Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2020 May 27;202(12):e00056-20. doi: 10.1128/JB.00056-20

Pyridoxal Reductase, PdxI, Is Critical for Salvage of Pyridoxal in Escherichia coli

Tomokazu Ito a,b,, Diana M Downs a
Editor: William W Metcalfc
PMCID: PMC7253606  PMID: 32253339

The biosynthetic pathway of pyridoxal 5′-phosphate (PLP) has extensively been studied in Escherichia coli, yet limited information is available about the vitamin B6 salvage pathway. We show that the protein PdxI (YdbC) is the primary pyridoxal (PL) reductase in E. coli and is involved in the salvage of PL. The orthologs of PdxI occur in a wide range of bacteria and plants, suggesting that PL reductase in the B6 salvage pathway is more widely distributed than previously expected.

KEYWORDS: Escherichia coli, pyridoxal phosphate, pyridoxal reductase, pyridoxal salvage, pyridoxine, vitamin B6

ABSTRACT

Pyridoxal 5′-phosphate (PLP) is the biologically active form of vitamin B6 and an essential cofactor in all organisms. In Escherichia coli, PLP is synthesized via the deoxyxylulose 5-phosphate (DXP)-dependent pathway that includes seven enzymatic steps and generates pyridoxine 5′-phosphate as an intermediate. Additionally, E. coli is able to salvage pyridoxal, pyridoxine, and pyridoxamine B6 vitamers to produce PLP using kinases PdxK/PdxY and pyridox(am)ine phosphate oxidase (PdxH). We found that E. coli strains blocked in PLP synthesis prior to the formation of pyridoxine 5′-phosphate (PNP) required significantly less exogenous pyridoxal (PL) than strains lacking pdxH and identified the conversion of PL to pyridoxine (PN) during cultivation to be the cause. Our data showed that PdxI, shown to have PL reductase activity in vitro, was required for the efficient salvage of PL in E. coli. The pdxI+ E. coli strains converted exogenous PL to PN during growth, while pdxI mutants did not. In total, the data herein demonstrated that PdxI is a critical enzyme in the salvage of PL by E. coli.

IMPORTANCE The biosynthetic pathway of pyridoxal 5′-phosphate (PLP) has extensively been studied in Escherichia coli, yet limited information is available about the vitamin B6 salvage pathway. We show that the protein PdxI (YdbC) is the primary pyridoxal (PL) reductase in E. coli and is involved in the salvage of PL. The orthologs of PdxI occur in a wide range of bacteria and plants, suggesting that PL reductase in the B6 salvage pathway is more widely distributed than previously expected.

INTRODUCTION

Pyridoxal 5′-phosphate (PLP) is the biologically active form of vitamin B6 that is used as a cofactor in various enzymes. PLP-dependent enzymes catalyze diverse biochemical reactions, including transamination, racemization, decarboxylation, and α,β-elimination or replacement of chemical groups at Cβ or Cγ involving amino acid, sugar, and lipid metabolisms (1, 2). Most bacteria harbor several MocR/GabR-type PLP-binding transcriptional regulators to modulate amino acid and/or vitamin B6 metabolisms (36).

Two distinct pathways for PLP biosynthesis, deoxyxylulose 5-phosphate (DXP)-dependent and DXP-independent pathways, have been reported. In Escherichia coli and a few members of the proteobacteria, PLP is synthesized via the DXP-dependent pathway that includes seven reaction steps catalyzed by seven enzymes (GapB, PdxB, SerC, PdxA, DXS, PdxJ, and PdxH) from erythrose 4-phosphate, glyceraldehyde 3-phosphate, and pyruvate (7, 8). In this pathway, the pyridine ring is formed by the action of the pyridoxine 5′-phosphate synthase (PdxJ), which catalyzes the condensation of DXP with 3-hydroxy-1-aminoacetone phosphate to form pyridoxine 5′-phosphate (PNP) (9) (Fig. 1). PNP is oxidized by a flavin mononucleotide (FMN)-dependent enzyme pyridoxine/pyridoxamine 5′-phosphate oxidase (PdxH) to form PLP (10). PdxH can also oxidize pyridoxamine 5′-phosphate (PMP) to produce PLP.

FIG 1.

FIG 1

Vitamin B6 salvage pathway in E. coli. Biosynthesis of PLP via the DXP-dependent pathway and salvage of B6 vitamers are schematically shown. Pyridoxine 5′-phosphate synthase (PdxJ) catalyzes the condensation of DXP with 3-hydroxy-1-aminoacetone phosphate to form pyridoxine 5′-phosphate (PNP) in de novo synthesis. PLP can be formed from PNP or PMP by pyridoxine/pyridoxamine 5′-phosphate oxidase (PdxH). PdxK can phosphorylate the three B6 vitamers, pyridoxine (PN), pyridoxamine (PM), and pyridoxal (PL), allowing PLP to be salvaged from the environment by the routes depicted. PdxY contributes to the phosphorylation of PL only. In addition, amino acid transaminases convert PMP to PLP and vice versa during their catalytic cycle. Some phosphatases, including YbhA and PhoA, can dephosphorylate PLP. There is currently little information about the bacterial vitamin B6 transporter(s). This study demonstrated that PdxI contributes to PL salvage and catalyzes the irreversible conversion of PL to PN under physiological conditions. Known or identified pathways are shown in solid arrows. Broken arrows indicate unidentified/missing pathways.

E. coli can convert various forms of B6 vitamers to PLP using the salvage pathway (11). Our current understanding of the salvage pathway in E. coli is summarized in Fig. 1. Unlike the biosynthetic pathway, details of the salvage pathway have not been fully elucidated. Two kinases, PdxK and PdxY, can phosphorylate the 5′ position of the B6 vitamers (12, 13). PdxK is capable of phosphorylating all three B6 vitamers, pyridoxine (PN), pyridoxamine (PM), and pyridoxal (PL), whereas PdxY phosphorylates only PL (13). Various amino acid transaminases are capable of converting PMP to PLP and vice versa via their reaction mechanism. Some phosphatases, including YbhA and PhoA, are capable of dephosphorylating PLP and/or PNP in vivo and in vitro (14, 15).

During the study of the biosynthesis, homeostasis, and metabolic network of vitamin B6 in Escherichia coli and Salmonella enterica (1618), we found that E. coli strains lacking pdxJ had different PL requirements than those lacking pdxH. This result was unexpected given that both lesions abolish PLP biosynthesis. The pdxH mutant required 10 times more PL than the pdxJ mutant to reach an optimal growth yield. This study was initiated to determine the cause of this difference. The data herein show that the protein YdbC (PdxI), reported to catalyze PL reductase activity in vitro (19), was primarily responsible for the differences of PL requirement observed and is a component of PL salvage in E. coli.

RESULTS AND DISCUSSION

Elimination of pdxH increases PL requirement in E. coli.

The ability of exogenous pyridoxal (PL) to allow growth of strains of E. coli blocked in the synthesis of PLP has been attributed to the PL kinase activity of PdxK/PdxY (Fig. 1). In the course of other work, it was noted that pdxJ and pdxH mutants, both of which cannot synthesize PLP de novo, required different concentrations of PL for growth in an M9-glucose medium. The pdxJ-deficient strain grew with a rate and reached a final density similar to those of a wild-type strain (Fig. 2A) when 0.1 μM PL was provided (1-h doubling time) (Fig. 2B). In contrast, the pdxH mutant required 1 μM of PL to achieve an optimal growth yield (1-h doubling time) (Fig. 2C). The final yield, but not the growth rate, of the pdxH mutant was affected by the concentration of PL. This result suggested that PL was limiting and was not simply being poorly utilized. Eliminating PdxJ or PdxH blocked PLP formation, though the pdxH mutant accumulated PNP due to flux through the PdxJ-dependent pathway (Fig. 1). A pdxJ pdxH double mutant exhibited slower growth than either the pdxJ or pdxH single mutant (1.5-h doubling time) but had a growth pattern most similar to that of the pdxH mutant strain, requiring >10-fold more exogenous PL than the pdxJ mutant (Fig. 2D). These data supported the conclusion that flux through the PLP biosynthetic pathway did not contribute to the increased PL requirement of the pdxH mutant.

FIG 2.

FIG 2

PL requirement of E. coli pdxJ, pdxH, or pdxJ pdxH mutants. (A to D) Wild-type (A) and pdxJ (B), pdxH (C), or pdxJ pdxH (D) mutant strains of E. coli were grown in M9-glucose medium in the absence (○) or presence of PL at 0.1 μM (■), 0.25 μM (●), or 1 μM (△). (E and F) pdxJ (E) and pdxJ pdxH (F) mutants of S. enterica were grown in NCE glucose medium in the absence (○) or presence of 0.1 μM (■) or 1 μM (△) PL. The data represent the averages from triplicate experiments. Cell growth was recorded by the OD-Monitor C&T apparatus (A to D) or the ELx808 (E and F) using a 96-well plate.

The above-described data were not anticipated based on the described salvage pathway for B6 vitamers in E. coli. In contrast, Salmonella enterica displayed a result closer to what was expected based on the described salvage enzymes. Strains lacking pdxJ or pdxH had a growth response to 0.1 μM of PL that was more similar to the full-growth allowed by 1 μM in no-carbon essential (NCE) minimal medium (Fig. 2E and F).

E. coli pdxJ pdxH mutant converts exogenous PL to PN and accumulates PNP.

Based on the kinases implicated in the salvage pathway, PdxK and PdxY, the PLP requirement of a pdxJ mutant should be satisfied with PL, PN, or PM (Fig. 1). This expectation was confirmed by growth analyses with 0.1 μM of each B6 vitamer (data not shown). In contrast, a pdxH mutant is not expected to utilize exogenous PN or efficiently convert PM to PLP and is likely to accumulate PNP synthesized through the DXP-dependent pathway (Fig. 1). Thus, a difference in the requirement for PL in the pdxJ and pdxH mutants was not predicted a priori. High-performance liquid chromatography (HPLC) analyses of the growth medium showed the disappearance of PL from the medium during the growth of a pdxJ pdxH mutant. As shown in Fig. 3A, the M9 growth medium of the pdxJ pdxH mutant, which contained 5 μM PL at time zero (T = 0), had only PN (∼4.5 μM) after 24 h of cell growth. PL was also absent in the medium after growth of the wild type (Fig. 3B) or the pdxH mutant strain (data not shown) and was seemingly replaced by the PN that accumulated. When cells were removed from the culture medium after 6 h of cultivation (by centrifugation and following filtration with a 0.45-μm filter membrane), no further conversion of PL to PN was observed, indicating that the conversion of PL to PN was mediated by E. coli cells (data not shown). The intracellular pools of B6 vitamers were analyzed in the pdxJ pdxH double mutant after growth in M9-glucose medium in the presence of 5 μM PL. Despite the block in synthesis and the lack of a known pathway from PL to PNP, a significant amount of PNP accumulated in the cells (Fig. 3C, bottom trace). Consistent with the growth results described above, when an S. enterica pdxJ pdxH double mutant strain was grown under similar conditions, PN did not appear in the medium and PNP did not accumulate in the cells (data not shown). These data suggested that E. coli had a mechanism(s) to convert PL→PN and/or PLP→PNP that is both internal and not present in S. enterica. The pdxH mutation abolishes the utilization of PN and PNP as a PLP source in E. coli (Fig. 1). If PL were partially converted to PN or PNP during growth, it could explain the increased PL requirement observed with the pdxH or pdxJ pdxH mutant of E. coli, and PL availability would be decreased (Fig. 1).

FIG 3.

FIG 3

A pdxI mutation prevents conversion of extracellular PL to PN and intracellular accumulation of PNP. The pdxJ pdxH and pdxI pdxJ pdxH mutant strains of E. coli were grown in M9-glucose medium supplemented with 5 μM PL. The culture supernatant was collected at different time points (0, 6, or 24 h). Internal pool concentrations of B6 vitamers were determined with cells collected at early stationary phase (OD600 of 0.7) as described in Materials and Methods. The pdxJ pdxH double mutant converted all of the extracellular PL to PN during its cultivation (A, left) and accumulated PNP in the cells (C, bottom trace). The pdxI mutation significantly decreased the conversion of exogenous PL to PN (A, right) and intracellular accumulation of PNP (C, top trace). A wild-type E. coli strain showed conversion of extracellular PL to PN during cultivation (B, left), and the pdxI mutation significantly decreased this conversion (B, right). Experiments were performed at least three times with similar results, and representative chromatograms are shown.

PdxI is required for the conversion of PL to PN in E. coli.

The presence of a PL reductase in E. coli would explain these data. A recent global study using a supplemented metabolome extract and purified protein identified a protein that catalyzes the NADPH-dependent reduction of PL to PN (19). The relevant protein, YdbC, contains 286 amino acids, belongs to the aldo-keto reductase (AKR) family (20), and was renamed PdxI based on the activity. The same protein had reductase activity with 5-nitro benzisoxazole→2-cyano-4-nitrophenol with the Km and kcat values of 270 μM and 0.11 s−1, respectively (21), and neither activity was attributed a physiological role.

A working model suggested that PdxI functioned as a PL reductase and converted PL to PN in the growth medium of E. coli strains. An insertion/deletion of pdxI was constructed and transduced into relevant genetic backgrounds. The requirement for B6 vitamers was determined in the relevant strains. As expected based on the working model, the pdxJ pdxH pdxI triple mutant (DM16865) had a lower requirement for PL in M9-glucose medium, and 0.1 μM PL in the medium allowed full growth (Fig. 4A). The pdxH pdxI double mutant had a similarly low requirement for PL compared to that of the parental pdxH strain (data not shown). Together, these data showed that the increased requirement for PL was dependent on PdxI. Consistently, HPLC analyses of the vitamin B6 pool showed that pdxI lesion in the pdxJ pdxH mutant background prevented the accumulation of PNP inside the cells (Fig. 3C). In strains with a lesion in pdxI (pdxI pdxH or pdxI pdxJ pdxH mutant), PL was not converted to PN over time in the growth medium (Fig. 3A). Finally, in an otherwise wild-type background, a pdxI mutation significantly decreased the accumulation of PN in medium supplemented with exogenous PL (Fig. 3B). A similar involvement of PL reductase in the accumulation of PN in the growth medium was reported in yeasts (22).

FIG 4.

FIG 4

PL requirement of E. coli pdxI pdxJ pdxH, pdxJ pdxK, or pdxI pdxJ pdxK mutant. The pdxI pdxJ pdxH (A), pdxJ pdxK (B), and pdxI pdxJ pdxK (C) mutant strains of E. coli were grown in M9-glucose medium in the absence (○) or presence of 0.1 μM (■), 0.25 μM (●), or 1 μM (△) PL. The data represent the averages from biological triplicates. Cell growth was recorded by the OD-Monitor C&T apparatus.

The physiological significance of the rapid PdxI-dependent conversion of PL to PN during growth and the location of this conversion remain to be elucidated. After 24 h of cultivation in M9 medium supplemented with PL, the pdxI mutant strain accumulated a small amount of PN in the medium (Fig. 3A and B). This result suggests there might be an additional enzyme(s) capable of reducing PL in E. coli. The genome of E. coli K-12 encodes PdxI and eight other proteins that belong to the AKR superfamily (DkgA [15%], DkgB [19%], YdjG [21%], YgdS [tas] [16%], YdhF [15%], YghZ [17%], YeaE [15%], YajO [20%], and PdxI; the percent values in brackets indicate sequence identities to PdxI). In yeasts and plants, members of the AKR family have PL reductase activity (2225). Alignment analyses showed that the E. coli PdxI shares weak homology with the eukaryotic PL reductases and is 13.6%, 15.0%, and 15.4% identical to the Schizosaccharomyces pombe PLR1, Saccharomyces cerevisiae PLR1, and Arabidopsis thaliana PLR1, respectively (Fig. 5A). The phylogenic analysis suggested that PdxI is evolutionarily related to PL reductases of yeast, although their amino acid identities are low. In contrast, PdxI is evolutionarily less related to the PL reductase from A. thaliana (Fig. 5B). BLAST analysis using PdxI sequence as a query sequence identified proteins exhibiting greater than 30% identities to PdxI in many bacteria and plants, including Shigella sonnei, Streptomyces coelicolor, Deinococcus radiodurans, Thermotoga maritima, Pseudomonas aeruginosa, Glycine max, and A. thaliana. The BLAST search also showed that most E. coli strains, excluding E. coli B strains such as BL21, have a PdxI ortholog that has >90% identity. No protein-encoding gene that exhibits >30% identity to E. coli PdxI was found in the genome of S. enterica LT2 strain and most of other S. enterica strains, while there were 8 members of the AKR superfamily (YdjG is missing, while YqhE is present in the S. enterica strain) (Fig. 5B), supporting the conclusion that PdxI is the primary enzyme that efficiently converts PL to PN in E. coli.

FIG 5.

FIG 5

Sequence alignment of PL reductases. (A) Primary sequences of PL reductase of E. coli (PdxI), S. pombe (SpPLR1), S. cerevisiae (ScPLR1), and A. thaliana (AtPLR1) were aligned using the ClustalW program (https://www.genome.jp/tools-bin/clustalw). E. coli PdxI exhibits weak similarity to the three eukaryotic PL reductases. The PdxI is 13.6%, 15.0%, and 15.4% identical to the S. pombe PLR1, S. cerevisiae PLR1, and A. thaliana PLR1, respectively. (B) A phylogenetic tree of PdxI, SpPLR1, AtPLR1, and other proteins belonging to the AKR superfamily of E. coli and S. enterica based on the ClustalW algorithm is shown.

Kinetic parameters of PdxI.

Our growth data suggested that in E. coli pdxH and pdxJ pdxH mutant strains, the flux to PLP from direct salvage (PL to PLP) via kinases PdxK and PdxY (12, 13) is lower than flux via a salvage pathway requiring reduction of PL by PdxI (PL→PN→PNP→PLP). PL reduction catalyzed by PdxI was kinetically characterized using the purified enzyme. PL showed Michaelis-Menten kinetics in the substrate concentration range examined (0 to 0.5 mM). The apparent Km and kcat values of the PL reductase activity in the presence of 0.3 mM NADPH were determined to be 31 ± 3 μM and 84 ± 2 s−1, respectively. PdxI had no detectable reductase activity with either PLP or PM as the substrates under the assay conditions used. Pyridoxal reductases of S. cerevisiae and S. pombe catalyze the reverse reaction (conversion of PN to PL in the presence of NADP+), although the efficiencies are low (22, 24). This activity was not detected for PdxI.

The Km and kcat values for the kinase activity of PL catalyzed by PdxK are reported to be 60 μM and 4 s−1, respectively (26). PdxY exhibits only 1% of the kinase activity compared to that of PdxK (27, 28). The expression levels of PdxI, PdxK, and PdxY were not expected to be significantly different (29). In total, these data support the hypothesis that the conversion of PL to PN (by PdxI) is favored over the conversion of PL to PLP (by PdxK and/or PdxY) in E. coli cells. The efficient conversion of PL to PN would result in a rapid shortage of PL in the medium, causing the increased requirement for PL in the pdxH mutants, since these strains are unable to use the PN or PNP that would result from PdxI and PdxK activity.

Contribution of PdxI in the B6 salvage pathway.

In S. pombe, the deletion of the pyridoxal reductase gene (plr1) resulted in a decrease in total vitamin B6 and PMP contents (22). The transfer DNA (T-DNA) insertion mutant in the pyridoxal reductase in A. thaliana exhibits significantly lower levels of total B6 vitamer, PL, PLP, PM, and PMP (25). We investigated the influence of disruption of pdxI on the homeostasis of B6 vitamers. The wild type and the pdxI mutant were grown in M9-glucose medium, and their intracellular B6 pools were analyzed. Importantly, the growth of the pdxI mutant was not significantly different from that of the wild-type strain when they were cultivated in M9-glucose medium. PL did not accumulate in either of the strains. The result showed that lack of pdxI did not significantly impact the intracellular B6 pools in E. coli under the condition examined (Table 1).

TABLE 1.

Effect of pdxI deletion on intracellular B6 pool

Genotypea Amt (pmol/mg [wet wt] cells) ofb :
PLP PNP PMP
WT 52 ± 7 ND 30 ± 4
pdxI 48 ± 2 ND 25 ± 3
a

Wild-type (WT) and pdxI mutant were grown in M9-glucose medium.

b

The intracellular B6 pool was determined as described in Materials and Methods. The pdxI mutation did not affect the levels of intracellular B6 vitamers. ND, no detectable amount was observed. The data represent the averages and standard deviations from triplicate experiments.

Conclusions.

Here, we report that E. coli possesses an efficient pathway to convert PL to PN. PdxI, which belongs to the AKR superfamily, exhibits weak homology to the known PL reductases. Our data showed that PdxI is also responsible for the accumulation of PN in the medium over time when E. coli is grown in the presence of PL. There are proteins homologous to PdxI in a wide range of bacteria and plants, suggesting that PL reductase in the B6 salvage pathway is widely distributed in nature, despite being absent in a close relative of E. coli, S. enterica.

We updated the vitamin B6 salvage pathway of E. coli taking account into the data described above and some results obtained with mutant strains that have single or multiple mutations in the enzyme(s) of the B6 salvage pathway. The results are summarized in Table 2 and Fig. 1. As described, E. coli synthesizes PLP from exogenous PL using a detoured pathway (PL→PN→PNP→PLP) involving PdxI, PdxK, and PdxH rather than the direct pathway involving PdxK/PdxY kinases (PL→PLP). This mechanism was further supported by results showing the pdxJ pdxK mutant had poor growth in the presence of low levels of exogenous PL (0.1 μM), but the pdxJ pdxK pdxI triple mutant did not (Fig. 4B and C) (Table 2).

TABLE 2.

Growth of E. coli strains that have single or multiple mutations in B6 salvage enzymes

Genotype Growth witha :
PL PN PM
pdxJ + + +
pdxH ± +
pdxJ pdxH ± +
pdxJ pdxK ±
pdxJ pdxH pdxI + +
pdxJ pdxK pdxI +
a

+, grew well; ±, poor growth (final OD was less than 0.2 after 16 h of cultivation); −, no growth.

MATERIALS AND METHODS

Bacterial strains and media.

All strains used in this study are derivatives of Escherichia coli BW25113 and are listed with their genotypes in Table 3. M9 medium supplemented with 0.2% glucose as the sole carbon source was used as the minimal medium for E. coli strains. Luria-Bertani (LB) broth was used for preculturing. Strains of S. enterica were grown in NCE medium. Agar (1.5%) was added for solid medium. When necessary, pyridoxal, pyridoxine, or pyridoxamine was added at designated concentrations. Antibiotics were added to the medium in a rich and minimal medium at the following final concentrations: ampicillin, 100 and 20 μg/ml; kanamycin, 50 and 10 μg/ml. Growth analyses in liquid medium were performed in a glass test tube using Taitec OD monitor C&T apparatus (for E. coli strains) or in 96-well microtiter plates in a BioTek ELx808 plate reader (for S. enterica strains). Media were incubated at 37°C with shaking, and growth was monitored every 30 min.

TABLE 3.

Strains, plasmids, and primers

Strain, plasmid, or primer Description or sequence (5′→3′) Source or reference
E. coli strains
    BW25113 Wild type Laboratory collection
    DM16769 pdxI::Cm This study
    DM16696 pdxH::Kan This study
    DM16698 pdxH This study
    DM16027 pdxJ::kan (Keio collection, JW2548-KC) 33
    DM16037 pdxJ This study
    DM16713 pdxJ pdxH::Kan This study
    DM16847 pdxH::Kan pdxI::Cm This study
    DM16865 pdxH::kan pdxI pdxJ This study
    AG1/pCA24N-pdxI ASKA clone, JW1403-AM 32
Plasmid pCA24N-pdxI N-terminal His-tagged PdxI expression (ASKA JW1403-AM) 32
Primers
    pdxH-H1 ATGTCTGATAACGACGAATTGCAGCAAATCGCGCATCTG
CGCCGTGAATGTGTAGGCTGGAGCTGCTTCG
    pdxH-H2 TCAGGGTGCAAGACGATCAATCTTCCACGCATCATTTTC
ACGCTGGTCATATGAATATCCTCCTTAG
    pdxI-H1 ATGAGCAGCAATACATTTACTCTCGGTACAAAATCCGTT
AACCGTCTTGTGTAGGCTGGAGCTGCTTCG
    pdxI-H2 TTATTCTCGCGAAATACCATCCAACGTAGA
CAACACTTCCTCAGAAAGATCATATGAATATCCTCCTTAG
    pdxH-check-fw CGCATCGTCTTGAATAACTGTCAG
    pdxH-check-rv CACCTTTGCCGGTACACGACTTTTC
    pdxI-check-fw GCAACTCATCCAGTAATCTTGTTTACACC
    pdxI-check-rv GTAAACGTATCCAGCCGCAATTCC

Deletion mutants of pdxH (DM16696) and pdxI (DM16769) were constructed with lambda Red recombineering as described previously using E. coli BW25113 as the parental strain (30). A kanamycin resistance cassette with a 40-bp homology region of the pdxH sequence was amplified by PCR with primers pdxH-H1 and pdxH-H2 and plasmid pKD4. A chloramphenicol resistance cassette flanked by 40-bp pdxI sequences was amplified by PCR with primers pdxI-H1 and pdxI-H2 and plasmid pKD3 as a template. These PCR products were purified from agarose gels and electroporated into the E. coli cells. Transformants were selected on an LB plate containing kanamycin (50 μg/ml) or chloramphenicol (30 μg/ml). Insertion of the antibiotic resistance gene at the pdxH or pdxI locus was confirmed by PCR using primer pair pdxH-check-fw/pdxH-check-rv or pdxI-check-fw/pdxI-check-rv. The antibiotic cassette was removed with pCP20 plasmid. When required, the pdxJ::Km, pdxK::Km, pdxH::Km, or pdxI::Cm mutations were transferred into the desired strain by P1 transduction as described previously (31).

Purification of PdxI.

An E. coli AG1/pCA24N-PdxI strain (JW1403-AM [32]) was grown overnight in LB medium supplemented with chloramphenicol (30 μg/ml). Two milliliters of the preculture was inoculated into 200 ml of LB medium containing chloramphenicol and grown at 37°C with shaking to an optical density at 650 nm (OD650) of 0.5. Isopropyl-β-d-thiogalactopyranoside (IPTG; 0.1 mM) was added to the medium, and cells were incubated for 4 h prior to harvesting by centrifugation (6,000 × g, 5 min, room temperature [RT]). The cell pellet was resuspended in a binding buffer containing 50 mM sodium phosphate (NaPB), 500 mM NaCl, 20 mM imidazole, pH 7.4, with DNase (0.025 mg/ml), lysozyme (1 mg/ml), and phenylmethylsulfonyl fluoride (0.1 mg/ml) and disrupted with a high-pressure cell disruption device, Constant Systems Limited One Shot (United Kingdom) at 20,000 lb/in2, and cell lysate was cleared by centrifugation at 48,000 × g for 30 min at 4°C. The cell extract was passed through a 0.45-μm filter membrane and applied to a HisTrap HP Ni-Sepharose column (GE Healthcare) preequilibrated with the binding buffer. The column was washed with 5 column volumes of the binding buffer and an elution buffer (20 mM NaPB, 500 mM NaCl, 500 mM imidazole, pH 7.4). Fractions containing PdxI, where the purified PdxI existed as a single band of ∼31 kDa by SDS-PAGE, were combined and concentrated with a centrifugal filter device. The buffer was replaced with a buffer consisting of 20 mM NaPB and 10% glycerol (pH 7.4) with a PD10 desalting column (GE Healthcare), flash-frozen in liquid nitrogen, and stored at −80°C until use.

Enzyme assay.

PL reductase activity catalyzed by PdxI was determined as described previously with slight modification (22, 24). Briefly, purified His-tagged PdxI (0.26 μg) was incubated in a reaction mixture containing 50 mM NaPB, 0.3 mM NADPH, and various concentrations (0, 0.025, 0.05, 0.1, 0.25, and 0.5 mM) of PL at 37°C. The reaction was started by the addition of purified PdxI. The decrease of NADPH absorption at 340 nm in a 1.0-ml reaction mixture was monitored over 5 min at 37°C. Control experiments were also performed in the absence of enzyme, PL, or NADPH.

B6 vitamer analysis.

B6 vitamers were extracted from the cells with 10 volumes (vol/wt) of 0.9 M HClO4 containing 50 μM deoxypyridoxine as an internal standard (100 μl of the HClO4 solution for 10 mg [wet weight] E. coli cells). The suspension was vortex mixed and incubated on ice for 15 min, and 5 volumes (vol/wt) of 0.9 M K2CO3 solution (50 μl for 10 mg E. coli cells) was added. The mixture was centrifuged, and the resultant supernatant was diluted three times with water and used for the HPLC analysis (25 μl). The culture medium was deproteinized with HClO4 (a final concentration of 0.9 M), neutralized by K2CO3, and clarified by centrifugation. The B6 vitamers were separated with an octadecylsilyl (ODS) column (Cosmosil AR-II; Nacalai Tesque) (250 mm by 4.6 mm, 5-μm particle size) using a gradient program as described previously (17, 18). The flow rate was 1.0 ml per min, and the excitation and emission wavelengths were 328 nm and 393 nm, respectively.

ACKNOWLEDGMENTS

This work was supported by JSPS KAKENHI (grant number 17KK0153 to T.I.) and a competitive grant from the National Institutes of Health (GM095837 to D.M.D.).

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

No conflict of interest is declared.

REFERENCES

  • 1.Eliot AC, Kirsch JF. 2004. Pyridoxal phosphate enzymes: mechanistic, structural, and evolutionary considerations. Annu Rev Biochem 73:383–415. doi: 10.1146/annurev.biochem.73.011303.074021. [DOI] [PubMed] [Google Scholar]
  • 2.Toney MD. 2011. Controlling reaction specificity in pyridoxal phosphate enzymes. Biochim Biophys Acta 1814:1407–1418. doi: 10.1016/j.bbapap.2011.05.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Belitsky BR. 2004. Bacillus subtilis GabR, a protein with DNA-binding and aminotransferase domains, is a PLP-dependent transcriptional regulator. J Mol Biol 340:655–664. doi: 10.1016/j.jmb.2004.05.020. [DOI] [PubMed] [Google Scholar]
  • 4.Jochmann N, Götker S, Tauch A. 2011. Positive transcriptional control of the pyridoxal phosphate biosynthesis genes pdxST by the MocR-type regulator PdxR of Corynebacterium glutamicum ATCC 13032. Microbiology 157:77–88. doi: 10.1099/mic.0.044818-0. [DOI] [PubMed] [Google Scholar]
  • 5.Takenaka T, Ito T, Miyahara I, Hemmi H, Yoshimura T. 2015. A new member of MocR/GabR-type PLP-binding regulator of d-alanyl-d-alanine ligase in Brevibacillus brevis. FEBS J 282:4201–4217. doi: 10.1111/febs.13415. [DOI] [PubMed] [Google Scholar]
  • 6.Tramonti A, Nardella C, Salvo ML, Pascarella S, Contestabile R. 2018. The MocR-like transcription factors: pyridoxal 5′-phosphate-dependent regulators of bacterial metabolism. FEBS J 285:3925–3944. doi: 10.1111/febs.14599. [DOI] [PubMed] [Google Scholar]
  • 7.Fitzpatrick TB, Amrhein N, Kappes B, Macheroux P, Tews I, Raschle T. 2007. Two independent routes of de novo vitamin B6 biosynthesis: not that different after all. Biochem J 407:1–13. doi: 10.1042/BJ20070765. [DOI] [PubMed] [Google Scholar]
  • 8.Mukherjee T, Hanes J, Tews I, Ealick SE, Begley TP. 2011. Pyridoxal phosphate: biosynthesis and catabolism. Biochim Biophys Acta 1814:1585–1596. doi: 10.1016/j.bbapap.2011.06.018. [DOI] [PubMed] [Google Scholar]
  • 9.Franco MG, Laber B, Huber R, Clausen T. 2001. Structural basis for the function of pyridoxine 5′-phosphate synthase. Structure 9:245–253. doi: 10.1016/S0969-2126(01)00584-6. [DOI] [PubMed] [Google Scholar]
  • 10.Zhao G, Winkler ME. 1995. Kinetic limitation and cellular amount of pyridoxine (pyridoxamine) 5′-phosphate oxidase of Escherichia coli K-12. J Bacteriol 177:883–891. doi: 10.1128/JB.177.4.883-891.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.di Salvo ML, Contestabile R, Safo MK. 2011. Vitamin B6 salvage enzymes: mechanism, structure and regulation. Biochim Biophys Acta 1814:1597–1608. doi: 10.1016/j.bbapap.2010.12.006. [DOI] [PubMed] [Google Scholar]
  • 12.Yang Y, Zhao G, Winkler ME. 1996. Identification of the pdxK gene that encodes pyridoxine (vitamin B6) kinase in Escherichia coli K-12. FEMS Microbiol Lett 141:89–95. doi: 10.1111/j.1574-6968.1996.tb08368.x. [DOI] [PubMed] [Google Scholar]
  • 13.Yang Y, Tsui HC, Man TK, Winkler ME. 1998. Identification and function of the pdxY gene, which encodes a novel pyridoxal kinase involved in the salvage pathway of pyridoxal 5′-phosphate biosynthesis in Escherichia coli K-12. J Bacteriol 180:1814–1821. doi: 10.1128/JB.180.7.1814-1821.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Reid TW, Wislon IB. 1971. E. coli alkaline phosphatase, p 373–415. In Boyer PD. (ed), The enzymes, 3rd ed Academic Press, Cambridge, MA. [Google Scholar]
  • 15.Sugimoto R, Saito N, Shimada T, Tanaka K. 2017. Identification of YbhA as the pyridoxal 5′-phosphate (PLP) phosphatase in Escherichia coli:importance of PLP homeostasis on the bacterial growth. J Gen Appl Microbiol 63:362–368. doi: 10.2323/jgam.2017.02.008. [DOI] [PubMed] [Google Scholar]
  • 16.Paxhia MD, Downs DM. 2019. SNZ3 encodes a PLP synthase involved in thiamine synthesis in Saccharomyces cerevisiae. G3 (Bethesda) 9:335–344. doi: 10.1534/g3.118.200831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ito T, Yamamoto K, Hori R, Yamauchi A, Downs DM, Hemmi H, Yoshimura T. 2019. Conserved pyridoxal 5′-phosphate-binding protein YggS impacts amino acid metabolism through pyridoxine 5′-phosphate in Escherichia coli. Appl Environ Microbiol 85:e00430-19. doi: 10.1128/AEM.00430-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ito T, Hori R, Hemmi H, Downs DM, Yoshimura T. 2020. Inhibition of glycine cleavage system by pyridoxine 5′-phosphate causes synthetic lethality in glyA yggS and serA yggS in Escherichia coli. Mol Microbiol 113:270–284. doi: 10.1111/mmi.14415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sévin DC, Fuhrer T, Zamboni N, Sauer U. 2017. Nontargeted in vitro metabolomics for high-throughput identification of novel enzymes in Escherichia coli. Nat Methods 14:187–194. doi: 10.1038/nmeth.4103. [DOI] [PubMed] [Google Scholar]
  • 20.Lapthorn AJ, Zhu X, Ellis EM. 2013. The diversity of microbial aldo/keto reductases from Escherichia coli K12. Chem Biol Interact 202:168–177. doi: 10.1016/j.cbi.2012.10.008. [DOI] [PubMed] [Google Scholar]
  • 21.Khersonsky O, Malitsky S, Rogachev I, Tawfik DS. 2011. Role of chemistry versus substrate binding in recruiting promiscuous enzyme functions. Biochemistry 50:2683–2690. doi: 10.1021/bi101763c. [DOI] [PubMed] [Google Scholar]
  • 22.Morita T, Takegawa K, Yagi T. 2004. Disruption of the plr1+ gene encoding pyridoxal reductase of Schizosaccharomyces pombe. J Biochem 135:225–230. doi: 10.1093/jb/mvh026. [DOI] [PubMed] [Google Scholar]
  • 23.Guirard BM, Snell EE. 1988. Physical and kinetic properties of a pyridoxal reductase purified from bakers’ yeast. Biofactors 1:187–192. [PubMed] [Google Scholar]
  • 24.Nakano M, Morita T, Yamamoto T, Sano H, Ashiuchi M, Masui R, Kuramitsu S, Yagi T. 1999. Purification, molecular cloning, and catalytic activity of Schizosaccharomyces pombe pyridoxal reductase. A possible additional family in the aldo-keto reductase superfamily. J Biol Chem 274:23185–23190. doi: 10.1074/jbc.274.33.23185. [DOI] [PubMed] [Google Scholar]
  • 25.Herrero S, González E, Gillikin JW, Vélëz H, Daub ME. 2011. Identification and characterization of a pyridoxal reductase involved in the vitamin B6 salvage pathway in Arabidopsis. Plant Mol Biol 76:157–169. doi: 10.1007/s11103-011-9777-x. [DOI] [PubMed] [Google Scholar]
  • 26.Ghatge MS, Contestabile R, di Salvo ML, Desai JV, Gandhi AK, Camara CM, Florio R, González IN, Parroni A, Schirch V, Safo MK. 2012. Pyridoxal 5′-phosphate is a slow tight binding inhibitor of E. coli pyridoxal kinase. PLoS One 7:e41680. doi: 10.1371/journal.pone.0041680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.di Salvo ML, Hunt S, Schirch V. 2004. Expression, purification, and kinetic constants for human and Escherichia coli pyridoxal kinases. Protein Expr Purif 36:300–306. doi: 10.1016/j.pep.2004.04.021. [DOI] [PubMed] [Google Scholar]
  • 28.Safo MK, Musayev FN, Hunt S, di Salvo ML, Scarsdale N, Schirch V. 2004. Crystal structure of the PdxY protein from Escherichia coli. J Bacteriol 186:8074–8082. doi: 10.1128/JB.186.23.8074-8082.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Li GW, Burkhardt D, Gross C, Weissman JS. 2014. Quantifying absolute protein synthesis rates reveals principles underlying allocation of cellular resources. Cell 157:624–635. doi: 10.1016/j.cell.2014.02.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640–6645. doi: 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Thomason LC, Costantino N, Court DL. 2007. E. coli genome manipulation by P1 transduction. Curr Protoc Mol Biol Chapter 1:Unit 1.17. doi: 10.1002/0471142727.mb0117s79. [DOI] [PubMed] [Google Scholar]
  • 32.Kitagawa M, Ara T, Arifuzzaman M, Ioka-Nakamichi T, Inamoto E, Toyonaga H, Mori H. 2006. Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res 12:291–299. doi: 10.1093/dnares/dsi012. [DOI] [PubMed] [Google Scholar]
  • 33.Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H. 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2:2006.0008. doi: 10.1038/msb4100050. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES