Significance
Control of branching is critical for optimizing growth and adaptation in plants. In contrast with annuals, in perennial plants growing in temperate and boreal regions, branching must be controlled temporally to adapt to seasonal changes. The molecular pathways regulating branching and its adaptation to seasonal changes are not well understood in perennial plants. We identified the genetic network underlying the control of branching and elucidated its role in branching by seasonal cues in model tree hybrid aspen. Our results reveal components mediating photoperiodic control of growth in trees, and conserved branching regulators have been integrated into a genetic network to control branching and facilitate its adaptation to seasonal changes experienced by long-lived perennial plants.
Keywords: shoot architecture, branching, seasonal growth, perennial trees, hybrid aspen
Abstract
Shoot architecture is critical for optimizing plant adaptation and productivity. In contrast with annuals, branching in perennials native to temperate and boreal regions must be coordinated with seasonal growth cycles. How branching is coordinated with seasonal growth is poorly understood. We identified key components of the genetic network that controls branching and its regulation by seasonal cues in the model tree hybrid aspen. Our results demonstrate that branching and its control by seasonal cues is mediated by mutually antagonistic action of aspen orthologs of the flowering regulators TERMINAL FLOWER 1 (TFL1) and APETALA1 (LIKE APETALA 1/LAP1). LAP1 promotes branching through local action in axillary buds. LAP1 acts in a cytokinin-dependent manner, stimulating expression of the cell-cycle regulator AIL1 and suppressing BRANCHED1 expression to promote branching. Short photoperiod and low temperature, the major seasonal cues heralding winter, suppress branching by simultaneous activation of TFL1 and repression of the LAP1 pathway. Our results thus reveal the genetic network mediating control of branching and its regulation by environmental cues facilitating integration of branching with seasonal growth control in perennial trees.
Shoot architecture has a central role in adaptation and optimizing plant productivity. Hence the outgrowth of axillary buds is tightly regulated in response to endogenous signals and exogenous environmental cues. Branching has been extensively studied in the model plants Arabidopsis and pea. These studies have shown tight regulation of axillary bud outgrowth, revealed the key genetic components controlling branching, and identified roles played by hormonal and nutrient signals (1–3). The plant hormones strigolactone and indole-acetic acid (IAA/auxin) suppress branching, whereas cytokinin and nutrients such as nitrogen and sucrose promote it (4–13). Hormonal and nutrient signaling pathways converge on transcription factor BRANCHED1 (BRC1) (2, 14), which integrates the various inputs and mediates control of branching by regulating axillary buds’ potential to grow.
In contrast with annuals, perennials, particularly of boreal and temperate regions, face extreme annual variation in temperature and day length. Essential adaptations of perennials to these seasonal changes include synchronized cycles of growth and dormancy. Prior to winter, shoot growth is arrested and shoot apical meristems and arrested leaf primordia are enclosed within an apical bud, and precocious activation of shoot growth is prevented by the establishment of dormancy (15, 16). Like shoot growth, branching needs to be tightly controlled to adapt to seasonal changes. Inadvertent activation of axillary bud outgrowth, late in the season, would cause fatal damage in newly formed shoots from early winter frost.
Whereas branching is well studied in annual models like Arabidopsis and pea, much less is known about control of branching in perennial trees. Changes in gene expression in axillary buds have been described, and the role of a few components including strigolactones, BRC1 orthologs, and flowering-time–related transcription factor RAV1 has been validated in branching in trees (17–19). However, information on branching control in perennials is fragmented, and there is a significant gap in our knowledge of how branching is controlled and integrated with seasonal growth cycles in perennial trees (20). Therefore, using functional genetic approaches, we elucidated the genetic network that mediates control of branching and its regulation by seasonal cues in the model tree hybrid aspen. These studies reveal the key role played by the mutually antagonistic action of LAP1 and TFL1 in mediating control of branching and its responses to hormonal and seasonal cues. Our results show that components involved in photoperiodic control of seasonal growth have been recruited along with tree orthologs of previously described branching regulators to control of branching and its adaptation to seasonal changes.
Results
Bud Dormancy- and Activation-Related Genes Are Differentially Expressed during Axillary Bud Outgrowth.
To identify how shoot branching is regulated in trees, we monitored the temporal expression of genes in axillary buds of hybrid aspen (P. tremula × tremuloides) clone T89 before and after decapitation of shoot apex (21) (SI Appendix, Fig. S1). We selected genes previously implicated in bud dormancy and bud break (both apical and axillary buds). The first visible signals of activity in the buds were detected 24 to 48 h after decapitation, as buds appeared to grow and separate from the stem. Transcript levels of genes previously implicated in bud outgrowth, such as BRANCHED1/TEOSINTE BRANCHED1, CYCLOIDEA, PCF 18 (BRC1/TCP18, a homolog of Arabidopsis BRANCHED 1) (22, 23), and TERMINAL FLOWER 1/CENTRORADIALIS 1 (TFL1/CEN1) (24) were down-regulated. In contrast, transcript levels of AINTEGUMENTA-LIKE 1 (AIL1), a known cell proliferation regulator (25–27), and Arabidopsis thaliana HISTIDINE PHOSPHOTRANSMITTER 4 (AHP4, putatively involved in cytokinin signaling) (28) were up-regulated 8 to 24 h after shoot apex decapitation before any visible change in axillary buds (SI Appendix, Fig. S2 A–D). Thus, genes implicated in bud dormancy and outgrowth display dynamic changes in expression preceding and during axillary bud outgrowth.
TFL1/CEN1 Is a Branching Repressor.
The correlation between down-regulation of TFL1 expression preceding axillary bud outgrowth and its proposed role as a negative regulator of apical bud break (SI Appendix, Fig. S2B) (24) prompted us to investigate its role in axillary bud outgrowth. RNA interference (RNAi)-mediated down-regulation of TFL1 (SI Appendix, Fig. S3) resulted in more branching than in wild-type (WT) plants (Fig. 1A). Moreover, upon decapitation, TFL-down-regulated (TFL1-RNAi) and -overexpressing (TFL1oe) lines had significantly higher and lower frequencies of axillary bud outgrowth, respectively, than WT plants (SI Appendix, Fig. S4 A and B). These results suggest that TFL1 acts to repress branching in hybrid aspen.
Fig. 1.
TFL1 is a repressor of branching. (A) Numbers of branches formed by WT and TFL1-RNAi plants in LD conditions. (B and C) Expression levels of FT2 and LAP1 in WT and TFL1-RNAi plants’ axillary buds in long days, respectively. Error bars indicate SEM. The expression values are normalized to the reference gene UBQ and averages of three biological replicates. Statistical analysis was done using unpaired t test. Asterisks (*) and (**) indicate significant differences from WT at P ≤ 0.001 and 0.0001, respectively.
LAP1 Is the Downstream Target in TFL1-Mediated Suppression of Branching.
Next, we investigated the downstream targets of TFL1 involved in control of axillary bud outgrowth. TFL1 is known to act antagonistically to the flowering regulator FLOWERING LOCUS T (FT) and APETALA 1 (AP1) during flower development (29–32). Both FT and AP1 orthologs participate in seasonal regulation of shoot apex activity, as well of bud break (33–35). Also, both rice and cotton orthologs of FT promote shoot branching (36, 37). Therefore, we investigated the expression of hybrid aspen FT2 and LAP1 in the axillary buds of WT and TFL1-RNAi hybrid poplar plants. Both FT2 and LAP1 were expressed in axillary buds more strongly in TFL1-RNAi plants than in WT plants (Fig. 1 B and C).
The enhanced expression of FT and LAP1 in TFL1-RNAi axillary buds and the role of FT orthologs in branching prompted us to ask if FT or LAP1 can promote shoot branching in trees. In hybrid aspen, two closely related FT orthologs (FT1 and FT2) have been described so far (38). Hence, we investigated whether overexpression of FT1 or FT2 enhances branching, as observed upon down-regulation of TFL1. Neither FT1 nor FT2 overexpressor lines differed significantly from the wild type in the branching phenotype (SI Appendix, Fig. S5). In contrast with FT overexpression, LAP1 overexpression led to a significant increase in branching with outgrowth from nearly all of the axillary buds (Fig. 2 A and B).
Fig. 2.
LAP1 promotes branching. (A) Branching phenotypes of WT and LAP1oe plants grown in LD conditions. (B) Numbers of axillary branches formed by plants illustrated in A. (C) Numbers of branches formed by WT, TFL1-RNAi, and LAP1ko/TFL1-RNAi lines in LD conditions. (D–G) Real-time PCR data showing relative transcript levels of BRC1, TFL1, AHP4, and AIL1 in axillary buds of WT and LAP1oe plants grown under LD conditions, respectively. Expression values are normalized to the reference gene UBQ and averages of three biological replicates. Error bars indicate SEM. Statistical analysis was done using unpaired t test. Asterisks (*) and (**) indicate significant differences from WT at P ≤ 0.001 and 0.01, respectively.
The up-regulation of LAP1 expression in TFL1-RNAi axillary buds and the LAP1oe phenotype suggested that TFL1 suppresses axillary bud outgrowth by suppressing LAP1 expression. To test this hypothesis, we generated TFL1-RNAi aspen plants with LAP1 activity knocked out by clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 (Fig. 2C and SI Appendix, Fig. S6). The resulting TFL1-RNAi/LAP1ko plants resembled WT producing extremely few branches, in contrast with TFL1-RNAi plants. Thus, loss of function of LAP1 could suppress increased branching resulting from down-regulation of TFL1. The enhanced expression of LAP1 in TFL1-RNAi and suppression of branching in TFL1-RNAi by loss of function of LAP1 indicate that LAP1 is a downstream target in TFL1-mediated control of branching.
LAP1 Acts Locally in Promoting Branching by Modulating Key Branching-Related Genes.
Following identification of the role of LAP1 in branching, we investigated if LAP1 acts locally or systemically in promoting branching because some key regulators, e.g., strigolactones, act as long-range signals in branching (8, 9, 39–42). We self-grafted wild type (WT/WT), and LAP1oe (LAP1oe/LAP1oe) and wild-type and LAP1oe scions were grafted onto LAP1oe (WT/LAP1oe) and wild-type (LAP1oe/WT) root stocks, respectively, and axillary bud outgrowth was monitored in the scions after grafting. The wild-type scions in WT/WT grafts did not make any branches whereas LAP1oe scions in LAP1oe/LAP1oe grafts continued to make branches both in scion and root stocks (SI Appendix, Fig. S7 A and B). While the LAP1 root stocks did not induce branches in WT scions, the LAP1oe scions that were grafted onto WT root stocks continued to produce branches. These results suggest that LAP1 acts locally in promoting branching.
We then monitored gene expression in axillary buds of LAP1oe to identify downstream targets in the LAP1 pathway and elucidate how LAP1 promotes branching. Expression of BRC1 and TFL1, which both act negatively in branching, was significantly weaker in the LAP1oe axillary buds than in the WT buds (Fig. 2 D and E). In contrast, expression of AIL1 and AHP4, a cytokinin signaling-related gene, were significantly up-regulated in axillary buds of LAP1oe compared to WT buds (Fig. 2 F and G).
LAP1 Promoted Branching Is Mediated Via Suppression of BRC1.
In several plants, including poplar, BRC1 and its homolog BRC2 act as branching repressors (18, 22). The reduced expression of BRC1 in LAP1oe plants and recent data showing that LAP1 can bind to the promoter of BRC1 (43) suggest that LAP1 could promote branching by suppressing BRC1 expression in axillary buds. To address this hypothesis, we expressed BRC1 in the LAP1oe background (SI Appendix, Fig. S8A) and investigated the resulting branching phenotype. BRC1oe/LAP1oe double transgenic lines produced significantly fewer branches than LAP1oe plants (SI Appendix, Fig. S8 B and C), indicating that BRC1 is a downstream target of LAP1 and that LAP1 promotes branching by repressing BRC1 expression in hybrid aspen.
LAP1 Requires AIL1 Activity to Promote Branching.
The expression of AIL1 transcription factor is up-regulated in axillary buds after decapitation as well in LAP1oe (Fig. 2F). AIL1 transcription factor is a downstream target of LAP1 in photoperiodic control of growth (34). Ectopic expression of AIL1 (AIL1oe) resulted in more branching than in WT plants (Fig. 3A), suggesting that AIL1 could act in LAP1-mediated promotion of branching. To test this possibility, we suppressed AIL in the LAP1oe background. However, in hybrid aspen four nearly identical AIL genes act redundantly (27). To overcome this genetic redundancy, we generated a dominant repressor, antagonizing the function of endogenous AIL genes by expressing a fusion of AIL1 with an SRDX domain (a synthetic repressor) (44). We expressed the AIL1-SRDX repressor in the LAP1oe background (SI Appendix, Fig. S9A). The resulting AIL1-SRDX/LAP1oe plants produced significantly fewer branches than the parental LAP1oe plants (Fig. 3B), thus confirming that LAP1 acts via AIL genes in promoting branching.
Fig. 3.
LAP1 acts via AIL and cytokinin to promote branching. Bar graphs show numbers of branches formed by (A) WT and AIL1oe plants; (B) WT, LAP1oe, and AIL1srdx (in LAP1oe background) plants; (C) WT, LAP1oe, and LAP1oe (in BHK4-CKX2 background) plants; and (D) WT, LAP1oe, and AHP4-RNAi (in LAP1oe background) plants grown in LD conditions. Error bars indicate SEM.
LAP1 Pathway Interacts with Cytokinin Signaling in Branching.
Plant hormone cytokinin promotes shoot branching. Therefore, we investigated whether cytokinins are involved in LAP1-mediated promotion of branching. For this, we generated transgenic hybrid aspen plants overexpressing LAP1 in a BHK4-CKX2 background (LAP1oe/BHK4-CKX2) (SI Appendix, Fig. S9B), which had reduced cytokinin levels due to overexpression of Arabidopsis CYTOKININ OXIDASE 2 (45). In contrast with LAP1oe, LAP1oe/BHK4-CKX2 plants resembled WT plants and displayed nearly complete suppression of branching (Fig. 3C), indicating that the cytokinin pathway is required for LAP1-mediated promotion of branching. This result was corroborated by the phenotype of transgenic hybrid aspen plants in which expression of AHP4, a putative cytokinin pathway-related gene (28), was down-regulated in LAP1oe background. As described for LAP1oe/BHK4-CKX2, down-regulation of AHP4 expression in a LAP1oe background (AHP4-RNAi/LAP1oe) (SI Appendix, Fig. S9 C and D) resulted in significantly less branching than in LAP1oe plants (Fig. 3D). Thus, our data suggest that the promotion of branching by LAP1 requires cytokinin and AHP4.
Short Days and Low Temperature Suppress Branching in LAP1oe Plants.
In contrast with annual plants, perennial trees need to prevent inadvertent activation of branching late in the season as winter approaches to reduce the risk to new shoots from winter damage. Short days and non-chilling low temperature (here after referred to as low temperature) are major seasonal cues heralding autumnal transition to winter and mediate seasonal growth cessation in shoot apex (33–35). To address the poorly understood mechanisms whereby these autumnal transition cues control branching, we first decapitated wild-type T89 plants grown in short days or low temperature and analyzed their bud outgrowth (SI Appendix, Fig. S10 A and B). Both short days (SDs) or low temperature completely suppressed bud outgrowth following decapitation in contrast with long days. Thus, environmental cues mediating seasonal control of shoot growth also act on axillary bud outgrowth, thereby coordinating apical growth and branching and facilitating adaptation to seasonal change.
We next examined the molecular basis of seasonal control of axillary bud outgrowth. Because our data indicated that control of shoot growth and branching involves shared components such as LAP1, we investigated whether seasonal cues mediating branching control act through these components. To address this possibility, we investigated branching in LAP1oe plants after exposure to SDs or low temperature. While apices of LAP1oe plants continued to grow in SDs as expected (34) or in low temperature (SI Appendix, Fig. S11), branching was completely suppressed in these plants by exposure to SDs or low temperature (Fig. 4A and SI Appendix, Fig. S12A). Thus, the seasonal cues contribute to the control of branching and can override LAP1-mediated promotion of branching.
Fig. 4.
Photoperiodic control of the shoot growth and branching.(A) Branching phenotype of WT and LAP1oe plants grown in SD conditions after leaf tagging (yellow tags). (B–E) Relative transcript levels of indicated bud growth-related genes in axillary buds of LAP1oe plants grown under LD and SD conditions. (F) Numbers of branches produced by WT, TFL1-RNAi, LAP1oe, and LAP1oe/TFL1-RNAi background plants grown in SD conditions. The expression values are normalized to the reference gene UBQ and averages of three biological replicates. Error bars indicate SEM. Statistical analysis was done using unpaired t test. Asterisks (*), (**), and (***) indicate significant differences from WT at P ≤ 0.01, 0.001, and 0.0001, respectively.
To better understand how seasonal cues control branching, we investigated the expression of genes implicated in bud dormancy and outgrowth in axillary buds of LAP1oe plants grown in short days or low temperature (Fig. 4 B–E and SI Appendix, Fig. S12 B–E). The transcript levels of BRC1 and TFL1, which we have shown suppress branching, were up-regulated upon exposure to SDs or low temperature. Conversely, expression of genes such as AIL1 and AHP4 that promote branching were down-regulated in axillary buds of LAP1oe plants grown in SDs or low temperature (Fig. 4 B–E and SI Appendix, Fig. S12 B–E). Thus, seasonal cues act through known mediators of branching and negate the effect of LAP1 by activating the expression of negative regulators and suppressing that of promoters of branching.
Suppression of LAP1 Promoted Branching by Seasonal Cues Is Dependent on TFL1.
TFL1 is a negative regulator of branching (Fig. 1), and its expression is up-regulated by SDs or low temperature in LAP1oe plants (Fig. 4C), indicating that TFL1 up-regulation could be required for suppression of branching by seasonal cues. Therefore, we examined axillary bud outgrowth in transgenic hybrid aspen in which we down-regulated TFL1 expression in LAP1oe (LAP1oe/TFL1-RNAi) (SI Appendix, Fig. S13) following exposure to SDs or low temperature. In contrast with LAP1oe, SDs or low temperature could no longer suppress axillary bud outgrowth in LAP1oe/TFL1-RNAi (Fig. 4F and SI Appendix, Fig. S12F). These results suggest that suppression of branching by seasonal cues in LAP1oe is dependent on TFL1 up-regulation.
Discussion
Tight regulation of shoot architecture by controlling the activity of axillary buds is crucial for plants (1, 46, 47). In contrast with annuals such as Arabidopsis and pea, much less is known about branching control in perennials. Moreover, neither of these annual models display seasonal growth cycles, and how branching in perennials is coordinated with seasonal growth cycles remains poorly understood. To address this knowledge gap, we first identified genetic pathways involved in branching and explored their role in mediating the control of branching by seasonal cues in hybrid aspen.
First, we analyzed changes in expression of key marker genes associated with activation of axillary bud outgrowth following decapitation in hybrid aspen (SI Appendix, Fig. S2). In agreement with previous studies (18, 22, 37, 48–50), our data suggest that BRC1 down-regulation is an important early event and support its key role as an integrator of various input signals in branching regulation (2, 14). Down-regulation of BRC1 putatively enhances buds’ potential to grow out (51), and data obtained from both gene expression and transgenic analyses with Populus × canescens clone INRA 717–1B4 indicate the conservation of BRC1 function in branching in trees (17, 18). However, gene expression also identified potential candidates such as TFL1, a negative regulator of spring bud break; AIL1, a promoter of cell proliferation; and AHP4, a signaling component implicated in the cytokinin pathway, as mediators of branching in hybrid aspen. AIL1 mediates in photoperiodic control of seasonal growth, whereas cytokinin signaling plays a key role in branching (6, 10, 27). Thus, while gene expression programs in axillary bud outgrowth are conserved across annual and perennial trees, they also suggest that regulators of seasonal growth could be involved in branching in perennials.
Although gene expression studies implicate TFL1 in branching, functional evidence for TFL1 involvement in branching has been lacking in trees. Our data showing increased branching in TFL1-RNAi plants suggest that TFL1 acts as a suppressor of branching in hybrid aspen (Fig. 1A). TFL1 has been extensively studied in the control of flowering, where it acts antagonistically to the flowering promoters FT and AP1 (29, 30, 31, 32), and we observe this in axillary buds (Fig. 1 B and C). Therefore, we investigated whether the branching mechanism involves a balance between FT and TFL1 as shown in control of floral transition in Arabidopsis (52–54). Whereas FT overexpression results in increased branching in rice and tobacco (36, 37), our results show that LAP1 rather than FT promotes increased branching in hybrid aspen (Fig. 2 A–C and SI Appendix, Fig. S5). Thus, FT-TFL1 balance does not appear to be a major determinant of branching; instead, TFL1 acts by suppressing expression of LAP1 in branching regulation in hybrid aspen trees in contrast with flowering-time regulation.
Whereas systemic signals play important roles in branching (8, 9), grafting suggests that LAP1 acts locally in promoting axillary bud outgrowth (SI Appendix, Fig. S7). Gene expression and enhanced branching in LAP1oe and TFL1RNAi plants indicate that LAP1 could promote branching by suppressing TFL1 expression. In flowering-time regulation, TFL1 has been shown to repress AP1, and vice versa (30, 32, 55, 56). The conservation of this TFL1-AP1 negative loop in axillary buds and the similar phenotypes of TFL1 down-regulation and LAP1 overexpression suggest that relative levels of these two mutually antagonistic factors are important for branching. Thus, regulatory features of the flowering-time pathway appear to have been recruited to branching regulation in perennial trees. However, rather than FT/TFL1 balance, the antagonistic loop between TFL1 and LAP1 is important in branching in hybrid aspen.
In addition to TFL1, LAP1 promotes branching via suppression of BRC1, the conserved integrator of diverse signaling pathways in branching regulation in axillary buds (2, 14). Moreover, our data show that LAP1 promotes branching by positively regulating AIL1, a positive regulator of the expression of cell-cycle–related genes, such as D-type cyclin genes (34). Thus, the LAP1-dependent regulatory module mediating seasonal control of growth is conserved in axillary buds. However, LAP1-promoted branching is also dependent on the cytokinin pathway that is known to promote branching (5, 6, 10). Earlier a connection between AP1 and the cytokinin pathway has been noted in establishment of determinate floral meristems via regulation of cytokinin levels (57) as well as in compound leaf development in tomato (58). Thus, the AP1-cytokinin module appears to be a widely utilized regulatory module across species to control a wide variety of developmental processes including branching in trees. Altogether, our data show that regulatory interaction between the AP1 ortholog LAP1 with hormonal pathways and mediators of seasonal growth have been recruited to the branching pathway in addition to their role in seasonal control of growth in trees and flowering in Arabidopsis.
Following the identification of genetic components mediating the control of branching, we next investigated how branching is regulated by seasonal cues. In contrast with annuals, perennials like long-lived trees display seasonally synchronized growth cycles to adapt to seasonal changes. In these plants, inadvertent activation of axillary bud outgrowth needs to be prevented, e.g., late in the autumn when the risk of damage from chilling injuries increases due to sudden frosts. Whereas chilling-mediated release of bud dormancy is well studied (15, 59), the mechanism underlying seasonal control of branching by autumnal transition cues, such as nonchilling low temperature or SDs, remains poorly understood in trees. Our data indicate that these two major cues, nonchilling low temperature or SDs, that herald autumnal transition to winter and control seasonal growth in trees (15) also play an important role in seasonal control of branching in trees. Both of these cues suppress axillary bud outgrowth and our data suggest that TFL1 is required for suppression of branching by these seasonal cues. However, it is worth noting that axillary bud outgrowth under autumn-mimicking conditions is stringently controlled. SDs and nonchilling low temperature can prevent axillary bud outgrowth even when the shoot apex is removed, and bud outgrowth under these conditions requires simultaneous down-regulation of TFL1, a suppressor, and activation of LAP1.
We propose a model (Fig. 5) for genetic control of branching in trees and its regulation by seasonal cues. The signaling pathway mediating control of branching in trees utilizes evolutionarily conserved components, including BRC1 and hormones such as strigolactones and cytokinins. However, in perennials, where seasonal adaptation is critical for survival, the TFL1-LAP1 module, which plays a crucial role in the photoperiodic pathway (34, 35), has also been recruited for mediating branching and its control by seasonal cues. The dual use of this regulatory module in seasonal growth at the apex and branching could indicate a simple mechanism to coordinate seasonal regulation of these two developmental processes by common cues such as photoperiod or low temperature that act as major environmental inputs for autumnal transition in boreal and temperate regions. Our results also highlight a striking feature of branching in hybrid aspen. Whereas apical dominance plays a key role in repressing axillary bud outgrowth in annuals (as well perennials) (1, 47), seasonal cues like SDs or low temperature (that mimic autumn transition) repress axillary bud outgrowth even when repression via apical dominance is removed in hybrid aspen. We suggest that repression of axillary bud outgrowth by seasonal cues plays a protective function and that this mechanism may have evolved in perennials to presumably prevent inappropriate activation of axillary bud outgrowth late in the season even when the shoot apex may be damaged.
Fig. 5.
Schematic model for branching in trees. Under LD conditions, TFL1 suppresses LAP1. LAP1 promotes branching by increasing the cytokinin signaling and repressing TFL1 and BRC1 expression. Exposure to SDs or low temperature (mimicking seasonal transition to winter), TFL1 and BRC1 expression is up-regulated resulting in suppression of branching.
In summary, the genetic framework underlying branching control in perennials such as trees has incorporated conserved components identified in annuals and merged these with elements mediating seasonal growth to facilitate coordination of branching with seasonal growth cycles. Despite evident conservation, there are also notable differences from annuals such as the key role of the mutually antagonistic TFL1-LAP1 loop and the regulatory complexity that results in seasonal cues operating to prevent branching even when the shoot apex is removed. Moreover, while chilling temperatures promote dormancy release, our results reveal that nonchilling low temperatures prevent axillary bud outgrowth and the underlying components. Thus, our results extend our knowledge of branching regulation derived primarily from annual models such as Arabidopsis and pea and reveal how coordination between growth in the shoot apex and branching is achieved to adapt to seasonal changes at the molecular level in perennial trees.
Materials and Methods
Plant Materials, Growth Conditions, and Tissue Sampling.
WT hybrid aspen (Populus tremula × tremuloides, clone T89) and transgenic plants were grown on half-strength Murashige–Skoog medium (Duchefa) under sterile conditions for 4 wk and then transferred to soil and cultivated for 4 to 5 wk in a greenhouse [providing 18 h day/6 h night at 22/18 °C long-day (LD) conditions]. Plants were fertilized weekly when growing in the greenhouse. Furthermore, plants were transferred and grown in controlled chambers under long-day (18 h day/6 h night at 20/15 °C) or short-day (8 h day/16 h night at 20/15 °C) or at a constant temperature of 12 °C (serving as low temperature in long days) for 5 to 6 wk, and then their branches were counted. To enhance the visibility of branches, pictures were taken after removing leaves using a Canon EOS digital camera. Tissue samples for gene expression analyses were collected from axillary buds at time points (indicated in the figures), immediately frozen in liquid nitrogen, and stored at −80 °C.
Plasmid Constructions and Generation of Transgenic Lines.
The generation of LAP1oe, FT1oe, FT2oe, TFL1oe, AIL1oe, and TFL1-RNAi plants has been previously described (24, 27, 34, 35). To generate a BRC1 construct, the coding sequence (CDS) was amplified by PCR and cloned into pENTR/D-TOPO donor vector (Invitrogen), sequenced, and subsequently cloned into the pH2GW7 plant transformation vector (60) to generate the plasmid pH2GW7-BRC1. To make AHP4-RNAi constructs, a 265-bp fragment was amplified by PCR from a full-length AHP4 CDS template and cloned first into donor vector pENTR/D-TOPO and then into pK7GWIWG2 (I) by LR (attL and attR) reaction to generate a pH7GWIWG2 (I)-AHP4-RNAi construct.
To generate a TFL1-RNAi/LAP1ko line, we used a CRISPR-Cas9 strategy. An LAP1-CRISPR construct was generated by designing two guide RNAs (Guide RNA 1, TTTTCACACCTCATTTTTTAAGG; Guide RNA 2, TTGAATACTCCACCAATGCTTGG) using an online CRISPR-P designer tool (http://crispr.hzau.edu.cn/CRISPR2/). Then oligos (SI Appendix, Table S1) were designed and cloning was done following a previously described protocol (61). The template for cloning was amplified from pCBC-DT1T2 with the help of oligos. The deletions were confirmed by sequencing (SI Appendix, Fig. S5). The PCR fragment was cloned into pHSE401 binary vector by Golden Gate reaction for plant transformation. To generate an AIL1-SRDX construct, nucleotides encoding the 12-amino-acid SRDX repressor domain [LDLDLELRLGFA (44)] was introduced into a reverse primer for AIL1, which was used together with a forward primer to generate nucleotides needed for a full-length AIL1-SRDX construct. This PCR product was then cloned into donor vector pENTR/D-TOPO and subsequently pH2GW7 to generate pH2GW7-AIL1-SRDX. BHK4-CKX2 constructs were generated by cloning Arabidopsis CYTOKININ OXIDASE 2 (AtCKX2) along with BIRCH HISTIDINE KINASE 4 (BHK4) promoter into pGEM-T Easy vector and then transferred to pHTT650 binary vector (45).
All these constructs (pH2GW7-BRC1, pH2GW7-LAP1, BHK4-AtCKX2, pH2GW7-AHP4-RNAi, pH2GW7-AIL1-SRDX, and pHSE401-LAP1-CRISPR) were introduced into Agrobacterium strain GV3101pmp90RK and then used to transform WT, LAP1oe, and TFL1-RNAi plants to generate single and double transgenic lines. All of the primers used for cloning are listed in SI Appendix, Table S1.
Generation of Transgenic Hybrid Aspen.
All of the transformations were performed as described by Tylewicz et al. (62).
Grafting of Hybrid Aspen Plants.
WT and LAP1oe plants used in the grafting experiments were grown for 5 wk in a greenhouse providing 18 h light/6 h dark cycles at 22 °C and 60% relative humidity) and then grafted as previously reported (45). After 2 wk in long-day conditions, the growing grafts were transferred to a long-day growth chamber (providing 18 h light/6 h dark cycles at 20/15 °C, 80% relative humidity) and monitored for branch development.
RNA Isolation and qRT-PCR Analysis.
Total RNA was extracted using a Spectrum Plant Total RNA Kit (Sigma-Aldrich). Ten-microgram portions of RNA were treated with RNase-free DNase I (Life Technologies, Ambion), and 1-μg portions were then utilized for complementary DNA (cDNA) synthesis using an iScript cDNA Synthesis Kit (Bio-Rad). In all experiments, ubiquitin was used as a reference gene. qRT-PCR experiments were conducted using LightCycler 480 SYBR Green I Master mix and a LightCycler 480 II instrument (both supplied by Roche). The Δ-cq method was used to calculate the relative expression values of the genes of interest. Primer sequences used in this study are listed in SI Appendix, Table S1.
Statistical Analysis.
All of the experiments were performed at least three times. For statistical comparisons, we used Student’s t test. Significant differences are denoted by asterisks. Horizontal lines in all of the graphs represent SEM.
Data Availability.
This study did not generate any unique datasets or code. All of the associated protocols and materials used in the paper will be made available to readers upon adequate request.
Supplementary Material
Acknowledgments
This work was supported by grants from Swedish Foundation for Strategic Research (SSF), the Swedish Research Council for Environment, Agricultural Sciences and Spatial Planning (FORMAS), and the Knut and Alice Wallenberg Foundation (2014-0032) (to R.P.B.).
Footnotes
The authors declare no competing interest.
This article is a PNAS Direct Submission.
This article contains supporting information online at https://www.pnas.org/lookup/suppl/doi:10.1073/pnas.2004705117/-/DCSupplemental.
References
- 1.Domagalska M. A., Leyser O., Signal integration in the control of shoot branching. Nat. Rev. Mol. Cell Biol. 12, 211–221 (2011). [DOI] [PubMed] [Google Scholar]
- 2.Rameau C., et al. , Multiple pathways regulate shoot branching. Front Plant Sci 5, 741 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Barbier F. F., Dun E. A., Kerr S. C., Chabikwa T. G., Beveridge C. A., An update on the signals controlling shoot branching. Trends Plant Sci. 24, 220–236 (2019). [DOI] [PubMed] [Google Scholar]
- 4.Thimann K. V., Skoog F., Studies on the growth hormone of plants: III. The inhibiting action of the growth substance on bud development. Proc. Natl. Acad. Sci. U.S.A. 19, 714–716 (1933). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Horgan J. M., Wareing P. F., Cytokinins and the growth-responses of seedlings of betula-pendula Roth and acer-pseudoplatanus L to nitrogen and phosphorus deficiency. J. Exp. Bot. 31, 525–532 (1980). [Google Scholar]
- 6.Takei K., Sakakibara H., Taniguchi M., Sugiyama T., Nitrogen-dependent accumulation of cytokinins in root and the translocation to leaf: Implication of cytokinin species that induces gene expression of maize response regulator. Plant Cell Physiol. 42, 85–93 (2001). [DOI] [PubMed] [Google Scholar]
- 7.Leyser O., Regulation of shoot branching by auxin. Trends Plant Sci. 8, 541–545 (2003). [DOI] [PubMed] [Google Scholar]
- 8.Gomez-Roldan V., et al. , Strigolactone inhibition of shoot branching. Nature 455, 189–194 (2008). [DOI] [PubMed] [Google Scholar]
- 9.Umehara M., et al. , Inhibition of shoot branching by new terpenoid plant hormones. Nature 455, 195–200 (2008). [DOI] [PubMed] [Google Scholar]
- 10.Ferguson B. J., Beveridge C. A., Roles for auxin, cytokinin, and strigolactone in regulating shoot branching. Plant Physiol. 149, 1929–1944 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Mason M. G., Ross J. J., Babst B. A., Wienclaw B. N., Beveridge C. A., Sugar demand, not auxin, is the initial regulator of apical dominance. Proc. Natl. Acad. Sci. U.S.A. 111, 6092–6097 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.de Jong M., et al. , Auxin and strigolactone signaling are required for modulation of Arabidopsis shoot branching by nitrogen supply. Plant Physiol. 166, 384–395 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Barbier F. F., Lunn J. E., Beveridge C. A., Ready, steady, go! A sugar hit starts the race to shoot branching. Curr. Opin. Plant Biol. 25, 39–45 (2015). [DOI] [PubMed] [Google Scholar]
- 14.Wang M., et al. , BRANCHED1: A key hub of shoot branching. Front Plant Sci 10, 76 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Singh R. K., Svystun T., AlDahmash B., Jönsson A. M., Bhalerao R. P., Photoperiod- and temperature-mediated control of phenology in trees: A molecular perspective. New Phytol. 213, 511–524 (2017). [DOI] [PubMed] [Google Scholar]
- 16.Maurya J. P., Bhalerao R. P., Photoperiod- and temperature-mediated control of growth cessation and dormancy in trees: A molecular perspective. Ann. Bot. 120, 351–360 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Muhr M., Prüfer N., Paulat M., Teichmann T., Knockdown of strigolactone biosynthesis genes in Populus affects BRANCHED1 expression and shoot architecture. New Phytol. 212, 613–626 (2016). [DOI] [PubMed] [Google Scholar]
- 18.Muhr M., Paulat M., Awwanah M., Brinkkötter M., Teichmann T., CRISPR/Cas9-mediated knockout of Populus BRANCHED1 and BRANCHED2 orthologs reveals a major function in bud outgrowth control. Tree Physiol. 38, 1588–1597 (2018). [DOI] [PubMed] [Google Scholar]
- 19.Moreno-Cortés A., et al. , Impact of RAV1-engineering on poplar biomass production: A short-rotation coppice field trial. Biotechnol. Biofuels 10, 110 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Rohde A., Bhalerao R. P., Plant dormancy in the perennial context. Trends Plant Sci. 12, 217–223 (2007). [DOI] [PubMed] [Google Scholar]
- 21.Yang Y., et al. , The TIE1 transcriptional repressor controls shoot branching by directly repressing BRANCHED1 in Arabidopsis. PLoS Genet. 14, e1007296 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Aguilar-Martínez J. A., Poza-Carrión C., Cubas P., Arabidopsis BRANCHED1 acts as an integrator of branching signals within axillary buds. Plant Cell 19, 458–472 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Singh R. K., et al. , A genetic network mediating the control of bud break in hybrid aspen. Nat. Commun. 9, 4173 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Mohamed R., et al. , Populus CEN/TFL1 regulates first onset of flowering, axillary meristem identity and dormancy release in Populus. Plant J. 62, 674–688 (2010). [DOI] [PubMed] [Google Scholar]
- 25.Elliott R. C., et al. , AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth. Plant Cell 8, 155–168 (1996). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Mizukami Y., Fischer R. L., Plant organ size control: AINTEGUMENTA regulates growth and cell numbers during organogenesis. Proc. Natl. Acad. Sci. U.S.A. 97, 942–947 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Karlberg A., Bako L., Bhalerao R. P., Short day-mediated cessation of growth requires the downregulation of AINTEGUMENTALIKE1 transcription factor in hybrid aspen. PLoS Genet. 7, e1002361 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Hutchison C. E., et al. , The Arabidopsis histidine phosphotransfer proteins are redundant positive regulators of cytokinin signaling. Plant Cell 18, 3073–3087 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Shannon S., Meeks-Wagner D. R., A mutation in the Arabidopsis TFL1 gene affects inflorescence meristem development. Plant Cell 3, 877–892 (1991). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Liljegren S. J., Gustafson-Brown C., Pinyopich A., Ditta G. S., Yanofsky M. F., Interactions among APETALA1, LEAFY, and TERMINAL FLOWER1 specify meristem fate. Plant Cell 11, 1007–1018 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ahn J. H., et al. , A divergent external loop confers antagonistic activity on floral regulators FT and TFL1. EMBO J. 25, 605–614 (2006). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hanano S., Goto K., Arabidopsis TERMINAL FLOWER1 is involved in the regulation of flowering time and inflorescence development through transcriptional repression. Plant Cell 23, 3172–3184 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Böhlenius H., et al. , CO/FT regulatory module controls timing of flowering and seasonal growth cessation in trees. Science 312, 1040–1043 (2006). [DOI] [PubMed] [Google Scholar]
- 34.Azeez A., Miskolczi P., Tylewicz S., Bhalerao R. P., A tree ortholog of APETALA1 mediates photoperiodic control of seasonal growth. Curr. Biol. 24, 717–724 (2014). [DOI] [PubMed] [Google Scholar]
- 35.Miskolczi P., et al. , Long-range mobile signals mediate seasonal control of shoot growth. Proc. Natl. Acad. Sci. U.S.A. 116, 10852–10857 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Li C., et al. , Promoting flowering, lateral shoot outgrowth, leaf development, and flower abscission in tobacco plants overexpressing cotton FLOWERING LOCUS T (FT)-like gene GhFT1. Front Plant Sci 6, 454 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Tsuji H., et al. , Hd3a promotes lateral branching in rice. Plant J. 82, 256–266 (2015). [DOI] [PubMed] [Google Scholar]
- 38.Hsu C. Y., et al. , FLOWERING LOCUS T duplication coordinates reproductive and vegetative growth in perennial poplar. Proc. Natl. Acad. Sci. U.S.A. 108, 10756–10761 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Brewer P. B., Dun E. A., Ferguson B. J., Rameau C., Beveridge C. A., Strigolactone acts downstream of auxin to regulate bud outgrowth in pea and Arabidopsis. Plant Physiol. 150, 482–493 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Shinohara N., Taylor C., Leyser O., Strigolactone can promote or inhibit shoot branching by triggering rapid depletion of the auxin efflux protein PIN1 from the plasma membrane. PLoS Biol. 11, e1001474 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Dun E. A., de Saint Germain A., Rameau C., Beveridge C. A., Dynamics of strigolactone function and shoot branching responses in Pisum sativum. Mol. Plant 6, 128–140 (2013). [DOI] [PubMed] [Google Scholar]
- 42.Waldie T., McCulloch H., Leyser O., Strigolactones and the control of plant development: Lessons from shoot branching. Plant J. 79, 607–622 (2014). [DOI] [PubMed] [Google Scholar]
- 43.Maurya J. P., et al. , Branching regulator BRC1 mediates photoperiodic control of seasonal growth in hybrid aspen. Curr. Biol. 30, 122–126.e2 (2019). [DOI] [PubMed] [Google Scholar]
- 44.Hiratsu K., Matsui K., Koyama T., Ohme-Takagi M., Dominant repression of target genes by chimeric repressors that include the EAR motif, a repression domain, in Arabidopsis. Plant J. 34, 733–739 (2003). [DOI] [PubMed] [Google Scholar]
- 45.Nieminen K., et al. , Cytokinin signaling regulates cambial development in poplar. Proc. Natl. Acad. Sci. U.S.A. 105, 20032–20037 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Leyser O., The control of shoot branching: An example of plant information processing. Plant Cell Environ. 32, 694–703 (2009). [DOI] [PubMed] [Google Scholar]
- 47.Wang B., Smith S. M., Li J., Genetic regulation of shoot architecture. Annu. Rev. Plant Biol. 69, 437–468 (2018). [DOI] [PubMed] [Google Scholar]
- 48.Braun N., et al. , The pea TCP transcription factor PsBRC1 acts downstream of Strigolactones to control shoot branching. Plant Physiol. 158, 225–238 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Ni J., et al. , Gibberellin promotes shoot branching in the perennial woody plant Jatropha curcas. Plant Cell Physiol. 56, 1655–1666 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Gao Y. L. et al., NtBRC1 suppresses axillary branching in tobacco after decapitation. Genet. Mol. Res., 10.4238/gmr15049320 (2016). [DOI] [PubMed] [Google Scholar]
- 51.Seale M., Bennett T., Leyser O., BRC1 expression regulates bud activation potential but is not necessary or sufficient for bud growth inhibition in Arabidopsis. Development 144, 1661–1673 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Coelho C. P., Minow M. A., Chalfun-Júnior A., Colasanti J., Putative sugarcane FT/TFL1 genes delay flowering time and alter reproductive architecture in Arabidopsis. Front Plant Sci 5, 221 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Kaneko-Suzuki M., et al. , TFL1-Like proteins in rice antagonize rice FT-like protein in inflorescence development by competition for complex formation with 14-3-3 and FD. Plant Cell Physiol. 59, 458–468 (2018). [DOI] [PubMed] [Google Scholar]
- 54.Moraes T. S., Dornelas M. C., Martinelli A. P., FT/TFL1: Calibrating plant architecture. Front Plant Sci 10, 97 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Gustafson-Brown C., Savidge B., Yanofsky M. F., Regulation of the Arabidopsis floral homeotic gene APETALA1. Cell 76, 131–143 (1994). [DOI] [PubMed] [Google Scholar]
- 56.Kaufmann K., et al. , Orchestration of floral initiation by APETALA1. Science 328, 85–89 (2010). [DOI] [PubMed] [Google Scholar]
- 57.Han Y., Zhang C., Yang H., Jiao Y., Cytokinin pathway mediates APETALA1 function in the establishment of determinate floral meristems in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 111, 6840–6845 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Burko Y., et al. , A role for APETALA1/fruitfull transcription factors in tomato leaf development. Plant Cell 25, 2070–2083 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Rinne P. L. H., Paul L. K., van der Schoot C., Decoupling photo- and thermoperiod by projected climate change perturbs bud development, dormancy establishment and vernalization in the model tree Populus. BMC Plant Biol. 18, 220 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Karimi M., Depicker A., Hilson P., Recombinational cloning with plant gateway vectors. Plant Physiol. 145, 1144–1154 (2007). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Xing H. L., et al. , A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 14, 327 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Tylewicz S., et al. , Dual role of tree florigen activation complex component FD in photoperiodic growth control and adaptive response pathways. Proc. Natl. Acad. Sci. U.S.A. 112, 3140–3145 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
This study did not generate any unique datasets or code. All of the associated protocols and materials used in the paper will be made available to readers upon adequate request.





