Skip to main content
eLife logoLink to eLife
. 2020 Apr 30;9:e55771. doi: 10.7554/eLife.55771

Yap-lin28a axis targets let7-Wnt pathway to restore progenitors for initiating regeneration

Zhian Ye 1,, Zhongwu Su 2,, Siyu Xie 1,3, Yuye Liu 1, Yongqiang Wang 1, Xi Xu 1,3, Yiqing Zheng 2,, Meng Zhao 3,, Linjia Jiang 1,
Editors: Tanya T Whitfield4, Kathryn Song Eng Cheah5
PMCID: PMC7250571  PMID: 32352377

Abstract

The sox2 expressing (sox2+) progenitors in adult mammalian inner ear lose the capacity to regenerate while progenitors in the zebrafish lateral line are able to proliferate and regenerate damaged HCs throughout lifetime. To mimic the HC damage in mammals, we have established a zebrafish severe injury model to eliminate both progenitors and HCs. The atoh1a expressing (atoh1a+) HC precursors were the main population that survived post severe injury, and gained sox2 expression to initiate progenitor regeneration. In response to severe injury, yap was activated to upregulate lin28a transcription. Severe-injury-induced progenitor regeneration was disabled in lin28a or yap mutants. In contrary, overexpression of lin28a initiated the recovery of sox2+ progenitors. Mechanistically, microRNA let7 acted downstream of lin28a to activate Wnt pathway for promoting regeneration. Our findings that lin28a is necessary and sufficient to regenerate the exhausted sox2+ progenitors shed light on restoration of progenitors to initiate HC regeneration in mammals.

Research organism: Zebrafish

Introduction

The auditory epithelium is a delicate structure located in the cochlea that is composed of sensory hair cells (HCs) and nonsensory support cells (SCs). During early development of mouse cochlea, the transcription factor sox2 is required to determine the prosensory region that mainly contains progenitors (Julian et al., 2013; Kiernan et al., 2005; Dabdoub et al., 2008). From E12.5 to E14.5 sox2+ progenitors exit cell cycle and differentiate into auditory HCs and SCs. Basic helix-loop-helix (bHLH) transcription factor atoh1 acts as the cardinal gene initiating auditory HC differentiation since atoh1 deficiency causes complete loss of cochlear HCs (Bermingham et al., 1999). A subset of post-mitotic progenitors start to express high levels of atoh1 and downregulate sox2 expression to differentiate into the HC precursors (Dabdoub et al., 2008; Zhong et al., 2019; Cai and Groves, 2015; Zhang et al., 2017). Afterwards, their terminal differentiation toward mature HCs is promoted by the upregulation of atoh1 target genes, such as pou4f3 (Cai et al., 2015). In the meanwhile, differentiating HCs secret Notch ligands to activate Notch pathway, which inhibits atoh1 expression in neighboring cells and forces them to adopt the SC fate (Abdolazimi et al., 2016; Costa et al., 2017; Lanford et al., 1999).

The zebrafish lateral line is a mechanosensory organ composed of a series of neuromasts distributed on the body surface for detecting water flow. The lateral line HCs share similarities with their counterparts in mammalian inner ear in morphology, function and developmental pathways (Whitfield, 2002; Nicolson, 2005). Each neuromast contains sensory HCs in the center surrounded by SCs and mantle cells (MCs). Aminoglycoside antibiotics, such as neomycin, ablates mature HCs and initiates robust mitotic regeneration that is characterized with SC division and differentiation (Harris et al., 2003; Jiang et al., 2014; Williams and Holder, 2000; Ma et al., 2008; Romero-Carvajal et al., 2015). The powerful capacity to regenerate HCs sustains after multiple rounds of damage, and retains throughout lifetime (Cruz et al., 2015; Pinto-Teixeira et al., 2015). Even after severe loss of the tissue integrity, the residual SCs have high potential to recover the neuromast by acting plastic to generate all three cell types (Viader-Llargués et al., 2018). Like in inner ear, atoh1a is expressed in HC precursors but not mature HCs in neuromast while sox2 is expressed in a part of SCs and MCs (Ma et al., 2008; Lush et al., 2019). Sox2+ SCs behave as progenitors to proliferate and differentiate through activation of canonical Wnt pathway during regeneration (Hernández et al., 2007; Jacques et al., 2014). However, it is unknown how regeneration is initiated when sox2+ progenitors are absent.

Mammalian sensory HCs are vulnerable to damages caused by antibiotics, chemotherapeutical drugs and noise, which results in various hearing and balance diseases (Cox et al., 2014). Until now, the principal method used to initiate auditory HC regeneration in mammalian inner ear is to induce the transdifferentiation of SCs into HCs by upregulating atoh1 expression. For example, many studies tried to overexpress atoh1 in SCs with adenovirus, or used Notch inhibitor to increase atoh1 expression (Atkinson et al., 2018; Mizutari et al., 2013; Izumikawa et al., 2005; Yang et al., 2012). However, because the efficiency of HC induction is very low and SCs are lost due to transdifferentiation, very limited progress toward hearing recovery has been achieved (Cox et al., 2014; Zheng and Zuo, 2017; Chen et al., 2019). New strategies of restoring sox2+ progenitors to initiate mitotic regeneration would be more promising to realize functional regeneration in mammalian adult inner ear. Unfortunately, very little is known whether and how sox2+ progenitors can be restored in sensory epithelium.

Here in the zebrafish lateral line, we found that exhausted sox2+ progenitors were able to restore quickly for initiating HC regeneration in severe injury. Atoh1a+ HC precursors were the main population that survived post severe injury and dedifferentiated into sox2+ progenitors through yap-lin28a pathway.

Results

Exhausted sox2+ progenitors were quickly recovered by intensive proliferation post severe injury

It is well documented that Notch signaling pathway negatively regulates the differentiation of SCs into HCs (Ma et al., 2008; Haddon et al., 1998). Using the γ-secretase inhibitor LY411575 to inhibit Notch pathway from 3-day-post-fertilization (dpf) to 5dpf, we found that SCs were exhausted by persistent differentiation into HCs (Figure 1—figure supplement 1). Neomycin was used to ablate mature HCs following LY treatment (LY+neo), which leads to the severe injury with both HCs and SCs being ablated. Sox2 marks the proliferative progenitors that produce both SCs and HCs in homeostatic and regenerative neuromasts (Hernández et al., 2007). We analyzed sox2+ cells in neo- and LY+neo-treated neuromast by immunostaining with anti-sox2 antibody. While the distribution of sox2+ cells moved to the center post neo compared with normal larvae, the number was not changed. But sox2+ cell number was dramatically decreased after LY or LY+neo (Figure 1A–B). Surprisingly, sox2+ progenitors were able to recover quickly post LY+neo. A few sox2+ progenitors appeared early at 6 hr, with increased sox2+ progenitors being regenerated afterwards and recovered to normal level by 48 hr. In Figure 1A, ET4+ HCs appeared at 48 hr post LY+neo, suggesting that HC regeneration happened after the recovery of sox2+ progenitors.

Figure 1. Exhausted sox2+ progenitors were able to restore quickly post severe injury.

(A, B) ET4;ET20 larvae were treated with neomycin, LY411575 (3dpf-5dpf), or neomycin following LY (LY+neo), and collected at indicated time points post neomycin treatment for sox2 immunostaining. The number of sox2+ progenitors was not affected post neo, while it was significantly decreased in LY and LY+neo-0h. The sox2+ progenitors were regenerated post LY+neo and recovered to normal level at 48 hr post LY+neo. (C, D) The sox2:GFP reporter was treated with LY from 3dpf to 5dpf to exhaust GFP+ progenitors. GFP+ progenitors cannot be regenerated when resting in normal medium for 2 days post LY treatment (LY+rest). In contrast, sox2+ progenitors were quickly recovered to normal level at 2-day post LY+neo. Scale bar equals 10 μm. All groups are compared with 5dpf unless indicated.

Figure 1.

Figure 1—figure supplement 1. Severe injury causes damage to HCs, SCs and MCs.

Figure 1—figure supplement 1.

ET4;ET20 larvae were treated with 2 μM LY from 3dpf to 5dpf followed by neomycin, and the number of HCs, SCs and MCs were counted before and right after neo treatment. Results showed that HCs were increased while SCs were decreased post LY, indicating that LY induced differentiation of SCs into HCs. Numbers of HCs, SCs and MCs were all significantly decreased post LY+neo compared with 5dpf normal larvae. Scale bar equals 10 μm.
Figure 1—figure supplement 2. More proliferative SCs and MCs were induced post severe injury compared with normal injury.

Figure 1—figure supplement 2.

Larvae treated with neo or LY+neo were incorporated with EdU for different time points and counted for numbers of differentiating cells (EdU+ET4+ cells, HC+), proliferative SCs (EdU+ET4-ET20- cells, SC+), and proliferative MCs (EdU+ET20+ cells, MC+). We calculated EdU incorporation per hour by dividing EdU+ cell number with incorporation time. Results showed that differentiation rate (HC+ in B) in LY+neo was decreased compared with neo, while proliferative rates of SCs (SC+ in C) and MCs (MC+ in D) were significantly increased. Scale bar equals 10 μm.

In addition to sox2 antibody staining, we also used sox2-2a-GFP knock-in reporter (sox2:GFP) (Shin et al., 2014) to observe the recovery of sox2+ progenitors. GFP-positive cells in neuromast, which were mostly co-labeled by sox2 antibody, were significantly decreased in LY, and recovered to normal level at 48 hr post LY+neo. In contrast, the exhausted sox2+ progenitors were not recovered without severe injury (Figure 1C–D). These results indicate that sox2+ progenitors in the zebrafish lateral line have high potential to regenerate themselves when exhausted by severe injury.

During regeneration, three types of cell divisions can be detected by combining EdU staining with GFP expression in ET4;ET20 (Romero-Carvajal et al., 2015). First, EdU is incorporated in differentiating cells when one HC precursor divides into two HCs (ET4+EdU+, or HC+). The second type is SC proliferation in which one SC divides into two SCs (ET4-ET20-EdU+, or SC+). The third type is mantle cell (MC) proliferation in which one MC divides into two MCs (ET20+EdU+, or MC+). Our results showed that proliferation in SCs or MCs post severe injury is highly increased compared with neo-induced normal injury, while HC differentiation is decreased (Figure 1—figure supplement 2). By time lapse, we recorded 12 times of MC or SC divisions in one neuromast from 24 hr to 40 hr post LY+neo, but none of them was differentiation (Video 1). These results indicate that intensive proliferation is necessary to accomplish regeneration post severe injury.

Video 1. ET4;ET20;cldnB:H2Amcherry larvae treated with LY+neo were processed for time lapse.

Download video file (1.8MB, mp4)

Results showed the intensive cell divisions (CDs) during severe-injury-induced regeneration. Scale bar equals 10 μm.

Activated yap upregulated lin28a expression in atoh1a+ HC precursors upon severe injury

We next investigated the mechanism involved in progenitor recovery. Previously, we have collected samples of regenerating neuromasts for RNA-Seq analysis (Jiang et al., 2014) and identified that lin28a was transiently upregulated post neomycin treatment (Figure 2—figure supplement 1A). By in situ hybridization, we verified that lin28a was not expressed in the developing lateral line primordium or neuromast (Figure 2A). Neomycin treatment and other types of HC injuries, including heavy metal (copper sulfate) or chemotherapeutic drug (cisplatin), induced sporadic lin28a expression (Figure 2—figure supplement 1B). Interestingly, LY+neo induced much higher expression of lin28a compared with neo alone (Figure 2B). Since LY+neo induced more cell death than neo as illustrated by ablation of s100t expressing HCs, we tested whether lin28a induction is proportional to the injury size. We used laser ablation to manipulate the number of injured cells in LY-treated neuromast. Low level of lin28a was induced when five HCs were ablated while higher level of lin28a was observed when sixteen HCs were ablated. Furthermore, we found that the ablation of SCs could also induce lin28a expression (Figure 2—figure supplement 1C–D).

Figure 2. Activated yap upregulate lin28a transcription in atoh1a+ HC precursors post severe injury.

(A) Lin28a was not expressed in the developing lateral line primordium or neuromast. (B) Treatment with Notch inhibitor LY411575 from 3dpf to 5dpf increased expression atoh1a and s100t. More lin28a expression was observed in LY+neo-1h compared with neo-1h. No lin28a was detected at 5 hr post LY+neo or neo. (C) The number of atoh1a-transcribed cells detected by in situ were higher at 1 hr post LY+neo compared with LY. (D) Double fluorescent in situ showed that lin28a was co-expressed with atoh1a post neo or LY+neo. (E) Induction of lin28a post injury was increased when atoh1a was overexpressed in hs:atoh1a. (F) Lin28a expression was completely blocked when atoh1a was inhibited in hs:notch1a. (G) Western blot results showed that LY+neo induced higher yap expression compared with neo alone. (H) Motifs of yap and tead1 (co-transcriptional factor of yap) binding sites were predicted near lin28a transcriptional start site. CHIP-PCR results verified that yap directly binds the predicted motif. (I and J) Inhibition of yap using verteporfin or yap mutant blocked lin28a induction post LY+neo. Scale bar equals 10 μm.

Figure 2.

Figure 2—figure supplement 1. lin28a was induced by various kinds of injury and lin28a expression level was proportional to injury size.

Figure 2—figure supplement 1.

(A) RNA-Seq analysis using neomycin-treated neuromast cells revealed that lin28a was highly induced at 1 hr post neo while lin28b expression wa s not changed. (B) lin28a was induced at 1 hr post treatments with neomycin, cisplatin and copper. (C) LY-treated larvae were subjected for laser scan to ablate HCs at the indicated locations (white circles). Expression levels of lin28a was proportional to the injured cell number manipulated by laser ablation. (D) Laser was targeted at the circles for ablating indicated number of HCs or SCs. The corresponding neuromast was performed for lin28a in situ, and the results showed that either HC damage or SC damage could induce lin28a expression. Scale bar equals 10 μm.
Figure 2—figure supplement 2. Yap was activated immediately post LY+neo.

Figure 2—figure supplement 2.

(A) Wnt inhibition with hs:dkk1 has no effect on lin28a induction post neo treatment. (B) Expression levels of lin28a, yap, taz and Hippo pathway genes, such as lats1 and mob1, were detected by western blot at various time points post LY+neo. Results showed that yap was increased at 1 hr post LY+neo. Levels of lats1 and phosphorylated mob1 were not changed at 1 hr, suggesting yap is activated independent of canonical Hippo pathway. (C) Specificity of yap antibody was tested with 32hpf sibling and yap mutants. (D–E) Larvae treated with neo or LY+neo were immonstained with yap antibody. Results showed that nuclear localized yap was increased in LY+neo compared with neo. (F) LY+neo induced yap expression in sibling but not yap mutants. (G) Yap activation post LY+neo was inhibited when atoh1a is inhibited with hs:notch1a, suggesting that yap is activated in atoh1a+ HC precursors. (H) Classic yap target genes cyr61 and ctgfa were upregulated post LY+neo, which is partially blocked by verteporfin. (I) Transcripts of yap and mst2 were highly induced post LY+neo, which was blocked by verteporfin. Scale bar equals 10 μm.

Atoh1a is a master gene for HC specification and labels mostly HC precursors including differentiating HCs and young HCs (Cai and Groves, 2015; Lush et al., 2019). We noticed that atoh1a+HC precursors were the main population that survived post LY+neo (Figure 2C). Using double fluorescent in situ, it was verified that lin28a was induced in atoh1a+ HC precursors in both neo- and LY+neo-treated neuromasts (Figure 2D). We further assessed the effect of atoh1a expression on lin28a induction. We used hs:atoh1a to induce atoh1a expression after heat shock and found that neo-induced lin28a was increased (Figure 2E). In contrast, lin28a induction post LY+neo was completely blocked when atoh1a expression was inhibited in hs:notch1a (Figure 2F). All these results indicate that lin28a was induced in atoh1a+ HC precursors post injury.

We further analyzed the upstream pathway that induce lin28a post injury. It’s documented that Wnt activation regulates lin28a expression (Yao et al., 2016), so we first examined whether Wnt activation acts upstream to induce lin28a expression post injury. We used hs:dkk1 to inhibit Wnt activation and found that lin28a induction post injury was not affected (Figure 2—figure supplement 2A). Because Hippo pathway critically regulates regeneration of many tissues (Gregorieff et al., 2015; Gregorieff and Wrana, 2017; Moya and Halder, 2016), we therefore tested the expression of yap and taz, two cardinal mediators of Hippo pathway. We found the protein levels of yap was up-regulated at 1 hr post LY+neo while taz was increased until 5 hr (Figure 2G and Figure 2—figure supplement 2B). By immunostaining, more yap was also dectected in LY+neo-treated neuromast cells compared with neo. Yap expression was inhibited when atoh1a is inhibited with hs:notch1a, which suggests that yap is activated in atoh1a+ HC precursors (Figure 2—figure supplement 2D–G). Expressions of the classic yap target genes, such as cyr61 and ctgfa, and the Hippo pathway genes, such as yap and mst2, were dramatically increased post LY+neo (Figure 2—figure supplement 2H–I), which was blocked with verteporfin (an inhibitor of yap-mediated transcription by blocking yap-tead1 interaction).

Interesting we found a conserved yap binding motif located at 100 bp downstream of lin28a transcription start site, where a tead1 binding motif is located nearby. We used CHIP-PCR to verify that yap directly binds to this region of lin28a promoter post severe injury (Figure 2H). In addition, LY+neo-induced lin28a expression was blocked in verteporfin or in yap mutant (Figure 2I–J). Taken together, we found that yap is highly activated by severe injury and directly binds lin28a promoter to initiate its transcription in atoh1a+ HC precursors.

Yap-lin28a pathway is necessary and sufficient to promote progenitor recovery

To determine whether lin28a is required for HC regeneration, we generated a lin28a mutant allele (lin28a^psi37, referred to as lin28a-) that harbors a deletion of five nucleotides and causes a premature stop codon within the cold shock domain (Figure 3—figure supplement 1). We found that lin28a deficiency had no effect on HC or SC number in homeostasis, nor did it affect exhaustion of sox2+ progenitors post LY or LY+neo (Figure 3—figure supplement 2). Since LY+neo treatment substantially enhanced lin28a expression, we examined whether lin28a deficiency affected LY+neo-induced regeneration. We found that the regenerated HC number was decreased by lin28a deficiency (Figure 3A). In addition, the number of regenerated SCs (Figure 3A) and the proliferative SCs (Figure 3B) were both significantly decreased. The EdU-positive SC cells that were located in each quadrant with no polarization in sibling post LY+neo were almost cleared in lin28a mutant (Figure 3C–D). In contrast, the EdU-positive SC number post neo is not affected by lin28a deficiency (Figure 3E), indicating that lin28a is not required for neo-induced regeneration.

Figure 3. Yap-lin28a pathway is essentially required for progenitor recovery post severe injury.

(A) The number of SCs and total cells were counted at 48 hr post LY+neo and were significantly decreased in lin28a mutant compared with sibling. (B–E) The ET4;ET20 larvae were incorporated with EdU post neo or LY+neo treatment. Three populations labeled with ET4+EdU+ (HC+), ET20+EdU+ (MC+) or ET4-ET20-EdU+ (SC+) were counted and recorded with location information. The proliferative SCs post LY+neo were significantly decreased in lin28a mutant compared with sibling (B and C), while not changed in neo-induced regeneration (E). (D) EdU plots show the positions of EdU+ nuclei of 18 neuromasts superimposed on the same plane, and rose diagrams document the angular positions of SC+. The results show that the proliferative SCs are evenly distributed in each quadrant with no polarization post LY+neo. (F) LY+neo-induced Edu incorporation was significantly reduced in yap mutant. (G) The hs:lin28a larvae were heat-shocked and pre-treated with 10 μM verteporfin before adding neomycin. Samples were collected at 14 hr post LY+neo for EdU+ cell counting. Proliferation (SC+) is significantly decreased post LY+neo in verteporfin, which could be rescued by overexpression of lin28a with hs:lin28a. (H, I) The numbers of regenerated sox2+ progenitors (sox2) and proliferative progenitors (sox2EdU) post LY+neo were both reced in lin28a mutant. Scale bar equals 10 μm.

Figure 3.

Figure 3—figure supplement 1. Create lin28a mutant using CRISPR.

Figure 3—figure supplement 1.

(A) Diagram shows four exons of lin28a and the position of CIRPSR that was used for creating lin28a mutant. (B–C) Deletion of five nucleotides in the lin28a mutant allele damages the restriction enzyme site of Hpy188I and leads to a truncated protein by creating a premature stop codon in lin28a mRNA. (D) F1 embryos were genotyped for lin28a mutation by PCR followed by Hyp188I digestion. (E) Transcribed lin28a mRNA level was decreased in lin28a-/- post LY+neo, probably because the mutant form of lin28a mRNA is unstable and degraded.
Figure 3—figure supplement 2. HCs and sox2+ progenitors were not affected by lin28a deficiency in homeostasis, LY and LY+neo.

Figure 3—figure supplement 2.

We compared numbers of ET4+ HCs and sox2+ progenitors in 5dpf sibling and lin28a-/- and found that they were not changed in lin28-/- in homeostasis (A), LY (B) and LY+neo (C). Scale bar equals 10 μm.

We also observed that yap deficiency induced similar phenotype with lin28a mutant. Yap mutation or inhibition with verteporfin caused proliferative deficiency post LY+neo, but has no effect on SC proliferation post neo (Figure 3F–G and data not shown). We have generated a transgenic line in which heat shock promoter is used to drive lin28a expression. Proliferative deficiency in verterporfin was rescued by hs:lin28a (Figure 3G), indicating that lin28a acts downstream of yap to promote SC proliferation. We next examined whether lin28a is required for recovery of sox2+ progenitors post LY+neo. The number of proliferative and regenerated progenitors at 12 hr post injury were significantly reduced in lin28a mutant (Figure 3H–I).

We found that the HC number was not changed in hs:lin28a, indicating that lin28a has no effect on HC development (Figure 4—figure supplement 1). We next examined whether lin28a overexpression is sufficient to promote progenitor proliferation. The number of proliferative SCs was significantly increased when lin28a is overexpressed in both homeostatic and neo-treated neuromast, whereas HC differentiation was not changed (Figure 4A–B). The proliferative SCs are localized in dorsal and ventral poles of neuromast in homeostasis and neo-induced regeneration (Ma et al., 2008; Romero-Carvajal et al., 2015; Wibowo et al., 2011). The location of proliferative SCs still remain polarized in hs:lin28a (Figure 4C–D). We further examined whether lin28a overexpression is sufficient to induce sox2+ progenitors, and observed higher number of proliferative progenitors in hs:lin28a post LY (Figure 4E–F).

Figure 4. Overexpression of lin28a is sufficient to restore the exhausted progenitors.

(A–D) ET4;ET20;hs:lin28a larvae were incorporated with BrdU for 24 hr following heat-shock and/or neomycin treatment. (A, B) Overexpression of lin28a increased number of proliferative SCs (SC+) in both untreated and neomycin conditions. (C, D) BrdU plots and rose diagrams indicate that locations of SC+ still remain dorsally and ventrally polarized in hs:lin28a. (E, F) OverexpressUion of lin28a is sufficient to partially restore the exhausted sox2+ progenitors post LY. Scale bar equals 10 μm.

Figure 4.

Figure 4—figure supplement 1. Developing HCs and MCs were not affected in hs:lin28a.

Figure 4—figure supplement 1.

The ET4;ET20;hs:lin28a larvae were heat-shocked at 3dpf or 5dpf and collected after 24 hr for HC and MC counting. Results showed that numbers of HCs and MCs were not significantly changed by overexpression of lin28a at 3dpf (A) and 5dpf (B and C).

Atoh1a+ HC precursors gained sox2 expression through Yap-lin28a pathway

Our data indicate that lin28a is induced in atoh1a+ HC precursors post injury, but lin28a functions to recover sox2+ progenitors during regeneration. To address this paradox, we hypothesized that HC precursors gained sox2 expression to initiate regeneration post severe injury. We co-labeled the expressions of atoh1a mRNA and sox2 protein and found that the number of atoh1a+sox2+ cells in LY+neo was significantly increased compared with neo (Figure 5A–B). In addition, we used atoh1a:TdTomato reporter to test whether atoh1a+ cells expressed sox2 post severe injury. The atoh1a:TdTomato reporter labeled partially ET4-positive HCs (Figue 5C, ctrl) and also a few cells that are ET4 negative and sox2 negative which are likely HC precursors (Figure 5C, yellow arrows in LY). Very few Tomato+ cells express sox2 in normal or LY-treated larvae. However, significantly more Tomato+ cells turned on sox2 expression at 12 hr and 48 hr post LY+neo and become Tomato+sox2+ cells (Figure 5D). We further used time-lapse microscopy to trace atoh1a:TdTomato cells and found that the Tomato+ cells became HCs in both neo and LY+neo (blue dots in Figure 5—figure supplement 1A–B, Video 2 and S3). However, it’s only in LY+neo-induced severe injury that Tomato+ cells became sox2-positive cells labeled by sox2:GFP (white dots in Figure 5—figure supplement 1B and Video 3). We traced the Tomato+ cells for their fate becoming HCs, SCs or MCs (Figure 5—figure supplement 1C–D), and the results showed that significantly higher ratio of SCs were labeled by Tomato post LY+neo. More importantly many Tomato+ MCs were labeled post LY+neo, but none was detected in normal or neo-treated larvae, suggesting that atoh1a+sox2+ cells gained more potential to produce MCs.

Figure 5. Yap-lin28a pathway promotes sox2 expression in atoh1a+ HC precursors.

(A–B) Larvae were stained with sox2 antibody and atoh1a RNA probe at 6 hr post neo or LY+neo treatment. The number of atoh1a+sox2+ cells was significantly increased in LY+neo group. (C–D) The atoh1a:TdTomato larvae were used to trace atoh1a+ HC precursors in ctrl, LY or LY+neo. Results showed that Tomato+ cells labeled partial ET4+ HCs and ET4-sox2- HC precursors (yellow arrows). However, many atoh1a+ cells start to express sox2 from 12 hr post LY+neo and their numbers were significantly increased compared with normal larvae. The arrowheads in (C) pointed the atoh1a+sox2+ cells at 48 hr post LY+neo. (E) The atoh1a:TdTomato;hs:lin28a larvae was treated with LY+neo and verteporfin and collected for immunostaining with sox2 antibody. The cell number of Tomato+sox2+ is decreased in verteporfin and overexpression of lin28a could rescue the phenotype. (F–G) The LY-treated hs:lin28a larvae were heat-shocked to overexpress lin28a. Samples were collected for staining with sox2 antibody and atoh1a RNA probe. The number of atoh1a+sox2+ cells was significantly increased in hs:lin28a group, indicating that lin28a is sufficient to express sox2 in atoh1a+ HC precursors. Scale bar equals 10 μm.

Figure 5.

Figure 5—figure supplement 1. Atoh1a+ cells became SCs and MCs post severe injury.

Figure 5—figure supplement 1.

(A) The Neo-treated atoh1a:TdTomato;brn3c:GFP larvae was imaged for time lapse. Results showed that one Tomato+ cell turned into two HCs with membrane-bound GFP post neo (blue dots). (B) The LY+neo-treated atoh1a:TdTomato;sox2:GFP larvae was imaged for time lapse. The blue dots indicate that one Tomato+ cell divided and turned into two sox2:GFP-negative HCs post LY+neo. The white dots indicate that two Tomato+ cells divided and became four sox2:GFP-positive cells post LY+neo. (C and D) The atoh1a:TdTomato;ET4;ET20 larvae were collected at 48 hr post neo or LY+neo. Tomato expressing HCs, SCs and MCs were separately divided by total numbers of each to calculate Tomato+ ratios. The results showed that significantly more Tomato+ SCs were detected post LY+neo compared with neo. In addition, many Tomato+ MCs were detected post LY+neo, but none was detected in 5dpf and neo.

Video 2. The neuromast of atoh1a:TdTomato;brn3c:GFP larvae treated with neo was imaged for time lapse.

Download video file (1.2MB, mp4)

Result showed that one Tomato+ cell divided and turned into two GFP+hair cells post neo. Scale bar equals 10 μm.

Video 3. The neuromast of atoh1a:TdTomato;sox2:GFP larvae treated with LY+neo was imaged for time lapse.

Download video file (1.5MB, mp4)

One Tomato+ cell (blue dot) divided and turned into two HCs that are GFP negative in the center. The other two Tomato+ cells (white dots) divided and converted into four sox2+ progenitors. Scale bar equals 10 μm.

We further tested whether HC precursors gained sox2 expression through Yap-lin28a pathway. The Yap inhibitor verteporfin decreased Tomato+sox2+ cell number post severe injury, which was rescued by overexpression of lin28a (Figure 5E). Significantly higher number of atoh1a+sox2+ cells were induced in LY-treated hs:lin28a (Figure 5F–G).

MicroRNA let7 acts downstream of lin28a to activate wnt pathway for promoting regeneration

Lin28a has been described to regulate progenitor proliferation in developing inner ear by inhibiting let7 microRNA processing (Golden et al., 2015). To interrogate the function of let7 microRNA in regenerating lateral line, we have created hs:let7 transgenic line. Similar with lin28a mutant, hs:let7 showed the defect of SC proliferation post LY+neo (Figure 6A). We further found that overexpression of let7 inhibited hs:lin28a-induced proliferation (Figure 6B), indicating that let7 acts downstream of lin28a to promote regeneration.

Figure 6. MicroRNA let7 acts downstream of lin28a to activate Wnt pathway for promoting progenitor regeneration.

(A) We created hs:let7 transgenic line and found that it recapitulates the phenotype of lin28a-/- by decreasing proliferative SCs post LY+neo. (B) The induction of EdU+ proliferative cells was blocked by hs:let7, indicating that let7 microRNA acts downstream of lin28a to induce proliferation. (C) In situ hybridization results showed that expression of Wnt pathway genes, such as wnt10a and mycn, were increased in hs:lin28a. The activation of Wnt pathway genes in hs:lin28a were blocked when let7 was overexpressed, indicating that let7 acts downstream of lin28a to inhibit Wnt pathway. (D) Expressions of Wnt pathway genes, such as mycn, wnt10a and ccnd1 (cyclind1), were highly induced at 1 hr post LY+neo in sibling, but were not detected in lin28a-/-. (E) Inhibition of Wnt pathway with hs:dkk1 decreased lin28a-induced EdU+ proliferative cells, indicating that Wnt activation acts downstream of lin28a to induce regeneration.

Figure 6.

Figure 6—figure supplement 1. Notch and Fgf pathways were not affected by lin28a overexpression.

Figure 6—figure supplement 1.

In situ results show that expression of her4 and dkk2, Notch pathway genes, and fgf3, a Fgf pathway gene, were not affected in hs:lin28a post neo.

Lin28a has no effect on Notch and Fgf pathways as her4, a Notch pathway gene, and fgf3, a Fgf pathway gene were not changed in hs:lin28a (Figure 6—figure supplement 1). We then tested whether Wnt pathway acts downstream of lin28a/let7 to promote proliferation. Overexpression of lin28a was sufficient to upregulate Wnt pathway genes wnt10a and mycn, which was inhibited by overexpression of let7 (Figure 6C). Activation of Wnt pathway genes at 1 hr post LY+neo were blocked in lin28a mutant (Figure 6D). We further tested the function of Wnt pathway and found that lin28a-induced proliferation were inhibited by hs:dkk1 in which Wnt activation is blocked (Figure 6E). To summarize, we found that lin28a activates Wnt pathway through let7 for promoting regeneration.

Discussion

The zebrafish lateral line provides a valuable model for studying the mechanism underpinning progenitor regeneration

Progenitors that divide and differentiate to generate HCs in embryonic development are absent in adult mammalian inner ear, which leads to the regeneration failure post injury. In this study, we simulated the situation of progenitor absence in the zebrafish lateral line through persistent conversion of sox2+ progenitors into HCs with Notch inhibitor LY411575. By adding neomycin post LY treatment to ablate HCs, we created a severe injury model in which both HCs and progenitors were eliminated. In big contrast to mammalian inner ear, progenitors in the lateral line were able to quickly restore themselves post severe injury, with HCs being regenerated afterwards. This model provides a valuable tool to elucidate the mechanisms underpinning progenitor recovery for initiating HC regeneration.

Here, we found that yap-lin28a-let7-Wnt axis is essential to promote progenitor regeneration. Lin28a is not only necessary but also sufficient to induce progenitor recovery. Our findings elucidate the underlying mechanism of progenitor regeneration, and open a novel avenue of restoring progenitors to enhance mammalian HC regeneration.

In contrast to the situation of severe injury, our data showed that yap inhibition or lin28a deficiency has no effect on progenitor proliferation post neo (Figure 3E and data not shown). Wnt pathway, which acts downstream of lin28a, is required to induce progenitor proliferation. We found that Wnt pathway was highly activated immediately post severe injury, but was not activated at 1 hr post neo. Since the number of sox2+ progenitors were not reduced post neo, it seems not necessary to activate Wnt for producing more progenitors. Therefore, our results identified that Yap-lin28a pathway functions specifically in severe-injury induced regeneration for promoting progenitor recovery (Figure 7).

Figure 7. Schematic model illustrates how Yap-lin28a pathway regulates progenitor regeneration post severe injury.

Figure 7.

(A) It’s known that sox2+ progenitors that are preserved post neo-induced HC injury divide and differentiate to regenerate HCs. To simulate the situation in mammalian inner ear where the progenitors are absent, we created a severe injury model by exhausting sox2+ progenitors with Notch inhibitor and ablating mature HCs with neomycin. We found that the exhausted sox2+ progenitors in severe injury have high potential to restore themselves within 48 hr, with HCs being regenerated afterwards. The atoh1a+ HC precursors, the main population that survived post severe injury, were converted into proliferative progenitors to initiate regeneration through yap-lin28a pathway. (B) Yap is activated in atoh1a+ HC precursors post severe injury and binds directly to lin28a promoter for initiating its transcription. Lin28a activates Wnt pathway through microRNA let7 to promote regenerative proliferation.

The upstream signal that activates yap post injury

Previous studies have described yap as an important regulator in mediating regeneration (Gregorieff and Wrana, 2017; Moya and Halder, 2016), but the downstream mechanism is unclear. Here, in this paper, we prove that severe injury activated yap directly binds lin28a promoter for transcriptional initiation. Lin28a acts downstream of yap to regulate progenitor regeneration.

The mechanism of yap activation post severe injury remains elusive. It is hypothesized that either injured cells secrete diffusible molecules leading to widespread yap activation, or the damage of cell junction adjacent to the injury site activates yap (Moya and Halder, 2016). We observed lin28a induction after laser ablation of HCs in the restricted areas. Our results showed that the lin28a-expressing cells were very close to the damaged HCs (Figure 2—figure supplement 1C), suggesting that the damage of cell junction might lead to yap-lin28a activation. In addition, we have noticed that not only HC injury but also the ablation of SCs was able to induce lin28a (Figure 2—figure supplement 1D), indicating that the injury of either HCs or SCs triggers yap-lin28a activation. Since cell-junction-associated protein amotl2a has been reported restricting yap activity in the zebrafish lateral line primordium (Agarwala et al., 2015), it is possible that the loss of amotl2a post HC injury might result in yap activation. This assumption requires further investigation.

The cellular mechanism mediated by Yap-lin28a pathway that regulates progenitor regeneration

It was reported that lin28b-let7 functions to enhance progenitor proliferation during embryonic inner ear development (Golden et al., 2015), but the downstream pathway is still unknown. Our data showed that lin28a-let7 functions to promote progenitor proliferation during regeneration, which is consistent with the previous finding that lin28a regulates retinal regeneration through let7 (Ramachandran et al., 2010). Our results indicate that Wnt pathway acts downstream of lin28a-let7 for promoting progenitor regeneration. Hippo and Wnt pathway genes, such as yap1, wnt10a, mycn, cyclind1, were highly induced by Yap-lin28a post severe injury. During early development the lateral line primordium that migrates from head to tail deposits neuromasts in the trunk. Hippo and Wnt pathway genes, which are highly expressed in the leading edge of the migrating primordium containing mostly the undifferentiated mesenchymal-like progenitors (Aman and Piotrowski, 2008; Kozlovskaja-Gumbrienė et al., 2017), get silenced when the leading progenitors differentiate into SCs and HCs (Jiang et al., 2014; Kozlovskaja-Gumbrienė et al., 2017). However, the severe-injury-treated neuromast displayed the expression patterns of leading progenitors in early developing primordium, which suggests that lin28a reprograms the differentiated cells into the stem/progenitor cells at early developmental stage.

Although resident stem/progenitor cells are required for homeostasis and regeneration in most tissues, emerging evidence implies that differentiated cells are able to reprogram to stem/progenitor cells upon tissue damage to initiate regeneration (Lin et al., 2018; Tetteh et al., 2015). For example, atoh1+ secretory cells in intestine are capable to dedifferentiate into lgr5+ stem cells in irradiation-induced severe injury (Tetteh et al., 2016; Tomic et al., 2018). In colon, atoh1+ secretory progenitors reprogram to lgr5+ stem cells and form the entire crypts post injury while contributed minimally to other lineages in homeostasis (Castillo-Azofeifa et al., 2019). Since it’s well-known that lin28a, together with Oct4, Sox2 and Nanog, can reprogram somatic cells to induced pluripotent stem cells (iPSC) in mouse and human (Yu et al., 2007; Moss and Tang, 2003; Zhang et al., 2016), it may be involved in tissue regeneration through dedifferentiation. Our results showed that atoh1a+ HC precursors were converted into sox2 expressing cells through Yap-lin28a pathway (Figure 5), suggesting that lin28a may reprogram HC precursors into sox2+ progenitors. Further lineage-tracing analyses using cre/loxP system is necessary to verify whether HC precursors are dedifferentiated into sox2+ progenitors post severe injury.

Materials and methods

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Genetic reagent (Danio rerio) Et(krt4:EGFP)sqet20ET Parinov et al., 2004 sqET20; RRID:ZFIN_ZDB-ALT-070628-20
Genetic reagent (Danio rerio) Et(krt4:EGFP)sqet4ET Parinov et al., 2004 sgET4; RRID:ZFIN_ZDB-GENO-110323-1
Genetic reagent (Danio rerio) Tg(atoh1a:
TdTomato)nns8
Wada et al., 2010 nns8; RRID:ZFIN_ZDB-GENO-120530-1
Genetic reagent (Danio rerio) sox2-2a-sfGFPstl84 Shin et al., 2014 stl84; RRID:ZFIN_ZDB-GENO-150721-11
Genetic reagent (Danio rerio) Tg(brn3c:GAP43-GFP) s356t Xiao et al., 2005 S356t; RRID:ZFIN_ZDB-GENO-200218-3
Genetic reagent (Danio rerio) Tg(hsp70l:dkk1-GFP)w32 Stoick-Cooper et al. (2007) W32; RRID:ZFIN_ZDB-ALT-070403-1
Genetic reagent (Danio rerio) Tg(hsp70l:myc-notch1a;cryaa:Cerulean)fb12 Zhao et al. (2014) fb12; RRID:ZFIN_ZDB-ALT-140522-5
Genetic reagent (Danio rerio) Tg(hsp70:atoh1a)x20 Millimaki et al. (2010) X20;
RRID:ZFIN_ZDB-GENO-110315-10
Genetic reagent (Danio rerio) yapmw48 Miesfeld et al., 2015 Ms48; RRID:ZFIN_ZDB-ALT-160122-5
Genetic reagent (Danio rerio) Tg(hsp70:lin28a-P2Amcherry;cmlc:GFP)psi30 this paper Details in Fish strain information
Genetic reagent (Danio rerio) Tg(hsp70:let7-P2AGFP;cryaa:Venus) this paper Details in Fish strain information
Genetic reagent (Danio rerio) lin28apsi37 this paper Details in Fish strain information
Antibody anti-sox2 (Rabbit, polyclonal) Abcam Cat# Ab97959; RRID:AB_2341193 IF(1:200)
Antibody anti-yap (Rabbit, polyclonal) CST Cat# 4912, RRID:AB_2218911 IF(1:200)
Antibody anti-taz (Rabbit, polyclonal) Abcam Cat# Ab84927; RRID:AB_1925489 IF (1:200), WB (1:500)
Antibody anti-GFP (Mouse, monoclonal) Invitrogen Cat# A11120; RRID:AB_221568 IF(1:500)
Antibody Anti-yap (Mouse, monoclonal) Santa Cruz Cat# sc-271134; RRID:AB_10612397 WB (1:1000)
Antibody Anti-lin28a (Rabbit, polyclonal) CST Cat# 3978; RRID:AB_2297060 WB (1:500)
Antibody Anti-lats (Rabbit, monoclonal) CST Cat# 3477; RRID:AB_2133513 WB (1:500)
Antibody Anti-p-mob1
(Rabbit, monoclonal)
CST Cat# 8699; RRID:AB_11139998 WB (1:500)
Antibody Anti-β-actin (Mouse, monoclonal) Sigma Cat# A1978; RRID:AB_476692 WB (1:2000)
Antibody Anti-digoxingenin POD (sheep, polyclonal) Roche 11207733910; RRID:AB_514500 1:2000
Antibody Anti-fluorescein POD(sheep, polyclonal) Roche 11426346910; RRID:AB_840257 1:2000
Chemical compound, drug EdU Carbosynth NE08701 3.3 mM
Chemical compound, drug LY411575 Santa Cruz sc-364529 2 μM
Chemical compound, drug Neomycin sulfate Sigma N6386 300 μM
Chemical compound, drug Alexa Fluor-594 Azide Thermo Fisher Scientific N6386
Chemical compound, drug Verteporfin Selleckchem S1786 5 μM
Chemical compound, drug Copper sulfate Sigma 451657 50 μM
Chemical compound, drug cisplatin Sigma 33342 500 μM
Commercial assay or kit TSA-Cyanine 3 Reagent PerkinElmer SAT704A001EA
Commercial assay or kit TSA-FITC Reagent PerkinElmer SAT704A001EA
Commercial assay or kit dynabeads Invitrogen 10015D

Fish strains

Tg(sqET20;sgET4) (Parinov et al., 2004), Tg(atoh1a:TdTomato)nns8(Wada et al., 2010), sox2-2a-sfGFPstl84 (Shin et al., 2014), Tg(brn3c:GAP43-GFP)s356t or brn3c:GFP(Xiao et al., 2005), Tg(hsp70l:dkk1-GFP)w32 or hs:dkk1 (Stoick-Cooper et al., 2007), Tg(hsp70l:myc-notch1a;cryaa:Cerulean)fb12 or hs:notch1a (Zhao et al., 2014), Tg(hsp70:atoh1a)x20 or hs:atoh1a (Millimaki et al., 2010), yapmw48 (Miesfeld et al., 2015) were used. To generate Tg(hsp70:lin28a-P2Amcherry;cmlc:GFP)psi30 or hs:lin28a line, the lin28a coding sequence was cloned into the Gateway destination vector containing the hsp70 promoter. To generate Tg(hsp70:let7-P2AGFP;cryaa:Venus) or hs:let7 line, the expression cassette of pri-let-7a and pri-let-7f in UI4-GFP-SIBR backbone (Ramachandran et al., 2010) was subcloned into the Gateway destination vector containing the hsp70 promoter. To create lin28apsi37 mutant or lin28a-/-, 50 pg Cas9 protein (PNA Bio) and 50 pg sgRNA (GAGGGTTTTCGCAGTCTGA) were injected per embryo. F0 founders were screened by genotyping F1 embryos with PCR (F: TGTTTGACATCTCTGCAGAGC, R:CACCGATCTCCTTTTGACCG) followed by Hpy188I digestion. The yapmw69 mutant was genotyped with PCR primers (F:AGTCATGGATCCGAACCAGCACAA, R:TGCAATCGGCCTTTATTTTCCTGC) followed by HinfI digestion.

Pharmacological inhibitors and heat-shock experiments

The γ-secretase inhibitor LY411575 (Santa Cruz sc-364529) was added to larvae at 2 μM from 3dpf to 5dpf. The inhibitor of yap-tead1 complext verteporfin (Selleckchem S1786)was added to larvae at 5 μM. Larvae at 5dpf were heat-shocked at 39°C for 30 min and sometimes heat-shock is repeated to maintain the target gene expression. hs:lin28a or hs:let7 larvae were sorted by GFP in heart or Venus in eye at 3dpf. hs:notch1a were sorted by Cerulean fluorescence in eye at 3dpf. And hs:dkk1 larvae were sorted by GFP after heat-shock. hs:atoh1a were genotyped by primers GCAGCCTGACAGGACTTTTC and GCTGCTCTTCCTGAAGTTGG.

Regeneration experiments, EdU incorporation

To ablate HCs, larvae at 5dpf were treated with 300 μM neomycin (Fisher Scientific) for 30 min, 500 μM cisplatin (Sigma Aldrich, 33342) for 2 hr, or 50 μM CuSO4 (Sigma Aldrich, 451657) for 2 hr. To ablate both SCs and HCs to induce severe injury, we added 2 μM LY411575 from 3dpf to 5dpf and then treated with neomycin. Afterwards, larvae were first rinsed three times in fresh 0.5x E2 medium, and incubated in fresh medium. EdU (Carbosynth, NE08701, diluted in 3.3 mM with E2 medium containing 1% DMSO) was used to label larvae for the indicated time at 28.5°C before collecting for staining. Incorporated EdU was stained with Azide-594 (Invitrogen, N6386). The numbers and relative positions of EdU-positive cells in neuromast were analyzed as described in Romero-Carvajal et al., 2015.

In situ hybridization

The following probes were used: atoh1a, her4.1, fgf3, wnt10a (Jiang et al., 2014), yap1, mst2(Kozlovskaja-Gumbrienė et al., 2017), mycn, ccnd1(Yamaguchi et al., 2005), s100t(Venero Galanternik et al., 2015), dkk2 (Wada et al., 2013). lin28a was cloned with primers (F: CATTACCATCCCGTGAAGAGGGTCCTGGTTCTG and R: CCAATTCTACCCGTGTGCAACAACACACTCAGC) and subcloned into pPR-T4P for probe synthesis. In situ hybridization was performed as described in Jiang et al. (2014). Digoxigenin-labeled atoh1a probe and fluorescein-labeled lin28a probe were used for double fluorescent in situ. We first incubated the larvae with atoh1a probe followed by anti-digoxingenin POD antibody and colorized with TSA-FITC substrate. Then samples were incubated with lin28a probe followed by anti-fluorescein POD antibody and colorized with TSA-Cyanine 3 substrate.

Immunostaining and live imaging

Antibodies against sox2 (Abcam, Ab97959), yap (Cell Signaling Technology, 4912), taz (Abcam, Ab84927), GFP (Invitrogen, A11120) were used for immunostaining as described in Kozlovskaja-Gumbrienė et al. (2017). Images were acquired on a Zeiss LSM780 or LSM800 confocal microscope using an Apochromat 40 × 1.1 NA objective. For time-lapse imaging larvae at 5dpf were anesthetized with tricaine and mounted in 1.2% low melting point agarose on glass bottom dishes.

Western blot and CHIP experiments

About 30 larvae at 5dpf were lysed with 150 μl SDS buffer (63 mM Tris-HCl PH6.8, 10% glycerol, 100 mM DTT, 3.5% SDS) to extract protein for western blot. The primary antibodies used are yap (Santa Cruz, sc-271134), lin28a (CST, 3978), taz (Abcam, Ab84927), lats1 (CST, 3477), p-mob1 (CST 8699), β-actin (Sigma, A1978). CHIP experiments were performed as described in zfin (https://wiki.zfin.org/display/prot/Chromatin+Immunoprecipitation+%28ChIP%29+Protocol+using+Dynabeads). Antibody against yap (Santa Cruz, sc-271134) and dynabeads (Invitrogen, 10015D) were used to immunoprecipitate yap-bound nuclear DNA. PCR was performed with primers F:GATAATGATTGCATCACGTGAC and R:CATGCAGGATTCTTGGATGC to detect the region surrounding transcription start site of lin28a.

Laser ablation

Larvae at 5dpf were mounted in agarose and numbered individually for laser ablation. Laser ablation was performed with a Chameleon Ultra II laser tuned to 800 nm. Regions of 2 μm diameter were bleached for 30 cycles in ZEN. Illumination power was adjusted as necessary to ensure that destruction of the targeted regions occurred but limited to only targeted areas. This could range anywhere from 40 mW to 400 mW and varied from sample to sample. Imaging was performed with an LD C-Apochromat 40 × 1.1 NA objective, with 0.5 μm pixel spacing and 1.6μs dwell time with 512 × 512 pixels. The numbered larvae were then recovered and fixed in 4% PFA for testing in situ individually.

Yap expression analysis

Individual nuclei, labeled with DAPI, were automatically identified by finding local maxima on a Lorentzian of Gaussian filtered image. The area around identified points was automatically quantified in the yap channel. A yap-positive and yap-negative cell were manually selected from the vicinity of each neuromast, and only cells having intensity above the positive were counted as yap-nuclear-positive. All processings were done in ImageJ, and customized macros and plugins can be found at https://github.com/jouyun/smc-macros/blob/master/2DSpotFinder.ijm.

Cell counting and data analysis

GFP in ET20 was used to label MC while GFP in ET4 was used to label HC. The SC number was counted by DAPI stained cells with no ET4;ET20 expression. About 3–4 neuromasts from 4 to 6 fish were used for cell counting. The polarization analysis was performed as in Romero-Carvajal et al., 2015, and the enrichment in dorsal-ventral poles was calculated by Binomial analysis. All data are presented as the mean ± s.e.m. Statistical analyses were performed using Student’s t-test for experiments with two groups. One-way ANOVA was used for more than two groups. * indicates p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Acknowledgements

We thank T Piotrowski and M Lush in Stowers Institute for Medical Research, B Link in Medical College of Wisconsin and L Solnica-Krezel in Washington University for providing fish lines; Sean Mckinney in Stowers Institute for support of imaging and data analysis. This work was supported by grants from National Key R and D Program of China (2018YFA0108304), National Science Foundation of China (81800164, 31871467), Guangdong Science and Technology (2018A030313497), Shenzhen Foundation of Science and Technology (JCYJ20170818103626421), the Key Research and Development Program of Guangdong Province (2019B020234002),Fundamental Research Funds for the Central Universities (19ykpy98).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Yiqing Zheng, Email: zhengyiq@mail.sysu.edu.cn.

Meng Zhao, Email: zhaom38@mail.sysu.edu.cn.

Linjia Jiang, Email: jianglj7@mail.sysu.edu.cn.

Tanya T Whitfield, University of Sheffield, United Kingdom.

Kathryn Song Eng Cheah, The University of Hong Kong, Hong Kong.

Funding Information

This paper was supported by the following grants:

  • Ministry of Science and Technology of the People's Republic of China National Key R&D Program of China 2018YFA0108304 to Linjia Jiang.

  • National Science Foundation Youth Project 81800164 to Linjia Jiang.

  • National Science Foundation General Project 31871467 to Linjia Jiang.

  • Guangdong Science and Technology Department basic research project 2018A030313497 to Linjia Jiang.

  • Guangdong Science and Technology Department The key Research and Development Program of Guangdong Province 2019B020234002 to Meng Zhao.

  • Shenzhen Foundation of Science and Technology JCYJ20170818103626421 to Meng Zhao.

  • Fundamental Research Funds for the Central Universities 19ykpy98 to Linjia Jiang.

Additional information

Competing interests

No competing interests declared.

Author contributions

Data curation, Formal analysis, Methodology.

Data curation, Formal analysis, Methodology.

Data curation, Formal analysis.

Data curation.

Data curation, Methodology.

Data curation, Formal analysis.

Supervision, Writing - review and editing.

Supervision, Writing - review and editing.

Conceptualization, Supervision, Funding acquisition, Writing - review and editing.

Additional files

Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

References

  1. Abdolazimi Y, Stojanova Z, Segil N. Selection of cell fate in the organ of Corti involves the integration of hes/Hey signaling at the Atoh1 promoter. Development. 2016;143:841–850. doi: 10.1242/dev.129320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Agarwala S, Duquesne S, Liu K, Boehm A, Grimm L, Link S, König S, Eimer S, Ronneberger O, Lecaudey V. Amotl2a interacts with the hippo effector Yap1 and the wnt/β-catenin effector Lef1 to control tissue size in zebrafish. eLife. 2015;4:e08201. doi: 10.7554/eLife.08201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aman A, Piotrowski T. Wnt/beta-catenin and fgf signaling control collective cell migration by restricting chemokine receptor expression. Developmental Cell. 2008;15:749–761. doi: 10.1016/j.devcel.2008.10.002. [DOI] [PubMed] [Google Scholar]
  4. Atkinson PJ, Dong Y, Gu S, Liu W, Najarro EH, Udagawa T, Cheng AG. Sox2 haploinsufficiency primes regeneration and wnt responsiveness in the mouse cochlea. Journal of Clinical Investigation. 2018;128:1641–1656. doi: 10.1172/JCI97248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bermingham NA, Hassan BA, Price SD, Vollrath MA, Ben-Arie N, Eatock RA, Bellen HJ, Lysakowski A, Zoghbi HY. Math1: an essential gene for the generation of inner ear hair cells. Science. 1999;284:1837–1841. doi: 10.1126/science.284.5421.1837. [DOI] [PubMed] [Google Scholar]
  6. Cai T, Jen HI, Kang H, Klisch TJ, Zoghbi HY, Groves AK. Characterization of the transcriptome of nascent hair cells and identification of direct targets of the Atoh1 transcription factor. Journal of Neuroscience. 2015;35:5870–5883. doi: 10.1523/JNEUROSCI.5083-14.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cai T, Groves AK. The role of atonal factors in mechanosensory cell specification and function. Molecular Neurobiology. 2015;52:1315–1329. doi: 10.1007/s12035-014-8925-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Castillo-Azofeifa D, Fazio EN, Nattiv R, Good HJ, Wald T, Pest MA, de Sauvage FJ, Klein OD, Asfaha S. Atoh1+ secretory progenitors possess renewal capacity independent of Lgr5+ cells during colonic regeneration. The EMBO Journal. 2019;38:e99984. doi: 10.15252/embj.201899984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chen Y, Zhang S, Chai R, Li H. Hair cell regeneration. Advances in Experimental Medicine and Biology. 2019;1130:1–16. doi: 10.1007/978-981-13-6123-4_1. [DOI] [PubMed] [Google Scholar]
  10. Costa A, Powell LM, Lowell S, Jarman AP. Atoh1 in sensory hair cell development: constraints and cofactors. Seminars in Cell & Developmental Biology. 2017;65:60–68. doi: 10.1016/j.semcdb.2016.10.003. [DOI] [PubMed] [Google Scholar]
  11. Cox BC, Chai R, Lenoir A, Liu Z, Zhang L, Nguyen DH, Chalasani K, Steigelman KA, Fang J, Rubel EW, Cheng AG, Zuo J. Spontaneous hair cell regeneration in the neonatal mouse cochlea in vivo. Development. 2014;141:816–829. doi: 10.1242/dev.103036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Cruz IA, Kappedal R, Mackenzie SM, Hailey DW, Hoffman TL, Schilling TF, Raible DW. Robust regeneration of adult zebrafish lateral line hair cells reflects continued precursor pool maintenance. Developmental Biology. 2015;402:229–238. doi: 10.1016/j.ydbio.2015.03.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dabdoub A, Puligilla C, Jones JM, Fritzsch B, Cheah KS, Pevny LH, Kelley MW. Sox2 signaling in prosensory domain specification and subsequent hair cell differentiation in the developing cochlea. PNAS. 2008;105:18396–18401. doi: 10.1073/pnas.0808175105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Golden EJ, Benito-Gonzalez A, Doetzlhofer A. The RNA-binding protein LIN28B regulates developmental timing in the mammalian cochlea. PNAS. 2015;112:E3864–E3873. doi: 10.1073/pnas.1501077112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gregorieff A, Liu Y, Inanlou MR, Khomchuk Y, Wrana JL. Yap-dependent reprogramming of Lgr5(+) stem cells drives intestinal regeneration and Cancer. Nature. 2015;526:715–718. doi: 10.1038/nature15382. [DOI] [PubMed] [Google Scholar]
  16. Gregorieff A, Wrana JL. Hippo signalling in intestinal regeneration and Cancer. Current Opinion in Cell Biology. 2017;48:17–25. doi: 10.1016/j.ceb.2017.04.005. [DOI] [PubMed] [Google Scholar]
  17. Haddon C, Jiang YJ, Smithers L, Lewis J. Delta-Notch signalling and the patterning of sensory cell differentiation in the zebrafish ear: evidence from the mind bomb mutant. Development. 1998;125:4637–4644. doi: 10.1242/dev.125.23.4637. [DOI] [PubMed] [Google Scholar]
  18. Harris JA, Cheng AG, Cunningham LL, MacDonald G, Raible DW, Rubel EW. Neomycin-induced hair cell death and rapid regeneration in the lateral line of zebrafish (Danio rerio) JARO - Journal of the Association for Research in Otolaryngology. 2003;4:219–234. doi: 10.1007/s10162-002-3022-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hernández PP, Olivari FA, Sarrazin AF, Sandoval PC, Allende ML. Regeneration in zebrafish lateral line neuromasts: expression of the neural progenitor cell marker sox2 and proliferation-dependent and-independent mechanisms of hair cell renewal. Developmental Neurobiology. 2007;67:637–654. doi: 10.1002/dneu.20386. [DOI] [PubMed] [Google Scholar]
  20. Izumikawa M, Minoda R, Kawamoto K, Abrashkin KA, Swiderski DL, Dolan DF, Brough DE, Raphael Y. Auditory hair cell replacement and hearing improvement by Atoh1 gene therapy in deaf mammals. Nature Medicine. 2005;11:271–276. doi: 10.1038/nm1193. [DOI] [PubMed] [Google Scholar]
  21. Jacques BE, Montgomery WH, Uribe PM, Yatteau A, Asuncion JD, Resendiz G, Matsui JI, Dabdoub A. The role of wnt/β-catenin signaling in proliferation and regeneration of the developing basilar papilla and lateral line. Developmental Neurobiology. 2014;74:438–456. doi: 10.1002/dneu.22134. [DOI] [PubMed] [Google Scholar]
  22. Jiang L, Romero-Carvajal A, Haug JS, Seidel CW, Piotrowski T. Gene-expression analysis of hair cell regeneration in the zebrafish lateral line. PNAS. 2014;111:E1383–E1392. doi: 10.1073/pnas.1402898111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Julian LM, Vandenbosch R, Pakenham CA, Andrusiak MG, Nguyen AP, McClellan KA, Svoboda DS, Lagace DC, Park DS, Leone G, Blais A, Slack RS. Opposing regulation of Sox2 by cell-cycle effectors E2f3a and E2f3b in neural stem cells. Cell Stem Cell. 2013;12:440–452. doi: 10.1016/j.stem.2013.02.001. [DOI] [PubMed] [Google Scholar]
  24. Kiernan AE, Pelling AL, Leung KK, Tang AS, Bell DM, Tease C, Lovell-Badge R, Steel KP, Cheah KS. Sox2 is required for sensory organ development in the mammalian inner ear. Nature. 2005;434:1031–1035. doi: 10.1038/nature03487. [DOI] [PubMed] [Google Scholar]
  25. Kozlovskaja-Gumbrienė A, Yi R, Alexander R, Aman A, Jiskra R, Nagelberg D, Knaut H, McClain M, Piotrowski T. Proliferation-independent regulation of organ size by fgf/Notch signaling. eLife. 2017;6:e21049. doi: 10.7554/eLife.21049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lanford PJ, Lan Y, Jiang R, Lindsell C, Weinmaster G, Gridley T, Kelley MW. Notch signalling pathway mediates hair cell development in mammalian cochlea. Nature Genetics. 1999;21:289–292. doi: 10.1038/6804. [DOI] [PubMed] [Google Scholar]
  27. Lin B, Srikanth P, Castle AC, Nigwekar S, Malhotra R, Galloway JL, Sykes DB, Rajagopal J. Modulating cell fate as a therapeutic strategy. Cell Stem Cell. 2018;23:329–341. doi: 10.1016/j.stem.2018.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lush ME, Diaz DC, Koenecke N, Baek S, Boldt H, St Peter MK, Gaitan-Escudero T, Romero-Carvajal A, Busch-Nentwich EM, Perera AG, Hall KE, Peak A, Haug JS, Piotrowski T. scRNA-Seq reveals distinct stem cell populations that drive hair cell regeneration after loss of Fgf and notch signaling. eLife. 2019;8:e44431. doi: 10.7554/eLife.44431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ma EY, Rubel EW, Raible DW. Notch signaling regulates the extent of hair cell regeneration in the zebrafish lateral line. The Journal of Neuroscience. 2008;28:2261–2273. doi: 10.1523/JNEUROSCI.4372-07.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Miesfeld JB, Gestri G, Clark BS, Flinn MA, Poole RJ, Bader JR, Besharse JC, Wilson SW, Link BA. Yap and taz regulate retinal pigment epithelial cell fate. Development. 2015;142:3021–3032. doi: 10.1242/dev.119008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Millimaki BB, Sweet EM, Riley BB. Sox2 is required for maintenance and regeneration, but not initial development, of hair cells in the zebrafish inner ear. Developmental Biology. 2010;338:262–269. doi: 10.1016/j.ydbio.2009.12.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Mizutari K, Fujioka M, Hosoya M, Bramhall N, Okano HJ, Okano H, Edge ASB. Notch Inhibition Induces Cochlear Hair Cell Regeneration and Recovery of Hearing after Acoustic Trauma. Neuron. 2013;77:58–69. doi: 10.1016/j.neuron.2012.10.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Moss EG, Tang L. Conservation of the heterochronic regulator Lin-28, its developmental expression and microRNA complementary sites. Developmental Biology. 2003;258:432–442. doi: 10.1016/S0012-1606(03)00126-X. [DOI] [PubMed] [Google Scholar]
  34. Moya IM, Halder G. The Hippo pathway in cellular reprogramming and regeneration of different organs. Current Opinion in Cell Biology. 2016;43:62–68. doi: 10.1016/j.ceb.2016.08.004. [DOI] [PubMed] [Google Scholar]
  35. Nicolson T. The genetics of hearing and balance in zebrafish. Annual Review of Genetics. 2005;39:9–22. doi: 10.1146/annurev.genet.39.073003.105049. [DOI] [PubMed] [Google Scholar]
  36. Parinov S, Kondrichin I, Korzh V, Emelyanov A. Tol2 transposon-mediated enhancer trap to identify developmentally regulated zebrafish genes in vivo. Developmental Dynamics. 2004;231:449–459. doi: 10.1002/dvdy.20157. [DOI] [PubMed] [Google Scholar]
  37. Pinto-Teixeira F, Viader-Llargués O, Torres-Mejía E, Turan M, González-Gualda E, Pola-Morell L, López-Schier H. Inexhaustible hair-cell regeneration in young and aged zebrafish. Biology Open. 2015;4:903–909. doi: 10.1242/bio.012112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ramachandran R, Fausett BV, Goldman D. Ascl1a regulates müller Glia dedifferentiation and retinal regeneration through a Lin-28-dependent, let-7 microRNA signalling pathway. Nature Cell Biology. 2010;12:1101–1107. doi: 10.1038/ncb2115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Romero-Carvajal A, Navajas Acedo J, Jiang L, Kozlovskaja-Gumbrienė A, Alexander R, Li H, Piotrowski T. Regeneration of sensory hair cells requires localized interactions between the notch and wnt pathways. Developmental Cell. 2015;34:267–282. doi: 10.1016/j.devcel.2015.05.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Shin J, Chen J, Solnica-Krezel L. Efficient homologous recombination-mediated genome engineering in zebrafish using TALE nucleases. Development. 2014;141:3807–3818. doi: 10.1242/dev.108019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Stoick-Cooper CL, Weidinger G, Riehle KJ, Hubbert C, Major MB, Fausto N, Moon RT. Distinct Wnt signaling pathways have opposing roles in appendage regeneration. Development. 2007;134:479–489. doi: 10.1242/dev.001123. [DOI] [PubMed] [Google Scholar]
  42. Tetteh PW, Farin HF, Clevers H. Plasticity within stem cell hierarchies in mammalian epithelia. Trends in Cell Biology. 2015;25:100–108. doi: 10.1016/j.tcb.2014.09.003. [DOI] [PubMed] [Google Scholar]
  43. Tetteh PW, Basak O, Farin HF, Wiebrands K, Kretzschmar K, Begthel H, van den Born M, Korving J, de Sauvage F, van Es JH, van Oudenaarden A, Clevers H. Replacement of Lost Lgr5-Positive Stem Cells through Plasticity of Their Enterocyte-Lineage Daughters. Cell Stem Cell. 2016;18:203–213. doi: 10.1016/j.stem.2016.01.001. [DOI] [PubMed] [Google Scholar]
  44. Tomic G, Morrissey E, Kozar S, Ben-Moshe S, Hoyle A, Azzarelli R, Kemp R, Chilamakuri CSR, Itzkovitz S, Philpott A, Winton DJ. Phospho-regulation of ATOH1 is required for plasticity of secretory progenitors and tissue regeneration. Cell Stem Cell. 2018;23:436–443. doi: 10.1016/j.stem.2018.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Venero Galanternik M, Kramer KL, Piotrowski T. Heparan sulfate proteoglycans regulate fgf signaling and cell polarity during collective cell migration. Cell Reports. 2015;10:414–428. doi: 10.1016/j.celrep.2014.12.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Viader-Llargués O, Lupperger V, Pola-Morell L, Marr C, López-Schier H. Live cell-lineage tracing and machine learning reveal patterns of organ regeneration. eLife. 2018;7:e30823. doi: 10.7554/eLife.30823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Wada H, Ghysen A, Satou C, Higashijima S, Kawakami K, Hamaguchi S, Sakaizumi M. Dermal morphogenesis controls lateral line patterning during postembryonic development of teleost fish. Developmental Biology. 2010;340:583–594. doi: 10.1016/j.ydbio.2010.02.017. [DOI] [PubMed] [Google Scholar]
  48. Wada H, Ghysen A, Asakawa K, Abe G, Ishitani T, Kawakami K. Wnt/Dkk Negative Feedback Regulates Sensory Organ Size in Zebrafish. Current Biology. 2013;23:1559–1565. doi: 10.1016/j.cub.2013.06.035. [DOI] [PubMed] [Google Scholar]
  49. Whitfield TT. Zebrafish as a model for hearing and deafness. Journal of Neurobiology. 2002;53:157–171. doi: 10.1002/neu.10123. [DOI] [PubMed] [Google Scholar]
  50. Wibowo I, Pinto-Teixeira F, Satou C, Higashijima S, López-Schier H. Compartmentalized notch signaling sustains epithelial mirror symmetry. Development. 2011;138:1143–1152. doi: 10.1242/dev.060566. [DOI] [PubMed] [Google Scholar]
  51. Williams JA, Holder N. Cell turnover in neuromasts of zebrafish larvae. Hearing Research. 2000;143:171–181. doi: 10.1016/S0378-5955(00)00039-3. [DOI] [PubMed] [Google Scholar]
  52. Xiao T, Roeser T, Staub W, Baier H. A GFP-based genetic screen reveals mutations that disrupt the architecture of the zebrafish retinotectal projection. Development. 2005;132:2955–2967. doi: 10.1242/dev.01861. [DOI] [PubMed] [Google Scholar]
  53. Yamaguchi M, Tonou-Fujimori N, Komori A, Maeda R, Nojima Y, Li H, Okamoto H, Masai I. Histone deacetylase 1 regulates retinal neurogenesis in zebrafish by suppressing Wnt and Notch signaling pathways. Development. 2005;132:3027–3043. doi: 10.1242/dev.01881. [DOI] [PubMed] [Google Scholar]
  54. Yang SM, Chen W, Guo WW, Jia S, Sun JH, Liu HZ, Young WY, He DZ. Regeneration of stereocilia of hair cells by forced Atoh1 expression in the adult mammalian cochlea. PLOS ONE. 2012;7:e46355. doi: 10.1371/journal.pone.0046355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Yao K, Qiu S, Tian L, Snider WD, Flannery JG, Schaffer DV, Chen B. Wnt regulates proliferation and neurogenic potential of müller glial cells via a Lin28/let-7 miRNA-Dependent pathway in adult mammalian retinas. Cell Reports. 2016;17:165–178. doi: 10.1016/j.celrep.2016.08.078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA. Induced pluripotent stem cell lines derived from human somatic cells. Science. 2007;318:1917–1920. doi: 10.1126/science.1151526. [DOI] [PubMed] [Google Scholar]
  57. Zhang J, Ratanasirintrawoot S, Chandrasekaran S, Wu Z, Ficarro SB, Yu C, Ross CA, Cacchiarelli D, Xia Q, Seligson M, Shinoda G, Xie W, Cahan P, Wang L, Ng SC, Tintara S, Trapnell C, Onder T, Loh YH, Mikkelsen T, Sliz P, Teitell MA, Asara JM, Marto JA, Li H, Collins JJ, Daley GQ. LIN28 regulates stem cell metabolism and conversion to primed pluripotency. Cell Stem Cell. 2016;19:66–80. doi: 10.1016/j.stem.2016.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Zhang T, Xu J, Maire P, Xu PX. Six1 is essential for differentiation and patterning of the mammalian auditory sensory epithelium. PLOS Genetics. 2017;13:e1006967. doi: 10.1371/journal.pgen.1006967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhao L, Borikova AL, Ben-Yair R, Guner-Ataman B, MacRae CA, Lee RT, Burns CG, Burns CE. Notch signaling regulates cardiomyocyte proliferation during zebrafish heart regeneration. PNAS. 2014;111:1403–1408. doi: 10.1073/pnas.1311705111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zheng F, Zuo J. Cochlear hair cell regeneration after noise-induced hearing loss: does regeneration follow development? Hearing Research. 2017;349:182–196. doi: 10.1016/j.heares.2016.12.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Zhong C, Fu Y, Pan W, Yu J, Wang J. Atoh1 and other related key regulators in the development of auditory sensory epithelium in the mammalian inner ear: function and interplay. Developmental Biology. 2019;446:133–141. doi: 10.1016/j.ydbio.2018.12.025. [DOI] [PubMed] [Google Scholar]

Decision letter

Editor: Tanya T Whitfield1
Reviewed by: Shawn Burgess2

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This paper examines regeneration following hair cell damage in the developing zebrafish lateral line, a tractable model system for hearing loss. The authors use genetic and pharmacological approaches to demonstrate a role for a key signalling pathway in the recovery of lateral line hair cells following chemically-induced injury.

Decision letter after peer review:

[Editors’ note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]

Thank you for submitting your work entitled "Yap-lin28a axis reprograms committed hair cells to progenitors for initiating regeneration" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Shawn Burgess (Reviewer #3).

Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife.

The manuscript tackles the interesting topic of hair cell regeneration in the lateral line of the zebrafish, using an injury model to examine the role of a yap-lin28a pathway in regenerating cells. The reviewers have pointed out several strengths of the study, but also raise a number of concerns. It was felt that there would be significant additional work necessary to meet these concerns, and that some of the conclusions were overstated. The reviewers have a number of specific suggestions, and we hope these will be useful to you in moving the work forward. The full reviews are appended below.

Reviewer #1:

This study uses a novel injury model to deplete both hair cells and surrounding supporting cells in the larval zebrafish lateral line, allowing the researchers to more closely mimic the mature mammalian inner ear, which does not contain viable progenitor cells. The experiments overall are sound, and the team makes elegant use of several heat shock lines to temporally regulate gene expression during damage and regeneration. The primary findings are that the lateral line is capable of regeneration after a severe injury, and that this regeneration is dependent on the yap-lin28-let7-Wnt pathway, while this pathway is not required for regeneration if supporting cells are still intact. This finding is novel and exciting, as the authors have identified a pathway that is necessary for regeneration in the absence of progenitor cells.

1) The findings are clearly supported by the data, although I have a reservation about the conclusion that "yap directly binds lin28a promoter for transcriptional initiation." The authors convincingly show that yap can bind the lin28a promoter, and that lin28a is sufficient to induce regeneration, but not that yap binding of the lin28a promoter is necessary for the regenerative response.

2) My other concern is the conclusion that sox2+/atoh1a+ cells present after LY+neo treatment truly represent dedifferentiated cells. The images in Figure 5E show that a brn3c- cell expressing the atoh1a reporter dTomato can divide to produce two hair cells, even without a severe injury. These data suggest that atoh1a can label a subset of progenitor cells in the lateral line, even if these cells are sox2-. I agree that their LY+neo injury model increases the number of sox2+/atoh1a+ cells, but I am not fully convinced that these cells are dedifferentiated hair cells; they may be an intermediate progenitor cell or hair cell precursor. Similarly, I am not convinced that the cells expressing weak tubulin label in Figure 6 are dedifferentiated cells; these could be newly born hair cells, since EdU is retained following cell division. I do not think additional experiments are necessary, but rather suggest toning down the conclusions.

Reviewer #2:

This manuscript reports work done in zebrafish aimed at further clarifying the mechanism underlying hair-cell regeneration.

The authors report that atoh1a+ committed hair cells de-differentiate into sox2+ progenitors upon injury, which initiates regeneration through a yap-lin28a-let7-Wnt pathway. They claim that their findings "shed light on restoration of progenitors by dedifferentiation to initiate HC regeneration in mammals."

I do not share their persuasion, however.

Their data does not demonstrate hair-cell de-differentiation because atoh1a+ cells can be hair-cell progenitors that are constantly normally produced in neuromasts, or cells whose atoh1a expression is transitory and may not stabilise to eventually become progenitors or hair cells.

Therefore, I cannot support the publication of this work.

The authors claim that in a developing neuromast, atoh1a marks committed sensory hair cells. Yet, there is published data showing that this is not the case, as some non-sensory supporting cells express atoh1a.

Their sentence "powerful capacity to regenerate HCs sustains after multiple rounds of damage…" references Cruz et al., 2015. This in one of two concurrent papers showing regeneration after multiple rounds of hair-cell ablation. The second is Pinto-Teixeira et al., 2015, which should be cited as well.

They state that the above papers "indicates that a population of stem/progenitor cell pool exists to self-renew and regenerate." However, there is ample evidence that the entire supporting cell population is able to convert to a stem cell-like is necessary. In other words, a stem cell population as a persistent cellular state has not been demonstrated.

"Sox2 marks the proliferative progenitors that produce both SCs and HCs in homeostatic and regenerative NMs (21)."

This is true, but only because sox2 is expressed by nearly every non-sensory cell. Because sensory cells are postmitotic, their conclusion is obvious.

"These results indicate that sox2+ progenitors in neuromast have high potential to restore themselves when exhausted by severe injury."

Again, true and obvious because sox2 is expressed by nearly every non-sensory cell.

"These results indicate that intensive proliferation is necessary to facilitate regeneration post severe injury."

This has been shown by no less than 10 previous papers already.

Nuclear localized yap was inhibited when atoh1a is inhibited with hs:notch1a, which suggests that yap is activated in atoh1a+ committed HCs.

This is puzzling because hair cells are postmitotic. In addition, is nuclear localization of yap takes place in atoh1a+ cells and activated Notch blocks the production of these cells, it is only obvious that the authors will see no nuclear localized yap.

"Taken together, we found that yap is highly activated by severe injury and binds directly to lin28a promoter to initiate its transcription in atoh1a+ committed HCs."

I could not find direct evidence that yap binds lin28a promoter. It would help me if the authors pointing the data supporting the claim.

"We found that the regenerated HC number was decreased by lin28a deficiency (Figure 3A)."

What I see is that the entire neuromast was nearly half the size. Reduced hair-cell numbers may be an indirect consequence of lower proliferation, cellular extrusion or increased cell death.

"The proliferative SCs are localized in dorsal and ventral poles of neuromast in homeostasis and neo-induced regeneration"

They reference Romero-Carvajal et al., 2015. Yet, earlier reports of the patterns of supporting-cell proliferation are: Ma et al., 2008, and Wibowo et al., 2011.

"The atoh1a:dTomato reporter labeled a part of but not all ET4 positive mature HCs in normal condition, indicating that the reporter is very mosaic (Figure 5C, ctrl)."

An alternative interpretation, supported by findings of Wibowo et al., 2011, is that atoh1a:dTomato is expressed by supporting cells that may not advance to the hair-cell progenitor or hair-cell fates.

"However, more than half of the dTomato+ cells turned on sox2 expression at 12h and 48h post LY+neo and become dTomato+sox2+ cells (Figure 5D), suggesting that atoh1a+ cells were converted to sox2+ progenitors upon severe injury."

Again, because sox2 is expressed by nearly every non-sensory cell, it is not surprising that some cells will co-express atoh1a and sox2.

"However, it's only in LY+neo-induced severe injury that dTomato+ cells converted to sox2+ cells labeled by sox2:GFP (white dots in Figure 5F and Video 3), which confirms the dedifferentiation of atoh1a+ cells into sox2+ progenitors.”

This statement is not supported by evidence presented in the manuscript.

Reviewer #3:

Ye et al. have submitted a manuscript that describes the interplay between the expression of sox2, lin28a, and atoh1a in the context of a zebrafish regenerating lateral line neuromast. The authors show that under normal conditions, lin28a plays at best a minor role in regeneration, it is induced in a small number of cells but a genetic knockout of lin28a does not have a measurable effect on lateral line hair cell regeneration after ablation with neomycin. In contrast, when notch signaling is inhibited, lateral inhibition from hair cells is blocked and you see supernumerary hair cells at the expense of supporting cells, which are the normal source of new hair cells after ablation. Under these conditions, the authors show atoh1 positive cells will induce lin28a and revert to a more support cell-like identity. This phenomenon is mediated via yap signaling and downstream of lin28a let7 is blocked, triggering Wnt signaling. When the support cells are depleted by notch inhibition, now a lin28a KO has a significant negative effect on hair cell regeneration. In general this is a very carefully done set of experiments that identifies an interesting gene pathway that would be difficult to recognize under typical conditions used to study regeneration. I have one significant additional experiment I would like to see.

1) The hypothesis and the evidence point to lin28a triggering down-regulation of atoh1a and a return to a support cell fate. It should therefore be true that in the earlier developing larvae, if you induced lin28a expression ectopically, you should be able to inhibit natural differentiation of hair cells. Part of the model presented is that lin28a dedifferentiated cells contribute to new supporting cell populations too. Is it possible that the lin28a cells can only go "backwards" far enough to divide but not far enough to become support cells again? Under those circumstances the new support cells could come from the mantle cells which have been shown to be capable of fully regenerating all cell types in the neuromast. If it is really complete dedifferentiation, there should be more supporting cells in these larvae and not cells that are neither HC nor SC. It would be interesting if there could be lineage tracing of "dedifferentiated" atoh1+ cells. Can they actually become supporting cells?

[Editors’ note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Yap-lin28a axis targets let7-Wnt pathway to restore progenitors for initiating regeneration" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Kathryn Cheah as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Shawn Burgess (Reviewer #1).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Please aim to submit the revised version within two months, but we are happy to extend this timeframe if needed, given the current situation which may restrict experimental work time.

Summary:

In the present study, Zhian Ye and colleagues took advantage of the zebrafish lateral line to further dissect the mechanisms enabling the mechanosensory organs of some vertebrates to regenerated while other, including the mammalian inner ear cannot. The zebrafish lateral line presents two major advantages for this study: (i) the mechanosensory organs can almost entirely regenerate and (ii) severe damages can be perform suing chemical inhibitor treatments. Here the authors show that:

1) Sox2 positive progenitors can largely regenerate after being fully illuminated in so-called severe injury after a combination of treatment with a Notch inhibitor (to promote the differentiation of support cells into hair cells) and an antibiotic (to damage the hair cells).

2) The regenerating sox2-positive cells derive from atoh1a-positive, committed hair cells.

3) The Hippo signaling pathway effector yap is upregulated upon severe injury, is required for regeneration of sox2-positive cells and induces the expression of lin28a.

4) Lin28a is necessary and sufficient to induce the regeneration of sox2-positive progenitors.

5) Progenitor regeneration results from a yap1-Lin28a-Let7-sox2-Wnt axis.

Essential revisions:

1) Improve the Western blots to strengthen the data here. At the moment, the immunostainings are not clear, and the increase in yap1 is not clear on the Western blot. Indicate Molecular Weight on the blot.

2) Confirm the specificity of your antibodies by checking on yap1 mutants.

3) Confirm the specificity of the verteporfin inhibitor by comparing to the phenotype of yap1 mutants.

4) Please attend to all the listed minor revisions and, where possible, to any other major revisions, such as citation of additional studies in the Introduction (or provide a rebuttal of these points).

The full reviews are appended below for your information, in particular, please refer to the detailed comments from reviewer 2.

Reviewer #2:

The study reveals an interesting, new mechanism driving neuromast regeneration upon severe injury. While I think the study is potentially interesting for eLife readership, I feel some parts are not as solid as others, in particular the part on the role of yap1. Please see my specific comments below.

1) The Introduction is short and miss to refer to some important studies that have been published on similar questions including, for example, work from the Lopez-Shier lab (PintoTeixeira et al., 2015, ViaderLlargues et al., 2018, for example)

2) Using hs:notch1a to block Atoh1a function is not ideal. The authors should use atoh1a mutants which are available or Morpholino which have been published.

3) The authors should demonstrate the specificity of the yap1 and taz antibodies they are using by showing the absence of signal in respective mutants (available). These controls should be shown both for western-blot and immunostaining.

4) On the western-blot in Figure 2—figure supplement 2B, taz seems to be much more upregulated than yap1. Why do the authors then focus exclusively on yap1?

5) The yap signal and the difference between control and treated in Figure 4C and 4E are not convincing.

6) "The induction of yap and mst2 was blocked by verteporfin, an inhibitor of yap-mediated transcription by blocking yap-tead1 interaction": why are the expression of yap and mst2 blocked upon inhibition of yap-mediated transcription? Has it previously been shown that yap and mst2 are transcriptional targets of yap? The authors should look at classical yap/taz transcriptional targets.

7) Several yap and taz zebrafish mutants have been published. The authors should perform experiments in these mutants instead of – or in addition to – verteporfin experiments.

8) "We used CHIP-PCR to verify that yap binds to a region 100bp downstream of lin28a transcription start site". How did the author choose this region?

9) Figure 3A: does the Y-axis indicate EdU cell number (as indicated on the figure) or absolute numbers of HS, SC and MC (as the text suggests)?

10) "The EdU positive SC cells that were located in each quadrant with no polarization in sibling post LY+neo were almost cleared in lin28a mutant (Figure 3C-D)": The link to polarization all the sudden here is not clear.

11) Figure 3F: the authors should use yap mutants in addition to Verteporfin treatment.

eLife. 2020 Apr 30;9:e55771. doi: 10.7554/eLife.55771.sa2

Author response


[Editors’ note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors’ response to the first round of review.]

The manuscript tackles the interesting topic of hair cell regeneration in the lateral line of the zebrafish, using an injury model to examine the role of a yap-lin28a pathway in regenerating cells. The reviewers have pointed out several strengths of the study, but also raise a number of concerns. It was felt that there would be significant additional work necessary to meet these concerns, and that some of the conclusions were overstated. The reviewers have a number of specific suggestions, and we hope these will be useful to you in moving the work forward. The full reviews are appended below.

In response to the reviewers, we have added several important references, copyedited the text, toned down some of our conclusions. Based on suggestions of reviewer 1, I toned down our conclusions about dedifferentiation. I changed the title to “Yap-lin28a axis targets let7-Wnt pathway to restore progenitors for initiating regeneration”. Instead of drawing the conclusion that atoh1a+ HC precursors were dedifferentiated, we now changed it to that atoh1a+ HC precursors gained sox2 expression post severe injury. I have deleted all the data with acetylated tubulin (original Figure 6D-G) since a reference (Liu et al., 2018) I have just read showed that it labels not only HCs but also SCs. Therefore, it’s not appropriate to use acetylated-tubulin as a specific marker for HC to test the fate change. Based on suggestions of reviewer 3 I have changed the nomination of atoh1a+ cells from committed HCs into HC precursors since atoh1a expression is shut down in mature HCs.

To answer the reviewer’s questions, we have made new experiments and integrated the results to the updated figures.

1) As pointed by all reviewers, we have used atoh1a:dTomato reporter to trace dTomato expression in HCs, SCs and MCs in normal condition, post normal and severe injury. Our new data in updated Figure 5—figure supplement 1C-D showed that atoh1a label mostly HCs and a small number of SCs in normal and neo-treated larvae. Higher number of atoh1a+ SCs was detected in LY+neo compared with neo. More importantly, many MCs were also labeled with atoh1a post LY+neo, which was not detected in normal or neo. This piece of data suggests that atoh1a+ cells behaved like progenitor/stem cells that give rise to many support cell types post severe injury.

2) As suggested by reviewer 3, we have tested hs:lin28a for HC differentiation during development. Our results showed that lin28a expression has no effect on developing HC.

I believe that the quality of the revised version is highly improved thanks to the reviewers’ comments.

Reviewer #1:

[…]

1) The findings are clearly supported by the data, although I have a reservation about the conclusion that "yap directly binds lin28a promoter for transcriptional initiation." The authors convincingly show that yap can bind the lin28a promoter, and that lin28a is sufficient to induce regeneration, but not that yap binding of the lin28a promoter is necessary for the regenerative response.

Verteporfin is a specific inhibitor that blocks the transcriptional activity of yap by inhibiting yap and tead interaction. Our data in Figure 3F showed that verteporfin inhibited regenerative proliferation which mimicked the phenotype of lin28a mutant. This piece of data indicated that yap binding of the lin28a promoter is necessary for the regenerative response. We have also tested yap mutants for regeneration post severe injury. Unfortunately, they all died after adding EdU post LY+neo, possibly because of their weakness caused by vascular and heart defect.

2) My other concern is the conclusion that sox2+/atoh1a+ cells present after LY+neo treatment truly represent dedifferentiated cells. The images in Figure 5E show that a brn3c- cell expressing the atoh1a reporter dTomato can divide to produce two hair cells, even without a severe injury.

It’s known that the lateral line HCs are born in pairs from the terminal mitotic division of atoh1a+ HC precursors in development and post neo (Pinto-Teixeira et al., 2015). Based on reviewer 3’s suggestion, we have changed the nomination of atoh1a+ cells from committed HCs to HC precursors since mature HCs lose atoh1a RNA expression. Our data (blue dots in updated Figure 4—figure supplement 1A-B) are consistent with this conclusion by showing that one atoh1a+ precursor divided and became two brn3c+ HCs post neo.

These data suggest that atoh1a can label a subset of progenitor cells in the lateral line, even if these cells are sox2-. I agree that their LY+neo injury model increases the number of sox2+/atoh1a+ cells, but I am not fully convinced that these cells are dedifferentiated hair cells; they may be an intermediate progenitor cell or hair cell precursor.

Thank you to the reviewer for suggesting toning down the conclusions. Our new data in updated Figure 5—figure supplement 1C-D showed that atoh1a label mostly HCs and a small number of SCs in normal and neo-treated larvae. Higher number of atoh1a+ SCs was detected in LY+neo compared with neo. More importantly, many MCs were also labeled with atoh1a post LY+neo, which was not detected in normal or neo-treated conditions. This piece of data suggests that atoh1a+ cells behaved like progenitor/stem cells that give rise to many support cell types post severe injury. However, the lineage tracing experiment using cre/loxP system is necessary to confirm whether atoh1a+ cells are dedifferentiated or not.

Since we were not able to do this experiment because of technology reason, we have already toned down the conclusions in our manuscript. Now the dedifferentiation conclusion was changed to that atoh1a+ HC precursors gained sox2 expression post severe injury.

Similarly, I am not convinced that the cells expressing weak tubulin label in Figure 6 are dedifferentiated cells; these could be newly born hair cells, since EdU is retained following cell division. I do not think additional experiments are necessary, but rather suggest toning down the conclusions.

We have decided to delete all the data with acetylated tubulin since it’s not a specific marker for HC. A reference I have just read described that not only HCs but also SCs have acetylated tubulin expression in mouse inner ear (Liu et al., 2018, Eur J Histochem). Therefore, it’s not appropriate to use acetylated tubulin as a specific HC marker to test whether HCs were co-labeled with sox2 and EdU.

Reviewer #2:

This manuscript reports work done in zebrafish aimed at further clarifying the mechanism underlying hair-cell regeneration.

The authors report that atoh1a+ committed hair cells de-differentiate into sox2+ progenitors upon injury, which initiates regeneration through a yap-lin28a-let7-Wnt pathway. They claim that their findings "shed light on restoration of progenitors by dedifferentiation to initiate HC regeneration in mammals."

I do not share their persuasion, however.

Their data does not demonstrate hair-cell de-differentiation because atoh1a+ cells can be hair-cell progenitors that are constantly normally produced in neuromasts, or cells whose atoh1a expression is transitory and may not stabilise to eventually become progenitors or hair cells.

Therefore, I cannot support the publication of this work.

The authors claim that in a developing neuromast, atoh1a marks committed sensory hair cells. Yet, there is published data showing that this is not the case, as some non-sensory supporting cells express atoh1a.

I agree with the reviewer that non-sensory SCs express atoh1a to become HC precursors. Based on atoh1a in situ results (Figure 2C) 6.42%±0.68% SCs express atoh1a in 5dpf larvae. Based on our new analysis with atoh1a:dTomato reporter in Figure 5—figure supplement 1D, 2.44%±1.03% SCs have dTomato expression in normal condition. However, data in Figure 5—figure supplement 1C-D showed that the ratio of dTomato+ SCs significantly increased to 41.78%± 8.47% in LY+neo. In addition, many MCs (49.05%±11.32%), which never express dTomato in 5dpf larvae and neo, were labeled by dTomato in LY+neo. These data suggest that atoh1a+ cells were converted into multipotential progenitors in severe injury.

However, the lineage tracing experiment using cre/loxP system is necessary to confirm whether atoh1a+ cells are dedifferentiated or not. Since we were not able to do this experiment because of technology reason, we have already toned down our conclusions about dedifferentiation in our manuscript.

Their sentence "powerful capacity to regenerate HCs sustains after multiple rounds of damage…" references Cruz et al., 2015. This in one of two concurrent papers showing regeneration after multiple rounds of hair-cell ablation. The second is Pinto-Teixeira et al., 2015, which should be cited as well.

Thank the reviewer for the advice. We have added the other reference in the manuscript.

They state that the above papers "indicates that a population of stem/progenitor cell pool exists to self-renew and regenerate." However, there is ample evidence that the entire supporting cell population is able to convert to a stem cell-like is necessary. In other words, a stem cell population as a persistent cellular state has not been demonstrated.

The reviewer is correct that SCs are able to convert to a stem cell-like population in regeneration. Our results also indicate that atoh1a+ HC precursors gained sox2 expression to promote regeneration post severe injury. We have deleted the sentence in the text to avoid the confusion.

"Sox2 marks the proliferative progenitors that produce both SCs and HCs in homeostatic and regenerative NMs (21)."

This is true, but only because sox2 is expressed by nearly every non-sensory cell. Because sensory cells are postmitotic, their conclusion is obvious.

The reviewer is correct that most SCs have sox2 expression in normal injury. Counting results (Author response image 1) show that about 60% of SCs or MCs are sox2+ in 5dpf normal and neo-treated larvae.

Author response image 1. Some SCs and MCs in neuromast are negative with sox2 expression.

Author response image 1.

(A)ET4;ET20 Larvae were treated with neo and immediately collected for sox2 immunostaining. The white arrowheads pointed out SCs and MCs that were sox2 negative. (B) Total number of SCs or MCs and sox2+ ones were counted, and sox2+ ratios were calculated. About 60% of SCs or MCs express sox2.

"These results indicate that sox2+ progenitors in neuromast have high potential to restore themselves when exhausted by severe injury."

Again, true and obvious because sox2 is expressed by nearly every non-sensory cell.

I agree with the reviewer that most SCs have sox2 expression in normal injury. But the sox2 expression pattern has changed in our new severe-injury model. We found that very few sox2+ cells (2.83±0.61, LY+neo group, Author response image 2A, also in original Figure 1B) survived. But many atoh1a+ cells (11.8±0.78, LY+neo group in Author response image 2B, related with Figure 2C) were still alive and became the main population post severe injury (Figure 2C).

Author response image 2. Sox2+ progenitors were eliminated and atoh1a+ HC precursors dominated post severe injury.

Author response image 2.

(A) Larvae were treated with LY, neo or LY+neo and collected immediately after neo treatment for sox2 immunostaining. Sox2+ cell numbers were counted, and the results showed that very few sox2+ cells survived post LY+neo. (B) Larvae were treated with LY, neo or LY+neo and collected immediately after neo treatment for atoh1a RNA probe hybridization. Results showed that significantly higher number of atoh1a+ cells survived post LY+neo.

"These results indicate that intensive proliferation is necessary to facilitate regeneration post severe injury."

This has been shown by no less than 10 previous papers already.

All the published papers used neo-treated model to analyze proliferation post normal injury. We compared LY+neo versus neo for EdU incorporation, and found that proliferation in SCs or MCs is highly increased (Figure 1—figure supplement 2). Therefore, we draw the conclusion that intensive proliferation facilitates regeneration post severe injury. Our finding is novel since this is the first study testing proliferation post severe injury.

Nuclear localized yap was inhibited when atoh1a is inhibited with hs:notch1a, which suggests that yap is activated in atoh1a+ committed HCs.

This is puzzling because hair cells are postmitotic. In addition, is nuclear localization of yap takes place in atoh1a+ cells and activated Notch blocks the production of these cells, it is only obvious thet the authors will see no nuclear localized yap.

We have collected LY+neo-treated hs:notch1a larvae to check yap immunostaining. Our data (Figure 2F) showed that atoh1a+ cells were eliminated in hs:notch1a. And data in updated Figure 2—figure supplement 2E showed that nuclear-localized yap was inhibited in hs:notch1a. Therefore, we concluded that yap is activated in atoh1a+ cells post LY+neo.

"Taken together, we found that yap is highly activated by severe injury and binds directly to lin28a promoter to initiate its transcription in atoh1a+ committed HCs."

I could not find direct evidence that yap binds lin28a promoter. It would help me if the authors pointing the data supporting the claim.

In Figure 2H, we used yap-immunoprecipitated DNA extracts for PCR (CHIP-PCR) using primers against lin28a promoter. We added the location of PCR primers in the updated figure. Results showed that PCR product against lin28a promoter was detected post LY+neo but not in LY. This piece of data indicates that yap binds lin28a promoter post severe injury.

"We found that the regenerated HC number was decreased by lin28a deficiency (Figure 3A)."

What I see is that the entire neuromast was nearly half the size. Reduced hair-cell numbers may be an indirect consequence of lower proliferation, cellular extrusion or increased cell death.

Data in Figure 3A showed that HC number was decreased in lin28a mutant. The reviewer is correct that the HC decrease may be caused by loss of SC proliferation or other possible reasons. We didn’t do further analysis since we mainly focus on progenitor proliferation rather than HC production in this manuscript. But thank the reviewer for pointing out other possibilities which we will further analyze in the future.

"The proliferative SCs are localized in dorsal and ventral poles of neuromast in homeostasis and neo-induced regeneration"

They reference Romero-Carvajal et al., 2015. Yet, earlier reports of the patterns of supporting-cell proliferation are: Ma et al., 2008, and Wibowo et al., 2011.

Thank the reviewer for the suggestion. We have added the other two references in the manuscript.

"The atoh1a:dTomato reporter labeled a part of but not all ET4 positive mature HCs in normal condition, indicating that the reporter is very mosaic (Figure 5C, ctrl)."

An alternative interpretation, supported by findings of Wibowo et al., 2011, is that atoh1a:dTomato is expressed by supporting cells that may not advance to the hair-cell progenitor or hair-cell fates.

Thank you to the reviewer for this comment. I learned from the published paper by Wibowo et al., 2011 that young HCs are dTomato+ cells and mature HCs lose dTomato expression. Therefore, the mosaic expression of dTomato in HCs in Figure 5C may be caused by different states of HC maturity. We have changed the description accordingly in the manuscript.

We found a few dTomato+ SCs in normal and neo conditions (Figure 5—figure supplement 1) and the number is highly increased post LY+neo.

"However, more than half of the dTomato+ cells turned on sox2 expression at 12h and 48h post LY+neo and become dTomato+sox2+ cells (Figure 5D), suggesting that atoh1a+ cells were converted to sox2+ progenitors upon severe injury."

Again, because sox2 is expressed by nearly every non-sensory cell, it is not surprising that some cells will co-express atoh1a and sox2.

I agree with the reviewer that most SCs have sox2 expression in normal larvae. Atoh1 is expressed in differentiating HC precursors and our data showed that very few dTomato+sox2+ cells existed in normal neuromast (updated Figure 5A-D). In accordance, several publications showed that atoh1 and sox2 is antagonistic in development (Dabdoub et al., 2008, Zhang et al., 2017). But the number of dTomato+sox2+ cells was highly increased post LY+neo, indicating that atoh1a+ cells gained sox2 expression in severe injury.

"However, it's only in LY+neo-induced severe injury that dTomato+ cells converted to sox2+ cells labeled by sox2:GFP (white dots in Figure 5F and Video 3), which confirms the dedifferentiation of atoh1a+ cells into sox2+ progenitors. „

This statement is not supported by evidence presented in the manuscript.

Our data in updated Figure 5—figure supplement 1B and Video 3 showed that the two blue-dotted dTomato+ cells were GFP negative in the beginning, and divided into four daughter cells which gained GFP expression. We have changed the conclusion about dedifferentiation to that atoh1a+ cells gained sox2 expression in severe injury. Thank the reviewer for pointing out this concern.

Reviewer #3:

[…]

1) The hypothesis and the evidence point to lin28a triggering down-regulation of atoh1a and a return to a support cell fate. It should therefore be true that in the earlier developing larvae, if you induced lin28a expression ectopically, you should be able to inhibit natural differentiation of hair cells.

Thank you to the reviewer for the suggestion. To address the question whether lin28a affect early differentiation, we have analyzed 3dpf and 5dpf hs:lin28a larvae for HC counting. The results (updated Figure 4—figure supplement 1) showed that lin28a has no effect on HC differentiation during development. Our data in Figure 3 and Figure 4 also indicate that lin28a has no effect on HC differentiation (HC+, EdU incorporated HCs). And data in updated Figure 6—figure supplement 1 showed that differentiation related gene her4 was not changed in hs:lin28a. All these data indicate that lin28a has no effect on differentiation in either development or regeneration. It could be possible that new atoh1a+ HC precursors are produced when lin28a inhibits the differentiation of old atoh1a+ cells.

Part of the model presented is that lin28a dedifferentiated cells contribute to new supporting cell populations too. Is it possible that the lin28a cells can only go "backwards" far enough to divide but not far enough to become support cells again? Under those circumstances the new support cells could come from the mantle cells which have been shown to be capable of fully regenerating all cell types in the neuromast. If it is really complete dedifferentiation, there should be more supporting cells in these larvae and not cells that are neither HC nor SC. It would be interesting if there could be lineage tracing of "dedifferentiated" atoh1+ cells. Can they actually become supporting cells?

Our new data in updated Figure 5—figure supplement 1C-D showed that atoh1a label mostly HCs and a small number of SCs in normal and neo-treated larvae. Higher number of atoh1a+ SCs was detected in LY+neo compared with neo. More importantly, many MCs were also labeled with atoh1a post LY+neo, which was not detected in normal or neo-treated conditions. This piece of data suggests that atoh1a+ cells behaved like progenitor/stem cells that give rise to many support cell types post severe injury. However, the lineage tracing experiment using cre/loxP system is necessary to confirm whether atoh1a+ cells are dedifferentiated or not. Since we were not able to do this experiment because of technology reason, we have already toned down the conclusions in our manuscript. Now the dedifferentiation conclusion was changed to that atoh1a+ HC precursors gained sox2 expression post severe injury.

[Editors’ note: what follows is the authors’ response to the second round of review.]

Essential revisions:

1) Improve the Western blots to strengthen the data here. At the moment, the immunostainings are not clear, and the increase in yap1 is not clear on the Western blot. Indicate Molecular Weight on the blot.

2) Confirm the specificity of your antibodies by checking on yap1 mutants.

3) Confirm the specificity of the Verteporfin inhibitor by comparing to the phenotype of yap1 mutants.

4) Please attend to all the listed minor revisions and, where possible, to any other major revisions, such as citation of additional studies in the Introduction (or provide a rebuttal of these points).

Thank you for providing us the opportunity for revision. We also appreciate the time and effort of the two reviewers. Based on the reviewers’ valuable comments we have performed a series of new experiments that were briefly summarized below.

1) We have optimized the western-blot conditions to detect yap expression post severe injury. The new results clearly showed that yap is upregulated at 1h and 5h post LY+neo.

2) We have used yap mutants to check the specificity of yap antibody by western-blot and immunostaining. The results showed that the yap antibody is very specific for detecting yap protein in siblings but not yap mutants.

3) We have used yap mutants to confirm that yap is required for the severe-injury-induced regeneration.

4) We also provided evidence that the classic target genes of yap such as cyr61 and ctgfa are upregulated post severe injury, which is inhibited by verteporfin.

Reviewer #2:

The study reveals an interesting, new mechanism driving neuromast regeneration upon severe injury. While I think the study is potentially interesting for eLife readership, I feel some parts are not as solid as others, in particular the part on the role of yap1. Please see my specific comments below.

1) The Introduction is short and miss to refer to some important studies that have been published on similar questions including, for example, work from the Lopez-Shier lab (PintoTeixeira et al., 2015, ViaderLlargues et al., 2018, for example)

Thanks to the reviewer for the nice suggestion. We have previously included PintoTeixeira et al., 2015 in the Introduction. Now we added ViaderLlargues et al., 2018 in the Introduction as an important reference for the high potential of SCs to regenerate after severe damage.

2) Using hs:notch1a to block Atoh1a function is not ideal. The authors should use atoh1a mutants which are available or Morpholino which have been published.

In Figure 2F we found that LY+neo-induced lin28a is decreased in hs:notch1a. I agree with the reviewer that atoh1a mutants or atoh1a morpholino is more specific to block atoh1a function than hs:notch1a. However, HCs are absent in atoh1a mutants or morphants, which makes it impossible to cause severe damage by combined treatment of LY and neomycin. In order to induce severe damage, we have to use hs:notch1a to transiently block atoh1a expression without affecting hair cell development.

The aim of this experiment is to check whether lin28a is induced in atoh1a expressing cells. In addition to this piece of data, we observed that lin28a induction is increased in hs:atoh1a and lin28a is co-labeled with atoh1a post severe injury. All these evidences clearly indicate that lin28a is induced in atoh1a+ cells post severe injury.

3) The authors should demonstrate the specificity of the yap1 and taz antibodies they are using by showing the absence of signal in respective mutants (available). These controls should be shown both for western-blot and immunostaining.

Our new results in updated Figure 2—figure supplement 2F showed that yap antibody had good immunostaining signal in LY+neo-treated neuromast, which was lack in yap mutants. Western-blot results in Figure 2—figure supplement 2C have detected the yap band in siblings but not in yap mutants. These results indicate that yap antibody is specific in recognizing yap protein.

4) On the western-blot in Figure 2—figure supplement 1B, taz seems to be much more upregulated than yap1. Why do the authors then focus exclusively on yap1?

We have optimized the western-blot conditions with yap antibody and updated the Figure 2—figure supplement 2B results. We found that yap protein level was upregulated at 1h and 5h post LY+neo while taz was upregulated until 5h. In addition, yap but not taz was detected in neuromast by immunostaining at 1h post LY+neo (updated Figure 2—figure supplement 2D-G and data not shown). Based on these results, yap is activated earlier than taz post severe injury and might be responsible for regeneration. Indeed, we found that the regenerative proliferation and lin28a induction were blocked in yap mutants (Figure 3F and 2J). All these indicate that yap activation is required for severe-injury-induced regeneration.

5) The yap signal and the difference between control and treated in Figure 4C and 4E are not convincing.

I assume the reviewer referred to Figure 2—figure supplement 2C and E in the original figures which were now updated as Figure 2—figure supplement 2D and Figure 2—figure supplement 2G. We have proved the specificity of yap antibody by using yap mutants in the updated Figures (details in major point 3). The signal of yap immunostaining seemed localized in both nucleus and cytoplasm of neuromast cells, possibly because yap shuttles between nuclei and cytoplasm. We also noticed that the injury induced yap expression not only in neuromast but also in surrounding skin and muscle. Only yap expressing cells within the neuromasts were chosen and divided by total cell number to calculate the ratio. The ratio of yap expression was significantly increased post LY+neo, which was inhibited in hs:notch1a.

6) "The induction of yap and mst2 was blocked by verteporfin, an inhibitor of yap-mediated transcription by blocking yap-tead1 interaction": why are the expression of yap and mst2 blocked upon inhibition of yap-mediated transcription? Has it previously been shown that yap and mst2 are transcriptional targets of yap? The authors should look at classical yap/taz transcriptional targets.

Thanks to the reviewer for the suggestion. We have tested the classic yap transcriptional target genes cyr61 and ctgfa post severe injury by real time PCR. Results in updated Figure 2—figure supplement 2H indicated that expression levels of cyp61 and ctgfa were increased post severe injury, which was inhibited by verteporfin. This indicates that yap activity is activated post severe injury. Our results in updated Figure 2—figure supplement 2I suggested that yap probably upregulated expressions of itself and mst2 to create a positive feedback loop.

7) Several yap and taz zebrafish mutants have been published. The authors should perform experiments in these mutants instead of – or in addition to – Verteporfin experiments.

Thanks to the reviewer for the suggestion. We have tested regenerative proliferation in yap mutants. The proliferation was significantly decreased in yap mutants (updated Figure 3F), which resembled the phenotype of verteporfin treatment (updated Figure 3G).

8) "We used CHIP-PCR to verify that yap binds to a region 100bp downstream of lin28a transcription start site". How did the author choose this region?

We used the promoter region of lin28a to search for the conserved yap binding motif by sequence similarity. There is a yap binding motif located at 100bp downstream of lin28a transcription start site, where a tead1 binding motif is located nearby. This suggested that yap might cooperate with tead1 to activate lin28a transcription. We verified the binding of yap to this region by CHIP-PCR (Figure 2H).

9) Figure 3A: does the Y-axis indicate EdU cell number (as indicated on the figure) or absolute numbers of HS, SC and MC (as the text suggests)?

Thanks to the reviewer for pointing out this typo. It should be the absolute number of HC, SC and MC, and we changed the Y-axis label accordingly.

10) "The EdU positive SC cells that were located in each quadrant with no polarization in sibling post LY+neo were almost cleared in lin28a mutant (Figure 3C-D)": The link to polarization all the sudden here is not clear.

Results in Figure 3D showed that the EdU+ proliferative cells post LY+neo is not polarized since the statistical analysis is not significant (N.S. at the bottom). Therefore the severe-injury-induced proliferation is not polarized, which is unlike the dorsal-ventral localization of EdU+ cells post neo (Figure 4C and 4D).

11) Figure 3F: the authors should use yap mutants in addition to Verteporfin treatment.

We have analyzed yap mutants for LY+neo-induced regeneration and added to updated Figure 3F. Please refer to point 7 for details.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Transparent reporting form

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES