Dis 2014; 27:432–436 [DOI] [PubMed] [Google Scholar]
  14. Ivanova S, Herbreteau V, Blasdell K, Chaval Y. Leptospira and rodents in Cambodia: Environmental determinants of infection. Am J Trop Med Hyg 2012; 86:1032–1038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ko AI, Goarant C, Picardeau M. Leptospira: The dawn of the molecular genetics era for an emerging zoonotic pathogen. Nat Rev Microbiol 2009; 7:736–747 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Koizumi N, Muto M, Yamamoto S, Baba Y, et al. Investigation of reservoir animals of Leptospira in the northern part of Miyazaki Prefecture. Jpn J Infect Dis 2008; 61:465–468 [PubMed] [Google Scholar]
  17. Kozuch O, Gresikova M, Nosek J, Lichard M, et al. The role of small rodents and hedgehogs in a natural focus of tick-borne encephalitis. Bull World Health Organ 1967; 36:61–66 [PMC free article] [PubMed] [Google Scholar]
  18. Krijger IM, Ahmed A, Goris MGA, Groot Koerkamp PWG, et al. Prevalence of Leptospira infection in rodents from Bangladesh. Int J Environ Res 2019; 16:2113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Lagadec E, Gomard Y, Guernier V, Dietrich M, et al. Pathogenic Leptospira spp. in bats, Madagascar and Union of the Comoros. Emerg Infect Dis 2012; 18:1696–1698 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Li SJ, Zhang CC, Li XW, Tian KC, et al. Molecular typing of Leptospira interrogans strains isolated from Rattus tanezumi2 in Guizhou Province, Southwest of China. Biomed Environ Sci 2012; 25:542–548 [DOI] [PubMed] [Google Scholar]
  21. Majeed SK, Morris PA, Cooper JE. Occurrence of the lungworms Capillaria and Crenosoma spp. in British hedgehogs (Erinaceus europaeus). J Comp Pathol 1989; 100:27–36 [DOI] [PubMed] [Google Scholar]
  22. Mwachui MA, Crump L, Hartskeerl R, Zinsstag J, et al. Environmental and behavioural determinants of leptospirosis transmission: Asystematic review. PLoS Negl Trop Dis 2015; 9:e0003843. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. NBS of Xianning City. Statistical Yearbook of Xianning City. China Statistics Press, 2011 [Google Scholar]
  24. Ogawa H, Koizumi N, Ohnuma A, Mutemwa A, et al. Molecular epidemiology of pathogenic Leptospira spp. in the straw-colored fruit bat (Eidolon helvum) migrating to Zambia from the Democratic Republic of Congo. Infect Genet Evol 2015; 32:143–147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Rahelinirina S, Leon A, Harstskeerl RA, Sertour N, et al. First isolation and direct evidence for the existence of large small-mammal reservoirs of Leptospira spp. in Madagascar. PLoS One 2010; 5:e14111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Ren SX, Fu G, Jiang XG, Zeng R, et al. Unique physiological and pathogenic features of Leptospira interrogans revealed by whole-genome sequencing. Nature 2003; 422:888–893 [DOI] [PubMed] [Google Scholar]
  27. Shi MH. Research progress of leptospirosis and problems to be solved. Pract Prev Med 1999; 04:241–243 [Google Scholar]
  28. Shi MH, Jiang XG. Research progress of leptospirosis epidemiology in China in the past 50 years. Chin J Epidemiol 2000; 03:68–70 [Google Scholar]
  29. Shi MH, Yu ES, Liang ZX, Tu YF, et al. Epidemic characteristics and influencing factors of leptospirosis in China. Chin J Zoonoses 1995; 11:3–7 [Google Scholar]
  30. Slack AT, Symonds ML, Dohnt MF, Smythe LD. The epidemiology of leptospirosis and the emergence of Leptospira borgpetersenii serovar Arborea in Queensland, Australia, 1998–2004. Epidemiol Infect 2006; 134:1217–1225 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Topic MB, Habus J, Milas Z, Tosev EC, et al. Human leptospirosis in Croatia: Current status of epidemiology and clinical characteristics. Trans R Soc Trop Med Hyg 2010; 104:202–206 [DOI] [PubMed] [Google Scholar]
  32. Torgerson PR, Hagan JE, Costa F, Calcagno J, et al. Global burden of leptospirosis: Estimated in terms of disability adjusted life years. PLoS Negl Trop Dis 2015; 9:e0004122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Van Der Hoeden J. Leptospiral infections in hedgehogs. J Infect Dis 1958; 103:225–238 [DOI] [PubMed] [Google Scholar]
  34. Victoriano AF, Smythe LD, Gloriani-Barzaga N, Cavinta LL, et al. Leptospirosis in the Asia Pacific region. BMC Infect Dis 2009; 9:147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Waitkins S. Leptospirosis. Br Med J (Clin Res Ed) 1985; 290:468. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Wolff JW, Bohlander HJ. Leptospiral infections of hedgehogs in the Netherlands. Trop Geogr Med 1965; 17:9–16 [PubMed] [Google Scholar]
  37. Xiao X, Zhou SH, Jiang N, Tian DZ, et al. First record of Leptospira and Blastocystis infections in captive flying squirrels (Trogopterus xanthipes) from Enshi County, China. Acta Tropica 2019; 197:10; 5065 [DOI] [PubMed] [Google Scholar]
  38. Zhang C, Wang H, Yan J. Leptospirosis prevalence in Chinese populations in the last two decades. Microbes Infect 2012; 14:317–323 [DOI] [PubMed] [Google Scholar]
  39. Zhao M, Xiao X, Han HJ, Wang LJ, et al. Leptospira in bats from Hubei Province, China, 2018. J Wildl Dis 2019;55:940–943 [PubMed] [Google Scholar]

Articles from Vector Borne and Zoonotic Diseases are provided here courtesy of SAGE Publications

RESOURCES