Skip to main content
microPublication Biology logoLink to microPublication Biology
. 2020 Apr 6;2020:10.17912/micropub.biology.000234. doi: 10.17912/micropub.biology.000234

Loss of proteasome subunit RPN-12 causes an increased mean lifespan at a higher temperature in C. elegans

Lourds Fernando 1, Victoria Nguyen 1, Tyler Hansen 2,3, Andy Golden 2, Anna Allen 1,§
Reviewed by: Anonymous
PMCID: PMC7252339  PMID: 32550497

Figure 1.

Figure 1

rpn-12(av93) mutant lifespan comparison to wild type at 20°C and 25°C. (A) Schematic of the rpn-12 gene showing the 952bp deleted region made via CRISPR/Cas9 genome editing. Exons are numbered 1-5 (external primer regions shown in black arrows and internal primer regions shown in grey arrows). Agarose gel image showing PCR amplification of the rpn-12 gene in wild type (Lanes A and C) and rpn-12(av93) (Lanes B and D) animals using external primers (Lanes A and B) or internal primers (Lanes C and D). (B) Lifespan analysis of the rpn-12(av93) mutants compared to wild type at 20°C and 25°C (single trials). Lifespan was determined by assaying percent survival of the hermaphrodites from the L4 stage in age synchronized larvae for wild type (n=71 at 20°C and n=92 at 25°C, shown in blue lines) and rpn-12(av93) mutants (n=76 at 20°C and n=41 at 25°C, shown in green lines). There was no significant difference between the lifespans of wild type and mutant animals at 20°C (p value 0.6163). There was a significant difference in the mean lifespans of wild type and mutant animals at 25°C (p value 0.0001). Log-Rank statistical test to determine mean lifespan and Mann Whitney U test to determine maximum lifespan was performed using OASIS2 software (Han et al., 2016). Lost animals were not included in the statistical analysis.

Description

The 26S proteasome is one of the major proteolytic machineries in cells and is composed of nearly 33 different subunits (Budenholzer et al., 2017; Chen et al., 2008; Papaevgeniou and Chondrogianni, 2014). The subunits are arranged as one or two 19S regulatory particle(s) capping a cylindrical catalytic 20S core particle (Budenholzer et al., 2017). Each subunit is highly conserved from yeast to mammals, and proper function of the proteasome is crucial for survival of organisms (Papaevgeniou and Chondrogianni, 2014). Spatiotemporal expression of specific subunits and their roles in regulating the proteasome activity is still not clearly understood.

RPN-12 is a subunit of the 19S regulatory particle (RP) of the 26S proteasome in Caenorhabditis elegans (Boehringer et al., 2012; Takahashi et al., 2002). In C. elegans, loss or down regulation of a single proteasome subunit causes embryonic lethality, with the exception of three of the 19S RP subunits: RPN-10, RPN-12, and DSS-1 (Keith et al., 2016; Pispa et al., 2008; Shimada et al., 2006; Takahashi et al., 2002). While the roles of RPN-10 and DSS-1 were previously studied, more detailed investigation into the function of RPN-12 has not been performed. A heterozygous mutant containing a 952bp deletion of the coding region of rpn-12 was generated [rpn-12(av93)] using CRISPR/Cas9 genome editing technology. The heterozygous rpn-12 null mutant was then homozygosed and determined to be homozygous viable with apparent fertility issues. Only 36% of the rpn-12(av93) hermaphrodites produced progeny due to sperm production defects (this phenotype will be published elsewhere). Since efficient proteasome activity is important for the longevity of most organisms, we wanted to investigate whether rpn-12(av93) mutants may have an altered lifespan compared to wild type animals (Saez and Vilchez, 2014; Vilchez et al., 2012). To determine whether the lifespan of rpn-12(av93) mutant animals was affected, lifespan assays were conducted at 20°C and 25°C. The mean lifespan of rpn-12(av93) hermaphrodites (15.94 days) was not significantly different from wild type hermaphrodites (15.54 days) at 20°C. Interestingly, at 25°C the mean lifespan of rpn-12(av93) hermaphrodites (15.59 days) was increased compared to wild type animals (12.80 days). However, the maximum lifespan of both rpn-12(av93) and wild type hermaphrodites was not significantly different at 25°C. The lifespan analysis at 20°C was performed three times (cumulative wild type n=240 and mutant n=192) and at 25°C was performed twice (cumulative wild type n=185 and mutant n=135). Our data suggests that RPN-12 is not essential for viability and lifespan of C. elegans under normal conditions (20ºC), but that absence of RPN-12 can result in a significant increase in mean lifespan under heat stress (25ºC).

Methods

The rpn-12(av93) AG343 strain was generated via CRISPR/Cas9 genome editing technology following the direct delivery method developed by the Seydoux laboratory (Paix et al., 2017). Two crRNAs (5’- agccagaagatttttatggg – 3’and 5’- actcgaacaaatcgtttaac – 3’) were used to guide the Cas9 to make cuts at specific regions of either ends of the rpn-12 gene. An ssODN (5’-aaacattattggatttaagaaaatgtctgccgcccaaccggtgtctttcaagaactcaagcattgtattt-3’) was delivered as a template for the repair that results in a 952bp deletion that removes most of the first exon and then the entire second to last exons. Screening was performed using the co-conversion dpy-10 method (Arribere et al., 2014). Two independent strains of the rpn-12 deletion were generated [rpn-12(av93) AG343 and rpn-12(ana10) WDC10] through the previously described method, and each strain outcrossed five times before experiments conducted. Both strains showed similar viability and fertility phenotypes, however only rpn-12(av93) was used for the lifespan experiments. Lifespan assays were conducted by placing age synchronized L4 larvae of rpn-12(av93) and wild type animals on MYOB plates seeded with OP50 (10-20 worms per plate). The worms were then passaged to new MYOB plates every two days. The number of dead hermaphrodites was scored every two days until all worms were dead and the percentage of surviving animals calculated. Missing worms were excluded from the statistical analysis.

Reagents

AG343 rpn-12(av93)

WDC10 rpn-12(ana10)

Acknowledgments

Funding

This work was supported, in part, by a grant W911NF-18-1-0465 from the Department of Defense to A.K.A. (V.N., L.M.F. and A.K.A.) and by the Intramural Research Program of the National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases (T.J.H. and A.G.).

References

  1. Arribere JA, Bell RT, Fu BX, Artiles KL, Hartman PS, Fire AZ. Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26;198(3):837–846. doi: 10.1534/genetics.114.169730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Boehringer J, Riedinger C, Paraskevopoulos K, Johnson EO, Lowe ED, Khoudian C, Smith D, Noble ME, Gordon C, Endicott JA. Structural and functional characterization of Rpn12 identifies residues required for Rpn10 proteasome incorporation. Biochem J. 2012 Nov 15;448(1):55–65. doi: 10.1042/BJ20120542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Budenholzer L, Cheng CL, Li Y, Hochstrasser M. Proteasome Structure and Assembly. J Mol Biol. 2017 Jun 01;429(22):3500–3524. doi: 10.1016/j.jmb.2017.05.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Chen C, Huang C, Chen S, Liang J, Lin W, Ke G, Zhang H, Wang B, Huang J, Han Z, Ma L, Huo K, Yang X, Yang P, He F, Tao T. Subunit-subunit interactions in the human 26S proteasome. Proteomics. 2008 Feb 01;8(3):508–520. doi: 10.1002/pmic.200700588. [DOI] [PubMed] [Google Scholar]
  5. Han SK, Lee D, Lee H, Kim D, Son HG, Yang JS, Lee SV, Kim S. OASIS 2: online application for survival analysis 2 with features for the analysis of maximal lifespan and healthspan in aging research. Oncotarget. 2016 Aug 30;7(35):56147–56152. doi: 10.18632/oncotarget.11269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Keith SA, Maddux SK, Zhong Y, Chinchankar MN, Ferguson AA, Ghazi A, Fisher AL. Graded Proteasome Dysfunction in Caenorhabditis elegans Activates an Adaptive Response Involving the Conserved SKN-1 and ELT-2 Transcription Factors and the Autophagy-Lysosome Pathway. PLoS Genet. 2016 Feb 01;12(2):e1005823–e1005823. doi: 10.1371/journal.pgen.1005823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Paix A, Folkmann A, Seydoux G. Precision genome editing using CRISPR-Cas9 and linear repair templates in C. elegans. Methods. 2017 Apr 01;121-122:86–93. doi: 10.1016/j.ymeth.2017.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Papaevgeniou N, Chondrogianni N. The ubiquitin proteasome system in Caenorhabditis elegans and its regulation. Redox Biol. 2014 Jan 18;2:333–347. doi: 10.1016/j.redox.2014.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Pispa J, Palmén S, Holmberg CI, Jäntti J. C. elegans dss-1 is functionally conserved and required for oogenesis and larval growth. BMC Dev Biol. 2008 May 01;8:51–51. doi: 10.1186/1471-213X-8-51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Saez I, Vilchez D. The Mechanistic Links Between Proteasome Activity, Aging and Age-related Diseases. Curr Genomics. 2014 Feb 01;15(1):38–51. doi: 10.2174/138920291501140306113344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Shimada M, Kanematsu K, Tanaka K, Yokosawa H, Kawahara H. Proteasomal ubiquitin receptor RPN-10 controls sex determination in Caenorhabditis elegans. Mol Biol Cell. 2006 Oct 18;17(12):5356–5371. doi: 10.1091/mbc.e06-05-0437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Takahashi M, Iwasaki H, Inoue H, Takahashi K. Reverse genetic analysis of the Caenorhabditis elegans 26S proteasome subunits by RNA interference. Biol Chem. 1970 Jan 01;383(7-8):1263–1266. doi: 10.1515/BC.2002.140. [DOI] [PubMed] [Google Scholar]
  13. Vilchez D, Morantte I, Liu Z, Douglas PM, Merkwirth C, Rodrigues AP, Manning G, Dillin A. RPN-6 determines C. elegans longevity under proteotoxic stress conditions. Nature. 2012 Sep 13;489(7415):263–268. doi: 10.1038/nature11315. [DOI] [PubMed] [Google Scholar]

Articles from microPublication Biology are provided here courtesy of California Institute of Technology

RESOURCES